KR20220077362A - Bioassay for detecting testosterone and identifying method for concentration of testosterone using the same - Google Patents

Abstract

The present invention relates to a testosterone detection biomarker and a method for determining the testosterone concentration using the same, and the testosterone concentration in a test sample can be easily and quickly confirmed.

Description

Testosterone detection biomarker and testosterone concentration using the same

The present invention relates to a biomarker for detecting testosterone and a method for determining testosterone concentration using the same, and more particularly, to a biomarker for detecting testosterone including an aptamer-gold nanoparticle conjugate, progesterone-HRP and TMB substrate and using the same It relates to a method for confirming testosterone concentration.

Testosterone is a steroid hormone produced by Leedig cells in the male testes. In men, testosterone stimulates secondary sexual characteristics such as penis enlargement, body hair growth, and degeneration, promotes spermatogenesis, and develops and maintains muscles. In women, testosterone is produced mainly by the adrenal glands, but also in small amounts by the ovaries, where testosterone is converted into estradiol, the main female sex hormone. High testosterone levels in boys cause precocious puberty, and conversely, a decrease in testosterone in adults results in infertility, sexual decline, and erectile dysfunction. In women, high levels of testosterone may indicate masculinity (low-pitched voice, heavy hair, amenorrhea) or infertility.

Existing testosterone testing methods include i) chemiluminescence immunoassay, ii) radioactivity-based immunoassay, and iii) high-performance liquid chromatography mass spectrometry (LC/MS/MS). i) The immunoassay by chemiluminescence (ELISA Kit) is a test method using color change, and has the advantage of using a high sensitivity and simple operation method. However, when the limit of detection (LOD) is 30-100 pg/mL and the concentration of testosterone in the sample is low, measurement is impossible and a lot of diagnostic errors occur. ii) Estradiol radioimmunoassay kit is a method of measuring the amount of estradiol (or testosterone) detected by radioactivity, and has an advantage in that it has a detection limit of 10 pg/mL and high sensitivity. However, when the concentration of testosterone in the sample is low, the accuracy is very poor and the sample may be contaminated by radiation exposure. iii) The advantage of high-performance liquid chromatography mass spectrometry is that the measurement method is accurate. However, there are disadvantages in that the inspection method is complicated, the detection time is very long, and the inspection cost is high.

Accordingly, the present inventors developed a biomarker that can easily and quickly identify testosterone in the test sample, and confirmed that the concentration of testosterone in the test sample can be confirmed using this, and completed the present invention.

Korean Patent Publication No. 10-2103550 (2020.04.23. Announcement)

It is an object of the present invention to provide a biomarker for detecting testosterone.

It is also an object of the present invention to provide a testosterone concentration confirmation method capable of quickly and easily confirming the testosterone concentration in a sample using a testosterone detection biomarker.

The problem to be solved by the present invention is not limited to the problem(s) mentioned above, and another problem(s) not mentioned will be clearly understood by those skilled in the art from the following description.

In order to solve the above problems, according to one aspect of the present invention, the present invention provides a biomarker for detecting testosterone, including; aptamer-gold nanoparticle conjugate, progesterone-HRP and TMB substrate.

In addition, the present invention, aptamer-gold nanoparticle conjugate; progesterone-HRP; and a TMB substrate, wherein the progesterone-HRP binds to the aptamer-gold nanoparticles and provides a biomarker for testosterone detection.

In addition, the present invention, aptamer-gold nanoparticle conjugate; progesterone-HRP; and a TMB substrate, wherein the progesterone-HRP binds to the aptamer-gold nanoparticles, and the testosterone displaces progesterone-HRP bound to the aptamer-gold nanoparticles and binds to the aptamer-gold nanoparticles. A biomarker for detection is provided.

According to another aspect of the present invention, there is provided an aptamer-gold nanoparticle with progesterone-HRP (step 1); adding a test sample containing testosterone to the solution of step 1 (step 2); removing the substituted progesterone-HRP in step 2 (step 2a); A step of reacting the TMB substrate with the solution of step 2a (step 3); and measuring the absorbance of the solution in step 3 to determine the concentration of testosterone (step 4).

In addition, the present invention, aptamer- mixing the gold nanoparticles with progesterone-HRP (step 1); adding a test sample containing testosterone to the solution of step 1 (step 2); Separating the substituted progesterone-HRP in step 2 (step 2b); a step of reacting the TMB substrate with the progesterone-HRP separated in step 2b (step 3); and measuring the absorbance of the solution in step 3 to determine the concentration of testosterone (step 4).

According to the testosterone detection biomarker of the present invention and the testosterone concentration confirmation method using the same, the testosterone concentration in the test sample can be easily and quickly checked and utilized for various diagnoses.

In addition, according to the testosterone detection biomarker of the present invention and the testosterone concentration confirmation method using the same, there is an effect of confirming the testosterone concentration in the test sample with high sensitivity.

It should be understood that the effects of the present invention are not limited to the above-described effects, and include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.

1 is a schematic diagram of the principle of action of a biomarker for testosterone detection according to an embodiment of the present invention step by step. FIG. 1A shows the case of performing in a microwell, and FIG. 1B shows the case of performing it in a lateral flow chip. .
2 is a process flow diagram of a method for determining a testosterone concentration according to an embodiment of the present invention.
3 is a standard curve graph showing the absorbance of a sample according to the concentration of testosterone according to an embodiment of the present invention.

Hereinafter, preferred embodiments according to the present invention will be described in detail with reference to the accompanying drawings.

Advantages and features of the present invention, and a method of achieving the same, will become apparent with reference to the embodiments described below in detail in conjunction with the accompanying drawings.

However, the present invention is not limited by the embodiments disclosed below, but will be implemented in a variety of different forms, and only these embodiments allow the disclosure of the present invention to be complete, and common knowledge in the art to which the present invention pertains It is provided to fully inform those who have the scope of the invention, and the present invention is only defined by the scope of the claims.

In addition, in the description of the present invention, when it is determined that related known techniques may obscure the gist of the present invention, a detailed description thereof will be omitted.

Hereinafter, the present invention will be described in detail.

Biomarkers for testosterone detection

The biomarker for testosterone detection of the present invention includes an aptamer-gold nanoparticle conjugate, progesterone-HRP and TMB substrates.

By using the biomarker for testosterone detection according to the present invention, it can be used for analysis of causes of hypogonadism or secondary sexual characteristics delay in men, analysis of hormone treatment progress, etc., and for women, analysis of adrenal defects or ovarian syndrome, hormones It can be used as a diagnostic tool such as treatment progress analysis.

The gold nanoparticles have a particle size of 1 to 100 nm, and a conventional one known in the art may be used.

The aptamer is a DNA aptamer that specifically binds to the gold nanoparticles, and ARS-3 aptamer is preferably used, and particularly preferably has an affinity dissociation constant of 5.7 nM.

A method for preparing the aptamer-gold nanoparticle conjugate is as follows, for example. BSA-gold nanoparticles were prepared by culturing gold nanoparticles and bovine serum albumin (BSA), and the aptamer-gold nanoparticle conjugate was prepared by mixing and culturing the biotinylated aptamer and phosphate buffer. can do. Then, progesterone-HRP and aptamer-gold nanoparticle conjugates are cultured in streptavidin-coated microwells and washed with PBS to purify the gold nanoparticle complex by biotin-streptavidin binding. Then, when a test sample containing testosterone is added, progesterone-HRP is replaced (substituted) with a specific reaction to the aptamer of testosterone.

The aptamer specifically reacts by electrostatic binding to progesterone and testosterone, but preferentially binds to testosterone having a relatively higher affinity. Therefore, when a test sample containing testosterone is reacted with the progesterone-HRP-conjugated aptamer-gold nanoparticle conjugate, testosterone replaces progesterone-HRP, and testosterone binds to the aptamer-gold nanoparticle conjugate, and progesterone- HRP is detached from the aptamer-gold nanoparticle conjugate.

A method for producing progesterone-HRP is, for example, as follows. NHS and EDAC are added to a solution in which hydroxylated progesterone (17-a-OH-P) is dissolved, and the mixture is activated. To this, an aqueous HRP solution may be added and reacted to prepare progesterone-HRP.

1 is a schematic diagram of the working principle of a biomarker for testosterone detection according to an embodiment of the present invention.

1a is a case in which a microwell is used. When a test sample containing testosterone is injected into a microwell containing an excess of aptamer-gold nanoparticle conjugate and a progesterone-HRP conjugate, the testosterone in the test sample is pressurized. When progesterone-HRP bound to the tamer-gold nanoparticle conjugate is substituted, washed, and TMB substrate is added, it reacts with the progesterone-HRP conjugate remaining in the aptamer-gold nanoparticle conjugate to cause a color reaction. Therefore, the higher the concentration of testosterone in the test sample, the weaker the color development, and the lower the testosterone concentration in the test sample, the stronger the color.

Figure 1b is a case of using a lateral flow chip (lateral flow chip) in the form of a test strip, an excess of aptamer-gold nanoparticle conjugate and progesterone-HRP conjugate are placed on the lateral flow chip and a test sample containing testosterone Upon reaction, testosterone in the test sample replaces progesterone-HRP bound to the aptamer-gold nanoparticle conjugate, and progesterone-HRP separated from the aptamer-gold nanoparticle conjugate moves and reacts with the TMB substrate to develop color cause a reaction Therefore, unlike the reaction of FIG. 1A, a color reaction appears in proportion to the concentration of testosterone in the test sample. That is, the higher the concentration of testosterone in the test sample, the stronger the color development, and the lower the testosterone concentration in the test sample, the weaker the color.

How to check testosterone concentration

Figure 2a shows a process flow diagram of a testosterone concentration confirmation method according to an embodiment of the present invention.

Referring to FIG. 2a , first, progesterone-HRP is mixed with the aptamer-gold nanoparticle conjugate (S100).

In this step, the aptamer-gold nanoparticle conjugate is mixed with progesterone-HRP, incubated, and then centrifuged to prepare a conjugate of the aptamer-gold nanoparticle conjugate and progesterone-HRP.

The gold nanoparticles have a particle size of 1 to 100 nm, and a conventional one known in the art may be used.

As the aptamer, the aptamer is a DNA aptamer that specifically binds to the gold nanoparticles. It is preferable to use an ARS-3 aptamer, and more preferably, an affinity dissociation constant of 5.7 nM.

The preparation of the aptamer-gold nanoparticle conjugate and progesterone-HRP overlaps with those described in the biomarker for testosterone detection, so it will be omitted.

Next, a test sample containing testosterone is added to the solution obtained in S100 (S200).

A test sample containing testosterone is added to a solution (solution obtained in S100) containing an excess of aptamer-gold nanoparticle conjugate and progesterone-HRP conjugate.

Since the binding force of testosterone contained in the test sample to the aptamer-gold nanoparticle conjugate is greater than that of progesterone-HRP, testosterone replaces progesterone-HRP and progesterone-HRP is separated from the aptamer-gold nanoparticle conjugate.

Thereafter, in the case of performing in a micro-well (FIG. 1a), the substituted progesterone-HRP may be removed by washing, and the substituted progesterone-HRP may be washed by centrifugation.

On the other hand, when carried out in the lateral flow chip (lateral flow chip) (Fig. 1b), the substituted progesterone-HRP can be separated and moved.

Next, the TMB substrate is added to the solution obtained in S200 (S300).

When TMB substrate is added to the solution or material obtained in S200, the TMB substrate binds with HRP to develop a yellow color reaction.

In the case of performing in a microwell (FIG. 1a), the TMB substrate reacts with progesterone-HRP remaining in the aptamer-gold nanoparticles after washing at S200 to measure the concentration of testosterone. Therefore, the higher the concentration of testosterone in the test sample, the weaker the color development, and the lower the testosterone concentration in the test sample, the stronger the color.

When performed in a lateral flow chip (FIG. 1b), the TMB substrate reacts with aptamer-progesterone-HRP isolated from aptamer-gold nanoparticles at S200 to measure the concentration of testosterone. Therefore, the color reaction appears in proportion to the concentration of testosterone in the test sample. That is, the higher the concentration of testosterone in the test sample, the stronger the color development, and the lower the testosterone concentration in the test sample, the weaker the color.

Next, the absorbance of the solution obtained in S300 is measured to determine the concentration of testosterone (S400).

The absorbance can be measured using a conventional absorbance meter such as a microplate reader, and after measuring the absorbance of the solution obtained in S300, the corresponding testosterone concentration can be confirmed by comparing it with a calibration curve.

3 is a calibration curve prepared by measuring absorbance using a microwell and varying the concentration of testosterone in a test sample using the biomarker for testosterone detection according to the present invention and a method for confirming the testosterone concentration using the same.

According to FIG. 3 , in the biomarker for detecting testosterone and the method for determining the testosterone concentration using the same according to the present invention, the detectable concentration of testosterone may be 500 pg/ml to 10 μg/ml.

Hereinafter, preferred examples are presented to help the understanding of the present invention, but the following examples are only illustrative of the present invention and the scope of the present invention is not limited to the following examples.

Example

Hereinafter, preferred examples are presented to help the understanding of the present invention, but the following examples are only illustrative of the present invention and the scope of the present invention is not limited to the following examples.

experimental material

Gold nanoparticles: Glassware required for manufacturing is washed with Aqua regia solution in a 1:3 ratio of nitric acid and hydrochloric acid to prevent contamination and then dried. 500 ul of 38.8 mM trisodium citrate (Sigma-aldrich) is mixed with 10 ml of boiling 1 mM HAuCl ₄ (Sigma aldrich), and boil with stirring for 10 minutes. After that, stop heating and stir well for 15 minutes to change the color of the solution to red. After cooling the mixture to room temperature, it was filtered using a 0.45um filter, and the filtered solution was prepared by storing it at 4°C.

Aptamer: ARS-3 aptamer (testosterone-specific aptamer with Affinity dissociation constant KD = 5.7 nM) was used, synthesized from an external company according to a known sequence, and then purchased and used (Bioneer, South Korea), and the sequence is SEQ ID NO: 1, and is as follows. 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTAAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCAGATAGTAAGCAATCT -3'

Aptamer-gold nanoparticle conjugate: Gold nanoparticles were prepared and quantified by UV-vis spectroscopy, and gold nanoparticles and BSA were placed in a rotator and incubated for 10 minutes. The prepared BSA-gold nanoparticles and anchor aptamer were incubated with NaCl in phosphate buffer for 14 hours. The aptamer-gold nanoparticles were separated by centrifugation, diluted in sodium phosphate buffer, and stored at 4°C.

Progesterone-HRP: 5 mg of 17-a-OH-P was dissolved in 200 mL of dimethyl formamide and 200 mL of dioxane. To this solution was added 100 ml of water containing 10 mg of NHS and 20 mg of EDAC; The reaction mixture was activated at 4 °C for 24 h. The activated 17-a-OH-P solution was added to HRP aqueous solution (1 mg/mL) and incubated at 4° C. for 24 hours. The reaction mixture was then passed through a G-25 column pre-equilibrated with 10 mM PBS containing 0.1% thimerosal. The brown fractions containing the enzyme activity were collected and 1% sucrose, ammonium sulfate, BSA and an equal volume of ethylene glycol were added thereto. The solution was stored at -30 °C in aliquots.

TMB substrate: TMB substrate was purchased from Thermo Scientific (USA) and used.

Preparation of test sample: To obtain a standard testosterone sample, a testosterone solution (1 mg/mL) was prepared by diluting purchased testosterone in methanol, and stored at -20 °C.

experimental method

The aptamer-gold nanoparticle conjugate solution and progesterone-HRP solution prepared as described above were added and incubated for 10 minutes, followed by centrifugation at 12000 rpm for 10 minutes (step 1). The aptamer-gold nanoparticle conjugate and progesterone-HRP conjugate solution prepared in step 1 were added in excess to the microwell, and test samples containing various concentrations of testosterone were added, followed by incubation at room temperature for 10 minutes (step 2) . The second step solution was centrifuged at 12000 rpm for 10 minutes to remove the substituted progesterone-HRP (step 2a). To this, a TMB substrate was added to react, and a stop solution was added (step 3). For the final sample, absorbance at 450 nm was measured (step 4) using a microplate reader (SpectraMax, USA).

Creating a standard curve

In order to prepare a standard curve for absorbance according to testosterone concentration, testosterone concentration was set to 500 pg, 1 ng, 100 ng, 500 ng, 1 μg, 10 μg, and the above experimental method was performed, and the calibration curve was drawn 3 is shown.

According to FIG. 3 , it can be confirmed that the detectable concentration of testosterone of the present invention is 500 pg/ml to 10 μg/ml.

In addition, by measuring the absorbance of a test sample containing testosterone according to the method for determining the testosterone concentration of the present invention, the corresponding testosterone concentration can be confirmed from the calibration curve.

Specific examples of the testosterone detection biomarker and the testosterone concentration confirmation method according to the present invention have been described so far, but it is apparent that various implementation modifications are possible within the limits that do not depart from the scope of the present invention.

Therefore, the scope of the present invention should not be limited to the described embodiments, and should be defined by the following claims as well as the claims and equivalents.

That is, the above-described embodiments are to be understood in all respects as illustrative and not restrictive, and the scope of the present invention is indicated by the claims to be described later rather than the detailed description, and the meaning and scope of the claims; All changes or modifications derived from the concept of equivalents thereof should be construed as being included in the scope of the present invention.

<Description of Sequence Listing>

SEQ ID NO: 1 is the base sequence of the aptermer used in an embodiment of the present invention.

<110> PARK, Seungkyung KHAN, Zeeshan A. BARAKAT, Emad <120> BIOMARKER FOR DETECTING AMYLOID BETA AND IDENTIFYING METHOD FOR CONCENTRATION OF AMYLOID BETA USING THE SAME <130> LNP200097 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> ARS-3 aptamer <400> 1 ggtaatacga ctcactatag ggagatacca gcttattcaa tttaagaaca accaacgtcg 60 ctccgggtac ttcttcatca gatagtaagc aatct 95

Claims (5)

aptamer-gold nanoparticle conjugates;
progesterone-HRP; and
TMB substrate; containing,
Biomarkers for testosterone detection.
aptamer-gold nanoparticle conjugates; progesterone-HRP; and TMB substrate;
The progesterone-HRP is characterized in that binding to the aptamer-gold nanoparticles,
Biomarkers for testosterone detection.
aptamer-gold nanoparticle conjugates; progesterone-HRP; and TMB substrate;
The progesterone-HRP binds to the aptamer-gold nanoparticles,
Testosterone substitutes progesterone-HRP bound to aptamer-gold nanoparticles and binds to aptamer-gold nanoparticles,
Biomarkers for testosterone detection.
mixing aptamer-gold nanoparticles with progesterone-HRP (step 1);
adding a test sample containing testosterone to the solution of step 1 (step 2);
removing the substituted progesterone-HRP in step 2 (step 2a);
A step of reacting the TMB substrate with the solution of step 2a (step 3); and
Checking the concentration of testosterone by measuring the absorbance of the solution in step 3 (step 4); characterized in that it comprises a,
A method for determining testosterone levels.
mixing aptamer-gold nanoparticles with progesterone-HRP (step 1);
adding a test sample containing testosterone to the solution of step 1 (step 2);
Separating the substituted progesterone-HRP in step 2 (step 2b);
a step of reacting the TMB substrate with the progesterone-HRP separated in step 2b (step 3); and
Checking the concentration of testosterone by measuring the absorbance of the solution in step 3 (step 4); characterized in that it comprises a,
A method for determining testosterone levels.

Images