KR20220077362A - Bioassay for detecting testosterone and identifying method for concentration of testosterone using the same - Google Patents
Bioassay for detecting testosterone and identifying method for concentration of testosterone using the same Download PDFInfo
- Publication number
- KR20220077362A KR20220077362A KR1020200166214A KR20200166214A KR20220077362A KR 20220077362 A KR20220077362 A KR 20220077362A KR 1020200166214 A KR1020200166214 A KR 1020200166214A KR 20200166214 A KR20200166214 A KR 20200166214A KR 20220077362 A KR20220077362 A KR 20220077362A
- Authority
- KR
- South Korea
- Prior art keywords
- testosterone
- hrp
- progesterone
- aptamer
- concentration
- Prior art date
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
- G01N33/743—Steroid hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
- G01N33/54346—Nanoparticles
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Nanotechnology (AREA)
- Endocrinology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 테스토스테론 검출용 바이오마커 및 이를 이용한 테스토스테론 농도의 확인방법에 관한 것으로, 피검시료 내의 테스토스테론의 농도를 쉽고 빠르게 확인할 수 있다.The present invention relates to a testosterone detection biomarker and a method for determining the testosterone concentration using the same, and the testosterone concentration in a test sample can be easily and quickly confirmed.
Description
본 발명은 테스토스테론 검출용 바이오마커 및 이를 이용한 테스토스테론 농도의 확인방법에 관한 것으로, 보다 상세하게는 압타머-금 나노입자 컨쥬케이트, 프로게스테론-HRP 및 TMB 기질을 포함하는 테스토스테론 검출용 바이오마커와 이를 이용한 테스토스테론 농도의 확인방법에 관한 것이다. The present invention relates to a biomarker for detecting testosterone and a method for determining testosterone concentration using the same, and more particularly, to a biomarker for detecting testosterone including an aptamer-gold nanoparticle conjugate, progesterone-HRP and TMB substrate and using the same It relates to a method for confirming testosterone concentration.
테스토스테론(testosterone)은 남성 고환의 라이디히 세포에서 생성되는 스테로이드 호르몬이다. 남성에서 테스토스테론은 성기 확대, 체모의 성장, 변성 등의 2차 성징을 자극하며 정자형성을 촉진하고, 근육을 발달시키고 유지시키는 등의 역할을 한다. 여성에서 테스토스테론은 주로 부신에서 생성되지만 난소에서도 소량 생성되는데, 여성의 테스토르테론은 여성의 주요 성 호르몬인 에스트라디올로 전환된다. 남아의 테스토스테론 수치가 높으면 성조숙증의 원인이 되며, 반대로 성인에서 테스토스테론이 감소하면 불임, 성기능 감퇴, 발기 부전 등이 나타난다. 여성의 경우 테스토스테론의 수치가 높으면 남성성(저음의 목소리, 많은 털, 무월경)을 보이거나 불임일 수 있다.Testosterone is a steroid hormone produced by Leedig cells in the male testes. In men, testosterone stimulates secondary sexual characteristics such as penis enlargement, body hair growth, and degeneration, promotes spermatogenesis, and develops and maintains muscles. In women, testosterone is produced mainly by the adrenal glands, but also in small amounts by the ovaries, where testosterone is converted into estradiol, the main female sex hormone. High testosterone levels in boys cause precocious puberty, and conversely, a decrease in testosterone in adults results in infertility, sexual decline, and erectile dysfunction. In women, high levels of testosterone may indicate masculinity (low-pitched voice, heavy hair, amenorrhea) or infertility.
기존의 테스토스테론 검사방법은, i) 화학적 발광에 의한 면역분석법, ii) 방사능 기반의 면역분석법 그리고 iii) 고속 액체 크로마토그래피 질량분석법(LC/MS/MS)이 있다. i) 화학적 발광에 의한 면역분석법(ELISA Kit)은 색 변화를 이용한 검사방법으로, 높은 민감도와 간단한 조작 방식을 이용하는 것이 장점이다. 그러나 검출한계(limit of detection: LOD)가 30-100 pg/mL이고 시료 내 테스토스테론의 농도가 낮은 경우 측정이 불가능하고 진단 오류가 많이 발생하는 것이 단점이다. ii) 방사능 기반 면역분석법(Estradiol radioimmunoassay kit)은 방사능으로 에스트라디올(또는 테스토스테론) 검출량을 측정하는 방법으로, 검출한계는 10 pg/mL이고 높은 민감도를 가지는 것이 장점이다. 그러나 시료 내 테스토스테론의 농도가 낮은 경우 정확성이 매우 떨어지고 방사능 노출에 의해 시료가 오염될 수 있는 단점이 있다. iii) 고속 액체 크로마토그래피 질량분석법은 측정방법이 정확한 것이 장점이다. 그러나 검사방식이 복잡하고 검출시간이 매우 길고 검사 비용이 많이 드는 단점이 있다.Existing testosterone testing methods include i) chemiluminescence immunoassay, ii) radioactivity-based immunoassay, and iii) high-performance liquid chromatography mass spectrometry (LC/MS/MS). i) The immunoassay by chemiluminescence (ELISA Kit) is a test method using color change, and has the advantage of using a high sensitivity and simple operation method. However, when the limit of detection (LOD) is 30-100 pg/mL and the concentration of testosterone in the sample is low, measurement is impossible and a lot of diagnostic errors occur. ii) Estradiol radioimmunoassay kit is a method of measuring the amount of estradiol (or testosterone) detected by radioactivity, and has an advantage in that it has a detection limit of 10 pg/mL and high sensitivity. However, when the concentration of testosterone in the sample is low, the accuracy is very poor and the sample may be contaminated by radiation exposure. iii) The advantage of high-performance liquid chromatography mass spectrometry is that the measurement method is accurate. However, there are disadvantages in that the inspection method is complicated, the detection time is very long, and the inspection cost is high.
이에 본 발명자들은 피검시료 내의 테스토스테론을 쉽고 빠르게 확인할 수 있는 바이오마커를 개발하였고, 이를 이용하여 피검시료 내 테스토스테론의 농도를 확인할 수 있음을 확인하고 본 발명을 완성하였다.Accordingly, the present inventors developed a biomarker that can easily and quickly identify testosterone in the test sample, and confirmed that the concentration of testosterone in the test sample can be confirmed using this, and completed the present invention.
본 발명의 목적은 테스토스테론 검출용 바이오마커를 제공하는데 있다.It is an object of the present invention to provide a biomarker for detecting testosterone.
또한, 본 발명의 목적은 테스토스테론 검출용 바이오마커를 이용하여 시료 내의 테스토스테론 농도를 쉽고 빠르게 확인할 수 있는 테스토스테론 농도 확인방법을 제공하는데 있다.It is also an object of the present invention to provide a testosterone concentration confirmation method capable of quickly and easily confirming the testosterone concentration in a sample using a testosterone detection biomarker.
본 발명이 해결하고자 하는 과제는 이상에서 언급한 과제(들)로 제한되지 않으며, 언급되지 않은 또 다른 과제(들)는 이하의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.The problem to be solved by the present invention is not limited to the problem(s) mentioned above, and another problem(s) not mentioned will be clearly understood by those skilled in the art from the following description.
상기 과제를 해결하기 위해, 본 발명의 일 측면에 따르면, 본 발명은 압타머-금 나노입자 컨쥬케이트, 프로게스테론-HRP 및 TMB 기질;을 포함하는, 테스토스테론 검출용 바이오마커를 제공한다.In order to solve the above problems, according to one aspect of the present invention, the present invention provides a biomarker for detecting testosterone, including; aptamer-gold nanoparticle conjugate, progesterone-HRP and TMB substrate.
또한, 본 발명은, 압타머-금 나노입자 컨쥬게이트; 프로게스테론-HRP; 및 TMB 기질을 포함하고, 상기 프로게스테론-HRP는 상기 압타머-금 나노입자에 결합하는, 테스토스테론 검출용 바이오마커를 제공한다.In addition, the present invention, aptamer-gold nanoparticle conjugate; progesterone-HRP; and a TMB substrate, wherein the progesterone-HRP binds to the aptamer-gold nanoparticles and provides a biomarker for testosterone detection.
또한, 본 발명은, 압타머-금 나노입자 컨쥬게이트; 프로게스테론-HRP; 및 TMB 기질을 포함하고, 상기 프로게스테론-HRP는 상기 압타머-금 나노입자에 결합하고, 테스토스테론은 압타머-금 나노입자에 결합한 프로게스테론-HRP를 치환하여 압타머-금 나노입자에 결합하는, 테스토스테론 검출용 바이오마커를 제공한다.In addition, the present invention, aptamer-gold nanoparticle conjugate; progesterone-HRP; and a TMB substrate, wherein the progesterone-HRP binds to the aptamer-gold nanoparticles, and the testosterone displaces progesterone-HRP bound to the aptamer-gold nanoparticles and binds to the aptamer-gold nanoparticles. A biomarker for detection is provided.
본 발명의 다른 측면에 따르면, 본 발명은, 압타머-금 나노입자에 프로게스테론-HRP를 혼합하는 단계(1단계); 1단계의 용액에 테스토스테론을 포함하는 피검시료를 첨가하는 단계(2단계); 2단계에서 치환된 프로게스테론-HRP를 제거하는 단계(2a 단계); 2a 단계의 용액에 TMB 기질이 반응하는 단계(3단계); 및 3단계의 용액의 흡광도를 측정하여 테스토스테론의 농도를 확인하는 단계(4단계);를 포함하는, 테스토스테론 농도의 확인방법을 제공한다.According to another aspect of the present invention, there is provided an aptamer-gold nanoparticle with progesterone-HRP (step 1); adding a test sample containing testosterone to the solution of step 1 (step 2); removing the substituted progesterone-HRP in step 2 (step 2a); A step of reacting the TMB substrate with the solution of step 2a (step 3); and measuring the absorbance of the solution in
또한, 본 발명은, 압타머-금 나노입자에 프로게스테론-HRP를 혼합하는 단계(1단계); 1단계의 용액에 테스토스테론을 포함하는 피검시료를 첨가하는 단계(2단계); 2단계에서 치환된 프로게스테론-HRP이 분리되는 단계(2b 단계); 2b 단계에서 분리된 프로게스테론-HRP에 TMB 기질이 반응하는 단계(3단계); 및 3단계의 용액의 흡광도를 측정하여 테스토스테론의 농도를 확인하는 단계(4단계);를 포함하는, 테스토스테론 농도의 확인방법을 제공한다.In addition, the present invention, aptamer- mixing the gold nanoparticles with progesterone-HRP (step 1); adding a test sample containing testosterone to the solution of step 1 (step 2); Separating the substituted progesterone-HRP in step 2 (step 2b); a step of reacting the TMB substrate with the progesterone-HRP separated in step 2b (step 3); and measuring the absorbance of the solution in
본 발명의 테스토스테론 검출용 바이오마커 및 이를 이용한 테스토스테론 농도의 확인방법에 따르면, 피검시료 내의 테스토스테론 농도를 쉽고 빠르게 확인하여 각종 진단에 활용할 수 있는 효과가 있다. According to the testosterone detection biomarker of the present invention and the testosterone concentration confirmation method using the same, the testosterone concentration in the test sample can be easily and quickly checked and utilized for various diagnoses.
또한, 본 발명의 테스토스테론 검출용 바이오마커 및 이를 이용한 테스토스테론 농도의 확인방법에 따르면, 피검시료 내의 테스토스테론 농도를 높은 민감도로 확인할 수 있는 효과가 있다.In addition, according to the testosterone detection biomarker of the present invention and the testosterone concentration confirmation method using the same, there is an effect of confirming the testosterone concentration in the test sample with high sensitivity.
본 발명의 효과는 상기한 효과로 한정되는 것은 아니며, 본 발명의 상세한 설명 또는 특허청구범위에 기재된 발명의 구성으로부터 추론 가능한 모든 효과를 포함하는 것으로 이해되어야 한다.It should be understood that the effects of the present invention are not limited to the above-described effects, and include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.
도 1는 본 발명의 일 실시예에 따른 테스토스테론 검출용 바이오마커의 작용원리를 단계별로 도식화 한 것으로, 도 1a는 마이크로웰에서 수행하는 경우를 나타내고, 도 1b는 측방유동 칩에서 수행하는 경우를 나타낸다.
도 2는 본 발명의 일 실시예에 따른 테스토스테론 농도 확인방법의 공정흐름도이다.
도 3은 본 발명의 일 실시예에 따른 테스토스테론의 농도에 따른 시료의 흡광도를 나타낸 검정곡선(standard curve) 그래프이다.1 is a schematic diagram of the principle of action of a biomarker for testosterone detection according to an embodiment of the present invention step by step. FIG. 1A shows the case of performing in a microwell, and FIG. 1B shows the case of performing it in a lateral flow chip. .
2 is a process flow diagram of a method for determining a testosterone concentration according to an embodiment of the present invention.
3 is a standard curve graph showing the absorbance of a sample according to the concentration of testosterone according to an embodiment of the present invention.
이하 첨부된 도면을 참조하면서 본 발명에 따른 바람직한 실시예를 상세히 설명하기로 한다.Hereinafter, preferred embodiments according to the present invention will be described in detail with reference to the accompanying drawings.
본 발명의 이점 및 특징, 그리고 그것을 달성하는 방법은 첨부된 도면과 함께 상세하게 후술되어 있는 실시예들을 참조하면 명확해질 것이다.Advantages and features of the present invention, and a method of achieving the same, will become apparent with reference to the embodiments described below in detail in conjunction with the accompanying drawings.
그러나 본 발명은 이하에 개시되는 실시예들에 의해 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 것이며, 단지 본 실시예들은 본 발명의 개시가 완전하도록 하며, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.However, the present invention is not limited by the embodiments disclosed below, but will be implemented in a variety of different forms, and only these embodiments allow the disclosure of the present invention to be complete, and common knowledge in the art to which the present invention pertains It is provided to fully inform those who have the scope of the invention, and the present invention is only defined by the scope of the claims.
또한, 본 발명을 설명함에 있어 관련된 공지 기술 등이 본 발명의 요지를 흐리게 할 수 있다고 판단되는 경우 그에 관한 자세한 설명은 생략하기로 한다.In addition, in the description of the present invention, when it is determined that related known techniques may obscure the gist of the present invention, a detailed description thereof will be omitted.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
테스토스테론 검출용 바이오마커Biomarkers for testosterone detection
본 발명의 테스토스테론 검출용 바이오마커는, 압타머-금 나노입자 컨쥬케이트, 프로게스테론-HRP 및 TMB 기질을 포함한다.The biomarker for testosterone detection of the present invention includes an aptamer-gold nanoparticle conjugate, progesterone-HRP and TMB substrates.
본 발명에 따른 테스토스테론 검출용 바이오마커를 사용하여, 남성의 경우 생식샘기능저하증(hypogonadism)이나 2차 성징 지연 원인 분석, 호르몬 치료 경과분석 등에 활용할 수 있고, 여성의 경우 부신 결함이나 난소 증후군 분석, 호르몬 치료 경과분석 등의 진단도구로 사용할 수 있다. By using the biomarker for testosterone detection according to the present invention, it can be used for analysis of causes of hypogonadism or secondary sexual characteristics delay in men, analysis of hormone treatment progress, etc., and for women, analysis of adrenal defects or ovarian syndrome, hormones It can be used as a diagnostic tool such as treatment progress analysis.
금 나노입자는 입자의 크기가 1 ~ 100 nm 인 것으로, 본 발명의 기술분야에서 알려진 통상의 것을 사용할 수 있다. The gold nanoparticles have a particle size of 1 to 100 nm, and a conventional one known in the art may be used.
압타머는 상기 금 나노입자에 특이적으로 결합하는 DNA 압타머로서, ARS-3 압타머를 사용하는 것이 바람직하고, 특히 affinity 해리상수(dissociation constant)가 5.7 nM 인 것이 더욱 바람직하다. The aptamer is a DNA aptamer that specifically binds to the gold nanoparticles, and ARS-3 aptamer is preferably used, and particularly preferably has an affinity dissociation constant of 5.7 nM.
압타머-금 나노입자 컨쥬게이트의 제조방법은 일 예로 다음과 같다. 금 나노입자와 BSA(bovine serum albumin)를 배양하여 BSA-금 나노입자를 제조하고, 이를 바이오틴화 시킨 압타머와 인산완충액(phosphate buffer)에서 혼합하고 배양하여 압타머-금 나노입자 컨쥬게이트를 제조할 수 있다. 이후 프로게스테론-HRP와 압타머-금 나노입자 컨쥬게이트를 스트렙타비딘이 코팅된 마이크로웰에서 배양하고, PBS로 워싱하면 바이오틴-스트렙타비딘 결합에 의해 금나노입자 복합체를 정제한다. 그 다음, 테스토스테론을 포함하는 피검시료를 첨가하면 테스토스테론의 압타머에 대한 특이적 반응으로 프로게스테론-HRP를 대체(치환)하게 되어 이후 TMB 추가를 통해 농도에 따른 색 변화를 관찰할 수 있게 된다. A method for preparing the aptamer-gold nanoparticle conjugate is as follows, for example. BSA-gold nanoparticles were prepared by culturing gold nanoparticles and bovine serum albumin (BSA), and the aptamer-gold nanoparticle conjugate was prepared by mixing and culturing the biotinylated aptamer and phosphate buffer. can do. Then, progesterone-HRP and aptamer-gold nanoparticle conjugates are cultured in streptavidin-coated microwells and washed with PBS to purify the gold nanoparticle complex by biotin-streptavidin binding. Then, when a test sample containing testosterone is added, progesterone-HRP is replaced (substituted) with a specific reaction to the aptamer of testosterone.
상기 압타머는 프로게스테론과 테스토스테론에 정전기적 결합에 의해 특이적으로 반응하나, affinity가 상대적으로 더 큰 테스토스테론에 우선적으로 결합하게 된다. 따라서 테스토스테론을 포함하는 피검시료를 프로게스테론-HRP이 결합된 압타머-금 나노입자 컨쥬게이트와 반응시키면 테스토스테론이 프로게스테론-HRP를 치환하여, 테스토스테론이 압타머-금 나노입자 컨쥬게이트에 결합하고, 프로게스테론-HRP은 압타머-금 나노입자 컨쥬게이트에서 분리되어 떨어져 나간다.The aptamer specifically reacts by electrostatic binding to progesterone and testosterone, but preferentially binds to testosterone having a relatively higher affinity. Therefore, when a test sample containing testosterone is reacted with the progesterone-HRP-conjugated aptamer-gold nanoparticle conjugate, testosterone replaces progesterone-HRP, and testosterone binds to the aptamer-gold nanoparticle conjugate, and progesterone- HRP is detached from the aptamer-gold nanoparticle conjugate.
프로게스테론-HRP의 제조방법은 일 예로 다음과 같다. 수산화 프로게스테론(17-a-OH-P)을 녹인 용액에 NHS와 EDAC를 첨가하고 그 혼합액을 활성화시킨다. 이에 HRP 수용액을 첨가하고 반응시켜 프로게스테론-HRP을 제조할 수 있다. A method for producing progesterone-HRP is, for example, as follows. NHS and EDAC are added to a solution in which hydroxylated progesterone (17-a-OH-P) is dissolved, and the mixture is activated. To this, an aqueous HRP solution may be added and reacted to prepare progesterone-HRP.
도 1은 본 발명의 일 실시예에 따른 테스토스테론 검출용 바이오마커의 작용원리 도식화한 것이다. 1 is a schematic diagram of the working principle of a biomarker for testosterone detection according to an embodiment of the present invention.
도 1a는 마이크로 웰(microwell)을 사용하는 경우로서, 과량의 압타머-금 나노입자 컨쥬케이트와 프로게스테론-HRP 결합체를 포함하는 마이크로 웰에 테스토스테론를 포함하는 피검시료를 투입하면, 피검시료 내 테스토스테론이 압타머-금 나노입자 컨쥬케이트에 결합되어 있던 프로게스테론-HRP을 치환하고, 이를 세척하고 TMB 기질을 첨가하면 압타머-금 나노입자 컨쥬케이트에 남아 있던 프로게스테론-HRP 결합체와 반응하여 발색반응을 일으킨다. 따라서, 피검시료 내의 테스토스테론의 농도가 높을수록 발색은 약하게 나타나고, 피검시료 내의 테스토스테론의 농도가 낮을수록 발색은 강하게 나타난다.1a is a case in which a microwell is used. When a test sample containing testosterone is injected into a microwell containing an excess of aptamer-gold nanoparticle conjugate and a progesterone-HRP conjugate, the testosterone in the test sample is pressurized. When progesterone-HRP bound to the tamer-gold nanoparticle conjugate is substituted, washed, and TMB substrate is added, it reacts with the progesterone-HRP conjugate remaining in the aptamer-gold nanoparticle conjugate to cause a color reaction. Therefore, the higher the concentration of testosterone in the test sample, the weaker the color development, and the lower the testosterone concentration in the test sample, the stronger the color.
도 1b는 테스트 스트립 형태의 측방유동 칩(lateral flow chip)을 사용하는 경우로서, 과량의 압타머-금 나노입자 컨쥬케이트와 프로게스테론-HRP 결합체를 측방유동칩 상에 위치시키고 테스토스테론를 포함하는 피검시료를 반응시키면, 피검시료 내 테스토스테론이 압타머-금 나노입자 컨쥬케이트에 결합되어 있던 프로게스테론-HRP을 치환하고, 압타머-금 나노입자 컨쥬케이트에서 분리된 프로게스테론-HRP가 이동하고 TMB 기질과 반응하여 발색반응을 일으킨다. 따라서, 도 1a의 반응과는 다르게, 피검시료 내의 테스토스테론의 농도에 비례하여 발색반응이 나타난다. 즉, 피검시료 내의 테스토스테론의 농도가 높을수록 발색은 강하게 나타나고, 피검시료 내의 테스토스테론의 농도가 낮을수록 발색은 약하게 나타난다.Figure 1b is a case of using a lateral flow chip (lateral flow chip) in the form of a test strip, an excess of aptamer-gold nanoparticle conjugate and progesterone-HRP conjugate are placed on the lateral flow chip and a test sample containing testosterone Upon reaction, testosterone in the test sample replaces progesterone-HRP bound to the aptamer-gold nanoparticle conjugate, and progesterone-HRP separated from the aptamer-gold nanoparticle conjugate moves and reacts with the TMB substrate to develop color cause a reaction Therefore, unlike the reaction of FIG. 1A, a color reaction appears in proportion to the concentration of testosterone in the test sample. That is, the higher the concentration of testosterone in the test sample, the stronger the color development, and the lower the testosterone concentration in the test sample, the weaker the color.
테스토스테론 농도의 확인방법How to check testosterone concentration
도 2a는 본 발명의 일 실시예에 따른 테스토스테론 농도 확인방법의 공정흐름도를 나타낸 것이다.Figure 2a shows a process flow diagram of a testosterone concentration confirmation method according to an embodiment of the present invention.
도 2a을 참조하면, 우선 압타머-금 나노입자 컨쥬게이트에 프로게스테론-HRP를 혼합한다(S100).Referring to FIG. 2a , first, progesterone-HRP is mixed with the aptamer-gold nanoparticle conjugate (S100).
이 단계에서 압타머-금 나노입자 컨쥬게이트에 프로게스테론-HRP를 혼합하고 배양(incubate)한 후 원심분리하여 압타머-금 나노입자 컨쥬게이트와 프로게스테론-HRP의 결합체를 제조할 수 있다.In this step, the aptamer-gold nanoparticle conjugate is mixed with progesterone-HRP, incubated, and then centrifuged to prepare a conjugate of the aptamer-gold nanoparticle conjugate and progesterone-HRP.
금 나노입자는 입자의 크기가 1 ~ 100 nm 인 것으로, 본 발명의 기술분야에서 알려진 통상의 것을 사용할 수 있다.The gold nanoparticles have a particle size of 1 to 100 nm, and a conventional one known in the art may be used.
압타머는 압타머는 상기 금 나노입자에 특이적으로 결합하는 DNA 압타머로서, ARS-3 압타머를 사용하는 것이 바람직하고, 특히 affinity 해리상수(dissociation constant)가 5.7 nM 인 것이 더욱 바람직하다. As the aptamer, the aptamer is a DNA aptamer that specifically binds to the gold nanoparticles. It is preferable to use an ARS-3 aptamer, and more preferably, an affinity dissociation constant of 5.7 nM.
압타머-금 나노입자 컨쥬게이트와 프로게스테론-HRP의 제조는 상기 테스토스테론 검출용 바이오마커에 기재된 내용과 중복되므로 생략한다.The preparation of the aptamer-gold nanoparticle conjugate and progesterone-HRP overlaps with those described in the biomarker for testosterone detection, so it will be omitted.
다음, 상기 S100 에서 얻은 용액에 테스토스테론을 포함하는 피검시료를 첨가한다(S200).Next, a test sample containing testosterone is added to the solution obtained in S100 (S200).
과량의 압타머-금 나노입자 컨쥬게이트와 프로게스테론-HRP의 결합체를 포함하는 용액(S100 에서 얻은 용액)에 테스토스테론을 포함하는 피검시료를 첨가한다.A test sample containing testosterone is added to a solution (solution obtained in S100) containing an excess of aptamer-gold nanoparticle conjugate and progesterone-HRP conjugate.
피검시료에 포함된 테스토스테론의 압타머-금 나노입자 컨쥬게이트에 대한 결합력이 프로게스테론-HRP보다 크므로, 테스토스테론이 프로게스테론-HRP를 치환하고 프로게스테론-HRP은 압타머-금 나노입자 컨쥬게이트로부터 분리된다.Since the binding force of testosterone contained in the test sample to the aptamer-gold nanoparticle conjugate is greater than that of progesterone-HRP, testosterone replaces progesterone-HRP and progesterone-HRP is separated from the aptamer-gold nanoparticle conjugate.
이후, 마이크로 웰(도 1a)에서 수행하는 경우에는 치환된 프로게스테론-HRP을 세척하여 제거할 수 있고, 원심분리를 이용하여 치환된 프로게스테론-HRP를 세척할 수 있다. Thereafter, in the case of performing in a micro-well (FIG. 1a), the substituted progesterone-HRP may be removed by washing, and the substituted progesterone-HRP may be washed by centrifugation.
한편, 측방유동 칩(lateral flow chip)(도 1b)에서 수행하는 경우에는 치환된 프로게스테론-HRP이 분리되어 이동할 수 있다.On the other hand, when carried out in the lateral flow chip (lateral flow chip) (Fig. 1b), the substituted progesterone-HRP can be separated and moved.
다음, 상기 S200 에서 얻은 용액에 TMB 기질을 첨가한다(S300).Next, the TMB substrate is added to the solution obtained in S200 (S300).
S200 에서 얻은 용액 또는 물질에 TMB 기질을 첨가하면, TMB 기질은 HRP와 결합하여 황색으로 발색반응을 한다. When TMB substrate is added to the solution or material obtained in S200, the TMB substrate binds with HRP to develop a yellow color reaction.
마이크로 웰(도 1a)에서 수행하는 경우에는, TMB 기질은 S200에서 세척 후 압타머-금 나노입자에 남아 있는 프로게스테론-HRP와 반응하여 테스토스테론의 농도를 측정할 수 있다. 따라서, 피검시료 내의 테스토스테론의 농도가 높을수록 발색은 약하게 나타나고, 피검시료 내의 테스토스테론의 농도가 낮을수록 발색은 강하게 나타난다.In the case of performing in a microwell (FIG. 1a), the TMB substrate reacts with progesterone-HRP remaining in the aptamer-gold nanoparticles after washing at S200 to measure the concentration of testosterone. Therefore, the higher the concentration of testosterone in the test sample, the weaker the color development, and the lower the testosterone concentration in the test sample, the stronger the color.
측방유동 칩(lateral flow chip)(도 1b)에서 수행하는 경우, TMB 기질은 S200에서 압타머-금 나노입자에서 분리된 프로게스테론-HRP와 반응하여 테스토스테론의 농도를 측정할 수 있다. 따라서, 피검시료 내의 테스토스테론의 농도에 비례하여 발색반응이 나타난다. 즉, 피검시료 내의 테스토스테론의 농도가 높을수록 발색은 강하게 나타나고, 피검시료 내의 테스토스테론의 농도가 낮을수록 발색은 약하게 나타난다.When performed in a lateral flow chip (FIG. 1b), the TMB substrate reacts with aptamer-progesterone-HRP isolated from aptamer-gold nanoparticles at S200 to measure the concentration of testosterone. Therefore, the color reaction appears in proportion to the concentration of testosterone in the test sample. That is, the higher the concentration of testosterone in the test sample, the stronger the color development, and the lower the testosterone concentration in the test sample, the weaker the color.
다음, 상기 S300 에서 얻은 용액의 흡광도를 측정하여 테스토스테론의 농도를 확인한다(S400).Next, the absorbance of the solution obtained in S300 is measured to determine the concentration of testosterone (S400).
흡광도는 마이크로 플레이트 리더 등의 통상의 흡광도 측정기를 이용할 수 있고, S300 에서 얻은 용액의 흡광도를 측정한 후, 검정곡선과 비교하여 해당하는 테스토스테론의 농도를 확인할 수 있다.The absorbance can be measured using a conventional absorbance meter such as a microplate reader, and after measuring the absorbance of the solution obtained in S300, the corresponding testosterone concentration can be confirmed by comparing it with a calibration curve.
도 3은 마이크로 웰을 이용하고 피검시료 내의 테스토스테론의 농도를 달리하여 본 발명에 따른 테스토스테론 검출용 바이오마커와 이를 이용한 테스토스테론 농도의 확인방법을 이용하여 흡광도를 측정하여 작성한 검정곡선이다. 3 is a calibration curve prepared by measuring absorbance using a microwell and varying the concentration of testosterone in a test sample using the biomarker for testosterone detection according to the present invention and a method for confirming the testosterone concentration using the same.
도 3에 따르면, 본 발명에 따른 테스토스테론 검출용 바이오마커와 이를 이용한 테스토스테론 농도의 확인방법은 상기 테스토스테론의 검출 가능 농도는 500 pg/ml 내지 10 ㎍/ml 일 수 있다.According to FIG. 3 , in the biomarker for detecting testosterone and the method for determining the testosterone concentration using the same according to the present invention, the detectable concentration of testosterone may be 500 pg/ml to 10 μg/ml.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시하나, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다.Hereinafter, preferred examples are presented to help the understanding of the present invention, but the following examples are only illustrative of the present invention and the scope of the present invention is not limited to the following examples.
실시예Example
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시하나, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다.Hereinafter, preferred examples are presented to help the understanding of the present invention, but the following examples are only illustrative of the present invention and the scope of the present invention is not limited to the following examples.
실험 재료experimental material
금 나노입자: 제조에 필요한 유리기구들은 오염방지를 위해 질산과 염산을 1:3 비율로 혼합한 Aqua regia 용액으로 세척 후 건조한다. 38.8 mM trisodium citrate (Sigma-aldrich) 500 ul를 끓고 있는 1 mM HAuCl4 (Sigma aldrich) 10 ml에 혼합하고, 10분 동안 잘 저으면서 끓인다. 이후 가열을 중지하고15분 동안 용액의 색이 붉은색으로 변하도록 잘 교반한다. 혼합액을 실온으로 냉각 후 0.45um 필터를 이용하여 걸러주고, 걸러진 용액은 4 ℃에서 보관하여 제조하였다.Gold nanoparticles: Glassware required for manufacturing is washed with Aqua regia solution in a 1:3 ratio of nitric acid and hydrochloric acid to prevent contamination and then dried. 500 ul of 38.8 mM trisodium citrate (Sigma-aldrich) is mixed with 10 ml of boiling 1 mM HAuCl 4 (Sigma aldrich), and boil with stirring for 10 minutes. After that, stop heating and stir well for 15 minutes to change the color of the solution to red. After cooling the mixture to room temperature, it was filtered using a 0.45um filter, and the filtered solution was prepared by storing it at 4°C.
압타머: ARS-3 압터머(testosterone-specific aptamer with Affinity dissociation constant KD = 5.7 nM)를 사용하였고, 알려진 시퀀스에 따라 외부업체에서 합성 후 구매하여 사용되었으며(Bioneer, South Korea), 시퀀스는 서열번호 1로 나타내었고, 다음과 같다. 5'- GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTAAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCAGATAGTAAGCAATCT -3'Aptamer: ARS-3 aptamer (testosterone-specific aptamer with Affinity dissociation constant KD = 5.7 nM) was used, synthesized from an external company according to a known sequence, and then purchased and used (Bioneer, South Korea), and the sequence is SEQ ID NO: 1, and is as follows. 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTAAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCAGATAGTAAGCAATCT -3'
압타머-금 나노입자 컨쥬케이트: 금 나노 입자를 준비하고 UV-vis 분광기로 정량한 후, 금 나노입자와 BSA를 로테이터(rotator)에 넣고 10분간 배양하였다. 제조된 BSA-금 나노입자와 앵커 압타머를 인산완충액에서 NaCl과 함께 14시간 동안 배양하였다. 이를 원심분리하여 압타머-금 나노입자를 분리하고 인산나트륨완충액(sodium phosphate buffer)에 희석한 후 4 ℃에 보관하였다. Aptamer-gold nanoparticle conjugate: Gold nanoparticles were prepared and quantified by UV-vis spectroscopy, and gold nanoparticles and BSA were placed in a rotator and incubated for 10 minutes. The prepared BSA-gold nanoparticles and anchor aptamer were incubated with NaCl in phosphate buffer for 14 hours. The aptamer-gold nanoparticles were separated by centrifugation, diluted in sodium phosphate buffer, and stored at 4°C.
프로게스테론-HRP: 17-a-OH-P 5mg을 디메틸 포름 아미드 200mL 및 디옥산 200mL에 용해시켰다. 이 용액에 NHS 10mg 및 EDAC 20mg 를 포함하는 물 100ml를 첨가하였다; 반응 혼합물을 4 ℃에서 24 시간 동안 활성화시켰다. 활성화된 17-a-OH-P 용액을 HRP 수용액(1 mg/mL)에 첨가하고 4 ℃에서 24 시간 동안 배양하였다. 그 후, 반응 혼합물을 0.1 % 티메로살(thimerosal)을 함유하는 10mM PBS로 미리 평형화된 G-25 컬럼을 통과시켰다. 효소 활성을 포함하는 갈색의 분획물을 모으고 여기에 1 %의 수크로스, 황산 암모늄, BSA 및 동일한 부피의 에틸렌 글리콜을 첨가하였다. 용액은 분취량으로 -30 ℃에서 보관하였다.Progesterone-HRP: 5 mg of 17-a-OH-P was dissolved in 200 mL of dimethyl formamide and 200 mL of dioxane. To this solution was added 100 ml of water containing 10 mg of NHS and 20 mg of EDAC; The reaction mixture was activated at 4 °C for 24 h. The activated 17-a-OH-P solution was added to HRP aqueous solution (1 mg/mL) and incubated at 4° C. for 24 hours. The reaction mixture was then passed through a G-25 column pre-equilibrated with 10 mM PBS containing 0.1% thimerosal. The brown fractions containing the enzyme activity were collected and 1% sucrose, ammonium sulfate, BSA and an equal volume of ethylene glycol were added thereto. The solution was stored at -30 °C in aliquots.
TMB 기질: TMB 기질은 Thermo Scientific(USA)에서 구입하여 사용하였다.TMB substrate: TMB substrate was purchased from Thermo Scientific (USA) and used.
피검시료의 준비: 표준 테스토스테론 샘플을 얻기 위해, 구입한 테스토스테론을 메탄올에 희석하여 테스토스테론 용액(1 mg/mL)을 준비하였고, -20 ℃에 저장하였다.Preparation of test sample: To obtain a standard testosterone sample, a testosterone solution (1 mg/mL) was prepared by diluting purchased testosterone in methanol, and stored at -20 °C.
실험 방법experimental method
상기와 같이 제조된 압타머-금 나노입자 컨쥬케이트 용액과 프로게스테론-HRP 용액을 넣고 10분간 배양한 후, 12000 rpm에서 10분간 원심분리 하였다(1단계). 마이크로 웰에 1단계에서 제조된 압타머-금 나노입자 컨쥬케이트와 프로게스테론-HRP 결합체 용액을 과량으로 넣고, 다양한 농도의 테스토스테론을 포함한 피검시료를 첨가한 후, 실온에서 10분간 배양하였다(2단계). 2단계 용액을 12000 rpm에서 10분간 원심분리 하여 치환된 프로게스테론-HRP를 제거하였다(2a 단계). 이에 TMB 기질을 첨가하여 반응시키고, 스탑 용액(stop solution)을 첨가하였다(3단계). 최종 시료는 마이크로 플레이트 리더(SpectraMax, USA)를 이용하여 450 nm 에서 흡광도를 측정(4단계)하였다.The aptamer-gold nanoparticle conjugate solution and progesterone-HRP solution prepared as described above were added and incubated for 10 minutes, followed by centrifugation at 12000 rpm for 10 minutes (step 1). The aptamer-gold nanoparticle conjugate and progesterone-HRP conjugate solution prepared in
검정곡선(standard curve) 작성Creating a standard curve
테스토스테론 농도에 따른 흡광도 검정곡선(standard curve) 작성을 위하여, 테스토스테론 농도를 500 pg, 1 ng, 100 ng, 500 ng, 1 ㎍, 10 ㎍ 으로 하고, 상기 실험방법으로 수행하여, 그 검정곡선을 도 3으로 나타내었다.In order to prepare a standard curve for absorbance according to testosterone concentration, testosterone concentration was set to 500 pg, 1 ng, 100 ng, 500 ng, 1 μg, 10 μg, and the above experimental method was performed, and the calibration curve was drawn 3 is shown.
도 3에 따르면, 본 발명의 테스토스테론의 검출 가능 농도는 500 pg/ml ~ 10 ㎍/ml 인 것을 확인할 수 있다. According to FIG. 3 , it can be confirmed that the detectable concentration of testosterone of the present invention is 500 pg/ml to 10 μg/ml.
또한, 테스토스테론을 포함하는 피검시료를 본 발명의 테스토스테론 농도의 확인방법에 따라 흡광도를 측정하여 검정곡선에서 이에 해당하는 테스토스테론 농도를 확인할 수 있다.In addition, by measuring the absorbance of a test sample containing testosterone according to the method for determining the testosterone concentration of the present invention, the corresponding testosterone concentration can be confirmed from the calibration curve.
지금까지 본 발명에 따른 테스토스테론 검출용 바이오마커 및 테스토스테론 농도의 확인방법에 관한 구체적인 실시예에 관하여 설명하였으나, 본 발명의 범위에서 벗어나지 않는 한도 내에서는 여러 가지 실시 변형이 가능함은 자명하다.Specific examples of the testosterone detection biomarker and the testosterone concentration confirmation method according to the present invention have been described so far, but it is apparent that various implementation modifications are possible within the limits that do not depart from the scope of the present invention.
그러므로 본 발명의 범위는 설명된 실시예에 국한되어 정해져서는 안 되며, 후술하는 특허청구범위뿐만 아니라 이 특허청구범위와 균등한 것들에 의해 정해져야 한다.Therefore, the scope of the present invention should not be limited to the described embodiments, and should be defined by the following claims as well as the claims and equivalents.
즉, 전술된 실시예는 모든 면에서 예시적인 것이며, 한정적인 것이 아닌 것으로 이해되어야 하며, 본 발명의 범위는 상세한 설명보다는 후술될 특허청구범위에 의하여 나타내어지고, 그 특허청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.That is, the above-described embodiments are to be understood in all respects as illustrative and not restrictive, and the scope of the present invention is indicated by the claims to be described later rather than the detailed description, and the meaning and scope of the claims; All changes or modifications derived from the concept of equivalents thereof should be construed as being included in the scope of the present invention.
<서열목록의 설명><Description of Sequence Listing>
서열번호 1은 본 발명의 일 실시예로 사용된 압터머의 염기서열이다.SEQ ID NO: 1 is the base sequence of the aptermer used in an embodiment of the present invention.
<110> PARK, Seungkyung KHAN, Zeeshan A. BARAKAT, Emad <120> BIOMARKER FOR DETECTING AMYLOID BETA AND IDENTIFYING METHOD FOR CONCENTRATION OF AMYLOID BETA USING THE SAME <130> LNP200097 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> ARS-3 aptamer <400> 1 ggtaatacga ctcactatag ggagatacca gcttattcaa tttaagaaca accaacgtcg 60 ctccgggtac ttcttcatca gatagtaagc aatct 95 <110> PARK, Seungkyung KHAN, Zeeshan A. BARAKAT, Emad <120> BIOMARKER FOR DETECTING AMYLOID BETA AND IDENTIFYING METHOD FOR CONCENTRATION OF AMYLOID BETA USING THE SAME <130> LNP200097 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> ARS-3 aptamer <400> 1 ggtaatacga ctcactatag ggagatacca gcttattcaa tttaagaaca accaacgtcg 60 ctccgggtac ttcttcatca gatagtaagc aatct 95
Claims (5)
프로게스테론-HRP; 및
TMB 기질;을 포함하는,
테스토스테론 검출용 바이오마커.
aptamer-gold nanoparticle conjugates;
progesterone-HRP; and
TMB substrate; containing,
Biomarkers for testosterone detection.
상기 프로게스테론-HRP는 상기 압타머-금 나노입자에 결합하는 것을 특징으로 하는,
테스토스테론 검출용 바이오마커.
aptamer-gold nanoparticle conjugates; progesterone-HRP; and TMB substrate;
The progesterone-HRP is characterized in that binding to the aptamer-gold nanoparticles,
Biomarkers for testosterone detection.
상기 프로게스테론-HRP는 상기 압타머-금 나노입자에 결합하고,
테스토스테론은 압타머-금 나노입자에 결합한 프로게스테론-HRP를 치환하여 압타머-금 나노입자에 결합하는 것을 특징으로 하는,
테스토스테론 검출용 바이오마커.
aptamer-gold nanoparticle conjugates; progesterone-HRP; and TMB substrate;
The progesterone-HRP binds to the aptamer-gold nanoparticles,
Testosterone substitutes progesterone-HRP bound to aptamer-gold nanoparticles and binds to aptamer-gold nanoparticles,
Biomarkers for testosterone detection.
1단계의 용액에 테스토스테론을 포함하는 피검시료를 첨가하는 단계(2단계);
2단계에서 치환된 프로게스테론-HRP를 제거하는 단계(2a 단계);
2a 단계의 용액에 TMB 기질이 반응하는 단계(3단계); 및
3단계의 용액의 흡광도를 측정하여 테스토스테론의 농도를 확인하는 단계(4단계);를 포함하는 것을 특징으로 하는,
테스토스테론 농도의 확인방법.
mixing aptamer-gold nanoparticles with progesterone-HRP (step 1);
adding a test sample containing testosterone to the solution of step 1 (step 2);
removing the substituted progesterone-HRP in step 2 (step 2a);
A step of reacting the TMB substrate with the solution of step 2a (step 3); and
Checking the concentration of testosterone by measuring the absorbance of the solution in step 3 (step 4); characterized in that it comprises a,
A method for determining testosterone levels.
1단계의 용액에 테스토스테론을 포함하는 피검시료를 첨가하는 단계(2단계);
2단계에서 치환된 프로게스테론-HRP이 분리되는 단계(2b 단계);
2b 단계에서 분리된 프로게스테론-HRP에 TMB 기질이 반응하는 단계(3단계); 및
3단계의 용액의 흡광도를 측정하여 테스토스테론의 농도를 확인하는 단계(4단계);를 포함하는 것을 특징으로 하는,
테스토스테론 농도의 확인방법.
mixing aptamer-gold nanoparticles with progesterone-HRP (step 1);
adding a test sample containing testosterone to the solution of step 1 (step 2);
Separating the substituted progesterone-HRP in step 2 (step 2b);
a step of reacting the TMB substrate with the progesterone-HRP separated in step 2b (step 3); and
Checking the concentration of testosterone by measuring the absorbance of the solution in step 3 (step 4); characterized in that it comprises a,
A method for determining testosterone levels.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020200166214A KR102423082B1 (en) | 2020-12-02 | 2020-12-02 | Bioassay for detecting testosterone and identifying method for concentration of testosterone using the same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020200166214A KR102423082B1 (en) | 2020-12-02 | 2020-12-02 | Bioassay for detecting testosterone and identifying method for concentration of testosterone using the same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20220077362A true KR20220077362A (en) | 2022-06-09 |
KR102423082B1 KR102423082B1 (en) | 2022-07-21 |
Family
ID=81985906
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020200166214A KR102423082B1 (en) | 2020-12-02 | 2020-12-02 | Bioassay for detecting testosterone and identifying method for concentration of testosterone using the same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102423082B1 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20160086768A (en) * | 2015-01-09 | 2016-07-20 | 한양대학교 에리카산학협력단 | Reagent kit for detecting sex hormone and method of detecting sex hormone using the same |
KR20200037697A (en) * | 2018-10-01 | 2020-04-09 | 한국과학기술연구원 | Bio prove for detection of hormone and method of detecting target analyte thereof |
-
2020
- 2020-12-02 KR KR1020200166214A patent/KR102423082B1/en active IP Right Grant
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20160086768A (en) * | 2015-01-09 | 2016-07-20 | 한양대학교 에리카산학협력단 | Reagent kit for detecting sex hormone and method of detecting sex hormone using the same |
KR20200037697A (en) * | 2018-10-01 | 2020-04-09 | 한국과학기술연구원 | Bio prove for detection of hormone and method of detecting target analyte thereof |
KR102103550B1 (en) | 2018-10-01 | 2020-04-23 | 한국과학기술연구원 | Bio probe for detection of hormone and method of detecting target analyte thereof |
Non-Patent Citations (1)
Title |
---|
EGUILAZ, MARCOS et al., Biosensors and Bioelectronics, 2010, Vol. 26, pp 517-522. * |
Also Published As
Publication number | Publication date |
---|---|
KR102423082B1 (en) | 2022-07-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Seth et al. | A simple radioimmunoassay for plasma cortisol | |
CN105181694B (en) | Carcinoembryonic antigen latex enhanced immunoturbidimetry kit | |
Fu et al. | The fabrication of magnetic particle-based chemiluminescence immunoassay for human epididymis protein-4 detection in ovarian cancer | |
Kohen et al. | An assay for urinary estriol-16α-glucuronide based on antibody-enhanced chemiluminescence | |
CN109633180A (en) | A kind of free testosterone chemiluminescence detection kit and preparation method thereof | |
CN109239367A (en) | Measure the method and kit of small molecule compound | |
CN113092786B (en) | Buffer solution and application thereof in central nervous system specific protein detection kit | |
CN111089958A (en) | P16 based on glucan signal amplificationINK4aChemiluminescence kit | |
CN111289758B (en) | Kit for quantitative detection of H-FABP and method for quantitative detection of H-FABP | |
CN112162101A (en) | Kit for detecting biomarkers of Alzheimer's disease and detection method thereof | |
CN116953248A (en) | Kit for measuring beta-amyloid (1-42) in human serum/plasma by magnetic particle chemiluminescence method | |
KR102423082B1 (en) | Bioassay for detecting testosterone and identifying method for concentration of testosterone using the same | |
CN110850085A (en) | Abnormal prothrombin chemiluminescence immunoassay kit and preparation method thereof | |
CN112683885B (en) | 5-methyltetrahydrofolate chemiluminescence detection kit and preparation method thereof | |
Xu et al. | Diagnostic value of total testosterone and free androgen index measured by LC–MS/MS for PCOS and insulin resistance | |
JP6934587B2 (en) | Method for measuring steroid hormones in samples | |
JP3194585B2 (en) | Two-site immunoassay for antibodies with chemiluminescent label and biotin-binding ligand | |
CN109180768B (en) | Estrone derivative, immunogen, antibody, enzyme-labeled conjugate, detection reagent and preparation method thereof | |
EP3480601B1 (en) | Inhibin b chemiluminescent immunoassay kit and preparation method therefor | |
CN111521832A (en) | Kit for determining 25-hydroxy-vitamin D | |
CN111024940B (en) | Time-resolved fluorescence immunoassay method based on gold magnetic particles | |
KR102103550B1 (en) | Bio probe for detection of hormone and method of detecting target analyte thereof | |
Lee et al. | Non-invasive molecular barcode assay for diagnosis of sex hormones correlated with precocious puberty | |
JP2022054122A (en) | Ferritin measurement reagent | |
CN112462075A (en) | Alkaline phosphatase-labeled AMH antibody conjugate and preparation method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E701 | Decision to grant or registration of patent right |