KR20220076658A - Antibodies specifically binding to aimp2 monomer and/or aimp2 aggregate - Google Patents

Abstract

The present invention relates to antibodies that specifically bind to AIMP2 and/or AIMP2 aggregate, wherein the antibody or fragment having immunological activity thereof produced in the 5B2 clone and 6C7 clone of the present invention binds specifically to the AIMP2 aggregate, , 3C2 clones and 7H9 clones produced antibodies or fragments having immunological activity thereof specifically bind to the normal structure of the AIMP2 monomer, and antibodies produced in 13H9 clones or fragments having immunological activity thereof are AIMP2 aggregates and normal Since it specifically binds to all of the AIMP2 monomers in the structure, it can be usefully utilized for diagnosis and treatment of diseases related to AIMP2 or AIMP2 aggregates, in particular, neurodegenerative diseases.

Description

Antibodies that specifically bind AIMP2 and/or AIMP2 aggregates {ANTIBODIES SPECIFICALLY BINDING TO AIMP2 MONOMER AND/OR AIMP2 AGGREGATE}

The present invention relates to antibodies that specifically bind to AIMP2 and/or AIMP2 aggregates.

Neurodegenerative brain diseases have characteristic denatured protein aggregates as the main lesion. That is, in the case of Parkinson's disease and Lewy body dementia disease, the Lewy body composed of denatured α-synuclein is represented as the main lesion, and in the case of Alzheimer's dementia, the neurofibrillar bundle composed of degenerated tau is the main lesion. indicates.

Dementia is a representative chronic progressive degenerative brain disease, which is defined as a complex of symptoms that affects both mental, cognitive and social behavioral abilities, leading to disturbances in normal daily life. , is emerging as a serious social and economical health issue for the elderly. Depending on the cause, dementia is classified into Alzheimer's disease, in which cognitive function is weakened without a clear cause, vascular dementia caused by cerebrovascular diseases such as recurrent cerebral infarction, and dementia caused by other diseases. It is known that 50-60% of all dementia patients are caused by Alzheimer's disease (as of 2014). In general, Alzheimer's disease patients show clinically distinct impairments in intellectual ability, emotional and behavioral changes, etc., and then show signs of serious cortical dysfunction such as loss of direction, memory impairment, and aphasia (Kumar V et al., Robbins and Cotran Pathologic Basis of Disease, Elsevier Saunders, 7th, 2004).

Alzheimer's disease (Alzheimer's disease) accounts for about 70% of all dementia patients (as of 2007) and occurs in 6% of the population over 65 years of age. As the main cause of cerebrovascular dementia is infarction caused by arteriosclerosis, symptoms can be improved by treatment with thrombolytic drugs, etc. However, Alzheimer's disease rarely shows prognostic signs before the age of 50, but the prevalence usually increases with age. It is a typical degenerative brain disease that worsens as brain cells are gradually destroyed. The final diagnosis of this disease is only possible through pathological examination through post-mortem autopsy. Medical Association, Neuropsychiatry, 2nd, JoongAng Munhwasa, 2007), although many researchers are actively researching it, the cause of the disease has not been fully elucidated so far. However, according to the research results so far, Alzheimer's disease is pathologically characterized by brain atrophy in the cerebral cortex or hippocampus and deposition of senile plaques or neurofibrillary tangles in the brain (Selkoe). DJ., Alzheimer's disease: Genes, proteins, and therapy, Physiol. Rev., 81, pp.741-766, 2001) It accumulates inside, and then the tau protein is aggregated in the nerve cells, resulting in synaptic damage, ultimately causing nerve dysfunction and brain cell death. (Dawbarn D et al., Neurobiology of Alzheimer's Disease, 2nd, Oxford Univ, Press, 2001; Kwangwoo Lee, Neuroscience, Beommunsa, 2005).

Parkinson's disease (PD) is the second most common age-related disease after senile dementia among neurodegenerative diseases. The number of patients is rapidly increasing. The elderly population in Korea is rapidly increasing, and the number of Parkinson's disease patients is also increasing continuously. Although the exact cause of Parkinson's disease is not yet known, it has been reported that a complex action of genetic factors and environmental factors causes Parkinson's disease. In this disease, motor function disorders such as hand tremor, rigidity syndrome, slow mobility, and postural instability appear, and emotional disorders such as emotional instability and fear are accompanied. The development of the disease is gradual, and pathologically, severe degeneration (about 70-80%) of dopaminergic neurons in the substantia nigra of the brain is observed. In these cells, lesions with abnormal deposition of proteins called Lewy bodies, which are α-synuclein aggregate lesions, are expressed, but in addition to these, several sub-type lesions such as co-expressing aggregate lesions (Tau aggregate lesions, Amyloid plaque lesions) appear. It can be divided into subtypes. That is, the development of additional diagnostic markers that can appropriately classify the subtypes of Parkinson's disease in which various complex lesions appear is necessary for precise treatment tailored to the patient.

AIMP2 (Aminoacyl-tRNA synthetase complex interacting multifunctional protein-2) is a substrate protein of E3 ligase Parkin, a recessive gene for Parkinson's disease, and has been reported to be present in Lewy body inclusions in the substantia nigra of Parkinson's patients ( Corti O, et al. The p38 subunit of the aminoacyl-tRNA synthetase complex is a Parkin substrate: linking protein biosynthesis and neurodegeneration. Hum Mol Genet. 2003; 12:1427-1437). AIMP2 is a substrate of pathogenic parkin that accumulates in Parkinson's disease, and the level of AIMP2 is increased in the ventral midbrain of Parkin ^-/- mice, and the level of AIMP2 is increased in the postmortem brain of patients with Parkin mutation or sporadic Parkinson's disease. rises In addition, the accumulation and structural denaturation of AIMP2 triggers AIMP2 aggregation, and in the previous study, it was confirmed that AIMP2 was expressed in Lewy bodies containing α-synuclein as the main component in the brain of an actual Parkinson's patient. It has been reported that Klein promotes aggregation and affects the expression of Lewy bodies in Parkinson's disease. In the case of α-synuclein, Tau and amyloid β, which are neurodegenerative disease-linked proteins, antibodies that can specifically recognize normal and aggregate forms have been developed, and diagnostic differentiation of basic, translational research and clinical brain tissue However, in the case of AIMP2, which has been recently identified as having an important function in Parkinson's disease, there are no antibodies or research results that can distinguish the normal form from the aggregate form.

Currently commercial AIMP2 antibodies do not recognize AIMP2 aggregates. In particular, since the AIMP2 antibody of Proteintech Group, which is currently the most used, is a rabbit polyclonal antibody, it is difficult to ensure consistent quality of the product, and antibody recombination technology is not used. There has been a problem that it is difficult to apply to clinical treatment because it is impossible to manufacture humanized antibodies through the

It is an object of the present invention to provide an antibody specific for AIMP2 or a fragment having immunological activity thereof.

It is also an object of the present invention to provide an isolated nucleic acid molecule encoding the antibody or fragment having immunological activity thereof, a vector comprising the same, and a host cell transformed with the vector.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating neurodegenerative diseases.

Another object of the present invention is to provide a composition for diagnosing neurodegenerative diseases.

Another object of the present invention is to provide a kit for diagnosing neurodegenerative diseases.

Another object of the present invention is to provide an information providing method for diagnosing a neurodegenerative disease.

Another object of the present invention is to provide a method for screening a substance that inhibits or inhibits the formation of AIMP2 aggregates.

In addition, it is an object of the present invention to provide a screening method for a therapeutic agent for a neurodegenerative disease.

In order to solve the above problems, the present invention provides an antibody or fragment having immunological activity specific for AIMP2.

In addition, the present invention provides an isolated nucleic acid molecule encoding the antibody or fragment having immunological activity thereof, a vector comprising the same, and a host cell transformed with the vector.

In addition, the present invention provides a pharmaceutical composition for preventing or treating a neurodegenerative disease comprising an antibody specific for AIMP2 or a fragment having immunological activity thereof.

In addition, the present invention provides a composition for diagnosing a neurodegenerative disease comprising an antibody specific to AIMP2 or a fragment having immunological activity thereof.

In addition, the present invention provides a neurodegenerative disease diagnosis kit comprising the composition.

In addition, the present invention provides an information providing method for diagnosing a neurodegenerative disease.

In addition, the present invention provides a method for screening a substance that inhibits or inhibits the formation of AIMP2 aggregates.

In addition, the present invention provides a screening method for a therapeutic agent for a neurodegenerative disease.

According to the present invention, the antibody or fragment having immunological activity thereof produced from the 5B2 clone and the 6C7 clone of the present invention binds specifically to the AIMP2 aggregate, and the antibody produced from the 3C2 clone and the 7H9 clone or its immunological activity The fragment having the normal structure specifically binds to the AIMP2 monomer of the normal structure, and the antibody or fragment having immunological activity thereof produced in the 13H9 clone specifically binds to both the AIMP2 aggregate and the normal structure of the AIMP2 monomer, so AIMP2 or AIMP2 aggregate It can be usefully used for diagnosis and treatment of related diseases, in particular, neurodegenerative diseases.

1 is a diagram illustrating the production and verification of an AIMP2 aggregate antigen:
A: Western blot analysis results for GST-AIMP2 recombinant protein (0) and GST-AIMP2 aggregate (7) obtained through aggregation reaction for 7 days;
B: Analysis of amyloid structure through Thioflavin T fluorescence analysis of recombinant proteins, GST-AIMP2 (GST-AIMP2 monomer) and GST-AIMP2 aggregate (GST-AIMP2 fibril) of normal structure; and
C: Coomassie blue staining results of GST-AIMP2 aggregate antigen (1: BSA, 2: size marker and 3: GST-AIMP2 aggregate).
2 is a diagram showing the results of isotype analysis of a single antibody clone specific for each type of AIMP2 aggregation:
A: 8 antibody-producing clones that bind AIMP2 monomers and/or AIMP2 aggregates; and
B: Results of antibody isotype analysis for 8 clones.
3 is a diagram showing the results of analyzing the reactivity of the AIMP2 antibody clone to the AIMP2 normal structure (monomer) and the aggregate structure:
A: Results of dot blot analysis of antibodies purified from 8 clones; and
B: Western blot analysis results of antibodies purified from 8 types of clones.
4 is a table summarizing the AIMP2 conformation-specific reactivity of eight AIMP2 antibody clones.
5 is a diagram showing the results of sequence analysis of antibodies produced in AIMP2 monomer conformation-specific antibody clones (5B2 and 6C7):
Yellow green: CDH1, CDH2 and CDH3 amino acid sequences;
Blue: CDRL1, CDRL2 and CDRL3 amino acid sequences;
Gray: N-terminal amino acid sequence other than the amino acid sequence analyzed by Igblast;
Gray and underlined: constant regions within the amino acid sequences of the complete heavy and light chains from humanized chimeric antibody production; and
Red squares: regions of amino acid sequence differences between the antibodies of the two clones.
6 is a diagram showing the results of sequencing of antibodies produced in AIMP2 aggregate conformation-specific antibody clones (3C2 and 7H9):
Yellow green: CDH1, CDH2 and CDH3 amino acid sequences;
Blue: CDRL1, CDRL2 and CDRL3 amino acid sequences;
Gray: N-terminal amino acid sequence other than the amino acid sequence analyzed by Igblast;
Gray and underlined: constant regions within the amino acid sequences of the complete heavy and light chains of humanized chimeric antibody production; and
Red squares: regions of amino acid sequence differences between the antibodies of the two clones.
7 is a diagram showing the results of sequencing of the antibody produced from the antibody clone (13H9) that binds to both the AIMP2 monomer and the aggregate conformation:
Yellow green: CDH1, CDH2 and CDH3 amino acid sequences;
Blue: CDRL1, CDRL2 and CDRL3 amino acid sequences;
Gray: N-terminal amino acid sequence other than the amino acid sequence analyzed by Igblast; and
Gray and underlined: constant regions within the amino acid sequences of the complete heavy and light chains from humanized chimeric antibody production.

Hereinafter, the present invention will be described in detail by way of embodiments of the present invention with reference to the accompanying drawings. However, the following embodiments are presented as examples for the present invention, and when it is determined that detailed descriptions of well-known techniques or configurations known to those skilled in the art may unnecessarily obscure the gist of the present invention, the detailed description may be omitted, and , the present invention is not limited thereby. Various modifications and applications of the present invention are possible within the scope of equivalents interpreted therefrom and the description of the claims to be described later.

In addition, the terms used in this specification are terms used to properly express the preferred embodiment of the present invention, which may vary according to the intention of a user or operator or customs in the field to which the present invention belongs. Accordingly, definitions of these terms should be made based on the content throughout this specification. Throughout the specification, when a part "includes" a certain element, it means that other elements may be further included, rather than excluding other elements, unless otherwise stated.

As used herein, the term "step for" or "step for" does not mean "step for".

All technical terms used in the present invention, unless otherwise defined, have the same meaning as commonly understood by one of ordinary skill in the art of the present invention. In addition, although preferred methods and samples are described herein, similar or equivalent ones are also included in the scope of the present invention. The contents of all publications herein incorporated by reference are incorporated herein by reference.

Throughout this specification, common one-letter and three-letter codes for naturally occurring amino acids are used as well as generally accepted for other amino acids such as Aib (α-aminoisobutyric acid), Sar (N-methylglycine), etc. A three-character code is used. Amino acids referred to by abbreviation in the present invention are also described according to the IUPAC-IUB nomenclature as follows:

Alanine: A, Arginine: R, Asparagine: N, Aspartic Acid: D, Cysteine: C, Glutamic Acid: E, Glutamine: Q, Glycine: G, Histidine: H, Isoleucine: I, Leucine: L, Lysine: K, Methionine : M, phenylalanine: F, proline: P, serine: S, threonine: T, tryptophan: W, tyrosine: Y and valine: V.

In one aspect, the present invention relates to an antibody specific for AIMP2 or a fragment having immunological activity thereof.

In one embodiment, the AIMP2 specific antibody may be a monoclonal antibody or a humanized antibody.

In one embodiment, the antibody or fragment having immunological activity specific for AIMP2 is CDRH (Complementarity determining regions Heavy chain) 1 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 1 to 3, the sequence A VH domain comprising a CDRH2 comprising any one selected from the group consisting of an amino acid sequence of SEQ ID NOs: 4 to 6, and a CDRH3 comprising any one selected from the group consisting of an amino acid sequence of SEQ ID NOs: 7 to 9. have.

In one embodiment, the AIMP2 specific antibody or fragment having immunological activity thereof is FR1 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 20 to 22, the amino acid sequence of SEQ ID NOs: 23 to 25 VH comprising FR2 comprising any one selected from the group consisting of, FR3 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 26 to 28, and FR4 comprising the amino acid sequence of SEQ ID NOs: 29 or 30 It can contain domains.

In one embodiment, the AIMP2 specific antibody or fragment having immunological activity thereof is CDRL1 comprising any one selected from the group consisting of amino acid sequences of SEQ ID NOs: 10 to 13, amino acid sequences of SEQ ID NOs: 14 to 16 It may include a VL domain comprising CDRL2 comprising any one selected from the group consisting of, and CDRL3 comprising any one selected from the group consisting of amino acid sequences of SEQ ID NOs: 17 to 19.

In one embodiment, the AIMP2 specific antibody or fragment having immunological activity thereof is FR1 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 31 to 33, the amino acid sequence of SEQ ID NOs: 34 to 37 FR2 containing any one selected from the group consisting of, FR3 containing any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 38 to 42, and any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 43 to 45 a VL domain comprising FR4 comprising

In one embodiment, the AIMP2 specific antibody or fragment having immunological activity thereof is a VH domain comprising any one selected from the group consisting of amino acid sequences of SEQ ID NOs: 46 to 49; And it may include a VL domain comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 50 to 54.

In one embodiment, the AIMP2 specific antibody or fragment having immunological activity thereof includes a heavy chain comprising any one selected from the group consisting of amino acid sequences of SEQ ID NOs: 55 to 58; And it may include a light chain comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 59 to 63.

In one embodiment, AIMP2 may be an AIMP2 monomer or an AIMP2 aggregate.

In one embodiment, the antibody or fragment having immunological activity specific for AIMP2 monomer is: CDRH1 comprising the amino acid sequence of SEQ ID NO:2, CDRH2 comprising the amino acid sequence of SEQ ID NO:5, and the amino acid sequence of SEQ ID NO:8 a VH domain comprising CDRH3 comprising; and a V domain comprising a VL domain comprising a CDRL1 comprising the amino acid sequence of SEQ ID NO: 11 or 12, a CDRL2 comprising the amino acid sequence of SEQ ID NO: 15, and a CDRL3 comprising the amino acid sequence of SEQ ID NO: 18 and a VH domain comprising the amino acid sequence of SEQ ID NO: 47 or 48; and a VL domain comprising the amino acid sequence of SEQ ID NO: 52 or 53, and a heavy chain comprising the amino acid sequence of SEQ ID NO: 56 or 57; and a light chain comprising the amino acid sequence of SEQ ID NO: 61 or 62.

In one embodiment, the antibody or fragment having immunological activity specific for the AIMP2 monomer is an antibody produced from a 3C2 clone comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 56 and a light chain comprising the amino acid sequence of SEQ ID NO: 61 or a fragment having immunological activity thereof; Alternatively, it may be an antibody or a fragment having immunological activity thereof produced from the 7H9 clone comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 57 and a light chain comprising the amino acid sequence of SEQ ID NO: 62.

In one embodiment, the antibody or fragment having immunological activity specific for an AIMP2 aggregate comprises: a CDRH1 comprising the amino acid sequence of SEQ ID NO: 1, a CDRH2 comprising the amino acid sequence of SEQ ID NO: 4, and an amino acid sequence of SEQ ID NO: 7 a VH domain comprising CDRH3 comprising; and a V domain comprising a VL domain comprising a CDRL1 comprising the amino acid sequence of SEQ ID NO: 10, a CDRL2 comprising the amino acid sequence of SEQ ID NO: 14, and a CDRL3 comprising the amino acid sequence of SEQ ID NO: 17, a VH domain comprising the amino acid sequence of SEQ ID NO:46; and a VL domain comprising the amino acid sequence of SEQ ID NO: 50 or 51, and a heavy chain comprising the amino acid sequence of SEQ ID NO: 55; and a light chain comprising the amino acid sequence of SEQ ID NO: 59 or 60.

In one embodiment, the antibody or fragment having immunological activity specific for the AIMP2 monomer is an antibody produced in clone 5B2 comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 55 and a light chain comprising the amino acid sequence of SEQ ID NO: 59 or a fragment having immunological activity thereof; Alternatively, it may be an antibody or fragment having immunological activity thereof produced from a 6C7 clone comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 55 and a light chain comprising the amino acid sequence of SEQ ID NO: 60.

In one embodiment, the antibody or fragment having immunological activity specific for the AIMP2 monomer and AIMP2 aggregate-specific antibody or fragment having immunological activity thereof is: CDRH1 comprising the amino acid sequence of SEQ ID NO:3, SEQ ID NO:6 a VH domain comprising a CDRH2 comprising the amino acid sequence of SEQ ID NO: 9 and a CDRH3 comprising the amino acid sequence of SEQ ID NO: 9; and a V domain comprising a VL domain comprising a CDRL1 comprising the amino acid sequence of SEQ ID NO: 13, a CDRL2 comprising the amino acid sequence of SEQ ID NO: 16, and a CDRL3 comprising the amino acid sequence of SEQ ID NO: 19, a VH domain comprising the amino acid sequence of SEQ ID NO: 49; and a VL domain comprising the amino acid sequence of SEQ ID NO: 54, and a heavy chain comprising the amino acid sequence of SEQ ID NO: 58; And it may be an antibody or a fragment having immunological activity thereof produced in the 13H9 clone comprising a light chain comprising the amino acid sequence of SEQ ID NO: 63.

In one embodiment, the fragment having immunological activity of the antibody specific for AIMP2 is Fab, Fd, Fab', dAb, F(ab'), F(ab') ₂ , scFv (single chain fragment variable), Fv , single-chain antibodies, Fv dimers, complementarity determining region fragments, humanized antibodies, chimeric antibodies, and diabodies may be any one selected from the group consisting of.

The antibody is not only in the form of a whole antibody, but also includes functional fragments of antibody molecules. The whole antibody has a structure having two full-length light chains and two full-length heavy chains, and each light chain is connected to the heavy chain by a disulfide bond. A functional fragment of an antibody molecule refers to a fragment having an antigen-binding function, and examples of antibody fragments include (i) a light chain variable region (VL), a heavy chain variable region (VH), and a light chain constant region (CL) and a Fab fragment consisting of the first constant region of the heavy chain (CH1); (ii) an Fd fragment consisting of the VH and CH1 domains; (iii) an Fv fragment consisting of the VL and VH domains of a single antibody; (iv) a dAb fragment consisting of the VH domain (Ward ES et al., Nature 341:544-546 (1989)); (v) an isolated CDR region; (vi) a bivalent fragment comprising two linked Fab fragments F(ab')2 fragments: (vii) single chain Fv molecules (scFv) joined by a peptide linker joining the VH and VL domains to form an antigen binding site (viii) bispecific single chain Fv dimers (PCT/US92/09965) and (ix) diabody WO94/13804, which is a multivalent or multispecific fragment produced by gene fusion), and the like.

The antibody or fragment having immunological activity thereof of the present invention may be selected from the group consisting of an animal-derived antibody, a chimeric antibody, a humanized antibody, a human antibody, and a fragment having immunological activity thereof. The antibody may be recombinantly or synthetically produced.

An animal-derived antibody produced by immunizing an animal to be immunized with a desired antigen may cause an immune rejection reaction when administered to a human for therapeutic purposes. A chimeric antibody is obtained by substituting the constant region of an animal-derived antibody that causes an anti-isotype reaction with that of a human antibody using a genetic engineering method. Chimeric antibodies have significantly improved anti-isotype response compared to animal-derived antibodies, but animal-derived amino acids are still present in the variable region, resulting in potential anti-idiotypic side effects. are doing A humanized antibody was developed to improve these side effects. This is produced by grafting complementarity determining regions (CDR) regions that play an important role in antigen binding among the variable regions of a chimeric antibody into a human antibody framework.

The most important thing in the CDR grafting technology for producing a humanized antibody is to select an optimized human antibody that can best accept the CDR region of an animal-derived antibody. structure analysis, molecular modeling technology, etc. are used. However, even when the CDR regions of an animal-derived antibody are transplanted into the optimized human antibody framework, there are cases in which amino acids that affect antigen binding are present while located in the framework of the animal-derived antibody, so that antigen-binding ability is not preserved in many cases. Therefore, it can be said that the application of additional antibody engineering technology to restore antigen binding force is essential.

The antibody or fragment having immunological activity thereof may be isolated from the living body (not present in the living body) or may be non-naturally occurring, for example, synthetically or recombinantly produced. can

As used herein, the term “antibody” refers to a substance produced by stimulation of an antigen in the immune system, the type of which is not particularly limited, and can be obtained naturally or non-naturally (eg, synthetically or recombinantly). can Antibodies are advantageous for mass expression and production because they are very stable and have a long half-life not only in vitro but also in vivo. In addition, since the antibody essentially has a dimer structure, the adhesion (avidity) is very high. A complete antibody has a structure having two full-length light chains and two full-length heavy chains, and each light chain is linked to a heavy chain by a disulfide bond. The constant region of an antibody is divided into a heavy chain constant region and a light chain constant region, and the heavy chain constant region has gamma (γ), mu (μ), alpha (α), delta (δ) and epsilon (ε) types, subclasses gamma 1 (γ1), gamma 2 (γ2), gamma 3 (γ3), gamma 4 (γ4), alpha 1 (α1) and alpha 2 (α2). The constant region of the light chain has the kappa (κ) and lambda (λ) types.

As used herein, the term "heavy chain" refers to a variable region domain V _H and three constant region domains C _H1 , C _H2 and C _H3 comprising an amino acid sequence having a variable region sequence sufficient to confer specificity to an antigen. and a full-length heavy chain including a hinge and a fragment thereof. In addition, the term "light chain" refers to both full-length light chains and fragments thereof comprising a variable region domain _VL and a constant region domain _CL comprising an amino acid sequence having sufficient variable region sequence to confer specificity to an antigen. interpreted as including

As used herein, the term "variable region or variable domain" refers to a portion of an antibody molecule that exhibits many variations in sequence while performing a function of specifically binding to an antigen, and the variable region has complementarity There are determining regions CDR1, CDR2 and CDR3. Between the CDRs, a framework region (FR) portion exists to support the CDR ring. The "complementarity determining region" is a ring-shaped region involved in antigen recognition, and the specificity of the antibody for the antigen is determined as the sequence of this region changes.

As used herein, the term "scFv (single chain fragment variable)" refers to a single-chain antibody made by expressing only the variable region of an antibody through genetic recombination, and a single-chain form in which the VH region and the VL region of the antibody are connected by a short peptide chain. refers to the antibody of The term “scFv” is intended to include scFv fragments, including antigen-binding fragments, unless otherwise indicated or understood otherwise by context. This is obvious to those skilled in the art.

As used herein, the term "complementarity determining region (CDR)" refers to the amino acid sequence of the hypervariable region of the heavy chain and light chain of an immunoglobulin. The heavy and light chains may each comprise three CDRs (CDRH1, CDRH2, CDRH3 and CDRL1, CDRL2, CDRL3). The CDRs may provide key contact residues for the binding of an antibody to an antigen or epitope.

In the present invention, the terms "specifically binding" or "specifically recognized" have the same meaning as commonly known to those skilled in the art, and mean that an antigen and an antibody specifically interact to undergo an immunological reaction. .

As used herein, the term “antigen-binding fragment” refers to a fragment of the entire immunoglobulin structure, and refers to a portion of a polypeptide including an antigen-binding portion. For example, it may be scFv, (scFv) 2 , scFv-Fc, Fab, Fab' or F(ab') 2 , but is not limited thereto. Among the antigen-binding fragments, Fab has a structure having a light chain and heavy chain variable regions, a light chain constant region and a heavy chain first constant region (C _H1 ), and has one antigen-binding site. Fab' differs from Fab in that it has a hinge region comprising one or more cysteine residues at the C-terminus of the heavy chain C _H1 domain. The F(ab') 2 antibody is produced by forming a disulfide bond with a cysteine residue in the hinge region of Fab'. Fv is a minimal antibody fragment having only a heavy chain variable region and a light chain variable region, and a recombinant technique for generating an Fv fragment is well known in the art. In a double-chain Fv (two-chain Fv), the heavy chain variable region and the light chain variable region are linked by a non-covalent bond, and in single-chain Fv (single-chain Fv), the heavy chain variable region and the single chain variable region are generally shared through a peptide linker. Since they are linked by a bond or are linked directly at the C-terminus, they can form a dimer-like structure like a double-stranded Fv. The linker may be a peptide linker consisting of any amino acids from 1 to 100 or 2 to 50 amino acids, and an appropriate sequence is known in the art. The antigen-binding fragment can be obtained using a proteolytic enzyme (for example, Fab can be obtained by restriction digestion of the entire antibody with papain, and F(ab') 2 fragment can be obtained by digestion with pepsin), It can be produced through genetic recombination technology.

In the present invention, the term "hinge region" is a region included in the heavy chain of an antibody, which exists between the C _H1 and C _H2 regions, and functions to provide flexibility of the antigen-binding site in the antibody. means area. For example, the hinge may be derived from a human antibody, and specifically, may be derived from IgA, IgE, or IgG, such as IgG1, IgG2, IgG3 or IgG4.

In one aspect, the invention relates to an isolated nucleic acid molecule encoding an antibody of the invention or an immunologically active fragment thereof, a vector comprising the same, and a host cell transformed therewith.

The nucleic acid molecules of the present invention may be isolated or recombinant, and include single-stranded and double-stranded forms of DNA and RNA as well as corresponding complementary sequences. An isolated nucleic acid is a nucleic acid that has been separated from surrounding genetic sequences present in the genome of the individual from which the nucleic acid was isolated, in the case of a nucleic acid isolated from a naturally occurring source. In the case of a nucleic acid synthesized enzymatically or chemically from a template, such as a PCR product, a cDNA molecule, or an oligonucleotide, a nucleic acid resulting from such a procedure can be understood as an isolated nucleic acid molecule. An isolated nucleic acid molecule refers to a nucleic acid molecule in the form of separate fragments or as a component of a larger nucleic acid construct. Nucleic acids are operably linked when placed into a functional relationship with another nucleic acid sequence. For example, the DNA of the presequence or secretion leader is operably linked to the DNA of the polypeptide when expressed as a preprotein in the form before the polypeptide is secreted, and the promoter or enhancer is the polypeptide sequence is operably linked to a coding sequence when it affects the transcription of, or a ribosome binding site is operably linked to a coding sequence when positioned to facilitate translation. In general, operably linked means that the DNA sequences to be linked are located contiguously, and in the case of a secretory leader, they are contiguous and in the same reading frame. However, enhancers need not be located adjacent to each other. Linkage is achieved by ligation at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers are used according to conventional methods.

The isolated nucleic acid molecule encoding the antibody or immunologically active fragment of the present invention is expressed from the coding region due to codon degeneracy or in consideration of codons preferred in the organism in which the antibody is to be expressed. Various modifications may be made to the coding region within the range that does not change the amino acid sequence of the antibody, and various modifications or modifications may be made within the range that does not affect the expression of the gene even in parts other than the coding region, such modifications It will be well understood by those skilled in the art that genes are also included within the scope of the present invention. That is, as long as the nucleic acid molecule of the present invention encodes a protein having an equivalent activity, one or more nucleic acid bases may be mutated by substitution, deletion, insertion, or a combination thereof, and these are also included in the scope of the present invention. The sequence of such a nucleic acid molecule may be single-stranded or double-stranded, and may be a DNA molecule or an RNA (mRNA) molecule.

An isolated nucleic acid molecule encoding an antibody of the present invention or an immunologically active fragment thereof according to the present invention can be inserted into an expression vector for protein expression. Expression vectors usually contain a protein operably linked, ie, placed in a functional relationship, with regulatory or regulatory sequences, selectable markers, optional fusion partners, and/or additional elements. In appropriate conditions, the present invention by a method for inducing protein expression by culturing a host cell transformed with a nucleic acid, preferably an expression vector containing an isolated nucleic acid molecule encoding an antibody of the present invention or an immunologically active fragment thereof Antibodies of the invention or fragments having immunological activity thereof can be produced. A variety of suitable host cells can be used, including, but not limited to, mammalian cells, bacteria, insect cells, and yeast. Methods for introducing an exogenous nucleic acid into a host cell are known in the art and will vary depending on the host cell used. Preferably, E. coli, which has a high industrial use value due to low production cost, can be produced as a host cell.

The vector of the present invention includes, but is not limited to, a plasmid vector, a cosmid vector, a bacteriophage vector, and a viral vector. Suitable vectors include a signal sequence or leader sequence for membrane targeting or secretion in addition to expression control elements such as promoter, operator, start codon, stop codon, polyadenylation signal and enhancer, and may be prepared in various ways depending on the purpose. The promoter of the vector may be constitutive or inducible. The signal sequence includes a PhoA signal sequence and an OmpA signal sequence when the host is Escherichia sp., and an α-amylase signal sequence and a subtilisin signal when the host is a Bacillus sp. When the host is yeast, the MFα signal sequence, SUC2 signal sequence, etc., and when the host is an animal cell, an insulin signal sequence, α-interferon signal sequence, antibody molecule signal sequence, etc. can be used, It is not limited thereto. The vector may also contain a selection marker for selecting a host cell containing the vector, and in the case of a replicable expression vector, an origin of replication.

As used herein, the term "vector" refers to a carrier capable of inserting a nucleic acid sequence for introduction into a cell capable of replicating the nucleic acid sequence. Nucleic acid sequences may be exogenous or heterologous. Vectors include, but are not limited to, plasmids, cosmids, and viruses (eg, bacteriophages). One skilled in the art can construct vectors by standard recombinant techniques (Maniatis, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1988; and Ausubel et al., In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, NY, 1994 et al.).

In one embodiment, when constructing the vector, expression control sequences such as promoter, terminator, enhancer, etc., membrane targeting or secretion according to the type of host cell in which the antibody is to be produced. Sequences and the like can be appropriately selected and combined in various ways depending on the purpose.

As used herein, the term "expression vector" refers to a vector comprising a nucleic acid sequence encoding at least a portion of a transcribed gene product. In some cases, the RNA molecule is then translated into a protein, polypeptide, or peptide. The expression vector may include various regulatory sequences. In addition to regulatory sequences for regulating transcription and translation, vectors and expression vectors may contain nucleic acid sequences that also serve other functions.

In the present invention, the term "host cell" includes eukaryotes and prokaryotes, and refers to any transformable organism capable of replicating the vector or expressing a gene encoded by the vector. A host cell may be transfected or transformed by the vector, which refers to a process in which an exogenous nucleic acid molecule is delivered or introduced into a host cell.

In one embodiment, the host cell may be a bacterium or an animal cell, the animal cell line may be a CHO cell, a HEK cell or an NSO cell, and the bacterium may be E. coli.

In one aspect, the present invention relates to a pharmaceutical composition for preventing or treating neurodegenerative diseases comprising the antibody or immunologically active fragment thereof of the present invention as an active ingredient.

In one embodiment, the neurodegenerative disease is Parkinson's disease, Huntington's disease, multiple system neurological atrophy, amyotrophic lateral sclerosis, Lou Gehrig's disease, polyglutamine ectasia, spinocerebellar ataxia, spinal and medulla muscle atrophy, tauosis, dystonia , serpin deficiency, cirrhosis, type II diabetes mellitus, primary systemic amyloidosis, secondary systemic amyloidosis, pronto-transient dementia, geriatric systemic amyloidosis, familial amyloid polyneuropathy, hereditary cerebral amyloid vasculopathy, hemodialysis-associated amyloidosis, macular degeneration, dementia , Alzheimer's disease, familial AD, Lewy body dementia, radiation therapy-induced dementia, boxer's dementia, Down syndrome, Gerstmann-Straussler-Scheinker disease, inclusion body myositis, prion protein brain amyloid angiopathy, axon injury, Acute diffuse cortical suppression, alpha-synucleinic condition, Parkinsonism-dementia complex of Guam, non-Gammanian motor neuron disease with nerve fiber entanglement, silver-affinity particle disease, cortical basal degeneration, diffuse nerve fibers with calcification entanglement, frontotemporal dementia with Parkinsonism associated with chromosome 17, Hallerforden-Spatz disease, stroke, cerebral infarction, head trauma, cerebral atherosclerosis, cerebral ischemia, permanent midcerebral ischemia, peripheral nerve regeneration, superimposed post-epileptic model, spinal cord injury, Niemann-Pick disease type C, Palido-Ponto-Nigral degeneration, Pick's disease, progressive subcortical gliosis, progressive supranuclear palsy, subacute sclerosing panencephalitis, dementia with tangles only, mild cognitive impairment, post encephalitis parkinsonism, myotonic Dystrophy, tau panencephalopathy, AD-like syndrome with astrocytes, senile cardiac amyloidosis, endocrine tumors, glaucoma, ocular amyloidosis, primary retinal degeneration, optic nerve drusen, optic neuropathy, optic neuritis, and lattice dystrophy, sporadic Lou Gehrig and Creutzfeldt-Jakob disease It may be one or more selected from the group consisting of.

The pharmaceutical composition of the present invention may further include an adjuvant. The adjuvant can be used without limitation as long as it is known in the art, for example, it can increase immunity by further including Freund's complete adjuvant or incomplete adjuvant.

As used herein, the term "treatment" means, unless otherwise stated, the disease or condition to which the term applies, or one or more symptoms of the disease or condition, which reverses, ameliorates, inhibits the progression, or means to prevent, and the term treatment as used herein refers to the act of treating.

A composition is indicated to be "pharmaceutically or physiologically acceptable" if the recipient animal can tolerate administration of the composition, or if administration of the composition to that animal is suitable. When the amount administered is physiologically important, the agent can be said to have been administered in a "therapeutically effective amount". An agent is physiologically meaningful if the presence of the agent results in a physiologically detectable change in the recipient patient.

The therapeutically effective amount of the composition of the present invention may vary depending on several factors, for example, the administration method, the target site, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined as an appropriate amount in consideration of both safety and efficiency. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These considerations in determining effective amounts are found, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not to cause side effects, and the effective dose level is determined by the patient's Health status, disease type, severity, drug activity, sensitivity to drug, administration method, administration time, administration route and excretion rate, treatment period, factors including drugs used in combination or concurrently, and other factors well known in the medical field can be determined according to The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

The compositions of the present invention may also include carriers, diluents, excipients, or combinations of two or more, commonly used in biological agents. A pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc. The compound described in , saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components can be mixed and used, and if necessary, other antioxidants, buffers, bacteriostats, etc. Conventional additives may be added. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets. Furthermore, it can be preferably formulated according to each disease or component using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

The pharmaceutical composition of the present invention may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions according to conventional methods, respectively. have.

As used herein, the term “pharmaceutically acceptable” refers to exhibiting non-toxic properties to cells or humans exposed to the composition.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additive includes starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate. , lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, Calcium stearate, sucrose, dextrose, sorbitol and talc and the like may be used. The pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

As used herein, the term "administration" means providing a predetermined substance to a patient by any suitable method, and parenteral administration (eg, intravenous, subcutaneous, intraperitoneal or topical administration according to a desired method) ) or oral administration, and the dosage varies according to the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of disease.

The composition of the present invention may be administered parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) or orally according to a desired method, and the dosage may vary depending on the subject's age, weight, sex, physical condition, etc. is selected taking into account. It is self-evident that the concentration of the active ingredient included in the pharmaceutical composition can be variously selected depending on the subject, and is preferably included in the pharmaceutical composition at a concentration of 0.01 to 5,000 μg/ml. If the concentration is less than 0.01 μg/ml, pharmaceutical activity may not appear, and if it exceeds 5,000 μg/ml, it may be toxic to the human body.

The pharmaceutical composition of the present invention may be formulated in various oral or parenteral dosage forms. Formulations for oral administration include, for example, tablets, pills, hard, soft capsules, solutions, suspensions, emulsifiers, syrups, and granules. crose, mannitol, sorbitol, cellulose and/or glycine), lubricants (eg silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycol). In addition, the tablet may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and optionally starch, agar, alginic acid or disintegrants such as sodium salts thereof or effervescent mixtures and/or absorbents, coloring, flavoring and sweetening agents. The formulation may be prepared by conventional mixing, granulating or coating methods. In addition, representative formulations for parenteral administration are injection formulations, and water, Ringer's solution, isotonic saline, or suspension can be exemplified as a solvent for the injection formulation. The sterile, fixed oil of the injectable preparation can be used as a solvent or suspending medium, and any non-irritating fixed oil including mono- and di-glycerides can be used for this purpose. In addition, the injection preparation may use a fatty acid such as oleic acid.

In the present invention, the term "prevention" refers to any action that inhibits or delays the occurrence, spread, and recurrence of the disease or disorder by administration of the pharmaceutical composition according to the present invention.

In one aspect, the present invention relates to a composition for diagnosing a neurodegenerative disease comprising the antibody or immunologically active fragment thereof of the present invention.

In one embodiment, the presence or amount (level) of an AIMP2 monomer or AIMP2 aggregate is detected in a biological sample isolated from a subject using a composition for diagnosing a neurodegenerative disease comprising the antibody or immunologically active fragment of the present invention can be measured.

As used herein, the term “detection” or “measurement” refers to quantifying the concentration of a detected or measured target.

In one embodiment, the kit may further include tools and/or reagents for collecting a biological sample from a subject or patient, as well as tools and/or reagents for preparing an AIMP2 protein or an aggregate thereof from the sample.

In the present invention, the term “neurodegenerative disease diagnosis kit” refers to a kit containing the composition for diagnosing neurodegenerative disease of the present invention. Therefore, the expression "neurodegenerative disease diagnosis kit" can be used interchangeably or mixed with the "neurodegenerative disease diagnosis composition". As used herein, the term “diagnosis” refers to determining a subject's susceptibility to a specific disease or disorder, determining whether an object currently has a specific disease or disorder, or having a specific disease or disorder. Determining a subject's prognosis (e.g., identifying a neurodegenerative disease state, determining the stage or subtype of a neurodegenerative disease, or determining the responsiveness of a neurodegenerative disease to treatment), or therametrics ( monitoring the condition of the subject to provide information on treatment efficacy).

In one aspect, the present invention relates to a kit for diagnosing a neurodegenerative disease comprising the composition.

In one aspect, the present invention relates to an information providing method for diagnosing a neurodegenerative disease comprising detecting an AIMP2 monomer or an AIMP2 aggregate in a biological sample isolated from a subject using the antibody of the present invention or a fragment having immunological activity thereof it's about

As used herein, the term “sample (sample)” refers to a biological sample obtained from a subject or patient. Sources of biological samples may include fresh, frozen and/or preserved organ or tissue samples or solid tissue from biopsies or aspirates; blood or any blood component; The cells may be at any point in the pregnancy or development of the subject.

In one aspect, the present invention comprises the steps of reacting a candidate compound with an AIMP2 aggregate; quantifying AIMP2 aggregates using an antibody of the present invention specific for AIMP2 aggregates or a fragment having immunological activity thereof; And it relates to a method for screening a substance that inhibits or inhibits the formation of AIMP2 aggregates, comprising the step of selecting a compound having a reduced amount of AIMP2 aggregates compared to a control group not treated with the candidate compound.

In one aspect, the present invention comprises the steps of reacting a candidate compound with an AIMP2 expressing cell or AIMP2 aggregate; quantifying the expression level of AIMP2 or the amount of AIMP2 aggregates using the antibody or fragment having immunological activity of the present invention; And a screening method for a therapeutic agent for a neurodegenerative disease, comprising the step of selecting a compound with a reduced amount of AIMP2 expression or AIMP2 aggregate compared to the control group not treated with the candidate compound

The present invention will be described in more detail through the following examples. However, the following examples are only intended to materialize the contents of the present invention, and the present invention is not limited thereto.

Example 1. AIMP2 aggregate production and verification

In order to construct a single antibody clone labeling the AIMP2 aggregate, a recombinant AIMP2 aggregate was prepared as an antigen. After transforming the vector encoding the GST-AIMP2 recombinant protein into BL21, it was cultured, eluted using GST beads, and purified to obtain the GST-AIMP2 recombinant protein. The purified GST-AIMP2 recombinant protein (GST-AIMP2 monomer) was incubated for 7 days in a test tube at 37° C. at 250 rpm for 7 days to form a high molecular weight aggregate (GST-AIMP2 fibril). For reference, GST-truncated AIMP2 (monomer) and AIMP2 aggregates (AIMP2 fibril) were dialyzed against the GST-AIMP2 and GST-AIMP2 aggregates, and 100ul of Glutathione Sepharose 4B (GE Heathcare #17-0756-01) and Prescission protease (GE Heathcare) #27-0843-01) was treated with 10ul and incubated overnight. The prepared GST-AIMP2 and GST-AIMP2 aggregates were analyzed by western blot using an AIMP2-specific antibody (Proteintech Group rabbit antibody), and the GST-AIMP2 aggregates were placed on an SDS-PAGE gel, followed by Coomassie blue staining. As a result, GST-AIMP2 was detected, and it was confirmed that a GST-AIMP2 aggregate (Days 7) was formed ( FIG. 1A ). In addition, the amyloid structure of the GST-AIMP2 aggregate was verified by thioflavin T fluorescence analysis ( FIG. 1B ).

Example 2. Hybridoma cell line production and antibody analysis

As in Example 1, ELISA analysis was performed using GST-AIMP2 of FIG. 1C, which formed aggregates in an amyloid structure, as an antigen, and did not react to GST, but GST-AIMP2 normal structure (monomer) or GST-AIMP2 aggregate Eight hybridoma clones 3C2, 5B2, 6C7, 7G2, 10F3, 12D12 and 13H9 producing an antibody binding to (fibril) were selected ( FIG. 2A ). Thereafter, the culture supernatant of each hybridoma clone was collected, treated with Protein G IgG binding buffer (Thermo Fisher Scientific), and using Capturem Protein G Maxiprep Column (Cat. No. 635727), the antibody produced from each clone. was purified. The isotype of the antibody of each purified clone was analyzed (FIG. 2B).

Example 3. AIMP2 conformation-specific reactivity analysis for each clone

3-1. dot blot analysis

In order to verify the binding ability of each antibody produced for each of the eight clones selected in the above Example to the AIMP2 three-dimensional structure, dot blot analysis was performed. Specifically, the concentrations of GST, GST-AIMP2 (Monomer) and GST-AIMP2 aggregates were equally diluted with 1X PBS to 0.1 mg/ml, printed on a nitrocellulose membrane, and then lowered in a vacuum. After confirming the loading with ponceau, it was removed again and blocked with 5% skim milk. After washing the blocked membrane 3 times with TBS-T, the antibodies of each clone purified in the above example were reacted with the primary antibody for 1 hour at 4°C (as controls, rabbit AIMP2 antibody and GST antibody from Proteintech Group were used. ). It was washed 3 times with TBS-T and reacted with the secondary antibody (5000 : 1) at RT for 30 minutes. Then, the blot was developed using ECL. As a result, unlike the ELISA results, 10F3 and 12D12 also bind to GST, so it was found that they were not suitable AIMP2 antibody clones. In addition, the rabbit AIMP2 antibody of Proteintech Group used as a control antibody labeled AIMP2 normal structure and aggregate structure without selectivity, and the antibody of the 7G2 clone did not show binding ability to both the AIMP2 monomer (normal structure) and the aggregate. The antibody of the 12D12 clone was shown to recognize GST ( FIG. 3A ). In addition, the antibody clones of 5B2 and 6C7 bound relatively well to AIMP2 aggregates, and the antibody clones of 3C2 7H9 and 13H9 showed the same level of binding signal for both the normal and aggregate structures of AIMP2 (FIG. 3A).

3-2. Western blot analysis

To verify the antibody recognition of the denatured protein, GST, GST-AIMP2 (Monomer) and GST-AIMP2 aggregates (Aggregate) were separated according to size on SDS-PAGE through Western blot analysis and purified from each antibody clone. Selective reactivity was analyzed using one antibody. As a result, as in the dot blot analysis result of Example 3-1, the conventional Proteintech Group antibody not only labels the GST-AIMP2 normal structure (monomer) of about 60 kDa, but also shows the high molecular weight GST-AIMP2 aggregate structure. 5B2 clones and 6C7 clones, which showed selectivity for AIM2 aggregates in dot blot analysis, were found to selectively label high molecular weight AIMP2 aggregates. It was found that the selectivity for AIMP2 aggregates was high (Fig. 3B). In addition, the 3C2 clone and the 7H9 clone had a signal detected only in AIMP2 (60 kDa) of the normal structure, indicating that the clones showed selectivity for AIMP2 of the normal structure (monomer) rather than the aggregate (FIG. 3B). In addition, the antibody purified from the 13H9 clone was labeled regardless of the structure of AIMP2 (FIG. 3B).

As a result of combining the results of the dot blot analysis and the Western analysis, the 10F3 clone and the 12D12 clone also bound to GST, and the 7G2 clone was not a suitable AIMP2 antibody clone due to its low binding affinity to AIMP2. However, 3C2 and 7H9 clones were It was possible to distinguish between AIMP2 normal structure-specific single antibody-producing clones, 5B2 and 6C7 as AIMP2 aggregate structure-specific single antibody-producing clones, and 13H9 clones as AIMP2 structure-specific single antibody-producing clones ( FIG. 4 ).

Example 4. CDS amino acid sequence analysis of AIMP2 antibody

In order to secure the cDNA sequence of each antibody encoded by each antibody clone, the sequence of the antibody variable region (variable region) with reference to the existing paper ( Lena Meyer et al. A simplified workflow for monoclonal antibody sequencing, PlosOne, 2019 ) was secured. Specifically, for cDNA extracted from each hybridoma cell, the light chain and heavy chain variable regions were amplified by PCR using the primers in Table 1 below, and then cloned into a T vector, including the corresponding light chain variable region and heavy chain variable region. The cDNA sequence was obtained by sequencing the T vector, and the variable region sequence was analyzed using IgBlast (Igblast: https://www.ncbi.nlm.nih.gov/igblast/ ) and the sequence of the CDR (complementarity determining region) amino acids Also analyzed.

Primer Name Forward or reverse Primer Sequence ISPCR Universal F primer 5' aagcagtggtatcaacgcagag 3' mIGK PCR R primer for kappa chain 5' acattgatgtctttggggtagaag 3' mIGL PCR R primer for lambda chain 5' atcgtacacaccagtgtggc 3' mIGHG PCR R primer for heavy chain 5' gggatccagagttccaggtc 3'

As a result, as a result of analyzing the cDNA sequences of the 5B2 clone and 6C7 clone showing specific reactivity to the AIMP2 aggregate, the amino acid sequence of the CDR region was confirmed, and only one of the amino acids encoding the light chain was different (FIG. 5). Accordingly, the entire sequence of the antibody including the sequence of the constant region in the case of making humanized IgG using this was also constructed (FIG. 5). In the same way, as a result of analyzing the sequence of the antibody variable region of the 3C2 clone and the 7H9 clone that showed specific binding ability to AIMP2 in the normal structure, the two clones also shared the same CDR amino acid sequence, the difference being the variable region of the light chain region. appeared only in the two amino acid sequences of (Fig. 6). Similarly, the entire sequence of a humanized antibody obtained by polymerizing the constant region of human IgG was also constructed (FIG. 6). In addition, 13H9, which is an antibody clone that detects both AIMP2 and aggregates in the normal structure, exhibited an antibody amino acid sequence distinct from the other four clones above ( FIG. 7 ). Also, the amino acid sequence of the variable region, the CDR amino acid sequence, and the entire amino acid sequence of the humanized antibody are shown in FIG. 7 .

<110> Research and Business Foundation SUNGKYUNKWAN UNIVERSITY <120> ANTIBODIES SPECIFICALLY BINDING TO AIMP2 MONOMER AND/OR AIMP2 AGGREGATE <130> R-2020-0654-KR-1 <160> 63 <170> KoPatentIn 3.0 <210> 1 <211 > 8 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-CDRH1 <400> 1 Gly Phe Thr Phe Ser Asp Phe Tyr 1 5 <210> 2 <211> 10 <212> PRT <213 > Artificial Sequence <220> <223> 3C2/7H9-CDRH1 <400> 2 Gly Phe Ser Leu Ser Thr Ser Gly Met Gly 1 5 10 <210> 3 <211> 9 <212> PRT <213> Artificial Sequence <220 > <223> 13H9-CDRH1 <400> 3 Asp Tyr Ser Ile Thr Ser Gly Tyr Ser 1 5 <210> 4 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-CDRH2 <400> 4 Ser Arg Asn Lys Ala Asn Asp Tyr Thr Thr 1 5 10 <210> 5 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 3C2/7H9-CDRH2 <400> 5 Ile Trp Trp Asp Asp Asp Lys 1 5 <210> 6 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 13H9-CDRH2 <400> 6 Ile His Tyr Arg Gly Se r Thr 1 5 <210> 7 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-CDRH3 <400> 7 Ala Arg Asp Ala Phe Tyr Gly Tyr Gly Ala Met Asp Tyr 1 5 10 <210> 8 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 3C2/7H9-CDRH3 <400> 8 Ala Arg Ile Ala Asn Ser Trp Phe Ala Tyr 1 5 10 <210> 9 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 13H9-CDRH3 <400> 9 Ala Thr Trp Asp Tyr Arg Leu Ala Tyr 1 5 <210> 10 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-CDRL1 <400> 10 Lys Ser Ile Arg Lys Tyr 1 5 <210> 11 <211> 10 <212> PRT <213> Artificial Sequence <220> <223 > 3C2-CDRL1 <400> 11 Lys Ser Val Ser Thr Ser Ala Tyr Ser Tyr 1 5 10 <210> 12 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 7H9-CDRL1 <400> 12 Lys Ser Val Ser Thr Ser Gly Tyr Thr Tyr 1 5 10 <210> 13 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 13H9-CDRL1 <400> 13 Ser Gln His Ser Thr Tyr Thr 1 5 <210> 14 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-CDRL2 <400> 14 Ser Gly Ser 1 <210> 15 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> 3C2/7H9-CDRL2 <400> 15 Leu Ala Ser 1 <210> 16 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 13H9- CDRL2 <400> 16 Leu Lys Lys Asp Gly Ser His 1 5 <210> 17 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-CDRL3 <400> 17 Gln Gln His Asn Glu Tyr Pro Tyr Thr 1 5 <210> 18 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 3C2/7H9-CDRL3 <400> 18 Gln His Ser Arg Glu Leu Pro Pro Thr 1 5 <210> 19 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> 13H9-CDRL3 <400> 19 Gly Val Gly Asp Thr Ile Lys Glu Gln Phe Val Tyr Val 1 5 10 <210> 20 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-H-FR1 <400> 20 Glu Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Thr Ser 20 25 <210> 21 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 3C2/7H9-H-FR1 <400> 21 Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ser Phe Ser 20 25 <210> 22 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 13H9-H-FR1 <400 > 22 Asp Val Gln Leu Gln Glu Ser Gly Pro Asp Leu Val Lys Pro Ser Gln 1 5 10 15 Ser Leu Ser Leu Thr Cys Thr Val Thr 20 25 <210> 23 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-H-FR2 <400> 23 Met Glu Trp Val Arg Gln Pro Gly Lys Arg Leu Glu Trp Ile Ala 1 5 10 15 Ala <210> 24 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 3C2/7H9-H-FR2 <400> 24 Val Gly Trp Ile Arg Gln Pro Ser Gly Lys Gly Leu Glu Trp Leu Ala 1 5 10 15 His <210> 25 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 13H9-H-FR2 <400> 25 Trp His Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp Met Ala 1 5 10 15 Tyr <210> 26 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-H-FR3 <400> 26 Glu Tyr Ser Glu Ser Val Lys Gly Arg Phe Ile Val Ser Arg Asp Ile 1 5 10 15 Ser Gln Ser Ile Leu Tyr Leu Gln Met Asn Ala Leu Arg Ala Glu Asp 20 25 30 Thr Ala Ile Tyr Tyr Cys 35 <210> 27 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> 3C2/7H9-H-FR3 <400> 27 Tyr Tyr Asn Thr Ala Leu Lys Ser Gly Leu Thr Ile Ser Lys Asp Thr 1 5 10 15 Ser Lys Asn Gln Val Phe Leu Lys Ile Ala Ser Val Asp Thr Ala Asp 20 25 30 Thr Ala Thr Tyr Tyr Cys 35 <210> 28 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> 13H9-H-FR3 <400> 28 Asn Tyr Asn Pro Ser Leu Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr 1 5 10 15 Ser Lys Asn Gln Phe Phe Leu Gln Leu Asn Ser Val Thr Thr Glu Asp 20 25 30 Thr Ala Thr Tyr Tyr Cys 35 <210> 29 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-H-FR4 <400> 29 Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser 1 5 10 <210> 30 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 3C2/7H9/13H9-H-FR4 <400> 30 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 1 5 10 <210> 31 <211> 26 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-L-FR1 <400> 31 Asp Val Gln Ile Thr Gln Ser Pro Ser Tyr Leu Ala Ala Ser Pro Gly 1 5 10 15 Glu Thr Ile Thr Ile Asn Cys Arg Ala Ser 20 25 <210> 32 <211> 26 <212> PRT <213> Artificial Sequence <220> <223> 3C2/7H9-L-FR1 <400> 32 Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser 20 25 <210> 33 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 13H9-L-FR1 < 400> 33 Gln Leu Val Leu Thr Gln Ser Ser Ser Ala Ser Phe Ser Leu Gly Ala 1 5 10 15 Ser Ala Lys Leu Thr Cys Thr Leu Ser 20 25 <210> 34 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-L-FR2 <400> 34 Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile 1 5 10 15 Tyr <210> 35 <211> 17 <212 > PRT <213> Artificial Sequence <220> <223> 3C2-L-FR2 <400> 35 Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Lys Leu Leu Ile 1 5 10 15 Tyr <210> 36 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 7H9-L-FR2 <400> 36 Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile 1 5 10 15 Tyr <210> 37 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 13H9-L-FR2 <400> 37 Ile Glu Trp Tyr Gln Gln Gln Pro Leu Lys Pro Pro Lys Tyr Val Met 1 5 10 15 Glu < 210> 38 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> 5B2-L-FR3 <400> 38 Thr Leu Gln Ser Gly Ile Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly 1 5 10 15 Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu Asp Phe Ala 20 25 30 Met Tyr Tyr Cys 35 <210> 39 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> 6C7- L-FR3 <400> 39 Thr Leu Gln Ser Gly Ile Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly 1 5 10 15 Ile Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu Asp Phe Ala 20 25 30 Met Tyr Tyr Cys 35 <210> 40 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> 3C2-L-FR3 <400> 40 Asn Leu Asp Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly 1 5 10 15 Thr Asp Phe Thr Leu Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala 20 25 30 Thr Tyr Tyr Cys 35 <210> 41 <211> 36 <212> PRT < 213> Artificial Sequence <220> <223> 7H9-L-FR3 <400> 41 Asn Leu Glu Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly 1 5 10 15 Thr Asp Phe Thr Leu Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala 20 25 30 Thr Tyr Tyr Cys 35 <210> 42 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> 13H9-L-FR3 <400> 42 Ser Thr Gly Asp Gly Ile Pro Asp Arg Phe Ser Gly Ser Ser Ser Ser Gly 1 5 10 15 Ala Asp Arg Tyr Leu Ser Ile Ser Asn Ile Gln Pro Glu Asp Glu Ala 20 25 30 Ile Tyr Ile Cys 35 <210> 43 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-L-FR4 <400> 43 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 1 5 10 <210> 44 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 3C2/7H9-L-FR4 <400> 44 Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 1 5 10 <210> 45 <211> 10 <212 > PRT <213> Artificial Sequence <220> <223> 13H9-L-FR4 <400> 45 Phe Gly Gly Gly Thr Lys Val Thr Val Leu 1 5 10 <210> 46 <211> 141 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-VH <400> 46 Met Lys Leu Trp Leu Asn Trp Val Phe Leu Leu Thr Leu Leu His Gly 1 5 10 15 Ile Gln Cys Glu Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Gln 20 25 30 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Thr Ser Gly Phe Thr Phe 35 40 45 Ser Asp Phe Tyr Met Glu Trp Val Arg Gln Pro Gly Lys Arg Leu 50 55 60 Glu Trp Ile Ala Ala Ser Arg Asn Lys Ala Asn Asp Tyr Thr Thr Glu 65 70 75 80 Tyr Ser Glu Ser Val Lys Gly Arg Phe Ile Val Ser Arg Asp Ile Ser 85 90 95 Gln Ser Ile Leu Tyr Leu Gln Met Asn Ala Leu Arg Ala Glu Asp Thr 100 105 110 Ala Ile Tyr Tyr Cys Ala Arg Asp Ala Phe Tyr Gly Tyr Gly Ala Met 11 5 120 125 Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser 130 135 140 <210> 47 <211> 137 <212> PRT <213> Artificial Sequence <220> <223> 3C2-VH <400> 47 Met Gly Arg Leu Thr Ser Ser Phe Leu Leu Leu Leu Ile Val Pro Ala Tyr 1 5 10 15 Val Leu Ser Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln 20 25 30 Pro Ser Gln Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu 35 40 45 Ser Thr Ser Gly Met Gly Val Gly Trp Ile Arg Gln Pro Ser Gly Lys 50 55 60 Gly Leu Glu Trp Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr 65 70 75 80 Asn Thr Ala Leu Lys Ser Gly Leu Thr Ile Ser Lys Asp Thr Ser Lys 85 90 95 Asn Gln Val Phe Leu Lys Ile Ala Ser Val Asp Thr Ala Asp Thr Ala 100 105 110 Thr Tyr Tyr Cys Ala Arg Ile Ala Asn Ser Trp Phe Ala Tyr Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ala 130 135 <210> 48 <211> 144 <212> PRT <213> Artificial S sequence <220> <223> 7H9-VH <400> 48 Met Gly Asp Lys Cys Ala Val Met Gly Arg Leu Thr Ser Ser Phe Leu 1 5 10 15 Leu Leu Ile Val Pro Ala Tyr Val Leu Ser Gln Val Thr Leu Lys Glu 20 25 30 Ser Gly Pro Gly Ile Leu Gln Pro Ser Gln Thr Leu Ser Leu Thr Cys 35 40 45 Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser Gly Met Gly Val Gly Trp 50 55 60 Ile Arg Gln Pro Ser Gly Lys Gly Leu Glu Trp Leu Ala His Ile Trp 65 70 75 80 Trp Asp Asp Asp Lys Tyr Tyr Asn Thr Ala Leu Lys Ser Gly Leu Thr 85 90 95 Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Phe Leu Lys Ile Ala Ser 100 105 110 Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Ile Ala Asn 115 120 125 Ser Trp Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 130 135 140 <210> 49 <211> 134 <212> PRT < 213> Artificial Sequence <220> <223> 13H9-VH <400> 49 Met Arg Val Leu Ile Leu Leu Cys Leu Phe Thr Ala Phe Pro Gly Ile 1 5 10 15 Leu Ser Asp Val Gln Leu Gln Glu Ser Gly Pro Asp Leu Val Lys Pro 20 25 30 Ser Gln Ser Leu Ser Leu Thr Cys Thr Val Thr Asp Tyr Ser Ile Thr 35 40 45 Ser Gly Tyr Ser Trp His Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu 50 55 60 Glu Trp Met Ala Tyr Ile His Tyr Arg Gly Ser Thr Asn Tyr Asn Pro 65 70 75 80 Ser Leu Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln 85 90 95 Phe Phe Leu Gln Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr 100 105 110 Tyr Cys Ala Thr Trp Asp Tyr Arg Leu Ala Tyr Trp Gly Gln Gly Thr 115 120 125 Leu Val Thr Val Ser Ala 130 <210> 50 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> 5B2-VL <400> 50 Met Gly Asn Gln Phe Leu Pro Gly His Ser Leu Asp Met Arg Phe Gln 1 5 10 15 Val Gln Val Leu Gly Leu Leu Leu Leu Trp Ile Ser Gly Ala Gln Cys 20 25 30 Asp Val Gln Ile Thr Gln Ser Pro Ser Tyr Leu Ala Ala Ser Pro Gly 35 40 45 Glu Thr Ile Thr Ile Asn Cys Arg Ala Ser Lys Ser Ile Arg Lys Tyr 50 55 60 Leu Ala Tr p Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile 65 70 75 80 Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser Arg Phe Ser Gly 85 90 95 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro 100 105 110 Glu Asp Phe Ala Met Tyr Tyr Cys Gln Gln His Asn Glu Tyr Pro Tyr 115 120 125 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 130 135 <210> 51 <211> 127 <212> PRT <213> Artificial Sequence <220> <223> 6C7-VL <400> 51 Met Arg Phe Gln Val Gln Val Leu Gly Leu Leu Leu Leu Leu Trp Ile Ser 1 5 10 15 Gly Ala Gln Cys Asp Val Gln Ile Thr Gln Ser Pro Ser Tyr Leu Ala 20 25 30 Ala Ser Pro Gly Glu Thr Ile Thr Ile Asn Cys Arg Ala Ser Lys Ser 35 40 45 Ile Arg Lys Tyr Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn 50 55 60 Lys Leu Leu Ile Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Ile Asp Phe Thr Leu Thr Ile Ser 85 90 95 Ser Leu Glu Pro Glu Asp Phe Ala Met Ty r Tyr Cys Gln Gln His Asn 100 105 110 Glu Tyr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 115 120 125 <210> 52 <211> 148 <212> PRT <213> Artificial Sequence <220> <223 > 3C2-VL <400> 52 Met Gly Ser Cys Gln Glu Pro Lys Lys His Pro Leu Phe Gln Leu Ser 1 5 10 15 Glu Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val 20 25 30 Pro Gly Ser Thr Gly Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu 35 40 45 Ala Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Lys 50 55 60 Ser Val Ser Thr Ser Ala Tyr Ser Tyr Met His Trp Tyr Gln Gln Lys 65 70 75 80 Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Asp 85 90 95 Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe 100 105 110 Thr Leu Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr 115 120 125 Cys Gln His Ser Arg Glu Leu Pro Pro Thr Phe Gly Ala Gly Thr Lys 130 135 140 Leu Glu Leu Lys 145 <210> 53 <211> 131 <212> PRT <213> Artificial Sequence <220> <223> 7H9-VL <400> 53 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala 20 25 30 Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Lys Ser 35 40 45 Val Ser Thr Ser Gly Tyr Thr Tyr Met His Trp Tyr Gln Gln Lys Pro 50 55 60 Gly Gln Ser Pro Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser 65 70 75 80 Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 85 90 95 Leu Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys 100 105 110 Gln His Ser Arg Glu Leu Pro Pro Thr Phe Gly Ala Gly Thr Lys Leu 115 120 125 Glu Leu Lys 130 <210> 54 < 211> 149 <212> PRT <213> Artificial Sequence <220> <223> 13H9-VL <400> 54 Met Gly Asn Leu Ser Val Ser Ala Glu Ile Ser Ser Thr Cys Ile Met 1 5 10 15 Ala Trp Thr Pro Leu Phe Phe Phe Phe Val Leu His Cys Ser Gly Ser 20 25 30 Phe Ser Gln Leu Val Leu Thr Gln Ser Ser Ser Ala Ser Phe Ser Leu 35 40 45 Gly Ala Ser Ala Lys Leu Thr Cys Thr Leu Ser Ser Gln His Ser Thr 50 55 60 Tyr Thr Ile Glu Trp Tyr Gln Gln Gln Pro Leu Lys Pro Pro Lys Tyr 65 70 75 80 Val Met Glu Leu Lys Lys Asp Gly Ser His Ser Thr Gly Asp Gly Ile 85 90 95 Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Ala Asp Arg Tyr Leu Ser 100 105 110 Ile Ser Asn Ile Gln Pro Glu Asp Glu Ala Ile Tyr Ile Cys Gly Val 115 120 125 Gly Asp Thr Ile Lys Glu Gln Phe Val Tyr Val Phe Gly Gly Gly Thr 130 135 140 Lys Val Thr Val Leu 145 <210> 55 <211> 467 <212> PRT <213> Artificial Sequence <220> <223> 5B2/6C7-HEAVY CHAIN <400> 55 Met Lys Leu Trp Leu Asn Trp Val Phe Leu Leu Thr Leu Leu His Gly 1 5 10 15 Ile Gln Cys Glu Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Gln 20 25 30 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Thr Ser Gly Phe Thr Phe 35 40 45 Ser Asp Phe Tyr Met Glu Trp Val Arg Gln Pro Pro Gly Lys Arg Leu 50 55 60 Glu Trp Ile Ala Ala Ser Arg Asn Lys Ala Asn Asp Tyr Thr Thr Glu 65 70 75 80 Tyr Ser Glu Ser Val Lys Gly Arg Phe Ile Val Ser Arg Asp Ile Ser 85 90 95 Gln Ser Ile Leu Tyr Leu Gln Met Asn Ala Leu Arg Ala Glu Asp Thr 100 105 110 Ala Ile Tyr Tyr Cys Ala Arg Asp Ala Phe Tyr Gly Tyr Gly Ala Met 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Ser Thr 130 135 140 Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser 145 150 155 160 Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu 165 170 175 Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His 180 185 190 Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser 195 200 205 Val Val Thr Val Pro Ser Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys 210 215 220 Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Thr Val Glu 225 230 235 240 Arg Lys Cys Cys Val Glu Cys Pro Pro Cys Pro Ala Pro Pro Val Ala 245 250 255 Gly Pro Ser Val Phe Leu Phe Pro Lys Pro Lys Asp Thr Leu Met 260 265 270 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 275 280 285 Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val 290 295 300 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe 305 310 315 320 Arg Val Val Ser Val Leu Thr Val Val His Gln Asp Trp Leu Asn Gly 325 330 335 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ala Pro Ile 340 345 350 Glu Lys Thr Ile Ser Lys Thr Lys Gly Gln Pro Arg Glu Pro Gln Val 355 360 365 Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser 370 375 380 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ser Val Glu 385 390 395 400 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 405 410 415 Met Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 420 425 430 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met 435 440 445 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 450 455 460 Pro Gly Lys 465 <210> 56 <211> 463 <212> PRT <213> Artificial Sequence <220> <223> 3C2-HEAVY CHAIN <400> 56 Met Gly Arg Leu Thr Ser Ser Phe Leu Leu Leu Ile Val Pro Ala Tyr 1 5 10 15 Val Leu Ser Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln 20 25 30 Pro Ser Gln Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu 35 40 45 Ser Thr Ser Gly Met Gly Val Gly Trp Ile Arg Gln Pro Ser Gly Lys 50 55 60 Gly Leu Glu Trp Leu A la His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr 65 70 75 80 Asn Thr Ala Leu Lys Ser Gly Leu Thr Ile Ser Lys Asp Thr Ser Lys 85 90 95 Asn Gln Val Phe Leu Lys Ile Ala Ser Val Asp Thr Ala Asp Thr Ala 100 105 110 Thr Tyr Tyr Cys Ala Arg Ile Ala Asn Ser Trp Phe Ala Tyr Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ala Ala Ser Thr Lys Gly Pro Ser 130 135 140 Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala 145 150 155 160 Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val 165 170 175 Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala 180 185 190 Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val 195 200 205 Pro Ser Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val Asp His 210 215 220 Lys Pro Ser Asn Thr Lys Val Asp Lys Thr Val Glu Arg Lys Cys Cys 225 230 235 240 Val Glu Cys Pro Pro Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val 245 250 255 Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr 260 265 270 Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu 275 280 285 Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys 290 295 300 Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Val Val Ser 305 310 315 320 Val Leu Thr Val Val His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys 325 330 335 Cys Lys Val Ser Asn Lys Gly Leu Pro Ala Pro Ile Glu Lys Thr Ile 340 345 350 Ser Lys Thr Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro 355 360 365 Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu 370 375 380 Val Lys Gly Phe Tyr Pro Ser Asp Ile Ser Val Glu Trp Glu Ser Asn 385 390 395 400 Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu Asp Ser 405 410 415 Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg 420 425 430 Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu 435 440 445 His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 450 455 460 <210> 57 <211> 470 <212> PRT <213> Artificial Sequence <220> <223> 7H9-HEAVY CHAIN <400> 57 Met Gly Asp Lys Cys Ala Val Met Gly Arg Leu Thr Ser Ser Phe Leu 1 5 10 15 Leu Leu Ile Val Pro Ala Tyr Val Leu Ser Gln Val Thr Leu Lys Glu 20 25 30 Ser Gly Pro Gly Ile Leu Gln Pro Ser Gln Thr Leu Ser Leu Thr Cys 35 40 45 Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser Gly Met Gly Val Gly Trp 50 55 60 Ile Arg Gln Pro Ser Gly Lys Gly Leu Glu Trp Leu Ala His Ile Trp 65 70 75 80 Trp Asp Asp Asp Lys Tyr Tyr Asn Thr Ala Leu Lys Ser Gly Leu Thr 85 90 95 Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Phe Leu Lys Ile Ala Ser 100 105 110 Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr Cys Ala Arg Ile Ala Asn 115 120 125 Ser Trp Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 130 135 140 Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg 145 150 155 160 Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 165 170 175 Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 180 185 190 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 195 200 205 Leu Ser Ser Val Val Thr Val Pro Ser Ser Asn Phe Gly Thr Gln Thr 210 215 220 Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys 225 230 235 240 Thr Val Glu Arg Lys Cys Cys Val Glu Cys Pro Pro Cys Pro Ala Pro 245 250 255 Pro Val Ala Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp 260 265 270 Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp 275 280 285 Val Ser His Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly 290 295 300 Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn 305 310 315 320 Ser Thr Phe Arg Val Val Ser Val Leu Thr Val Val His Gln Asp Trp 325 330 335 Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro 340 345 350 Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Gln Pro Arg Glu 355 360 365 Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn 370 375 380 Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile 385 390 395 400 Ser Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr 405 410 415 Thr Pro Pro Met Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys 420 425 430 Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys 435 440 445 Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu 450 455 460 Ser Leu Ser Pro Gly Lys 465 470 <210> 58 <211 > 460 <212> PRT <213> Artificial Sequence <220> <223> 13H9-HEAVY CHAIN <400> 58 Met Arg Val Leu Ile Leu Leu Cys Leu Phe Thr Ala Phe Pro Gly Ile 1 5 10 15 Leu Ser Asp Val Gln Leu Gln Glu Ser Gly Pro Asp Leu Val Lys Pro 20 25 30 Ser Gln Ser Leu Ser Leu Thr Cys Thr Val Thr Asp Tyr Ser Ile Thr 35 40 45 Ser Gly Tyr Ser Trp His Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu 50 55 60 Glu Trp Met Ala Tyr Ile His Tyr Arg Gly Ser Thr Asn Tyr Asn Pro 65 70 75 80 Ser Leu Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln 85 90 95 Phe Phe Leu Gln Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr 100 105 110 Tyr Cys Ala Thr Trp Asp Tyr Arg Leu Ala Tyr Trp Gly Gln Gly Thr 115 120 125 Leu Val Thr Val Ser Ala Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 130 135 140 Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly 145 150 155 160 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 165 170 175 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 180 185 190 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 195 200 205 Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser 210 215 220 Asn Thr Lys Val Asp Lys Thr Val Glu Arg Lys Cys Cys Val Glu Cys 225 230 235 240 Pro Pro Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu Phe 245 250 255 Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val 260 265 270 Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Gln Phe 275 280 285 Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro 290 295 300 Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Val Val Ser Val Leu Thr 305 310 315 320 Val Val His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val 325 330 335 Ser Asn Lys Gly Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr 340 345 350 Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg 355 360 365 Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly 370 375 380 Phe Tyr Pro Ser Asp Ile Ser Val Glu Trp Glu Ser Asn Gly Gln Pro 385 390 395 400 Glu Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu Asp Ser Asp Gly Ser 405 410 415 Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln 420 425 430 Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His 435 440 445 Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 450 455 460 <210> 59 <211> 246 <212> PRT <213> Artificial Sequence <220> <223> 5B2-LIGHT CHAIN <400> 59 Met Gly Asn Gln Phe Leu Pro Gly His Ser Leu Asp Met Arg Phe Gln 1 5 10 15 Val Gln Val Leu Gly Leu Leu Leu Leu Trp Ile Ser Gly Ala Gln Cys 20 25 30 Asp Val Gln Ile Thr Gln Ser Pro Ser Tyr Leu Ala Ala Ser Pro Gly 35 40 45 Glu Thr Ile Thr Ile Asn Cys Arg Ala Ser Lys Ser Ile Arg Lys Tyr 50 55 60 Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile 65 70 75 80 Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser Arg Phe Ser Gly 85 90 95 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro 100 105 110 Glu Asp Phe Ala Met Tyr Tyr Cys Gln Gln His Asn Glu Tyr Pro Tyr 115 120 125 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala Ala 130 135 140 Pro Ser Val Phe Ile Phe Pro Ser Asp Glu Gln Leu Lys Ser Gly 145 150 155 160 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 165 170 175 Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 180 185 190 Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 195 200 205 Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 210 215 220 Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 225 230 235 240 Phe Asn Arg Gly Glu Cys 245 <210> 60 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> 6C7-LIGHT CHAIN <400> 60 Met Arg Phe Gln Val Gln Val Leu Gly Leu Leu Leu Leu Trp Ile Ser 1 5 10 15 Gly Ala Gln Cys Asp Val Gln Ile Thr Gln Ser Pro Ser Tyr Leu Ala 20 25 30 Ala Ser Pro Gly Glu Thr Ile Thr Ile Asn Cys Arg Ala Ser Lys Ser 35 40 45 Ile Arg Lys Tyr Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn 50 55 60 Lys Leu Leu Ile Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser 65 7 0 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Ile Asp Phe Thr Leu Thr Ile Ser 85 90 95 Ser Leu Glu Pro Glu Asp Phe Ala Met Tyr Tyr Cys Gln Gln His Asn 100 105 110 Glu Tyr Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 115 120 125 Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln 130 135 140 Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 145 150 155 160 Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser 165 170 175 Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Leu Ser Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 195 200 205 His Lys Val Tyr Ala Cys Glu Val Thr His Gin Gly Leu Ser Ser Pro 210 215 220 Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 <210> 61 <211> 255 <212> PRT <213> Artificial Sequence <220> <223> 3C2-LIGHT CHAIN <400> 61 Met Gly Ser Cys Gln Glu Pro Lys Lys His Pro Leu Phe Gln Leu Ser 1 5 10 15 Glu Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val 20 25 30 Pro Gly Ser Thr Gly Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu 35 40 45 Ala Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Lys 50 55 60 Ser Val Ser Thr Ser Ala Tyr Ser Tyr Met His Trp Tyr Gln Gln Lys 65 70 75 80 Pro Gly Gln Pro Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Asp 85 90 95 Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Ser Gly Thr Asp Phe 100 105 110 Thr Leu Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr 115 120 125 Cys Gln His Ser Arg Glu Leu Pro Pro Thr Phe Gly Ala Gly Thr Lys 130 135 140 Leu Glu Leu Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro 145 150 155 160 Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu 165 170 175 Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp 180 185 190 Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp 195 200 205 Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys 210 215 220 Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln 225 230 235 240 Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 245 250 255 <210> 62 <211> 238 <212> PRT <213> Artificial Sequence <220> <223> 7H9 -LIGHT CHAIN <400> 62 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala 20 25 30 Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Lys Ser 35 40 45 Val Ser Thr Ser Gly Tyr Thr Tyr Met His Trp Tyr Gln Gln Lys Pro 50 55 60 Gly Gln Ser Pro Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser 65 70 75 80 Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 85 90 95 Leu Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys 100 105 110 Gln His Ser Arg Glu Leu Pro Pro Thr Phe Gly Ala Gly Thr Lys Leu 115 120 125 Glu Leu Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro 130 135 140 Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu 145 150 155 160 Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn 165 170 175 Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser 180 185 190 Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala 195 200 205 Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly 210 215 220 Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 63 <211> 255 < 212> PRT <213> Artificial Sequence <220> <223> 13H9-LIGHT CHAIN <400> 63 Met Gly Asn Leu Ser Val Ser Ala Glu Ile Ser Ser Thr Cys Ile Met 1 5 10 15 Ala Trp Thr Pro Leu Phe Phe Phe Phe Val Leu His Cys Ser Gly Ser 20 25 30 Phe Ser Gln Leu Val Leu Thr Gln Ser Ser Ser Ala Ser Phe Ser Leu 35 40 45 Gly Ala Ser Ala Lys Leu Thr Cys Thr Leu Ser Ser Gln His Ser Thr 50 55 60 Tyr Thr Ile Glu Trp Tyr Gln Gln Gln Pro Leu Lys Pro Pro Lys Tyr 65 70 75 80 Val Met Glu Leu Lys Lys Asp Gly Ser His Ser Thr Gly Asp Gly Ile 85 90 95 Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Ala Asp Arg Tyr Leu Ser 100 105 110 Ile Ser Asn Ile Gln Pro Glu Asp Glu Ala Ile Tyr Ile Cys Gly Val 115 120 125 Gly Asp Thr Ile Lys Glu Gln Phe Val Tyr Val Phe Gly Gly Gly Thr 130 135 140 Lys Val Thr Val Leu Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu 145 150 155 160 Phe Pro Pro Ser Ser Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val 165 170 175 Cys Leu Ile Ser Asp Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys 180 185 190 Ala Asp Ser Ser Pro Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser 195 200 205 Lys Gln Ser Asn Asn Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr 210 215 220 Pro Glu Gln Trp Lys Ser His Arg Ser Tyr Ser Cys Gln Val Thr His 225 230 235 240Glu Gly Ser Thr Val Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 245 250 255

Claims (23)

AIMP2 (Aminoacyl-tRNA synthetase complex interacting multifunctional protein-2) specific antibody or fragment having immunological activity. According to claim 1, Complementarity determining regions heavy chain (CDRH) comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 1 to 3, any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 4 to 6 An antibody or fragment having immunological activity specific for AIMP2, comprising a VH domain comprising CDRH2 comprising one, and CDRH3 comprising any one selected from the group consisting of amino acid sequences of SEQ ID NOs: 7 to 9. According to claim 1, FR1 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 20 to 22, FR2 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 23 to 25, SEQ ID NO: An antibody specific for AIMP2 or immunological thereof, comprising a VH domain comprising FR3 comprising any one selected from the group consisting of the amino acid sequence of 26 to 28, and FR4 comprising the amino acid sequence of SEQ ID NO: 29 or 30 fragments with activity. The method according to claim 1, wherein the CDRL1 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 10 to 13, CDRL2 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 14 to 16, and the sequence An antibody or fragment having immunological activity specific for AIMP2, comprising a VL domain comprising CDRL3 comprising any one selected from the group consisting of the amino acid sequence of Nos. 17 to 19. According to claim 1, FR1 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 31 to 33, FR2 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 34 to 37, SEQ ID NO: AIMP2 comprising a VL domain comprising FR3 comprising any one selected from the group consisting of the amino acid sequence of 38 to 42 and FR4 comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 43 to 45 A specific antibody or fragment having immunological activity thereof. According to claim 1, wherein the VH domain comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 46 to 49; And a VL domain comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 50 to 54, AIMP2 specific antibody or fragment having immunological activity thereof. According to claim 1, wherein the heavy chain comprising any one selected from the group consisting of the amino acid sequence of SEQ ID NOs: 55 to 58; And a light chain comprising any one selected from the group consisting of amino acid sequences of SEQ ID NOs: 59 to 63, AIMP2 specific antibody or fragment having immunological activity thereof. According to claim 1, wherein AIMP2 is an AIMP2 monomer (monomer) or AIMP2 aggregate, AIMP2 specific antibody or fragment having immunological activity thereof. The method according to claim 8, wherein the antibody or fragment having immunological activity specific for the AIMP2 monomer comprises:
(i) a VH domain comprising a CDRH1 comprising the amino acid sequence of SEQ ID NO: 2, a CDRH2 comprising the amino acid sequence of SEQ ID NO: 5, and a CDRH3 comprising the amino acid sequence of SEQ ID NO: 8; and
(ii) a V domain comprising a VL domain comprising a CDRL1 comprising the amino acid sequence of SEQ ID NO: 11 or 12, a CDRL2 comprising the amino acid sequence of SEQ ID NO: 15, and a CDRL3 comprising the amino acid sequence of SEQ ID NO: 18 which, an antibody specific for AIMP2 or a fragment having immunological activity thereof. The method of claim 8, wherein the antibody or fragment having immunological activity specific for the AIMP2 aggregate comprises:
(i) a VH domain comprising a CDRH1 comprising the amino acid sequence of SEQ ID NO: 1, a CDRH2 comprising the amino acid sequence of SEQ ID NO: 4, and a CDRH3 comprising the amino acid sequence of SEQ ID NO: 7; and
(ii) a V domain comprising a VL domain comprising a CDRL1 comprising the amino acid sequence of SEQ ID NO: 10, a CDRL2 comprising the amino acid sequence of SEQ ID NO: 14, and a CDRL3 comprising the amino acid sequence of SEQ ID NO: 17; An antibody specific for AIMP2 or a fragment having immunological activity thereof. The method according to claim 8, wherein the antibody or fragment having immunological activity specific for the antibody or fragment having immunological activity thereof is specific for AIMP2 monomer and AIMP2 aggregate:
(i) a VH domain comprising a CDRH1 comprising the amino acid sequence of SEQ ID NO: 3, a CDRH2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDRH3 comprising the amino acid sequence of SEQ ID NO: 9; and
(ii) a V domain comprising a VL domain comprising a CDRL1 comprising the amino acid sequence of SEQ ID NO: 13, a CDRL2 comprising the amino acid sequence of SEQ ID NO: 16, and a CDRL3 comprising the amino acid sequence of SEQ ID NO: 19; An antibody specific for AIMP2 or a fragment having immunological activity thereof. According to claim 1, wherein the fragment having immunological activity is Fab, Fd, Fab', dAb, F(ab'), F(ab') ₂ , scFv (single chain fragment variable), Fv, single chain antibody, Fv Any one selected from the group consisting of dimers, complementarity determining region fragments, humanized antibodies, chimeric antibodies, and diabodies, AIMP2 specific antibody or fragment having immunological activity thereof. An isolated nucleic acid molecule encoding the antibody of claim 1 or a fragment having immunological activity thereof. A vector comprising the isolated nucleic acid molecule of claim 13 . A host cell transformed with the vector of claim 14 . A pharmaceutical composition for preventing or treating neurodegenerative diseases comprising the antibody of claim 1 or a fragment having immunological activity as an active ingredient. 17. The method of claim 16, wherein the neurodegenerative disease is Parkinson's disease, Huntington's disease, multiple system nerve atrophy, amyotrophic lateral sclerosis, Lou Gehrig's disease, polyglutamine ectasia, spinocerebellar ataxia, spinal and soft muscle atrophy, tauosis, muscle tone Abnormalities, serpin deficiency, cirrhosis, type II diabetes, primary systemic amyloidosis, secondary systemic amyloidosis, pronto-transient dementia, geriatric systemic amyloidosis, familial amyloid polyneuropathy, hereditary cerebral amyloid vasculopathy, hemodialysis-associated amyloidosis, macular degeneration, Dementia, Alzheimer's disease, familial AD, Lewy body dementia, radiation therapy-induced dementia, boxer's dementia, Down syndrome, Gerstmann-Straussler-Scheinker disease, inclusion body myositis, prion protein brain amyloid angiopathy, axon injury , Acute diffuse cortical suppression, alpha-synucleinic condition, Parkinsonism-dementia complex of Guam, non-Gammanian motor neuron disease with nerve fiber entanglement, silver-affinity particle disease, cortical basal degeneration, diffuse nerve with calcification Fibrous entanglement, frontotemporal dementia with Parkinsonism associated with chromosome 17, Hallerforden-Spatz disease, stroke, cerebral infarction, head trauma, cerebral atherosclerosis, cerebral ischemia, permanent midcerebral ischemia, peripheral nerve regeneration, superimposed post-epileptic model, spinal cord injury , Niemann-Pick disease type C, Palido-Ponto-Nigral degeneration, Pick's disease, progressive subcortical gliosis, progressive supranuclear palsy, subacute sclerosing panencephalitis, dementia with tangles only, mild cognitive impairment, post encephalitis parkinsonism, myotonia Sexual dystrophy, tau panencephalopathy, AD-like syndrome with astrocytes, senile cardiac amyloidosis, endocrine tumors, glaucoma, ocular amyloidosis, primary retinal degeneration, optic nerve drusen, optic neuropathy, optic neuritis, and lattice dystrophy, sporadic Lou Gehrig and Creutzfeldt- At least one selected from the group consisting of Jacob's disease, a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases. A composition for diagnosing neurodegenerative diseases comprising the antibody of claim 1 or a fragment having immunological activity thereof. A neurodegenerative disease diagnostic kit comprising the composition of claim 18. An information providing method for diagnosing a neurodegenerative disease comprising detecting an AIMP2 monomer or an AIMP2 aggregate in a biological sample isolated from a subject using the antibody of claim 1 or a fragment having immunological activity thereof. 21. The method of claim 20, wherein the neurodegenerative disease is Parkinson's disease, Huntington's disease, multiple system nerve atrophy, amyotrophic lateral sclerosis, Lou Gehrig's disease, polyglutamine ectasia, spinocerebellar ataxia, spinal and soft muscle atrophy, tauosis, muscle tone Abnormalities, serpin deficiency, cirrhosis, type II diabetes, primary systemic amyloidosis, secondary systemic amyloidosis, pronto-transient dementia, geriatric systemic amyloidosis, familial amyloid polyneuropathy, hereditary cerebral amyloid vasculopathy, hemodialysis-associated amyloidosis, macular degeneration, Dementia, Alzheimer's disease, familial AD, Lewy body dementia, radiation therapy-induced dementia, boxer's dementia, Down syndrome, Gerstmann-Straussler-Scheinker disease, inclusion body myositis, prion protein brain amyloid angiopathy, axon injury , Acute diffuse cortical suppression, alpha-synucleinic condition, Parkinsonism-dementia complex of Guam, non-Gammanian motor neuron disease with nerve fiber entanglement, silver-affinity particle disease, cortical basal degeneration, diffuse nerve with calcification Fibrous entanglement, frontotemporal dementia with Parkinsonism associated with chromosome 17, Hallerforden-Spatz disease, stroke, cerebral infarction, head trauma, cerebral atherosclerosis, cerebral ischemia, permanent midcerebral ischemia, peripheral nerve regeneration, superimposed post-epileptic model, spinal cord injury , Niemann-Pick disease type C, Palido-Ponto-Nigral degeneration, Pick's disease, progressive subcortical gliosis, progressive supranuclear palsy, subacute sclerosing panencephalitis, dementia with tangles only, mild cognitive impairment, post encephalitis parkinsonism, myotonia Sexual dystrophy, tau panencephalopathy, AD-like syndrome with astrocytes, senile cardiac amyloidosis, endocrine tumors, glaucoma, ocular amyloidosis, primary retinal degeneration, optic nerve drusen, optic neuropathy, optic neuritis, and lattice dystrophy, sporadic Lou Gehrig and Creutzfeldt- At least one selected from the group consisting of Jacob's disease, an information providing method for diagnosing neurodegenerative diseases. 1) reacting the candidate compound with the AIMP2 aggregate;
2) quantifying AIMP2 aggregates using the antibody of claim 10 or 11 or a fragment having immunological activity thereof; and
3) A method for screening a substance that inhibits or inhibits the formation of AIMP2 aggregates, comprising the step of selecting a compound with a reduced amount of AIMP2 aggregates compared to a control group not treated with the candidate compound. 1) reacting the candidate compound with AIMP2 expressing cells or AIMP2 aggregates;
2) quantifying the expression level of AIMP2 or the amount of AIMP2 aggregates using the antibody of claim 1 or a fragment having immunological activity thereof; and
3) A screening method for a therapeutic agent for a neurodegenerative disease, comprising the step of selecting a compound having a reduced amount of AIMP2 expression or AIMP2 aggregate compared to a control group not treated with the candidate compound.

Images