KR20220084561A - Food composition for anti-inflammatory comprising Arctoscopus japonicus eggs lipid extract as an active ingredient - Google Patents

Abstract

Dorumukal lipid extract of the present invention, when treated with macrophages, inhibits inflammatory mediators iNOS and COX-2, and also inhibits inflammatory cytokines IL-1, IL-6 and TNF-α, and inflammatory pathways By confirming that the phosphorylation of NF-κB p65, ERK, JNK and p38, which are related proteins, was inhibited, it was confirmed that the Dorumukal lipid extract of the present invention exhibits an effective anti-inflammatory effect and can be usefully used in related fields did

Description

Food composition for anti-inflammatory comprising Dorumukal lipid extract as an active ingredient {Food composition for anti-inflammatory comprising Arctoscopus japonicus eggs lipid extract as an active ingredient}

The present invention relates to an anti-inflammatory food composition comprising a Dorumukal lipid extract as an active ingredient.

Inflammation refers to a defensive reaction that occurs in the body when a living tissue is damaged. It is a classical concept of medicine and is defined as calor, dolor, rubor, and tumor in Latin meaning heat, pain, redness, and edema, respectively. The causes of such inflammation include mechanical injury, physical factors such as temperature and radiation, chemical factors such as poisons, and parasites such as bacterial infection.

LPS is a substance constituting the cell wall of Gram-negative bacteria that causes an inflammatory reaction in cells, is recognized by macrophages, and causes reactions such as local inflammation, antibody production, and sepsis. In particular, LPS-induced inflammatory responses include nitric oxide (NO), prostaglandin E2 (PGE2), interleukin 1β (IL-1β), tumor necrosis factor-α (TNF-α), matrix metalloprotease-9 (MMP-9), etc. is known to increase.

When nitric oxide (NO) is increased by iNOS (inducible nitric oxide synthesis) as an inflammatory response by LPS, the increase in prostaglandins (PGs) causes symptoms such as pain and fever. PGs are synthesized by COX-1, COX-2, etc., which leads to increased blood flow and symptoms such as edema. In addition, LPS-stimulated macrophage activates several pathways, and increases PGE2 by producing COX-2 through the NFB pathway or the mitogen-activated protein kinase (MAPK) pathway. Therefore, when NO or PGE2 is decreased, it can be seen that inflammation is relieved.

Dorumuk ( Arctoscopus japonicas ) is a cold-flowing fish found in the Pacific Northwest and the East Coast of Korea. is incomplete.

It is an object of the present invention to provide an anti-inflammatory food composition comprising a Dorumukal lipid extract as an active ingredient.

Another object of the present invention is to provide an anti-inflammatory pharmaceutical composition comprising a Dorumukal lipid extract as an active ingredient.

Another object of the present invention comprises the steps of freeze-drying Dorumukal; and

It is to provide a method for preparing an anti-inflammatory food composition comprising a dorumukal lipid extract as an active ingredient;

The present invention is to provide an anti-inflammatory food composition comprising a Dorumukal lipid extract as an active ingredient.

The present invention provides an anti-inflammatory pharmaceutical composition comprising a dorumukal lipid extract as an active ingredient.

The present invention comprises the steps of freeze-drying Dorumukal; and

It provides a method for preparing an anti-inflammatory food composition comprising a Dorumukal lipid extract as an active ingredient, comprising the step of extracting by adding chloroform and methanol to the freeze-dried Dorumukal.

Dorumukal lipid extract of the present invention inhibits inflammatory mediators iNOS and COX-2, also inhibits inflammatory cytokines IL-1, IL-6 and TNF-α, and NF-κB, a protein related to inflammatory pathways It was confirmed that the phosphorylation of p65, ERK, JNK and p38 was inhibited, and it was confirmed that the dorumukal lipid extract of the present invention exhibits an effective anti-inflammatory effect and can be usefully used in related fields.

1 is a result of confirming the composition of the Dorumukal lipid extract of the present invention by gas chromatography.
2 is a diagram confirming whether the Dorumukal lipid extract of the present invention exhibits cytotoxicity to the RAW264.7 cell line.
3 is a view confirming the inhibition of nitric oxide production according to the treatment concentration of the Dorumukal lipid extract of the present invention.
4 is a view confirming the inhibition of the activity of inflammation-related factors according to the treatment of the Dorumukal lipid extract of the present invention.
Figure 5 is a diagram confirming the degree of phosphorylation of proteins related to the inflammatory pathway according to the treatment of the Dorumukal lipid extract of the present invention by Western blot (A: Western blot results of inflammatory pathway proteins, B: Schematic of phosphorylation level).

The present invention is to provide an anti-inflammatory food composition comprising a Dorumukal lipid extract as an active ingredient.

In addition to containing the active ingredient of the present invention, the food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like a conventional food composition.

Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. The above-mentioned flavoring agents can advantageously use natural flavoring agents (Taumatine), stevia extract (eg rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.). The food composition of the present invention may be formulated in the same manner as the pharmaceutical composition and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gums, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements. There is this.

In addition, the food composition includes, in addition to the active ingredient extract, various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. In addition, the food composition of the present invention may contain natural fruit juice and pulp for the production of fruit juice beverages and vegetable beverages.

The functional food composition of the present invention may be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. for anti-inflammatory purposes. In the present invention, the term 'health functional food composition' refers to food manufactured and processed using raw materials or ingredients useful for the human body according to Act No. 6727 of the Health Functional Food Act, and It refers to ingestion for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological effects. The health functional food of the present invention may contain normal food additives, and unless otherwise specified, whether it is suitable as a food additive is related to the item according to the general rules and general test method of food additives approved by the Food and Drug Administration. It is judged according to the standards and standards. The items listed in the 'Food Additives Code' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, high pigment, and guar gum; Mixed preparations, such as a sodium L-glutamate preparation, a noodle-added alkali agent, a preservative preparation, and a tar color preparation, etc. are mentioned. For example, a health functional food in tablet form is granulated by a conventional method by mixing a mixture of the active ingredient of the present invention with an excipient, binder, disintegrant and other additives, followed by compression molding by putting a lubricant, etc., or The mixture may be compression molded directly. In addition, the health functional food in the form of tablets may contain a corrosive agent and the like, if necessary. Among health functional foods in the form of capsules, hard capsules can be prepared by filling a mixture of the active ingredient of the present invention with additives such as excipients in ordinary hard capsules. It can be prepared by filling the mixture mixed with the capsule base such as gelatin. The soft capsules may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary. A health functional food in the form of a ring can be prepared by molding a mixture of the active ingredient of the present invention and an excipient, a binder, a disintegrant, etc. by a conventionally known method, Alternatively, the surface may be coated with a material such as starch or talc. The health functional food in the form of granules can be prepared in granular form by a conventionally known method by mixing a mixture of excipients, binders, disintegrants, etc. of the active ingredient of the present invention, and may contain flavoring agents, flavoring agents, etc. as necessary can

According to one embodiment of the present invention, the Dorumukal lipid extract may be extracted using a solvent selected from the group consisting of distilled water, C1 to C4 lower alcohol, aqueous solution of lower alcohol, hexane, chloroform and acetic acid.

According to an embodiment of the present invention, the dorumukal lipid extract contains palmitic acid (C16:0), oleic acid (C18:0), eicosapentaenoic acid (DHA, C20: 5n-3) and docosahexaenoic acid (docosahexaenoic acid, DHA, C22:6n-3) may be a lipid extract composed of one or more fatty acids selected from the group consisting of.

According to an embodiment of the present invention, the Dorumukal lipid extract may inhibit the production of nitric oxide.

According to an embodiment of the present invention, the Dorumukal lipid extract may inhibit the expression of a factor selected from the group consisting of inflammatory mediators iNOS and COX-2.

According to one embodiment of the present invention, the dorumukal lipid extract may inhibit the pro-inflammatory cytokines IL-1, IL-6, and a cytokine selected from the group consisting of TNF-α.

The present invention provides an anti-inflammatory pharmaceutical composition comprising a dorumukal lipid extract as an active ingredient.

The pharmaceutical composition of the present invention may further include an adjuvant in addition to the active ingredient. The adjuvant may be used without limitation as long as it is known in the art, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase the effect.

The pharmaceutical composition according to the present invention may be prepared in a form in which the active ingredient is incorporated into a pharmaceutically acceptable carrier. Here, the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers that can be used in the pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention may be formulated in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions according to conventional methods, respectively. .

In the case of formulation, it can be prepared using a diluent or excipient such as a filler, extender, binder, wetting agent, disintegrant, surfactant, etc. commonly used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the active ingredient, for example, starch, calcium carbonate, sucrose, lactose, gelatin. It can be prepared by mixing and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. can Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As the base of the suppository, witepsol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.

The pharmaceutical composition according to the present invention may be administered to an individual by various routes. Any mode of administration can be envisaged, for example, by oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.

The dosage of the pharmaceutical composition according to the present invention is selected in consideration of the individual's age, weight, sex, physical condition, and the like. It is self-evident that the concentration of the tetrapeptide contained in the pharmaceutical composition can be variously selected depending on the subject, and is preferably contained in the pharmaceutical composition at a concentration of 0.01 to 5,000 μg/ml. If the concentration is less than 0.01 μg/ml, pharmaceutical activity may not appear, and if it exceeds 5,000 μg/ml, it may be toxic to the human body.

The present invention comprises the steps of freeze-drying Dorumukal; and

It provides a method for preparing an anti-inflammatory composition comprising a Dorumukal lipid extract as an active ingredient, comprising: extracting by adding chloroform and methanol to the freeze-dried Dorumukal.

Hereinafter, the present invention will be described in more detail by way of Examples. These examples are merely for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited to these examples.

<Example 1> Preparation of Dorumukal lipid extract

<Example 1-1> Dorumukal lipid extraction

The Dorumuk ( Arctoscopus japonicus ) eggs used in the present invention were separated from the Dorumuk eggs collected near the East Sea of Gangwon-do, and the separated Dorumuk eggs were freeze-dried and pulverized to extract lipids by the modified method of Bligh and Dyer. Specifically, the dorumukal lipid extract was extracted using chloroform and methanol, and the inert gas was evaporated to prepare it. In the Dorumuk lipid extract, all volatile components were evaporated, dissolved in dimethyl sulfoxide (DMSO), weighed, and stored at -20°C.

<Example 1-2> Fatty acid analysis

For the analysis of fatty acids, according to the method of Garces and Mancha, Dorumukal lipid extract was analyzed. Specifically, in order to analyze the Dorumukal lipid extract, fatty acid methyl ester (FAME) was prepared by a one-step lipid extraction method. The prepared FAME was analyzed for fatty acid content using GC-flame distillation detection (FID) gas chromatography.

As a result, as shown in Figure 1, the lipid extract of Dorumukal is first composed of saturated fatty acids (SFA), monounsaturated fatty acids (MUFA) and polyhydric unsaturated fatty acids (PUFA). and 23.4%, 23.7%, and 52.9%, respectively. As a composition of fatty acids, 19.4% palmitic acid (C16:0), 2.6% oleic acid (C18:0), 21.2% eicosapentaenoic acid (DHA, C20:5n) -3) and 25.9% of docosahexaenoic acid (DHA, C22:6n-3) was confirmed as a lipid extract.

<Example 2> Macrophage cell line culture and cell viability confirmation

RAW264.7 cells, a mouse macrophage cell line, were purchased from Korea Cell Line Bank (Seoul) and used. The RAW264.7 cell line was cultured in a 96-well plate containing RPMI medium containing 10% fetal bovine serum and 1% penicillin/streptomycin for 24 hours at 37°C under the condition of 5% CO2. The cultured RAW264.7 cells were further cultured for 24 hours by adding different concentrations of Dorumukal lipid extract (0, 0.5, 1.0, or 2.0%), and then removing the residual medium after culturing, EZ-Cytox Cell viability was analyzed using the Cell Viabiliy Kit. The cell viability ratio was calculated using Equation 1 below.

[Equation 1]

As a result, as shown in FIG. 2 , it was confirmed that the Dorumukal lipid extract did not exhibit cytotoxicity even when the treatment concentration was increased.

<Example 3> Confirmation of nitric oxide production

For measurement of nitric oxide production, RAW264.7 cells were incubated for 1 hour under the conditions described in Example 2 and at the concentration of Dorumuk egg lipid extract, and then the cells were stimulated with 1 g/ml LPS for 24 hours. Then, using the Griess reagent, NO production was determined based on nitrite accumulation in the culture medium.

As a result, as shown in FIG. 3, when the dorumukal lipid extract was treated with RAW264.7 cells, it was confirmed that the production of NO was decreased in a concentration-dependent manner.

<Example 4> RNA extraction and quantitative Real-Time PCR (RT PCR)

Total RNA was extracted by treating the cells with Tri reagentⓡ, and the extracted RNA was washed with 75% ethanol and precipitated using 100% isopropanol. RNA concentration was analyzed using a nanophotometer (nanophotometer, Implen, Germany). The cDNA of the first strand was synthesized using a high capacity cDNA reverse transcription kit according to the manufacturer's guide. Quantitative RT PCR was performed using SYBRⓡ premix Ex taq ^TM II and QuantStudio 3 Flex real time PCR system (Applied Biosystems, Foster city, USA) to confirm the expression of immune-related genes in the RAW264.7 cell line using the synthesized cDNA. carried out. The β-actin gene was used as a control, and the results were quantified by the 2- ^ΔΔ _T method. The primer sets used for quantitative RT PCR are shown in Table 1 below.

Gene Accession No. Oligonucleotide Sequence (5’-3’) IL-1β NM_008361.4 F: GGGCCTCAAAGGAAAGAATC R: TACCAGTTGGGGAACTCTGC iNOS BC062378.1 F: TTCCAGAATCCCTGGACAAG R: TGGTCAAACTCTTGGGGTTC IL-6 NM_031168.2 F: AGTTGCCTTCTTGGGACTGA R: CAGAATTGCCATTGCACAAC COX-2 NM_011198.4 F: AGAAGGAAATGGCTGCAGAA R: GCTCGGCTTCCAGTATTGAG TNF-α D84199.2 F: ATGAGCACAGAAAGCATGATC R: TACAGGCTTGTCACTCGAATT β-actin NM_007393.5 F: CCACAGCTGAGAGGGAAATC R: AAGGAAGGCTGGAAAAGAGC

As a result, as shown in FIG. 4, when the LPS-stimulated RAW264.7 cells were treated with the dorumukal lipid extract, the expression of most inflammation-related factors was reduced, and in particular, the inflammatory mediators iNOS and COX-2 The expression was significantly reduced, and it was confirmed that the expression of pro-inflammatory cytokines IL-1, IL-6 and TNF-α also decreased in a concentration-dependent manner.

<Example 5> Western blot

Total protein was extracted from RAW264.7 cells using RIPA buffer and quantified with Pierce BCA protein Assat Kit. The quantified total protein was electrophoresed (SDS-polyacrylamide gel electrophoresis, SDS-PAGE), and the electrophoresed protein was transferred to a polyvinylidene fluoride (PVDF) membrane, and Narayanan's Western blot method was performed. To investigate the NF-κB and MAPK signaling pathways, specific antibodies binding to phosphorylated p-NF-κB p65, p-p38, p-ERK1/2 and p-JNK were used, and α-Tubulin was used as a control. and a goat anti-rabbit IgG antibody was used for detection. The antigen signal specifically bound to the protein was recognized by Pierceⓡ ECL Plus Western Blotting Substrate, and quantitatively analyzed using ChemiDoc XRS+ imaging system (Bio-Rad) and ImageLab software.

As a result, as shown in FIG. 5, the dorumukal lipid extract reduced the phosphorylation level of the NF-κB p65 subunit in a concentration-dependent manner compared to the control group, and the phosphorylation level of ERK, JNK and p38, biomarkers of the MAPK pathway, was also shown. It was confirmed that it decreased.

Therefore, the dorumukal lipid extract of the present invention, when treated with the mouse macrophage RAW264.7 cell line, inhibits inflammatory mediators iNOS and COX-2, and inflammatory cytokines IL-1, IL-6 and TNF -α also inhibited, and it was confirmed that the phosphorylation of NF-κB p65, ERK, JNK and p38, which are proteins related to the inflammatory pathway, was inhibited, and it was confirmed that the Dorumukal lipid extract of the present invention has an effective anti-inflammatory effect.

Claims (9)

Dorumuk ( Arctoscopus japonicus ) Anti-inflammatory food composition comprising an egg lipid extract as an active ingredient. The method of claim 1,
The Dorumukal lipid extract is a composition characterized in that it is extracted using a solvent selected from the group consisting of distilled water, C1 to C4 lower alcohol, aqueous solution of lower alcohol, hexane, chloroform and acetic acid. The method of claim 1,
The dorumukal lipid extract, palmitic acid (C16:0), oleic acid (C18:0), eicosapentaenoic acid (DHA, C20:5n-3) and docosahexaene A composition characterized in that it is a lipid extract composed of at least one fatty acid selected from the group consisting of acids (docosahexaenoic acid, DHA, C22:6n-3). The method of claim 1,
The Dorumukal lipid extract is a composition, characterized in that it inhibits the production of nitric oxide. The method of claim 1,
The dorumukal lipid extract composition, characterized in that it inhibits the expression of a factor selected from the group consisting of inflammatory mediators iNOS and COX-2. The method of claim 1,
The Dorumukal lipid extract is a composition characterized in that it inhibits cytokines selected from the group consisting of pro-inflammatory cytokines IL-1, IL-6 and TNF-α. The method of claim 1,
The dorumukal lipid extract is a composition characterized in that it reduces phosphorylation of a protein selected from the group consisting of NF-κB p65, ERK, JNK and p38 of inflammatory pathways. An anti-inflammatory pharmaceutical composition comprising a Dorumukal lipid extract as an active ingredient. Freeze-drying Dorumukal; and
A method for preparing an anti-inflammatory food composition comprising a lipid extract of Dorumukal, comprising the step of extracting by adding chloroform and methanol to the freeze-dried Dorumukal.

Images