KR20220078769A - Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof - Google Patents

Abstract

Disclosed are microorganisms and new strains that are not known as microorganisms exhibiting phenanthrene decomposition activity to date, and new strains, compositions for decomposing phenanthrene using the same, and a method for decomposing phenanthrene using the same. The present invention relates to a phenanthrene decomposition activity, Phialemonium inflatum and a new strain Phialemonium inflatum 20F-2035 strain, and a composition for decomposing phenanthrene using the same and a method for decomposing phenanthrene using the same.

Description

Phialemonium implatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof isolated from freshwater and uses thereof

The present invention relates to a microorganism having phenanthrene decomposition activity, and more particularly, to a microorganism having a decomposition activity for phenanthrene present in a lot of soil contaminated by oil.

A polyaromatic hydrocarbon (PAH, Poly Aromatic Hydrocarbon) is a substance in which two or more benzene rings are connected to each other. Rarely used alone, it is used as a precursor for the production of a variety of substances in the petrochemical industry, and is also found in fumes from unrefined petroleum or fuels that have not been completely combusted. Most polyaromatic hydrocarbons exhibit carcinogenicity and ecotoxicity, which tends to increase as the number of benzene rings connected increases. Phenanthrene has three benzene rings, and although it is less toxic than benzopyrene or pyrene, it is found in a large amount in industrial sites or in contaminated soil, so it is used as a representative material in the decomposition study of PAH.

Most of the environmental pollution caused by PAHs is the soil contaminated by oil spill accidents or the surrounding soil and water pollution that occurs during the process of petrochemical-related industrial complexes. However, due to the stability of the PAH itself, it is removed very slowly. Therefore, PAHs that have not been decomposed remain in the soil and are absorbed and accumulated by surrounding organisms and people, causing various harm.

There are two main methods for restoring soil contaminated by PAH: physicochemical methods and biological methods. Physical and chemical methods include methods of dissolving PAHs accumulated in the soil through a solvent or vaporizing them by blowing air. Most of the biological treatment methods are preferred due to problems such as contamination, and for this purpose, research to find microorganisms with high PAH decomposition activity is continuously being conducted.

Most of the microorganisms used in the treatment process of biological pollutants are bacteria, which have a long history of process development and utilization research, but are relatively easy to handle and have high decomposition efficiency of biodegradable pollutants. Therefore, until now, PAH degradation studies using microorganisms have been mainly focused on bacteria such as Pseudomonas , Aeromonas , and Flavobacterium . is gradually increasing. In the case of bacteria, the growth rate or the decomposition rate of organic substances is high, but when a non-degradable pollutant such as PAH is treated, the efficiency drops sharply. also receive

In the case of fungi to which molds or mushrooms belong, the rate of decomposition of general organic substances is slower than that of bacteria, but due to the characteristic of feeding on organic substances with a complex structure, it has a high potential as a resource capable of processing difficult-to-decompose pollutants. In fact, fungi that decompose difficult-to-decompose contaminants such as polyvinyl alcohol (PVA) and microplastics have been reported steadily since the late 1990s, and research on enzymes involved in decomposition is being actively conducted.

White rot fungi, such as Phanerochaete chrysosporium , are well known fungi capable of decomposing PAH. Excavation is required, and furthermore, fungi having phenanthrene decomposition activity other than white rot, have not been suggested.

Accordingly, the present invention intends to present a microorganism and a new strain that can be used for a new purpose not known as a microorganism exhibiting phenanthrene decomposition activity until now, a composition for decomposing phenanthrene using the same, and a method for decomposing phenanthrene using the same.

In order to solve the above problems, the present invention provides a phenanthrene decomposing activity, Phialemonium implatum ( Phialemonium inflatum ).

In addition, it provides a novel microorganism Phialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession Number: KCTC14329BP) strain.

In addition, the strain provides a phenanthrene (phenanthrene) decomposing activity Pialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession No.: KCTC14329BP) strain characterized in that it has.

In addition, the strain provides a Pialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession No.: KCTC14329BP) strain, characterized in that it is isolated from fresh water.

In order to solve the another problem, the present invention provides a composition for decomposing phenanthrene containing the strain or a culture material thereof as an active ingredient.

In order to solve the another problem, the present invention provides a method for decomposing phenanthrene by treating the composition in a medium containing phenanthrene.

According to the present invention, in addition to previously known microorganisms, microorganisms that can be used for new uses having phenanthrene degrading activity Phialemonium implatum ( Phialemonium inflatum ) and a new strain Phialemonium implatum ( Phialemonium inflatum ) 20F-2035 strains may be provided.

The microorganisms and new strains according to the present invention have excellent phenanthrene decomposition performance and are very suitable for biological restoration of contaminated soil, and thus have a very high value as a biological resource that can be used in related industries.

1 is a photograph showing the results of confirming that the 20F-2035 strain according to the present invention is a pure culture strain by subculture on a PDA plate medium;
2 is a view showing the ITS nucleotide sequence of the 20F-2035 strain according to the present invention;
3 is a view showing the results of analyzing the phylogenetic tree for molecular biological identification of the 20F-2035 strain according to the present invention based on the ITS nucleotide sequence;
4 is a photograph showing the decomposition of phenanthrene by culturing the 20F-2035 strain according to the present invention for 15 days on an agar medium smeared with phenanthrene;
5 is a graph showing the measurement results of the phenanthrene degradation activity of the 20F-2035 strain according to the present invention.

Hereinafter, the present invention will be described in detail through examples. Prior to this, the terms or words used in the present specification and claims should not be construed as being limited to their ordinary or dictionary meanings, and the inventor should properly understand the concept of the term in order to best describe his invention. Based on the principle that can be defined, it should be interpreted as meaning and concept consistent with the technical idea of the present invention. Accordingly, since the configuration of the embodiments described in the present specification is only the most preferred embodiment of the present invention and does not represent all the technical spirit of the present invention, various equivalents and modifications that can be substituted for them at the time of the present application It should be understood that there may be

To find freshwater fungi having phenanthrene decomposition activity, the present inventors obtained samples from various freshwater nationwide, and among them, 20F-2035 strain isolated from freshwater sediments in Hampyeongcheon, Hampyeong-si, Jeollanam-do, was obtained. As a result of ITS sequencing to carry out the identification, it was identified as Pialemonium implatum ( Phialemonium inflatum ). The strain was cultured in a phenanthrene-plated medium and the phenanthrene degradation rate was measured to confirm that it had phenanthrene degradation activity, leading to the present invention.

Therefore, the present invention is a phenanthrene (phenanthrene) decomposing activity Pialemonium implatum ( Phialemonium inflatum ), and a novel microorganism Phialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession No.: KCTC14329BP) strain to start

As a new use of a specific microorganism, the present invention is to present for the first time Pialemonium implatum ( Phialemonium inflatum ) having phenanthrene decomposition activity, and therefore, as a Pialemonium implatum ( Phialemonium inflatum ) strain A strain used for decomposing phenanthrene, a composition for decomposing phenanthrene using the same, or a method for decomposing phenanthrene using the same should all be regarded as belonging to the technical concept intended by the present invention.

The strain according to the present invention was confirmed to have excellent phenanthrene decomposition activity.

According to an application example of the present invention, there is provided a composition for decomposing phenanthrene containing the strain or a metabolite thereof as an active ingredient.

In the present invention, the strain or its metabolites may be used in the state of the cells of the strain, the culture solution of the strain, the culture filtrate of the strain, and the like. Here, the cells of the strain are meant to include all of the cells themselves, the culture medium means a culture solution containing the cells, and the culture filtrate means a culture solution containing no cells.

According to another application example of the present invention, the method of decomposing phenanthrene may be performed by treating an effective amount of the strain or a metabolite thereof in a solution containing phenanthrene.

Hereinafter, the present invention will be described in detail by way of examples.

Example 1: Isolation of strain 20F-2035 of freshwater fungus having phenanthrene degrading activity

In the present invention, in order to select freshwater fungi having phenanthrene degrading activity, as shown in the strain collection information in Table 1 below, freshwater sediments were collected from Hampyeongcheon Stream in Singwang-myeon, Hampyeong-gun, Jeollanam-do in 2020. To isolate freshwater fungi from the collected freshwater sediment, dilute 1 g of the sediment in 10 ml of sterile water, dilute it up to 100 times, and take 100 µl of 1.5% water agar (streptomycin, ampicilin) added to it ( water agar) and cultured at 25°C in dark conditions. After 3 days of culturing, the mycelium that grew up was separated from the water agar medium, inoculated in a 24-well plate V8 medium, and cultured.

collection area Year of collection water system separatist Singwang-myeon, Hampyeong-gun, Jeollanam-do 2020 Yeongsan River (Hampyeongcheon) freshwater sediment

Example 2: Identification of 20F-2035 strain of freshwater fungus having phenanthrene degrading activity

1 is a photograph showing the result of confirming that the strain 20F-2035 according to the present invention is a pure culture strain by subculture on a PDA plate medium. In order to perform molecular biological identification of freshwater fungi isolated from pure water as shown in FIG. 1, an ITS (Internal Transcribed Spacer) nucleotide sequence was analyzed, and the results are shown in FIG. 2 (SEQ ID NO: 1). The primers used are shown in Table 2 below.

primer
name Forward (5'-3')
primer sequence primer
name Reverse (5'-3')
primer sequence ITS5 GGAAGTAAAAGTCGTAACAAGG ITS4 TCCTCCGCTTATTGATATGC

As a result of BLAST of NCBI for the ITS sequence, strain 20F-2035 was identified as Phialemonium inflatum . In addition, 100% similarity to Phialemonium inflatum isolate BK239 was shown in the phylogenetic analysis using the ITS sequence of the related species as shown in FIG. Finally, the strain was named as Phialemonium inflatum 20F-2035 strain, and it was entrusted to the Korean Collection for Type Cultures (KCTC) on October 12, 2020, It was given accession number KCTC14329BP.

Example 3: Pialemonium implatum ( Phialemonium inflatum ) Confirmation of phenanthrene degradation activity of strain 20F-2035

In order to confirm the phenanthrene decomposition activity of the Phialemonium inflatum 20F-2035 strain isolated and identified in Examples 1 and 2 above, a solution of phenanthrene in methanol at a concentration of 10 mg/ml was spread on PDA medium, and methanol was evaporated and treated so that only phenanthrene remained on the medium to prepare a phenanthrene medium. After inoculating the Phialemonium inflatum 20F-2035 strain in the prepared phenanthrene medium, cancer culture at 25 ° C. for 15 days. , the results are shown in FIG. 4 .

Referring to Figure 4, the region where phenanthrene disappears is clearly confirmed in a wider region than the growth range of the 20F-2035 strain, and from this, it is proved that the 20F-2035 strain according to the present invention has excellent phenanthrene decomposition activity. do.

Example 4: Pialemonium implatum ( Phialemonium inflatum ) Measurement of phenanthrene degradation activity of strain 20F-2035

In order to measure the phenanthrene degradation activity of the Pialemonium inflatum 20F-2035 strain isolated and identified in Examples 1 and 2, an experiment was performed as follows. Since the amount of phenanthrene dissolved in the medium is very small, an indirect measurement method was used, and after inoculating the Phialemonium inflatum 20F-2035 strain in the center of the phenanthrene medium used in Example 3 The decomposition activity was measured by calculating the area of the phenanthrene decomposition region according to time. As a control, a phenanthrene medium that was not inoculated with the strain was treated under the same conditions, and the phenanthrene degradation experiment was repeated 5 times to calculate the average and standard deviation to calculate the degradation activity, and the results are shown in FIG. 5 .

Referring to FIG. 5 , it can be confirmed that up to 71% of phenanthrene on the medium was degraded by the Phialemonium inflatum 20F-2035 strain according to the present invention for 15 days.

Preferred embodiments of the present invention described above are disclosed to solve the technical problem, and various modifications, changes, additions, etc. will be possible within the spirit and scope of the present invention by those of ordinary skill in the art to which the present invention pertains. , such modifications and changes should be regarded as belonging to the following claims.

Korea Institute of Bioscience and Biotechnology KCTC14329BP 20201012

<110> Nakdonggang National Institute of Biological Resources <120> Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof <130> NP20-11153 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 555 <212> DNA <213> Unknown <220> <223> Phialemonium inflatum 20F-2035 <400> 1 aacaaggtct ccgttggtga accagcggag ggatcattac agagtttaac gactcccaaa 60 ccactgtgaa catacccgta ccgttgcctc ggcgggcggc cccagggcgg ggccgcagcc 120 tccccagcgg aggcgcccgc cgcaggtcgc aaaactataa ctatatttag tggcatctct 180 gagtaacttc caaacaatca aaactttcaa caacggatct cttggttctg gcatcgatga 240 agaacgcagc gaaatgcgat aagtaatgtg aattgcagaa ttcagtgaat catcgaatct 300 ttgaacgcac attgcgcccg ccagcattct ggcgggcatg cctgtccgag cgtcatttca 360 accctcaagc cctgcttggt gttggggcac tacgcgcgag cgtaggccct caaaatcagt 420 ggcggacccg ctggaggtcc gggcgtagta acacatctcg cccgaggtcc ccagcgtgcc 480 cctgccgtta aacccccaaa tttacagaag gttgacctcg gatcaggtag gaatacccgc 540 tgaacttaag catat 555

Claims (6)

Phialemonium implatum having a phenanthrene decomposition activity ( Phialemonium inflatum ). Novel microorganism Phialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession Number: KCTC14329BP) strain. 3. The method of claim 2,
The strain is phenanthrene (phenanthrene), characterized in that it has a decomposing activity Pialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession No.: KCTC14329BP) strain. 3. The method of claim 2,
The strain is Pialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession No.: KCTC14329BP) strain, characterized in that it is isolated from fresh water. A composition for decomposing phenanthrene comprising the strain of any one of claims 2 to 4 or a culture material thereof as an active ingredient. A method of decomposing phenanthrene by treating the composition of claim 5 in a medium containing phenanthrene.

Images