KR20220078769A - Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof - Google Patents

Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof Download PDF

Info

Publication number
KR20220078769A
KR20220078769A KR1020200167448A KR20200167448A KR20220078769A KR 20220078769 A KR20220078769 A KR 20220078769A KR 1020200167448 A KR1020200167448 A KR 1020200167448A KR 20200167448 A KR20200167448 A KR 20200167448A KR 20220078769 A KR20220078769 A KR 20220078769A
Authority
KR
South Korea
Prior art keywords
phenanthrene
strain
phialemonium
inflatum
present
Prior art date
Application number
KR1020200167448A
Other languages
Korean (ko)
Other versions
KR102455290B1 (en
Inventor
박상규
한상수
고재덕
문혜연
천원수
서민정
전유정
황혜진
박영환
Original Assignee
국립낙동강생물자원관
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 국립낙동강생물자원관 filed Critical 국립낙동강생물자원관
Priority to KR1020200167448A priority Critical patent/KR102455290B1/en
Publication of KR20220078769A publication Critical patent/KR20220078769A/en
Application granted granted Critical
Publication of KR102455290B1 publication Critical patent/KR102455290B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B09DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
    • B09CRECLAMATION OF CONTAMINATED SOIL
    • B09C1/00Reclamation of contaminated soil
    • B09C1/10Reclamation of contaminated soil microbiologically, biologically or by using enzymes
    • B09C1/105Reclamation of contaminated soil microbiologically, biologically or by using enzymes using fungi or plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/645Fungi ; Processes using fungi

Abstract

현재까지 페난트렌 분해 활성을 나타내는 미생물로 알려지지 않은 새로운 용도로 활용 가능한 미생물과 신균주, 이를 이용한 페난트렌 분해용 조성물 및 이를 이용한 페난트렌 분해 방법이 개시된다. 본 발명은 페난트렌(phenanthrene) 분해 활성을 가지는 피알레모니움 임플라툼(Phialemonium inflatum) 및 신균주 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035 균주, 그리고 이를 이용한 페난트렌 분해용 조성물 및 이를 이용한 페난트렌 분해 방법을 제공한다.Disclosed are microorganisms and new strains that are not known as microorganisms exhibiting phenanthrene decomposition activity to date, and new strains, compositions for decomposing phenanthrene using the same, and a method for decomposing phenanthrene using the same. The present invention relates to a phenanthrene decomposition activity, Phialemonium inflatum and a new strain Phialemonium inflatum 20F-2035 strain, and a composition for decomposing phenanthrene using the same and a method for decomposing phenanthrene using the same.

Description

담수에서 분리한 페난트렌 분해 활성을 가지는 피알레모니움 임플라툼 20F-2035 균주 및 이의 용도{Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof}Phialemonium implatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof isolated from freshwater and uses thereof

본 발명은 페난트렌 분해 활성을 가지는 미생물에 관한 것으로, 보다 상세하게는 유류에 의해 오염된 토양에 많이 존재하는 페난트렌에 대한 분해 활성을 가지는 미생물에 관한 것이다.The present invention relates to a microorganism having phenanthrene decomposition activity, and more particularly, to a microorganism having a decomposition activity for phenanthrene present in a lot of soil contaminated by oil.

다환방향족 탄화수소(PAH, Poly Aromatic Hydrocarbon)는 2개 이상의 벤젠고리가 서로 연결되어 있는 물질이다. 단독으로 사용되는 일은 드물지만 석유화학산업에서 다양한 물질을 생산하는 데 필요한 전구체로 쓰이고 있으며, 정제되지 않은 석유나 완전히 연소되지 않은 연료에 의해 발생하는 연기에서도 발견된다. 대부분의 다환방향족 탄화수소는 발암성과 생태독성을 나타내며, 이는 연결되어 있는 벤젠고리의 수가 많을수록 증가하는 경향을 보인다. 페난트렌은 3개의 벤젠고리를 갖고 있으며, 벤조피렌이나 파이렌에 비해 독성은 낮으나 산업현장이나 오염된 토양에서 발견되는 양이 많아 PAH의 분해 연구에 대표물질로 사용되고 있다.A polyaromatic hydrocarbon (PAH, Poly Aromatic Hydrocarbon) is a substance in which two or more benzene rings are connected to each other. Rarely used alone, it is used as a precursor for the production of a variety of substances in the petrochemical industry, and is also found in fumes from unrefined petroleum or fuels that have not been completely combusted. Most polyaromatic hydrocarbons exhibit carcinogenicity and ecotoxicity, which tends to increase as the number of benzene rings connected increases. Phenanthrene has three benzene rings, and although it is less toxic than benzopyrene or pyrene, it is found in a large amount in industrial sites or in contaminated soil, so it is used as a representative material in the decomposition study of PAH.

PAH에 의한 환경오염은 주로 기름유출사고에 의해 오염된 토양이나 석유화학과 관련된 공업단지의 공정중 발생하는 주변 토양 및 수계오염이 대부분을 차지하고 있으며, 이렇게 유출된 PAH들은 광분해, 화학적 산화 및 생분해를 통해 제거되지만, PAH 자체의 안정성으로 인해 제거되는 속도는 매우 늦다. 따라서 미처 분해되지 못한 PAH들은 토양에 잔류하게 되고, 주변 생물체 및 사람에 흡수, 축적되어 다양한 해를 끼치게 된다.Most of the environmental pollution caused by PAHs is the soil contaminated by oil spill accidents or the surrounding soil and water pollution that occurs during the process of petrochemical-related industrial complexes. However, due to the stability of the PAH itself, it is removed very slowly. Therefore, PAHs that have not been decomposed remain in the soil and are absorbed and accumulated by surrounding organisms and people, causing various harm.

PAH에 의해 오염된 토양을 복원하는 방법은 크게 물리화학적 방법과 생물학적 방법이 있는데, 물리화학적 방법에는 토양에 축적된 PAH들을 용매를 통해 녹여내거나 공기를 불어넣어 기화시키는 방법들이 있지만, 비용이나 2차오염과 같은 문제로 인해 대부분 생물학적 처리방법이 선호되고 있으며, 이를 위해 PAH 분해활성이 높은 미생물을 찾기 위한 연구가 지속적으로 이루어지고 있다.There are two main methods for restoring soil contaminated by PAH: physicochemical methods and biological methods. Physical and chemical methods include methods of dissolving PAHs accumulated in the soil through a solvent or vaporizing them by blowing air. Most of the biological treatment methods are preferred due to problems such as contamination, and for this purpose, research to find microorganisms with high PAH decomposition activity is continuously being conducted.

대부분의 생물학적 오염물질 처리공정에 활용되는 미생물은 세균류로서 공정개발 및 활용연구의 역사가 길면서도 비교적 다루기 쉽고 생분해성 오염물질의 분해 효율이 높다는 특징을 갖고 있다. 따라서 지금까지 미생물을 활용한 PAH 분해 연구는 주로 슈도모나스(Pseudomonas), 에어로모나스(Aeromonas), 플라보박테리움(Flavobacterium) 등 세균류에 치우쳐져 있었으나, 최근 백색부후균을 비롯한 진균류에 의한 PAH 분해 연구가 점차 증가하고 있다. 세균류의 경우 생장속도나 유기물질의 분해속도는 높으나, PAH와 같은 난분해성 오염물질이 처리대상일 경우 효율이 급격하게 떨어지며 오염물질의 종류에 따라서는 오히려 공정의 안정성에 문제를 일으킬 정도의 타격을 받기도 한다.Most of the microorganisms used in the treatment process of biological pollutants are bacteria, which have a long history of process development and utilization research, but are relatively easy to handle and have high decomposition efficiency of biodegradable pollutants. Therefore, until now, PAH degradation studies using microorganisms have been mainly focused on bacteria such as Pseudomonas , Aeromonas , and Flavobacterium . is gradually increasing. In the case of bacteria, the growth rate or the decomposition rate of organic substances is high, but when a non-degradable pollutant such as PAH is treated, the efficiency drops sharply. also receive

곰팡이 또는 버섯이 속하는 진균류의 경우 일반적인 유기물질을 분해하는 속도는 세균류에 비해 느리지만 복잡한 구조를 갖는 유기물질을 먹이로 하는 특성으로 인해 난분해성 오염물질을 처리할 수 있는 자원으로서의 가능성이 높다. 실제로 PVA(polyvinyl alcohol), 미세플라스틱 등의 난분해성 오염물질을 분해하는 진균류가 1990년대 후반부터 지금까지 꾸준하게 보고되고 있으며, 분해에 관여하는 효소에 대한 연구도 활발하게 진행되고 있다.In the case of fungi to which molds or mushrooms belong, the rate of decomposition of general organic substances is slower than that of bacteria, but due to the characteristic of feeding on organic substances with a complex structure, it has a high potential as a resource capable of processing difficult-to-decompose pollutants. In fact, fungi that decompose difficult-to-decompose contaminants such as polyvinyl alcohol (PVA) and microplastics have been reported steadily since the late 1990s, and research on enzymes involved in decomposition is being actively conducted.

PAH를 분해할 수 있는 진균류는 파네로케이트 크리소스포리움(Phanerochaete chrysosporium)과 같은 백색부후균(white rot fungi)이 잘 알려져 있으나, 백색부후균이라도 PAH 분해활성을 가지는 균주는 매우 적게 알려져 있어 추가적인 발굴이 필요하며, 나아가, 백색부후균 이외에 페난트렌 분해 활성을 가지는 균류는 제시되지 않고 있다.White rot fungi, such as Phanerochaete chrysosporium , are well known fungi capable of decomposing PAH. Excavation is required, and furthermore, fungi having phenanthrene decomposition activity other than white rot, have not been suggested.

이에, 본 발명은 현재까지 페난트렌 분해 활성을 나타내는 미생물로 알려지지 않은 새로운 용도로 활용 가능한 미생물과 신균주, 이를 이용한 페난트렌 분해용 조성물 및 이를 이용한 페난트렌 분해 방법을 제시하고자 한다.Accordingly, the present invention intends to present a microorganism and a new strain that can be used for a new purpose not known as a microorganism exhibiting phenanthrene decomposition activity until now, a composition for decomposing phenanthrene using the same, and a method for decomposing phenanthrene using the same.

상기 과제를 해결하기 위하여 본 발명은, 페난트렌(phenanthrene) 분해 활성을 가지는 피알레모니움 임플라툼(Phialemonium inflatum)을 제공한다.In order to solve the above problems, the present invention provides a phenanthrene decomposing activity, Phialemonium implatum ( Phialemonium inflatum ).

또한 신규 미생물 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035(수탁번호: KCTC14329BP) 균주를 제공한다.In addition, it provides a novel microorganism Phialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession Number: KCTC14329BP) strain.

또한 상기 균주는 페난트렌(phenanthrene) 분해 활성을 가지는 것을 특징으로 하는 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035(수탁번호: KCTC14329BP) 균주를 제공한다.In addition, the strain provides a phenanthrene (phenanthrene) decomposing activity Pialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession No.: KCTC14329BP) strain characterized in that it has.

또한 상기 균주는 담수로부터 분리된 것을 특징으로 하는 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035(수탁번호: KCTC14329BP) 균주를 제공한다.In addition, the strain provides a Pialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession No.: KCTC14329BP) strain, characterized in that it is isolated from fresh water.

상기 또 다른 과제를 해결하기 위하여 본 발명은, 상기 균주 또는 이의 배양물질을 유효성분으로 함유하는 페난트렌 분해용 조성물을 제공한다.In order to solve the another problem, the present invention provides a composition for decomposing phenanthrene containing the strain or a culture material thereof as an active ingredient.

상기 또 다른 과제를 해결하기 위하여 본 발명은, 상기 조성물을 페난트렌이 포함된 배지에 처리하여 페난트렌을 분해하는 방법을 제공한다.In order to solve the another problem, the present invention provides a method for decomposing phenanthrene by treating the composition in a medium containing phenanthrene.

본 발명에 따르면, 기존에 알려진 미생물 이외에 페난트렌 분해 활성을 가지는 새로운 용도로 활용 가능한 미생물 피알레모니움 임플라툼(Phialemonium inflatum) 및 신균주 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035 균주를 제공할 수 있다.According to the present invention, in addition to previously known microorganisms, microorganisms that can be used for new uses having phenanthrene degrading activity Phialemonium implatum ( Phialemonium inflatum ) and a new strain Phialemonium implatum ( Phialemonium inflatum ) 20F-2035 strains may be provided.

이러한 본 발명에 따른 미생물 및 신균주는 페난트렌 분해 성능이 우수하여 오염된 토양의 생물학적 복원에 매우 적합하여, 관련 산업에 활용 가능한 생물자원으로서의 가치가 매우 높다.The microorganisms and new strains according to the present invention have excellent phenanthrene decomposition performance and are very suitable for biological restoration of contaminated soil, and thus have a very high value as a biological resource that can be used in related industries.

도 1은 본 발명에 따른 20F-2035 균주를 PDA 평판배지에 계대배양하여 순수배양 균주임을 확인한 결과를 나타낸 사진,
도 2는 본 발명에 따른 20F-2035 균주의 ITS 염기서열을 나타낸 도면,
도 3은 ITS 염기서열에 기초한 본 발명에 따른 20F-2035 균주의 분자생물학적 동정을 위한 계통도를 분석한 결과를 나타낸 도면,
도 4는 본 발명에 따른 20F-2035 균주를 페난트렌이 도말된 한천배지에서 15일간 배양하여 페난트렌이 분해된 모습을 나타낸 사진,
도 5는 본 발명에 따른 20F-2035 균주의 페난트렌 분해 활성도 측정 결과를 나타낸 그래프.
1 is a photograph showing the results of confirming that the 20F-2035 strain according to the present invention is a pure culture strain by subculture on a PDA plate medium;
2 is a view showing the ITS nucleotide sequence of the 20F-2035 strain according to the present invention;
3 is a view showing the results of analyzing the phylogenetic tree for molecular biological identification of the 20F-2035 strain according to the present invention based on the ITS nucleotide sequence;
4 is a photograph showing the decomposition of phenanthrene by culturing the 20F-2035 strain according to the present invention for 15 days on an agar medium smeared with phenanthrene;
5 is a graph showing the measurement results of the phenanthrene degradation activity of the 20F-2035 strain according to the present invention.

이하, 실시예를 통하여 본 발명을 상세히 설명하기로 한다. 이에 앞서, 본 명세서 및 청구범위에 사용된 용어나 단어는 통상적이거나 사전적인 의미로 한정해서 해석되어서는 아니 되며, 발명자는 그 자신의 발명을 가장 최선의 방법으로 설명하기 위해 용어의 개념을 적절하게 정의할 수 있다는 원칙에 입각하여, 본 발명의 기술적 사상에 부합하는 의미와 개념으로 해석되어야만 한다. 따라서, 본 명세서에 기재된 실시예의 구성은 본 발명의 가장 바람직한 일실시예에 불과할 뿐이고 본 발명의 기술적 사상을 모두 대변하는 것은 아니므로, 본 출원 시점에 있어서 이들을 대체할 수 있는 다양한 균등물과 변형예들이 있을 수 있음을 이해하여야 한다.Hereinafter, the present invention will be described in detail through examples. Prior to this, the terms or words used in the present specification and claims should not be construed as being limited to their ordinary or dictionary meanings, and the inventor should properly understand the concept of the term in order to best describe his invention. Based on the principle that can be defined, it should be interpreted as meaning and concept consistent with the technical idea of the present invention. Accordingly, since the configuration of the embodiments described in the present specification is only the most preferred embodiment of the present invention and does not represent all the technical spirit of the present invention, various equivalents and modifications that can be substituted for them at the time of the present application It should be understood that there may be

본 발명자들은 페난트렌 분해 활성을 가지는 담수균류를 찾고자 전국 여러 담수에서 시료를 확보하였으며, 그 중 전남 함평시 함평천의 담수퇴적물에서 분리한 20F-2035 균주를 확보하였고, 순수 분리된 담수균류의 분자생물학적 동정을 실시하고자 ITS 염기서열 분석한 결과, 피알레모니움 임플라툼(Phialemonium inflatum)으로 동정되었다. 상기 균주를 페난트렌이 도말된 배지에서 배양하고 페난트렌 분해율을 측정하여 페난트렌 분해 활성을 보유한 것을 확인하고, 본 발명에 이르게 되었다.To find freshwater fungi having phenanthrene decomposition activity, the present inventors obtained samples from various freshwater nationwide, and among them, 20F-2035 strain isolated from freshwater sediments in Hampyeongcheon, Hampyeong-si, Jeollanam-do, was obtained. As a result of ITS sequencing to carry out the identification, it was identified as Pialemonium implatum ( Phialemonium inflatum ). The strain was cultured in a phenanthrene-plated medium and the phenanthrene degradation rate was measured to confirm that it had phenanthrene degradation activity, leading to the present invention.

따라서, 본 발명은 페난트렌(phenanthrene) 분해 활성을 가지는 피알레모니움 임플라툼(Phialemonium inflatum)과, 신규 미생물 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035(수탁번호: KCTC14329BP) 균주를 개시한다.Therefore, the present invention is a phenanthrene (phenanthrene) decomposing activity Pialemonium implatum ( Phialemonium inflatum ), and a novel microorganism Phialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession No.: KCTC14329BP) strain to start

본 발명은 특정 미생물의 새로운 용도로서, 페난트렌 분해 활성능을 보유한 피알레모니움 임플라툼(Phialemonium inflatum)를 최초로 제시하고자 하는 것이며, 따라서, 피알레모니움 임플라툼(Phialemonium inflatum) 균주로서 페난트렌 분해를 위해 사용되는 균주, 이를 이용한 페난트렌 분해용 조성물 또는 이를 이용한 페난트렌 분해 방법들은 모두 본 발명이 예정하는 기술적 개념에 속한다고 보아야 할 것이다.As a new use of a specific microorganism, the present invention is to present for the first time Pialemonium implatum ( Phialemonium inflatum ) having phenanthrene decomposition activity, and therefore, as a Pialemonium implatum ( Phialemonium inflatum ) strain A strain used for decomposing phenanthrene, a composition for decomposing phenanthrene using the same, or a method for decomposing phenanthrene using the same should all be regarded as belonging to the technical concept intended by the present invention.

본 발명에 따른 균주는 페난트렌(phenanthrene) 분해 활성이 뛰어난 것으로 확인되었다.The strain according to the present invention was confirmed to have excellent phenanthrene decomposition activity.

본 발명의 적용예에 따르면, 상기 균주 또는 이의 대사물질을 유효성분으로 함유하는 페난트렌 분해용 조성물이 제공된다.According to an application example of the present invention, there is provided a composition for decomposing phenanthrene containing the strain or a metabolite thereof as an active ingredient.

본 발명에서 상기 균주 또는 이의 대사물질은 상기 균주의 균체, 상기 균주의 배양액, 상기 균주의 배양여액 등의 상태로 이용될 수 있다. 여기서, 상기 균주의 균체는 균 자체를 모두 포함하는 의미이며, 상기 배양액은 균체가 포함된 배양액을 의미하며, 상기 배양여액은 균체 비포함 배양액을 의미한다.In the present invention, the strain or its metabolites may be used in the state of the cells of the strain, the culture solution of the strain, the culture filtrate of the strain, and the like. Here, the cells of the strain are meant to include all of the cells themselves, the culture medium means a culture solution containing the cells, and the culture filtrate means a culture solution containing no cells.

본 발명의 또 다른 적용예에 따르면, 페난트렌을 분해하는 방법은 상기 균주 또는 이의 대사산물의 유효량을 페난트렌이 포함된 용액에 처리하는 방법으로 수행될 수 있다.According to another application example of the present invention, the method of decomposing phenanthrene may be performed by treating an effective amount of the strain or a metabolite thereof in a solution containing phenanthrene.

이하, 실시예를 들어 본 발명을 상세히 설명하기로 한다.Hereinafter, the present invention will be described in detail by way of examples.

실시예 1: 페난트렌 분해 활성을 보유한 담수균류 20F-2035 균주의 분리Example 1: Isolation of strain 20F-2035 of freshwater fungus having phenanthrene degrading activity

본 발명에서는 페난트렌 분해 활성을 지닌 담수균류를 선발하기 위하여, 하기 표 1의 균주 채집 정보로 나타낸 바와 같이, 2020년에 전라남도 함평군 신광면 지역의 함평천에서 담수퇴적물를 채집하였다. 채집한 담수퇴적물에서 담수균류를 순수 분리하기 위하여, 퇴적물 1 g을 멸균수 10 ㎖에 희석하고 이를 다시 100배까지 희석한 뒤 100 ㎕를 취하여 항생제(streptomycin, ampicilin)가 첨가된 1.5% 물한천(water agar) 배지에 도말하고 25℃, 암조건에서 배양하였다. 배양 3일 후 자라나온 균사를 물한천 배지에서 분리하여 24-웰 플레이트(24-well plate) V8 배지에 접종하여 배양하고 V8 배지에서 자란 균류는 다시 PDA 배지에 여러 번 계대배양하여 순수 분리하였다.In the present invention, in order to select freshwater fungi having phenanthrene degrading activity, as shown in the strain collection information in Table 1 below, freshwater sediments were collected from Hampyeongcheon Stream in Singwang-myeon, Hampyeong-gun, Jeollanam-do in 2020. To isolate freshwater fungi from the collected freshwater sediment, dilute 1 g of the sediment in 10 ml of sterile water, dilute it up to 100 times, and take 100 µl of 1.5% water agar (streptomycin, ampicilin) added to it ( water agar) and cultured at 25°C in dark conditions. After 3 days of culturing, the mycelium that grew up was separated from the water agar medium, inoculated in a 24-well plate V8 medium, and cultured.

채집지역collection area 채집년도Year of collection 수계water system 분리원separatist 전라남도 함평군 신광면Singwang-myeon, Hampyeong-gun, Jeollanam-do 20202020 영산강(함평천)Yeongsan River (Hampyeongcheon) 담수퇴적물freshwater sediment

실시예 2: 페난트렌 분해 활성을 보유한 담수균류 20F-2035 균주의 동정Example 2: Identification of 20F-2035 strain of freshwater fungus having phenanthrene degrading activity

도 1은 본 발명에 따른 20F-2035 균주를 PDA 평판배지에 계대배양하여 순수배양 균주임을 확인한 결과를 나타낸 사진이다. 도 1과 같이 순수 분리된 담수균류의 분자생물학적 동정을 실시하고자 ITS(Internal Transcribed Spacer) 염기서열을 분석하여 그 결과를 도 2(서열번호 1)에 나타내었다. 사용된 프라이머는 하기 표 2와 같다.1 is a photograph showing the result of confirming that the strain 20F-2035 according to the present invention is a pure culture strain by subculture on a PDA plate medium. In order to perform molecular biological identification of freshwater fungi isolated from pure water as shown in FIG. 1, an ITS (Internal Transcribed Spacer) nucleotide sequence was analyzed, and the results are shown in FIG. 2 (SEQ ID NO: 1). The primers used are shown in Table 2 below.

프라이머
이름
primer
name
정방향(5'-3')
프라이머 염기서열
Forward (5'-3')
primer sequence
프라이머
이름
primer
name
역방향(5'-3')
프라이머 염기서열
Reverse (5'-3')
primer sequence
ITS5ITS5 GGAAGTAAAAGTCGTAACAAGGGGAAGTAAAAGTCGTAACAAGG ITS4ITS4 TCCTCCGCTTATTGATATGCTCCTCCGCTTATTGATATGC

ITS 염기서열에 대해 NCBI의 BLAST 결과, 20F-2035 균주는 피알레모니움 임플라툼(Phialemonium inflatum)로 동정되었다. 또한, 도 3과 같이 근연종의 ITS 염기서열을 이용한 계통도 분석에서 피알레모니움 임플라툼(Phialemonium inflatum isolate BK239)과 100% 유사성을 보였으며, 균사생장, 포자형태, 크기 등에 따라 형태학적 관찰을 통해 최종적으로 상기 균주를 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035 균주로 명명하고, 이를 생물자원센터(KCTC: Korean Collection for Type Cultures)에 2020년 10월 12일자로 수탁하여, 수탁번호 KCTC14329BP를 부여받았다.As a result of BLAST of NCBI for the ITS sequence, strain 20F-2035 was identified as Phialemonium inflatum . In addition, 100% similarity to Phialemonium inflatum isolate BK239 was shown in the phylogenetic analysis using the ITS sequence of the related species as shown in FIG. Finally, the strain was named as Phialemonium inflatum 20F-2035 strain, and it was entrusted to the Korean Collection for Type Cultures (KCTC) on October 12, 2020, It was given accession number KCTC14329BP.

실시예 3: 피알레모니움 임플라툼(Example 3: Pialemonium implatum ( Phialemonium inflatumPhialemonium inflatum ) 20F-2035 균주의 페난트렌 분해 활성 확인) Confirmation of phenanthrene degradation activity of strain 20F-2035

상기 실시예 1 및 2에서 분리 및 동정한 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035 균주의 페난트렌 분해 활성을 확인하기 위하여, 메탄올에 페난트렌을 10 mg/㎖의 농도로 녹인 용액을 PDA 배지에 100 ㎕ 도말하고 메탄올을 증발시켜 페난트렌만 배지 위에 남도록 처리하여 페난트렌 배지를 제작하였다. 제작한 페난트렌 배지에 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035 균주를 접종한 뒤 25℃에서 15일 동안 암배양하여 생장한 균주 주변의 페난트렌이 사라지는 영역의 발생 여부를 확인하였고, 그 결과를 도 4에 나타내었다. In order to confirm the phenanthrene decomposition activity of the Phialemonium inflatum 20F-2035 strain isolated and identified in Examples 1 and 2 above, a solution of phenanthrene in methanol at a concentration of 10 mg/ml was spread on PDA medium, and methanol was evaporated and treated so that only phenanthrene remained on the medium to prepare a phenanthrene medium. After inoculating the Phialemonium inflatum 20F-2035 strain in the prepared phenanthrene medium, cancer culture at 25 ° C. for 15 days. , the results are shown in FIG. 4 .

도 4를 참조하면, 20F-2035 균주가 생장하는 범위보다 넓은 영역에서 페난트렌이 사라지는 영역이 명확히 확인되고, 이로부터 본 발명에 따른 20F-2035 균주는 우수한 페난트렌 분해 활성을 보유하고 있음이 증명된다.Referring to Figure 4, the region where phenanthrene disappears is clearly confirmed in a wider region than the growth range of the 20F-2035 strain, and from this, it is proved that the 20F-2035 strain according to the present invention has excellent phenanthrene decomposition activity. do.

실시예 4: 피알레모니움 임플라툼(Example 4: Pialemonium implatum ( Phialemonium inflatumPhialemonium inflatum ) 20F-2035 균주의 페난트렌 분해 활성도 측정) Measurement of phenanthrene degradation activity of strain 20F-2035

상기 실시예 1 및 2에서 분리 및 동정한 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035 균주의 페난트렌 분해 활성도를 측정하기 위하여, 다음과 같이 실험하였다. 페난트렌이 배지에 용해되는 양이 극히 적기 때문에 간접적인 측정방법을 사용하였으며, 실시예 3에서 사용한 페난트렌 배지의 중앙에 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035 균주를 접종한 후 시간에 따른 페난트렌 분해 영역의 넓이를 계산하여 분해활성도를 측정하였다. 대조군으로서 균주를 접종하지 않은 페난트렌 배지를 동일한 조건으로 처리하였으며, 페난트렌 분해 실험은 5반복으로 진행한 뒤 평균 및 표준편차를 계산하여 분해 활성도를 산출하고 그 결과를 도 5에 나타내었다.In order to measure the phenanthrene degradation activity of the Pialemonium inflatum 20F-2035 strain isolated and identified in Examples 1 and 2, an experiment was performed as follows. Since the amount of phenanthrene dissolved in the medium is very small, an indirect measurement method was used, and after inoculating the Phialemonium inflatum 20F-2035 strain in the center of the phenanthrene medium used in Example 3 The decomposition activity was measured by calculating the area of the phenanthrene decomposition region according to time. As a control, a phenanthrene medium that was not inoculated with the strain was treated under the same conditions, and the phenanthrene degradation experiment was repeated 5 times to calculate the average and standard deviation to calculate the degradation activity, and the results are shown in FIG. 5 .

도 5를 참조하면, 본 발명에 따른 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035 균주에 의해 15일간 배지상의 페난트렌이 71%까지 분해되었음을 확인할 수 있다.Referring to FIG. 5 , it can be confirmed that up to 71% of phenanthrene on the medium was degraded by the Phialemonium inflatum 20F-2035 strain according to the present invention for 15 days.

이상에서 설명한 본 발명의 바람직한 실시예들은 기술적 과제를 해결하기 위해 개시된 것으로, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자라면 본 발명의 사상 및 범위 안에서 다양한 수정, 변경, 부가 등이 가능할 것이며, 이러한 수정 변경 등은 이하의 특허청구범위에 속하는 것으로 보아야 할 것이다.Preferred embodiments of the present invention described above are disclosed to solve the technical problem, and various modifications, changes, additions, etc. will be possible within the spirit and scope of the present invention by those of ordinary skill in the art to which the present invention pertains. , such modifications and changes should be regarded as belonging to the following claims.

한국생명공학연구원Korea Institute of Bioscience and Biotechnology KCTC14329BPKCTC14329BP 2020101220201012

<110> Nakdonggang National Institute of Biological Resources <120> Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof <130> NP20-11153 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 555 <212> DNA <213> Unknown <220> <223> Phialemonium inflatum 20F-2035 <400> 1 aacaaggtct ccgttggtga accagcggag ggatcattac agagtttaac gactcccaaa 60 ccactgtgaa catacccgta ccgttgcctc ggcgggcggc cccagggcgg ggccgcagcc 120 tccccagcgg aggcgcccgc cgcaggtcgc aaaactataa ctatatttag tggcatctct 180 gagtaacttc caaacaatca aaactttcaa caacggatct cttggttctg gcatcgatga 240 agaacgcagc gaaatgcgat aagtaatgtg aattgcagaa ttcagtgaat catcgaatct 300 ttgaacgcac attgcgcccg ccagcattct ggcgggcatg cctgtccgag cgtcatttca 360 accctcaagc cctgcttggt gttggggcac tacgcgcgag cgtaggccct caaaatcagt 420 ggcggacccg ctggaggtcc gggcgtagta acacatctcg cccgaggtcc ccagcgtgcc 480 cctgccgtta aacccccaaa tttacagaag gttgacctcg gatcaggtag gaatacccgc 540 tgaacttaag catat 555 <110> Nakdonggang National Institute of Biological Resources <120> Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof <130> NP20-11153 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 555 <212> DNA <213> Unknown <220> <223> Phialemonium inflatum 20F-2035 <400> 1 aacaaggtct ccgttggtga accagcggag ggatcattac agagtttaac gactcccaaa 60 ccactgtgaa catacccgta ccgttgcctc ggcgggcggc cccagggcgg ggccgcagcc 120 tccccagcgg aggcgcccgc cgcaggtcgc aaaactataa ctatatttag tggcatctct 180 gagtaacttc caaacaatca aaactttcaa caacggatct cttggttctg gcatcgatga 240 agaacgcagc gaaatgcgat aagtaatgtg aattgcagaa ttcagtgaat catcgaatct 300 ttgaacgcac attgcgcccg ccagcattct ggcgggcatg cctgtccgag cgtcatttca 360 accctcaagc cctgcttggt gttggggcac tacgcgcgag cgtaggccct caaaatcagt 420 ggcggacccg ctggaggtcc gggcgtagta acacatctcg cccgaggtcc ccagcgtgcc 480 cctgccgtta aacccccaaa tttacagaag gttgacctcg gatcaggtag gaatacccgc 540 tgaacttaag catat 555

Claims (6)

페난트렌(phenanthrene) 분해 활성을 가지는 피알레모니움 임플라툼(Phialemonium inflatum).Phialemonium implatum having a phenanthrene decomposition activity ( Phialemonium inflatum ). 신규 미생물 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035(수탁번호: KCTC14329BP) 균주.Novel microorganism Phialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession Number: KCTC14329BP) strain. 제2항에 있어서,
상기 균주는 페난트렌(phenanthrene) 분해 활성을 가지는 것을 특징으로 하는 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035(수탁번호: KCTC14329BP) 균주.
3. The method of claim 2,
The strain is phenanthrene (phenanthrene), characterized in that it has a decomposing activity Pialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession No.: KCTC14329BP) strain.
제2항에 있어서,
상기 균주는 담수로부터 분리된 것을 특징으로 하는 피알레모니움 임플라툼(Phialemonium inflatum) 20F-2035(수탁번호: KCTC14329BP) 균주.
3. The method of claim 2,
The strain is Pialemonium implatum ( Phialemonium inflatum ) 20F-2035 (Accession No.: KCTC14329BP) strain, characterized in that it is isolated from fresh water.
제2항 내지 제4항 중 어느 한 항의 균주 또는 이의 배양물질을 유효성분으로 함유하는 페난트렌 분해용 조성물.A composition for decomposing phenanthrene comprising the strain of any one of claims 2 to 4 or a culture material thereof as an active ingredient. 제5항의 조성물을 페난트렌이 포함된 배지에 처리하여 페난트렌을 분해하는 방법.A method of decomposing phenanthrene by treating the composition of claim 5 in a medium containing phenanthrene.
KR1020200167448A 2020-12-03 2020-12-03 Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof KR102455290B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020200167448A KR102455290B1 (en) 2020-12-03 2020-12-03 Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200167448A KR102455290B1 (en) 2020-12-03 2020-12-03 Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof

Publications (2)

Publication Number Publication Date
KR20220078769A true KR20220078769A (en) 2022-06-13
KR102455290B1 KR102455290B1 (en) 2022-10-18

Family

ID=81983854

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200167448A KR102455290B1 (en) 2020-12-03 2020-12-03 Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof

Country Status (1)

Country Link
KR (1) KR102455290B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090175838A1 (en) * 2007-01-26 2009-07-09 Newell Rogers M Karen Methods of modulating immune function
JP2010523076A (en) * 2006-11-02 2010-07-15 ザ ユニバーシティー オブ マンチェスター Fungal infection assays
US20180153174A1 (en) * 2016-12-01 2018-06-07 Indigo Ag, Inc. Modulated nutritional quality traits in seeds

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010523076A (en) * 2006-11-02 2010-07-15 ザ ユニバーシティー オブ マンチェスター Fungal infection assays
US20090175838A1 (en) * 2007-01-26 2009-07-09 Newell Rogers M Karen Methods of modulating immune function
US20180153174A1 (en) * 2016-12-01 2018-06-07 Indigo Ag, Inc. Modulated nutritional quality traits in seeds

Also Published As

Publication number Publication date
KR102455290B1 (en) 2022-10-18

Similar Documents

Publication Publication Date Title
Wang et al. Case study of the relationship between fungi and bacteria associated with high-molecular-weight polycyclic aromatic hydrocarbon degradation
CN110283741B (en) Rose color-changing bacterium with function of efficiently degrading polycyclic aromatic hydrocarbon and application thereof
CN105713862B (en) The bacterial strain and its application of degradable pyridine and ammonia nitrogen
CN110283755B (en) Gordoniella terricola RL-JC02 and application thereof in degradation of organic pollutants
Andriani et al. Effects of saline-alkaline stress on benzo [a] pyrene biotransformation and ligninolytic enzyme expression by Bjerkandera adusta SM46
Teerapatsakul et al. Biodegradation of polycyclic aromatic hydrocarbons by a thermotolerant white rot fungus Trametes polyzona RYNF13
JP3673496B2 (en) Bacterial community EBC1000 that degrades persistent toxic chemicals, and a method for biologically correcting persistent chemicals that contaminate industrial wastewater, waste, soil, etc. using the same
CN111057670A (en) Mixed bacterium agent for degrading sulfonamide antibiotics in sewage and preparation method and application thereof
kumar Rajendran et al. Aerobic degradation of estrogenic alkylphenols by yeasts isolated from a sewage treatment plant
CN113462609A (en) Mycobacterium for efficiently degrading polycyclic aromatic hydrocarbon and application thereof
CN114292764A (en) Achromobacter strain JD417 and application thereof
KR102455290B1 (en) Phialemonium inflatum 20F-2035 strain isolated from freshwater having phenanthrene degradation activity and uses thereof
KR101471508B1 (en) New Microbial Strain Alteromonas sp. SN2 for Degrading Polycyclic Aromatic Hydrocarbon
Chen et al. Effects of six types of straw derived biochar on anaerobic biodegradation of polybrominated diphenyl ethers in mangrove sediments: a microcosm experiment
CN112239731A (en) Surface active bacterial strain for degrading petroleum hydrocarbon and application thereof
CN106834165B (en) Paracoccus capable of degrading penicillin, cell fraction and composition thereof
CN111808770B (en) Air bacillus for degrading crude oil and application thereof
Henagamage et al. Degradation and decolorization of textile azo dyes by effective fungal-bacterial consortium
Bello et al. Tolerance to heavy metals by some fungal isolates from petroleum refinery effluent in Kaduna, Nigeria
Ayu et al. Biological Treatment of Naphthol Yellow S and Batik Effluent using Aspergillus tamarii and Aspergillus sclerotiorum
CN1904033A (en) Diesel oil alkane eating bacteria and its degradation enzyme system
CN111269854A (en) Geo-LYY strain of geobacillus for dehalogenation of halogenated organic matters and dye decoloration and application thereof
KR100693865B1 (en) 0210-09 [-11368] Development of the isolate Pseudomonas fluorescens HYK0210-SK09 against the harmful diatom in fresh water growth control method and bio-agent using the isolate
Daâssi et al. Soil microcosms for bioaugmentation with fungal isolates to remediate petroleum hydrocarbon-contaminated soil
CN114854626B (en) Pseudomonas strain for degrading polycyclic aromatic hydrocarbon pollutants and application thereof

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant