KR20220073327A - Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe - Google Patents

Abstract

The present invention relates to a real-time multiplex LAMP primer set for differential detection of Candida albicans , Candida auris , and Candida glabrata , , since it was produced based on the 18s-28s rRNA gene sequence including the ITS2 region, the electrophoresis process is unnecessary compared to conventional PCR and real time PCR-based detection, and there is no temperature change required for the test, so Candida detection time This short, economical and lightweight device has the advantage of being available. In addition, the present invention maintains the accuracy of diagnosis in that it can detect and simultaneously detect Candida albican, Candida auris, and Candida glabrata in one tube using an additional fluorescent probe and a quencher of a complementary sequence. Since it is advantageous in terms of time and cost, it is expected to be used as a molecular diagnostic test method replacing the existing fungal detection method.

Description

A primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe}

The present invention is a multiplex loop-mediated isothermal amplification that can discriminate and detect Candida albicans , Candida auris , and Candida glabrata using a fluorescent probe reaction, multiplex LAMP) primer set.

Sepsis is a syndrome in which various pathogenic bacteria penetrate into the blood and infect various organs, resulting in a systemic inflammatory reaction. with a sharp increase in mortality. According to a recent study, the sepsis mortality rate in developed countries such as the United States and the United Kingdom has decreased by 0.9% per year for the past 20 years, while the sepsis incidence rate in Koreans has risen by 50% over the past five years, from 233 per 100,000 in 2008 to 347 in 2012. Confirmed.

According to reports so far, Candida albicans is a major causative agent of nosocomial bloodstream infections, and mortality increases as antifungal treatment is delayed. The mortality rate due to candidiasis was as high as 40-54%. Candida auris , which the U.S. Centers for Disease Control and Prevention (CDC) recently warned of the possibility of global spread, was first discovered in Japan in 2009, and then in 30 countries including Korea, the U.S., India, Israel, the U.K., Spain, and Kuwait. The above confirmed cases of infection, and the US CDC upgraded Candida auris to emergency in April before issuing a warning about the possibility of spread due to the high possibility that Candida auris is multidrug-resistant to various antifungal drugs. made it Early and accurate diagnosis of Candida is very important for rapid antifungal treatment for Candida-infected patients.

Until now, blood culture is still considered as the optimal standard test for the diagnosis of candidaemia. It takes 4 days and usually shows a low sensitivity of about 63-83%. To this end, various non-culture-based diagnostic methods such as mannan, (1-3)-β-d-glucan, and PCR have been developed, but detection methods using mannan and BDG have been reported in many cases with low specificity. Although the detection specificity is high, there is a disadvantage in that it is difficult to detect when the fungus is present at a low concentration in the sample. In the case of PCR detection, various techniques such as standard, nested, real-time, and reverse transcriptase PCR were used to detect the fungus, but all of them were confirmed to be detectable only when the fungus of at least 10 CFU/ml was present. Therefore, if the fungus in the blood is separated and concentrated and a high-sensitivity PCR method is developed, it is thought that the detection sensitivity of the fungus present in the blood at a low concentration can be greatly improved.

Recently, a loop-mediated isothermal amplification reaction (LAMP) that amplifies genes at a constant temperature without temperature change has been developed. The LAMP uses 6 primers complementary to the template to recognize 8 different sites and proceed with gene amplification. Compared with the existing PCR method, the time required for the test can be shortened in that amplification can be performed without temperature change, and the test can be performed without expensive equipment for temperature change. LAMP has been applied to infectious diseases with the above-mentioned advantages, but a test method for diagnosing three Candida species simultaneously with multiplex LAMP has not been developed. Accordingly, the present inventors completed the present invention by intensively studying a method for simultaneously differentially detecting Candida albican, Candida auris, and Candida glabrata using the multiplex LAMP method.

Norihiro, T. et. al. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature protocols. 2008;3:5.

The technical object of the present invention is to provide a multiplex LAMP primer set for differential detection of three Candida species (Candida albican, Candida auris, Candida glabrata) and a kit comprising the same, An object of the present invention is to provide a method for discriminating and detecting the three types of Candida by using a primer set and a kit.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to solve the above problems, the present invention includes a primer of SEQ ID NO: 1 to 6 and a probe of SEQ ID NO: 7 (Candida albican primer set), and a primer of SEQ ID NO: 8 to 13 and a probe of SEQ ID NO: 14 (Candida au Lys primer set), including the primers of SEQ ID NOs: 15 to 20 and the probes of SEQ ID NO: 21 (Candida glabrata primer set), Candida albicans , Candida auris , and Provides a multiplex loop-mediated isothermal amplification reaction (multiplex LAMP) primer set for differential detection of Candida glabrata .

In one embodiment of the present invention, the probes of SEQ ID NOs: 7, 14, and 21 may have a fluorescent material attached to the 5' end. In this case, the fluorescent material may emit different wavelengths to differentially detect the three kinds of Candida bacteria.

In another embodiment of the present invention, the fluorescent material is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), HEX (2',4',5',7'-tetrachloro-6 -carboxy-4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate) ), oregon green, alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro-Fluorescein), TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dye and thiadicarbocyanine It may be any one or more selected from the group.

As another embodiment of the present invention, the probe of SEQ ID NO: 7 has HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein) attached to the 5' end, Cy5 may be attached to the 5' end of the probe of SEQ ID NO: 14, and Texas RED may be attached to the 5' end of the probe of SEQ ID NO: 21. In this case, the probe of SEQ ID NO: 7 has a higher sensitivity than that of FAM attached to the 5' end, and Cy5.5 may be attached to the 5' end of the probe of SEQ ID NO: 14 instead of Cy5.

In one embodiment of the present invention, the probes of SEQ ID NOs: 7, 14, and 21 may each include a quencher.

As another embodiment of the present invention, the quenching material is IABkFQ (Iowa black FQ quencher), IAbRQSp (Iowa black RQ quencher), DABCYL (4-dimethylaminoazobenzene-4'-sulfonyl chloride), BHQ (Black Hole Quencher), EBQ ( Excellent Bioneer Quencher), and ZEN-IBFQ (ZEN-Iowa Black FQ) may be any one or more selected from the group consisting of.

In addition, the present invention provides Candida albican, Candida auris, and Candida glas comprising a multiplex LAMP primer set for differential detection of three Candida species including the Candida albican, Candida auris, and Candida glabrata primer sets. A kit for differential detection of Brata is provided.

In one embodiment of the present invention, the kit may further include a reagent for performing an amplification reaction, and the reagent may include one or more selected from the group consisting of DNA polymerase, dNTPs, and a buffer.

In addition, the present invention comprises the steps of (1) isolating genomic DNA (gDNA) from a biological sample; (2) using the isolated gDNA as a template and performing an isothermal amplification reaction using a multiplex LAMP primer set for differential detection of three Candida bacteria including the Candida albican, Candida auris, and Candida glabrata primer sets amplifying the target sequence; and (3) detecting the amplified product.

In one embodiment of the present invention, the biological sample may be one or more selected from the group consisting of blood, sputum, bronchial aspiration, oral cavity swab, and urine. have.

In another embodiment of the present invention, the primer set in step (2) may further include an internal control primer.

As another embodiment of the present invention, step (3) may be performed by one or more methods selected from the group consisting of DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, and phosphorescence measurement, but preferably fluorescence measurement can depend on the method.

In another embodiment of the present invention, in the method, after step (3), (i) the product amplified by the Candida albican primer set is detected, but the product amplified by the Candida auris and Candida glabrata primer set in Candida albican if not detected, (ii) the product amplified by the Candida auris primer set is detected, but the product amplified by the Candida albican and Candida glabrata primer sets is not detected in Candida auris (iii) determining that the patient is infected with Candida glabrata when the product amplified by the Candida glabrata primer set is detected but the product amplified by the Candida albican and Candida auris primer sets is not detected; may additionally include.

As another embodiment of the present invention, the method may include the step of interpreting as negative when the amplification product by the internal control primer is detected after step (3) and the amplification product by the other primer set is not detected after step (3). .

In another embodiment of the present invention, the method further comprises quantifying Candida albican, Candida auris and/or Candida glabrata by measuring the detection time of step (3) after step (3). can do. The "quantification" may be to quantify the fluorescent substance detection time according to the DNA concentration compared to a standard curve when performing an amplification reaction using the primer set according to the present invention, and preferably, the amplification product of step (c) is fluorescence By detecting using an indicator, the detection time of the fluorescent substance may be measured to quantify the DNA concentration.

In another embodiment of the present invention, RNA is extracted from a biological sample, reverse transcription is performed using the RNA as a template to synthesize total cDNA, and then the Candida albican, Candida auris, and Candida glas are used as a template. The isothermal amplification reaction can be performed using the multiplex LAMP primer set including the Brata primer set.

The present invention relates to a real-time multiplex LAMP primer set for differential detection of Candida albicans , Candida auris , and Candida glabrata , , since it was produced based on the 18s-28s rRNA gene sequence including the ITS2 region, the electrophoresis process is unnecessary compared to conventional PCR and real time PCR-based detection, and there is no temperature change required for the test, so Candida detection time This short, economical and lightweight device has the advantage of being available. In addition, the present invention maintains the accuracy of diagnosis in that it can detect and simultaneously detect Candida albican, Candida auris, and Candida glabrata in one tube using an additional fluorescent probe and a quencher of a complementary sequence. Since it is advantageous in terms of time and cost, it is expected to be used as a molecular diagnostic test method replacing the existing fungal detection method.

1 shows the location of the 18s rRNA sequence-specific LAMP primer set, which is a target gene of Candida albicans .
Figure 2 shows the position of the LAMP primer set specific to the 28s rRNA sequence, which is a target gene of Candida auris .
Figure 3 shows the position of the 18s rRNA sequence-specific LAMP primer set, which is a target gene of Candida glabrata .
FIG. 4 shows 7 Candida species (Candida albican, Candida auris, Candida glabrata, Candida tropicalis) using the LAMP primer set of three Candida species (Candida albican, Candida auris, and Candida glabrata). ( Candida tropicalis ), Candida krusei ( Candida krusei ), Candida parapsilosis ( Candida parapsilosis ), and Candida guilliermondii ( Candida guilliermondii ) and distilled water (DW) for Candida simultaneous multiple isothermal amplification (multiplex) LAMP) shows the detection test results of the primer set. As fluorescent probes of the primer set, HEX (Candida albican), Cy5 (Candida auris), and Texas Red (Candida glabrata) were used.

The present inventors completed the present invention by intensively researching a method for rapidly and accurately discriminating and diagnosing Candida infection in the field.

Specifically, the present invention produces a primer set based on multiplex real time LAMP, unlike conventional PCR and real time PCR detection, by producing a primer set based on Candida albicans , Candida aureus. Res ( Candida auris ) and Candida glabrata ( Candida glabrata ) By simultaneously detecting bacteria, the time required for analysis was dramatically reduced compared to the real-time PCR method and the conventional PCR method.

In addition, the present invention is an invention that reduces the time required for analysis of results that can be generated by the conventional PCR method and reduces the change in temperature, thereby providing a basis for using a simpler and lighter apparatus compared to the conventional PCR apparatus. In addition, since it can be tested in multiplex, Candida albicans , Candida auris , and Candida glabrata can all be detected at once. Compared to the LAMP method of

Specifically, the present invention provides a primer set that specifically acts on Candida albicans ( C. albicans ) (C. albicans LAMP primer set), a primer set that specifically acts on Candida auris ( C. auris ) (C. auris LAMP primer set), and a primer set that specifically acts on Candida glabrata (C. glabrata LAMP primer set). In addition, the present invention provides a composition for differential detection of three Candida species (Candida albican, Candida auris, and Candida glabrata) comprising the primer set. SEQ ID NOs: 1 to 7 of Table 1 are primer sets including six primers and one probe for detecting Candida albican, and SEQ ID NOs: 8 to 14 are six primers and one probe for detecting Candida auris A primer set comprising: SEQ ID NOs: 15 to 21 are primer sets including six primers and one probe for detecting Candida glabrata. The primer set of Table 1 and the composition including the same can be used for the differential detection method of Candida albican, Candida auris, and Candida glabrata using the multiplex LAMP method.

In the present invention, the term “detection” refers to the determination of the presence or absence of microorganisms or the relative amount of microorganisms, or the determination of the location of microbial infection, wherein the microorganism is a microscopic organism including a single cell, a cell cluster, or a multicellular organism. Specifically, it means viruses, fungi (fungi), protozoa, and bacteria (bacteria).

In the present invention, the term "differentiation" refers to distinguishing or discriminating a specific microorganism, and in particular, in the sense of accurately discriminating which microorganism is infected among microorganisms sharing some similar characteristics, in the present invention, "differential detection is performed" used the term.

In the present invention, the term “loop-mediated isothermal amplification (LAMP)” refers to a method of performing a reaction under isothermal conditions using polymerases such as Bst and Gsp that do not require a PCR cycle unlike the existing PCR method, Basically, by using four primers, both ends are synthesized into a loop structure to infinitely amplify a specific region of a gene, and the amplified DNA product is used for fluorescence detection or a precipitation reaction to confirm amplification. As such, a reagent for detecting fluorescence may be preferably used, but is not limited thereto. In addition, in the present invention, the "real time multiple isothermal amplification reaction (real time LAMP)" is a method of confirming the presence or absence of amplification in real time, and various genes can be simultaneously detected, preferably Candida albican, Candida auris and/or Candida glabrata can be simultaneously detected and discriminated, but is not limited thereto.

The primer set of the present invention is preferably used for isothermal amplification (LAMP; Loop-mediated isothermal amplification), and the isothermal amplification reaction may be a one-step LAMP amplifying target DNA by LAMP, It may be a real-time LAMP (real-time LAMP), or a combination thereof.

As used herein, the term "primer" refers to a template under suitable conditions (eg, four different nucleoside triphosphates and a polymerization agent such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and at an appropriate temperature. - Refers to single-stranded oligonucleotides that can serve as a starting point for directing DNA synthesis. The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence need not be completely complementary to the template, but must be sufficiently complementary to hybridize to the template.

The primer of the present invention can be chemically synthesized using methods known in the art, such as, for example, a phosphoramidite solid support method. In addition, it can be modified by methylation, capping, etc. by a known method. In addition, if necessary, the primer of the present invention may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (eg horseradish peroxidase, alkaline phosphatase), radioactive isotopes (eg ³² P), fluorescent molecules, chemical groups (eg biotin), and the like. There is this.

As used herein, the term “inner primer” refers to a single-stranded oligonucleotide capable of binding to a template DNA and serving as a starting point for synthesis of a new DNA chain.

In the present invention, the term “outer primer” refers to a single-stranded oligonucleotide that binds to the template DNA outside the position where the inner primer binds to the template DNA. After this elongation, a strand displacement occurs due to the binding of the external primer and the template DNA, and the previously formed chain is separated.

In the present invention, the term “loop primer” means that the initial stem loop structure chain formed by binding the inner primer and the outer primer to the template DNA increases the number of loop structures and consequently the entire It refers to a single-stranded oligonucleotide that can act as a starting point for nucleotide synthesis, allowing the reaction to be accelerated.

In the present invention, F3 (Forward 3) primer, B3 (Backward 3) primer, FIP (Forward Internal Primer) primer, BIP (Backward Internal Primer) primer, LF (Loop Forward) primer, LB (Loop Backward) primer, forward (forward) ) primer, reverse primer, etc. were used.

In the present invention, the term 　 "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases as short as possible to achieve specific binding to a gene or mRNA, oligonucleotide 　 probe , single-stranded DNA probe, double-stranded DNA probe, RNA probe, etc., and can be labeled for easier detection, but is not particularly limited thereto.

The fluorescent material attached to the probe is not limited as long as it emits fluorescence, but non-limiting examples thereof include FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein, HEX (2',4). ',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl Rhodamine (tetramethyl rhodamine), FITC (fluorescein isothiocyanate), Oregon green, Alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein) , ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro-Fluorescein), TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N- (1-Naphthyl) ethylenediamine), cyanine-based dyes and thiadicarbocyanine. In the present invention, LAMP primer/probe sets for Candida albican, Candida auris, and Candida glabrata are labeled with HEX, Cy5, and Texas Red, respectively, so that three Candida species can be simultaneously detected in one tube. have.

A quencher (quencher) may be attached to the probe, and the quencher is IABkFQ (Iowa black FQ quencher), IAbRQSp (Iowa black RQ quencher), DABCYL (4-dimethylaminoazobenzene-4'-sulfonyl chloride), BHQ (Black Hole Quencher; BHQ-1, BHQ-2, etc.), EBQ (Excellent Bioneer Quencher), or ZEN-IBFQ (ZEN-Iowa Black FQ), but is not limited thereto, and various matting materials known in the art can be used In the present invention, BHQ1 or BHQ2 may be preferably used, and BHQ1 may be used when the fluorescent material is HEX, FAM, or TEX, and BHQ2 may be used when Cy5 is used.

In the present invention, the term “biological sample” refers to cells of various parts of the body, including blood, sputum, bronchial aspiration, oral cavity swab, urine, or the like. may include organizations.

The present invention can apply various transformations and can have various embodiments. Hereinafter, specific embodiments are illustrated in the drawings and described in detail in the detailed description. However, this is not intended to limit the present invention to specific embodiments, and should be understood to include all modifications, equivalents, and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of a related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

Example 1: LAMP primer set for detection of three Candida species (Candida albican, Candida auris, Candida glabrata), polymerase chain reaction mixture composition and reaction conditions

Candida albican LAMP primer set designed based on the nucleotide sequence of Candida albican 18s rRNA gene (Fig. 1), Candida auris LAMP primer set designed based on the nucleotide sequence of Candida auris 28s rRNA gene (Fig. 2), and the Candida glabrata LAMP primer set (FIG. 3) designed based on the nucleotide sequence of the Candida glabrata 18s rRNA gene and the reference thesis primer set (real-time PCR and LAMP) are shown in Table 1. In Table 1 below, bases marked with fluorescent materials are underlined. The composition of the RT-LAMP primer mixture is shown in Table 2, the reagent composition of the RT-LAMP reaction mixture is shown in Table 3, and the RT-LAMP reaction conditions are shown in Table 4.

SEQ ID NO: target gene Name Sequence (5'-3') Reference One Candida albicans
(18s rRNA) Candida albicans_F3 CGATACGTAATATGAATTGCAGAT 2 Candida albicans_B3 AGACCTAAGCCATTGTCAA 3 Candida albicans_FIP AACGACGCTCAAACAGGCATCGTGAATCATCGAATCTTTGAAC 4 Candida albicans_BIP CTGGGTTTGGTGTTGAGCAAATCCCGCCTTACCACTAC 5 Candida albicans_LF CAGAGGGCGCAATGTGC 6 Candida albicans_LB ACGACTTGGGTTTGCTTGAAAA 7 Candida albicans_LB_P4_HEX CGGGCCCGTACAAAGGGAACACCCACACTCCG
ACGACTTGGGTTTGCTTGAAAA 8 Candida auris
(28s rRNA) Candida auris_F3 GGATTGCCTCAGTAACGGC 9 Candida auris_B3 GCTGCATTCCCAAACAACTC 10 Candida auris_FIP TGGTGGCCACCTCCAGACTACGAGTGAAGCGGCAAGAGC 11 Candida auris_BIP TAGCAGCAGGCAAGTCCTTTGGGCCACAGGAAGCACTAGC 12 Candida auris_LB AACAAGGCGCCAGCGA 13 Candida auris_LF CGGAGCGATTCCAAAGTTGA 14 Candida auris_LF_P2_CY5 GTCAGTGCAGGCTCCCGTGTTAGGACGAGGGTAGG
CGGAGCGATTCCAAAGTTGA 15 Candida glabrata
(18s rRNA) C. glabrata_F3 TCAGTATGTGGGACACGA 16 C. glabrata_B3 CGGGTAACCCTACCTGAT 17 C. glabrata_FIP CCTAATACAGTATTAACCCCCGCGCAAGCTTCTCTATTAATCTGC 18 C. glabrata_BIP CCAACTCGGTGTTGATCTAGGGTTGAGGTCAAACTTAAAGACG 19 C. glabrata_LB TAAGTGAGTGTTTTGTGCGTGCTGG 20 C. glabrata_LF GCTCGCGCAAACGAGCA 21 C. glabrata_LF_P4_TEX CGGGCCCGTACAAAGGGAACACCCACACTCCG
GCTCGCGCAAACGAGCA 22 lamp_PROBE2_QUENCHER CCT ACC CTC GTC CTA ACA CGG GAG CCT GCA CTG AC-BHQ2 23 lamp_PROBE4_QUENCHER GAG TGT GGG TGT TCC CTT TGT ACG GGC CCG-BHQ1 24 Reference
C. albicans
real-time PCR C. albicans
real-time PCR-f CTTGGTATTTTGCATGTTGCTCTC One 25 C. albicans
real-time PCR-r GTCAGAGGCTATAACACACAGCAG 26 C. albicans
real-time PCR-p TTTACCGGGCCAGCATCGGTTT 27 Reference
C. auris
real-time PCR C. auris
real-time PCR-f CGTGATGTCTTCTCACCAATCT 2 28 C. auris
real-time PCR-r TACCTGATTTGAGGCGACAAC 29 C. auris
real-time PCR-p GCGGTGGCGTTGC 30 Reference
C. glabrata
real-time PCR C. glabrata
real-time PCR-f GCGCCCCTTGCCTCTC One 31 C. glabrata
real-time PCR-r CCCAGGGCTATAACACTCTACACC 32 C. glabrata
real-time PCR-p TGGGCTTGGGACTCTCGCAGC 33 Reference
C. albicans
LAMP Reference Candida albicans_F3 TCTGGTATTCCGGAGGGC 3 34 Reference Candida albicans_B3 AGTCCTACCTGATTTGAGGT 35 Reference Candida albicans_FIP CTACCGTCTTTCAAGCAAACCCATGAGCGTCGTTTCTCCCT 36 Reference Candida albicans_BIP TTGACAATGGCTTAGGTCTAACCAAAAGATATACGTGGTGGACGTTAC 37 Reference Candida albicans_LB CTCAACACCAAACCCAGCGG 38 Reference
C. auris
LAMP Reference Candida auris_F3 GGGAAAGGAACCCTGACCT 4 39 Reference Candida auris_B3 GGACACAGCATTCGAAGTGT 40 Reference Candida auris_FIP AGGCTACTGAGCTTGCTGGTGTAACCAAACCAACAGGAGAGG 41 Reference Candida auris_BIP ACGGTTTCAGGGTTAGCATGGCTCAACAAAGTCGCTGGTACA 42 Reference Candida auris_LF CATCTCGAAGGCCTCGGT 43 Reference Candida auris_LB CACATACTCGAACGGAGTC 44 Reference
C. glabrata
LAMP Reference C. glabrata_F3 TGGTAGTGAGTGATACTCGTT 3 45 Reference C. glabrata_B3 CTTAAAGACGTCTGTCTGCC 46 Reference C. glabrata_FIP GCAGATTAATAGAGAAGCTTGCGCTGAGTTAACTTGAAATTGTAGGCC 47 Reference C. glabrata_BIP GCGGCGGGGGTTAATACTGTCACAAAACACTCACTTATCCCT 48 Reference C. glabrata_LF GGTTTTACCAACTCGGTGTTGATCT

References in Table 1 are as follows.

(1) Brinkman NE, Haugland RA, Wymer LJ, Byappanahalli M, Whitman RL, Vesper SJ. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water. Appl Environ Microbiol . 2003;69(3):1775-82.

(2) Lima A, Widen R, Vestal G, Uy D, Silbert S. A TaqMan probe-based real-time PCR assay for the rapid identification of the emerging multidrug-resistant pathogen Candida auris on the BD Max system. J Clin Microbiol . 2019;57(7):e01604-18.

(3) Kasahara K, Ishikawa H, Sato S, Shimakawa Y, Watanabe K. Development of multiplex loop-mediated isothermal amplification assays to detect medically important yeasts in dairy products. FEMS Microbiol Lett . 2014;357(2):208-16.

(4) Yamamoto M, Alshahni MM, Tamura T, Satoh K, Iguchi S, Kikuchi K, Mimaki M, Makimura K. Rapid detection of Candida auris based on loop-mediated isothermal amplification (LAMP). J Clin Microbiol . 2018;56(9):e00591-18.

C. albicans LAMP primer uM C. auris LAMP primer uM C. glabrata LAMP primer uM Candida albicans_F3 4 Candida auris_F3 4 C. glabrata_F3 4 Candida albicans_B3 4 Candida auris_B3 4 C. glabrata_B3 4 Candida albicans_FIP 32 Candida auris_FIP 32 C. gabrata_FIP 32 Candida albicans_BIP 32 Candida auris_BIP 32 C. glabrata_BIP 32 Candida albicans_LF 10 Candida auris_LB 10 C. glabrata_LB 10 Candida albicans_LB 6 Candida auris_LF 6 C. glabrata_LF 6 Candida albicans_LB_P4_HEX 4 Candida auris_LF_P2_CY5 4 C. Glabrata_LF_P4_TEX 4

division volume RM 12.5 EM 2 Distilled water 0.3 Primer mix 1 (Candida albicans) 1 (Candida auris) 1 (Candida glabrata) QUENCHER (P4) 1.5 QUENCHER (P2) 0.7 Template 5 TOTAL 25

Experiment 1. One-step RT-LAMP detection experiment temperature reaction time 60 ℃ 1 minute 50 Cycles total reaction time 50 minutes

Example 2: Specificity test of Candida three LAMP primer sets against various Candida bacteria

7 species of Candida ( Candida albicans ( C. albicans ), Candida auris ( C. auris ), Candida glabrata ( C. glabrata ), Candida krusei ( C. krusei ), Candida tropicalis ( C. tropicalis ), Candida parapsilosis ( C. parapsilosis ), and Candida guilliermondii ( C. guilliermondii ) The performance of the multiplex LAMP primer set against three Candida species (Candida albican, Candida auris, Candida glabrata) was evaluated. As a result, the multiplex LAMP primer set for three types of Candida specifically detected only the target Candida without a non-specific reaction in all samples ( FIGS. 4 and 5 ).

Samples C. albicans (Hex) C. auris (Cy5) C. glabrata (Texas Red) Ct RFU Ct RFU Ct RFU C. albicans DNA 18.24 7015 N/A 353 N/A 87.4 C. glabrata DNA N/A 97.6 N/A 996 17.97 11210 C. krusei DNA N/A 1.33 N/A 9.13 N/A -1.23 C. tropicalis DNA N/A 0.192 N/A 11 N/A -3.56 C. parapsilosis DNA N/A 0.202 N/A 10.9 N/A -2.4 C. guilliermondii DNA N/A 2.76 N/A 12.5 N/A -1.88 C. auris DNA N/A 57.2 16.96 7487 N/A 133 DW N/A 0.658 N/A 12.4 N/A -1.5

Example 3: Sensitivity test of Candida three LAMP primer sets

DNA samples of Candida albican, Candida auris, and Candida glabrata were diluted from 1 ng/μl to 1 fg/μl, and Candida monoplex and multiplex LAMP primer sets, Candida 3 strains RT-PCR and LAMP primer sets published in the paper and sensitivities were compared (Table 6, Table 7, and Table 8). For Candida albican, both the monoplex and multiplex LAMP primer sets of the present invention were detected up to 100 fg/μl, but the reference Candida albican real-time PCR primer and reference Candida albican LAMP primer set detected up to 1 pg/μl. In the case of Candida auris, all of the primer sets of the present invention were detected up to 1 pg/μl, the reference Candida auris real-time PCR primer was detected up to 1 pg/μl, and the reference Candida auris LAMP primer set was detected up to 10 pg/μl. did In the case of Candida glabrata, it was confirmed that the monoplex primer set of the present invention was amplified up to 100 fg/μl, and in the case of the multiplex primer set of the present invention up to 1 pg/μl, and the reference Candida glabrata real-time PCR primer was Up to 1 pg/μl, the reference Candida glabrata LAMP primer set was detected up to 10 pg/μl. Overall, the Candida multiplex LAMP primer set of the present invention was similar to the Candida albicans and auris monoplex results except for Candida glabrata, which showed a lower sensitivity, and compared to the previously published Candida real-time primer set and LAMP primer set. It was fast and showed high sensitivity.

Candida albicans DNA Development of C. albicans LAMP Monoplex Developed Candida 3 LAMP Multiplex Reference RT-PCR
Primer set Reference RT-LAMP
Primer set CT RFU CT RFU CT RFU CT RFU DNA 1 ng/ul 14.01 14620 18.42 5714 18.34 10348 11.43 14696 DNA 100 pg/ul 15.63 15101 21.99 5595 23.49 9345 13.81 12199 DNA 10 pg/ul 18.04 14901 25.62 5652 29.34 6077 16.01 11227 DNA 1 pg/ul 20.44 15605 28.31 5714 32.85 3468 16.1 14422 DNA 100 fg/ul 31.44 14912 33.09 5647 N/A 195 N/A 143 DNA 10 fg/ul N/A 6.81 N/A 2.21 N/A 2.23 N/A 177 DNA 1 fg/ul N/A 274 N/A 3.74 N/A 4.24 N/A 91.7 DW N/A 6.2 N/A 2.53 N/A -3.33 N/A -48.1

C. auris DNA Development of C. auris LAMP Monoplex Developed Candida 3 LAMP Multiplex Reference RT-PCR
Primer set Reference RT-LAMP
Primer set CT RFU CT RFU CT RFU CT RFU DNA 1 ng/ul 12.65 8856 16.01 6673 21.85 27011 11.88 28289 DNA 100 pg/ul 14.67 8706 18.39 7137 26.67 22426 12.57 22962 DNA 10 pg/ul 17.11 8852 21.35 7134 31.34 14985 14.46 20500 DNA 1 pg/ul 20.17 8702 25.16 6918 35.98 6039 N/A 77.3 DNA 100 fg/ul N/A 14.3 N/A 8.62 N/A 856 N/A 37.4 DNA 10 fg/ul N/A 16.9 N/A 12.3 N/A 129 N/A 64.9 DNA 1 fg/ul N/A 14 N/A 11.4 N/A 177 N/A 53.4 DW N/A 15.1 N/A 2.57 N/A 59.4 N/A 161

C. glabrata DNA Development of C. glabrata LAMP Monoplex Developed Candida 3 LAMP Multiplex Reference RT-PCR
Primer set Reference RT-LAMP
Primer set CT RFU CT RFU CT RFU CT RFU DNA 1 ng/ul 13.22 11478 17.91 9698 21.32 7358 24.02 18252 DNA 100 pg/ul 15 12370 20.55 10034 25.96 6097 26.46 14704 DNA 10 pg/ul 17.61 12127 23.91 9775 31.03 3699 N/A 149 DNA 1 pg/ul 19.21 12193 27.33 9823 35.23 1416 N/A 102 DNA 100 fg/ul 24.44 12659 N/A 0.136 N/A 3.04 N/A 148 DNA 10 fg/ul N/A -4.63 N/A 0.531 N/A 0.681 N/A 109 DNA 1 fg/ul N/A -5.55 N/A 1.13 N/A 1.32 N/A 123 DW N/A -5.2 N/A -3.3 N/A 2.63 N/A 99.8

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Korea University Research and Business Foundation <120> Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe <130> DP-2020-0686, DHP20-K159 <160> 48 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> Candida albicans <400> 1 cgatacgtaa tatgaattgc agat 24 <210> 2 <211> 19 <212> DNA <213> Candida albicans <400> 2 agacctaagc cattgtcaa 19 <210> 3 <211> 43 <212> DNA <213> Candida albicans <400> 3 aacgacgctc aaacaggcat cgtgaatcat cgaatctttg aac 43 <210> 4 <211> 38 <212> DNA <213> Candida albicans <400> 4 ctgggtttgg tgttgagcaa atcccgcctt accactac 38 <210> 5 <211> 17 <212> DNA <213> Candida albicans <400> 5 cagagggcgc aatgtgc 17 <210> 6 <211> 21 <212> DNA <213> Candida albicans <400> 6 acgacttggg tttgcttgaa a 21 <210> 7 <211> 53 <212> DNA <213> Candida albicans <400> 7 cgggcccgta caaagggaac acccacactc cgacgacttg ggtttgcttg aaa 53 <210> 8 <211> 19 <212> DNA <213> Candida auris <400> 8 ggattgcctc agtaacggc 19 <210> 9 <211> 20 <212> DNA <213> Candida auris <400> 9 gctgcattcc caaacaactc 20 <210> 10 <211> 39 <212> DNA <213> Candida auris <400> 10 tggtggccac ctccagacta cgagtgaagc ggcaagagc 39 <210> 11 <211> 40 <212> DNA <213> Candida auris <400> 11 tagcagcagg caagtccttt gggccacagg aagcactagc 40 <210> 12 <211> 16 <212> DNA <213> Candida auris <400> 12 aacaaggcgc cagcga 16 <210> 13 <211> 20 <212> DNA <213> Candida auris <400> 13 cggagcgatt ccaaagttga 20 <210> 14 <211> 55 <212> DNA <213> Candida auris <400> 14 gtcagtgcag gctcccgtgt taggacgagg gtaggcggag cgattccaaa gttga 55 <210> 15 <211> 18 <212> DNA <213> Candida glabrata <400> 15 tcagtatgtg ggacacga 18 <210> 16 <211> 18 <212> DNA <213> Candida glabrata <400> 16 cgggtaaccc tacctgat 18 <210> 17 <211> 45 <212> DNA <213> Candida glabrata <400> 17 cctaatacag tattaacccc cgcgcaagct tctctattaa tctgc 45 <210> 18 <211> 43 <212> DNA <213> Candida glabrata <400> 18 ccaactcggt gttgatctag ggttgaggtc aaacttaaag acg 43 <210> 19 <211> 25 <212> DNA <213> Candida glabrata <400> 19 taagtgagtg ttttgtgcgt gctgg 25 <210> 20 <211> 17 <212> DNA <213> Candida glabrata <400> 20 gctcgcgcaa acgagca 17 <210> 21 <211> 49 <212> DNA <213> Candida glabrata <400> 21 cgggcccgta caaagggaac acccacactc cggctcgcgc aaacgagca 49 <210> 22 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> lamp_PROBE2_QUENCHER <400> 22 cctaccctcg tcctaacacg ggagcctgca ctgac 35 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> lamp_PROBE4_QUENCHER <400> 23 gagtgtgggt gttccctttg tacgggcccg 30 <210> 24 <211> 24 <212> DNA <213> Candida albicans <400> 24 cttggtattt tgcatgttgc tctc 24 <210> 25 <211> 24 <212> DNA <213> Candida albicans <400> 25 gtcagaggct ataacacaca gcag 24 <210> 26 <211> 22 <212> DNA <213> Candida albicans <400> 26 tttaccgggc cagcatcggt tt 22 <210> 27 <211> 22 <212> DNA <213> Candida auris <400> 27 cgtgatgtct tctcaccaat ct 22 <210> 28 <211> 21 <212> DNA <213> Candida auris <400> 28 tacctgattt gaggcgacaa c 21 <210> 29 <211> 13 <212> DNA <213> Candida auris <400> 29 gcggtggcgt tgc 13 <210> 30 <211> 16 <212> DNA <213> Candida glabrata <400> 30 gcgccccttg cctctc 16 <210> 31 <211> 24 <212> DNA <213> Candida glabrata <400> 31 cccagggcta taacactcta cacc 24 <210> 32 <211> 21 <212> DNA <213> Candida glabrata <400> 32 tgggcttggg actctcgcag c 21 <210> 33 <211> 18 <212> DNA <213> Candida albicans <400> 33 tctggtattc cggagggc 18 <210> 34 <211> 20 <212> DNA <213> Candida albicans <400> 34 agtcctacct gatttgaggt 20 <210> 35 <211> 41 <212> DNA <213> Candida albicans <400> 35 ctaccgtctt tcaagcaaac ccatgagcgt cgtttctccc t 41 <210> 36 <211> 48 <212> DNA <213> Candida albicans <400> 36 ttgacaatgg cttaggtcta accaaaagat atacgtggtg gacgttac 48 <210> 37 <211> 20 <212> DNA <213> Candida albicans <400> 37 ctcaacacca aacccagcgg 20 <210> 38 <211> 19 <212> DNA <213> Candida auris <400> 38 gggaaaggaa ccctgacct 19 <210> 39 <211> 20 <212> DNA <213> Candida auris <400> 39 ggacacagca ttcgaagtgt 20 <210> 40 <211> 35 <212> DNA <213> Candida auris <400> 40 cctaccctcg tcctaacacg ggagcctgca ctgac 35 <210> 41 <211> 42 <212> DNA <213> Candida auris <400> 41 acggtttcag ggttagcatg gctcaacaaa gtcgctggta ca 42 <210> 42 <211> 18 <212> DNA <213> Candida auris <400> 42 catctcgaag gcctcggt 18 <210> 43 <211> 19 <212> DNA <213> Candida auris <400> 43 cacatactcg aacggagtc 19 <210> 44 <211> 21 <212> DNA <213> Candida glabrata <400> 44 tggtagtgag tgatactcgt t 21 <210> 45 <211> 20 <212> DNA <213> Candida glabrata <400> 45 cttaaagacg tctgtctgcc 20 <210> 46 <211> 48 <212> DNA <213> Candida glabrata <400> 46 gcagattaat agagaagctt gcgctgagtt aacttgaaat tgtaggcc 48 <210> 47 <211> 42 <212> DNA <213> Candida glabrata <400> 47 gcggcggggg ttaatactgt cacaaaacac tcacttatcc ct 42 <210> 48 <211> 25 <212> DNA <213> Candida glabrata <400> 48 ggttttacca actcggtgtt gatct 25

Claims (11)

It comprises a primer of SEQ ID NOs: 1 to 6 and a probe of SEQ ID NO: 7,
It comprises a primer of SEQ ID NO: 8 to 13 and a probe of SEQ ID NO: 14,
comprising a primer of SEQ ID NO: 15 to 20 and a probe of SEQ ID NO: 21,
A multiplex loop-mediated isothermal amplification reaction (multiplex LAMP) primer set for differential detection of Candida albicans , Candida auris , and Candida glabrata .
According to claim 1,
The probes of SEQ ID NOs: 7, 14, and 21 are multiplex LAMP primer sets for differential detection of Candida albican, Candida auris, and Candida glabrata, characterized in that a fluorescent material is attached to the 5' end.
3. The method of claim 2,
A multiplex LAMP primer set for differential detection of Candida albican, Candida auris, and Candida glabrata, characterized in that the fluorescent materials emit different wavelengths, respectively.
3. The method of claim 2,
The fluorescent material is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein) ), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate), oregon green , Alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), Tetrachloro-Fluorescein (TET), TRITC ( Any one or more selected from the group consisting of tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes and thiadicarbocyanine Characterized, Candida albican, Candida auris, and Candida glabrata multiplex LAMP primer set for differential detection.
3. The method of claim 2,
The probe of SEQ ID NO: 7 had HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein) attached to the 5' end,
Cy5 was attached to the 5' end of the probe of SEQ ID NO: 14,
The probe of SEQ ID NO: 21 is a multiplex LAMP primer set for differential detection of Candida albican, Candida auris, and Candida glabrata, characterized in that Texas RED is attached to the 5' end.
According to claim 1,
The probes of SEQ ID NOs: 7, 14, and 21 each contain a quencher, Candida albican, Candida auris, and Candida glabrata multiplex LAMP primer set for differential detection.
7. The method of claim 6,
The quenching material is IABkFQ (Iowa black FQ quencher), IAbRQSp (Iowa black RQ quencher), DABCYL (4-dimethylaminoazobenzene-4'-sulfonyl chloride), BHQ (Black Hole Quencher), EBQ (Excellent Bioneer Quencher), and ZEN- A multiplex LAMP primer set for differential detection of Candida albican, Candida auris, and Candida glabrata, characterized in that at least one selected from the group consisting of IBFQ (ZEN-Iowa Black FQ).
A kit for differential detection of Candida albican, Candida auris, and Candida glabrata, comprising the primer set of claim 1 and a reagent for performing an amplification reaction.
9. The method of claim 8,
A reagent for performing the amplification reaction is a kit for differential detection of Candida albican, Candida auris, and Candida glabrata, characterized in that it comprises at least one selected from the group consisting of DNA polymerase, dNTPs, and a buffer.
(1) isolating genomic DNA (gDNA) from the biological sample;
(2) amplifying the target sequence by using the isolated gDNA as a template and performing an isothermal amplification reaction using the primer set of claim 1; and
(3) Candida albican, Candida auris, and Candida glabrata differential detection method comprising the step of detecting the amplified product.
11. The method of claim 10,
The biological sample of step (1) is at least one selected from the group consisting of blood, sputum, bronchial aspiration, oral cavity swab, and urine, characterized in that , Candida albican, Candida auris, and Candida glabrata differential detection method.

Images