KR20220073327A - Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe - Google Patents

Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe Download PDF

Info

Publication number
KR20220073327A
KR20220073327A KR1020200161300A KR20200161300A KR20220073327A KR 20220073327 A KR20220073327 A KR 20220073327A KR 1020200161300 A KR1020200161300 A KR 1020200161300A KR 20200161300 A KR20200161300 A KR 20200161300A KR 20220073327 A KR20220073327 A KR 20220073327A
Authority
KR
South Korea
Prior art keywords
candida
auris
glabrata
primer set
dna
Prior art date
Application number
KR1020200161300A
Other languages
Korean (ko)
Other versions
KR102453357B1 (en
KR102453357B9 (en
Inventor
장웅식
임채승
임다혜
임민섭
남정훈
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Priority to KR1020200161300A priority Critical patent/KR102453357B1/en
Publication of KR20220073327A publication Critical patent/KR20220073327A/en
Application granted granted Critical
Publication of KR102453357B1 publication Critical patent/KR102453357B1/en
Publication of KR102453357B9 publication Critical patent/KR102453357B9/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00Reactions demanding special reaction conditions
    • C12Q2527/101Temperature
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/10Detection mode being characterised by the assay principle
    • C12Q2565/101Interaction between at least two labels
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 칸디다 알비칸(Candida albicans), 칸디다 아우리스(Candida auris), 및 칸디다 글라브라타(Candida glabrata) 감별 검출을 위한 실시간 동시다중 등온증폭반응(real-time multiplex LAMP) 프라이머 세트에 관한 것으로서, ITS2 부위를 포함한 18s-28s rRNA 유전자 서열을 기반으로 제작된 바, 종래 PCR, real time PCR 기반의 검출과 비교하여 전기영동 과정이 불필요하고, 검사에 온도변화가 필요하지 않아, 칸디다균 검출 시간이 짧고, 경제적이고 가벼운 기기를 이용할 수 있는 장점이 있다. 또한, 본 발명은 추가적인 형광 프로브 및 상보적인 서열의 소광물질을 사용하여 한 튜브 안에서 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타를 동시에 감별하여 검출할 수 있다는 점에서 진단의 정확성을 유지하며 시간과 비용 측면에 유리한바, 기존의 진균 검출법을 대체하는 분자진단검사방법으로 이용될 것으로 기대된다. The present invention relates to a real-time multiplex LAMP primer set for differential detection of Candida albicans , Candida auris , and Candida glabrata , , since it was produced based on the 18s-28s rRNA gene sequence including the ITS2 region, the electrophoresis process is unnecessary compared to conventional PCR and real time PCR-based detection, and there is no temperature change required for the test, so Candida detection time This short, economical and lightweight device has the advantage of being available. In addition, the present invention maintains the accuracy of diagnosis in that it can detect and simultaneously detect Candida albican, Candida auris, and Candida glabrata in one tube using an additional fluorescent probe and a quencher of a complementary sequence. Since it is advantageous in terms of time and cost, it is expected to be used as a molecular diagnostic test method replacing the existing fungal detection method.

Description

형광 프로브를 이용한 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타를 감별하여 검출할 수 있는 동시다중 등온증폭반응 프라이머 세트{Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe}A primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe}

본 발명은 형광 프로브를 이용한 칸디다 알비칸(Candida albicans), 칸디다 아우리스(Candida auris), 및 칸디다 글라브라타(Candida glabrata)를 감별하여 검출할 수 있는 동시다중 등온증폭(multiplex loop-mediated isothermal amplification reaction, multiplex LAMP) 프라이머 세트에 관한 것이다. The present invention is a multiplex loop-mediated isothermal amplification that can discriminate and detect Candida albicans , Candida auris , and Candida glabrata using a fluorescent probe reaction, multiplex LAMP) primer set.

패혈증(sepsis)은 여러 가지 병원성균이 혈액내로 침투하여 여러 장기에 감염을 일으켜 이로 인한 전신적인 염증반응을 일으키는 증후군으로 병원 내 감염 발생률이 매우 높고, 진단이 늦어져서 빠른 시일 내에 치료하지 않으면 치료비용과 함께 사망률 급격히 증가한다. 최근 연구에 따르면 미국·영국 등 선진국은 최근 20년간 패혈증 사망률이 매년 0.9%씩 감소한 반면, 한국인의 패혈증 발생률은 10만명당 2008년 233명에서 2012년 347명으로 5년간 패혈증 환자가 50%가량 증가한 것으로 확인되었다. Sepsis is a syndrome in which various pathogenic bacteria penetrate into the blood and infect various organs, resulting in a systemic inflammatory reaction. with a sharp increase in mortality. According to a recent study, the sepsis mortality rate in developed countries such as the United States and the United Kingdom has decreased by 0.9% per year for the past 20 years, while the sepsis incidence rate in Koreans has risen by 50% over the past five years, from 233 per 100,000 in 2008 to 347 in 2012. Confirmed.

현재까지 보고된 바에 따르면 칸디다 알비칸(Candida albicans)은 병원 내 혈류 감염의 주요 원인균이며 항진균제 치료가 늦어질수록 사망률이 높아지며, 특히 12시간 이상 지체될 경우 사망률이 급격히 증가한다. 칸디다혈증에 의한 사망률은 40~54%로 높게 나타났다. 최근 미국 질병통제예방센터(CDC)가 전세계적인 확산 가능성을 경고한 칸디다 아우리스(Candida auris)는 2009년 일본에서 처음 발견된 후, 한국, 미국, 인도, 이스라엘, 영국, 스페인, 쿠웨이트 등 30개국 이상에서 감염 사례가 확인되었고, 미국 CDC는 칸디다 아우리스가 다양한 항진균제에 대하여 다제내성(multidrug-resistant) 가능성이 높아 확산 가능성 경고를 하기에 앞서 지난 4월, 칸디다 아우리스를 긴급상황으로 등급을 상향시켰다. 칸디다 감염 환자에 대해 빠른 항진균제 치료를 위해서는 칸디다균에 대한 조기 정확한 진단이 매우 중요한 실정이다.According to reports so far, Candida albicans is a major causative agent of nosocomial bloodstream infections, and mortality increases as antifungal treatment is delayed. The mortality rate due to candidiasis was as high as 40-54%. Candida auris , which the U.S. Centers for Disease Control and Prevention (CDC) recently warned of the possibility of global spread, was first discovered in Japan in 2009, and then in 30 countries including Korea, the U.S., India, Israel, the U.K., Spain, and Kuwait. The above confirmed cases of infection, and the US CDC upgraded Candida auris to emergency in April before issuing a warning about the possibility of spread due to the high possibility that Candida auris is multidrug-resistant to various antifungal drugs. made it Early and accurate diagnosis of Candida is very important for rapid antifungal treatment for Candida-infected patients.

현재까지 혈액 배양은 여전히 칸디다혈증의 진단을 위한 최적의 표준 검사로 여겨지고 있으나, 혈액 배양 검사는 혈액 내 칸디다 알비칸이 매우 낮은 농도로 존재할 경우 배양이 쉽지 않아 양성 진단까지의 시간이 일반적으로 2-4일 소요되고 일반적으로 대략 63-83% 정도의 낮은 민감도를 나타낸다. 이를 위해 다양한 mannan, (1-3)-β-d-glucan, PCR 등 non-culture 기반 진단법이 개발되었으나 mannan, BDG 등을 이용한 검출법은 특이도가 낮은 경우가 많이 보고되었고, PCR법의 경우에는 검출 특이도는 높으나 샘플 내에 진균이 낮은 농도로 존재할 경우 검출하기 힘든 단점이 있다. PCR 검출의 경우, standard, nested, real-time, reverse transcriptase PCR등 다양한 기법이 진균 검출에 사용되었으나, 이들 모두 최소 10 CFU/ml의 진균이 존재하여야 검출이 가능한 것으로 확인되었다. 따라서 혈액내 진균을 분리 농축하고 민감도 높은 PCR법을 개발한다면 낮은 농도로 혈액내 존재하는 진균의 검출 민감도를 크게 개선할 수 있을 것으로 생각된다.Until now, blood culture is still considered as the optimal standard test for the diagnosis of candidaemia. It takes 4 days and usually shows a low sensitivity of about 63-83%. To this end, various non-culture-based diagnostic methods such as mannan, (1-3)-β-d-glucan, and PCR have been developed, but detection methods using mannan and BDG have been reported in many cases with low specificity. Although the detection specificity is high, there is a disadvantage in that it is difficult to detect when the fungus is present at a low concentration in the sample. In the case of PCR detection, various techniques such as standard, nested, real-time, and reverse transcriptase PCR were used to detect the fungus, but all of them were confirmed to be detectable only when the fungus of at least 10 CFU/ml was present. Therefore, if the fungus in the blood is separated and concentrated and a high-sensitivity PCR method is developed, it is thought that the detection sensitivity of the fungus present in the blood at a low concentration can be greatly improved.

최근, 온도 변화 없이 일정한 온도에서 유전자를 증폭하는 등온증폭 반응법(loop-mediated isothermal amplification reaction, LAMP)이 개발되었다. 상기 LAMP는 주형에 상보적인 프라이머 6개를 사용하여 각기 다른 8개의 부위를 인식하여 유전자 증폭을 진행한다. 기존의 PCR법과 비교하였을 때, 온도의 변화가 없이 증폭할 수 있다는 점에서 검사의 소모시간을 단축할 수 있고, 온도 변화를 위한 값비싼 장비 없이 검사를 진행할 수 있다. LAMP는 상술한 장점을 가져 감염질환에 적용된 바 있으나, 칸디다균 3종을 multiplex LAMP로 한 번에 동시적으로 진단하는 검사법에 대해서는 개발된 바 없다. 이에 본 발명자들은 multiplex LAMP법을 이용하여 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타를 동시에 감별 검출하는 방법에 대해 예의 연구하여 본 발명을 완성하였다.Recently, a loop-mediated isothermal amplification reaction (LAMP) that amplifies genes at a constant temperature without temperature change has been developed. The LAMP uses 6 primers complementary to the template to recognize 8 different sites and proceed with gene amplification. Compared with the existing PCR method, the time required for the test can be shortened in that amplification can be performed without temperature change, and the test can be performed without expensive equipment for temperature change. LAMP has been applied to infectious diseases with the above-mentioned advantages, but a test method for diagnosing three Candida species simultaneously with multiplex LAMP has not been developed. Accordingly, the present inventors completed the present invention by intensively studying a method for simultaneously differentially detecting Candida albican, Candida auris, and Candida glabrata using the multiplex LAMP method.

Norihiro, T. et. al. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature protocols. 2008;3:5.Norihiro, T. et. al. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature protocols. 2008;3:5.

본 발명이 이루고자 하는 기술적 과제는 칸디다균 3종(칸디다 알비칸, 칸디다 아우리스, 칸디다 글라브라타) 감별 검출용 다중진단 등온증폭반응(multiplex LAMP) 프라이머 세트 및 이를 포함하는 키트를 제공하고, 상기 프라이머 세트 및 키트를 이용하여 상기 칸디다균 3종을 감별하여 검출하는 방법을 제공하는 것이다.The technical object of the present invention is to provide a multiplex LAMP primer set for differential detection of three Candida species (Candida albican, Candida auris, Candida glabrata) and a kit comprising the same, An object of the present invention is to provide a method for discriminating and detecting the three types of Candida by using a primer set and a kit.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

상기 과제를 해결하기 위하여, 본 발명은 서열번호 1 내지 6의 프라이머와 서열번호 7의 프로브(칸디다 알비칸 프라이머 세트)를 포함하고, 서열번호 8 내지 13의 프라이머와 서열번호 14의 프로브(칸디다 아우리스 프라이머 세트)를 포함하고, 서열번호 15 내지 20의 프라이머와 서열번호 21의 프로브(칸디다 글라브라타 프라이머 세트)를 포함하는, 칸디다 알비칸(Candida albicans), 칸디다 아우리스(Candida auris), 및 칸디다 글라브라타(Candida glabrata) 감별 검출용 동시다중 등온증폭반응(multiplex loop-mediated isothermal amplification reaction, multiplex LAMP) 프라이머 세트를 제공한다.In order to solve the above problems, the present invention includes a primer of SEQ ID NO: 1 to 6 and a probe of SEQ ID NO: 7 (Candida albican primer set), and a primer of SEQ ID NO: 8 to 13 and a probe of SEQ ID NO: 14 (Candida au Lys primer set), including the primers of SEQ ID NOs: 15 to 20 and the probes of SEQ ID NO: 21 (Candida glabrata primer set), Candida albicans , Candida auris , and Provides a multiplex loop-mediated isothermal amplification reaction (multiplex LAMP) primer set for differential detection of Candida glabrata .

본 발명의 일 구현예로서, 상기 서열번호 7, 14, 및 21의 프로브는 5' 말단에 형광물질이 부착될 수 있다. 이 때, 상기 형광물질은 상기 칸디다균 3종을 감별 검출하기 위해 각각 상이한 파장을 발하는 것일 수 있다.In one embodiment of the present invention, the probes of SEQ ID NOs: 7, 14, and 21 may have a fluorescent material attached to the 5' end. In this case, the fluorescent material may emit different wavelengths to differentially detect the three kinds of Candida bacteria.

본 발명의 다른 구현예로서, 상기 형광물질은 FAM(6-carboxyfluorescein), 텍사스 레드(texas red), 플루오레신(fluorescein), HEX(2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), 플루오레신 클로로트리아지닐(fluorescein chlorotriazinyl), 로다민 그린(rhodamine green), 로다민 레드(rhodamine red), 테트라메틸 로다민(tetramethyl rhodamine), FITC(fluorescein isothiocyanate), 오레곤 그린(oregon green), 알렉사 플루오로(alexa fluor), JOE(6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-XRhodamine), TET(Tetrachloro-Fluorescein), TRITC(tertramethylrodamine isothiocyanate), TAMRA(6-carboxytetramethyl-rhodamine), NED(N-(1-Naphthyl) ethylenediamine), 시아닌(Cyanine) 계열 염료 및 씨아디카르보시아닌(thiadicarbocyanine)으로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있다.In another embodiment of the present invention, the fluorescent material is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), HEX (2',4',5',7'-tetrachloro-6 -carboxy-4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate) ), oregon green, alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro-Fluorescein), TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dye and thiadicarbocyanine It may be any one or more selected from the group.

본 발명의 또 다른 구현예로서, 상기 서열번호 7의 프로브는 5' 말단에 HEX(2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein)가 부착되었고, 상기 서열번호 14의 프로브는 5' 말단에 Cy5가 부착되었고, 상기 서열번호 21의 프로브는 5' 말단에 텍사스 레드(Texas RED)가 부착될 수 있다. 이 경우, 상기 서열번호 7의 프로브는 5' 말단에 FAM을 부착한 것보다 민감도가 더 높게 측정되고, 상기 서열번호 14의 프로브의 5' 말단에 Cy5 대신 Cy5.5가 부착될 수 있다.As another embodiment of the present invention, the probe of SEQ ID NO: 7 has HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein) attached to the 5' end, Cy5 may be attached to the 5' end of the probe of SEQ ID NO: 14, and Texas RED may be attached to the 5' end of the probe of SEQ ID NO: 21. In this case, the probe of SEQ ID NO: 7 has a higher sensitivity than that of FAM attached to the 5' end, and Cy5.5 may be attached to the 5' end of the probe of SEQ ID NO: 14 instead of Cy5.

본 발명의 일 구현예로서, 상기 서열번호 7, 14, 및 21의 프로브는 각각 소광물질을 포함하는 것일 수 있다.In one embodiment of the present invention, the probes of SEQ ID NOs: 7, 14, and 21 may each include a quencher.

본 발명의 다른 구현예로서, 상기 소광물질은 IABkFQ(Iowa black FQ quencher), IAbRQSp(Iowa black RQ quencher), DABCYL(4-dimethylaminoazobenzene-4'-sulfonyl chloride), BHQ (Black Hole Quencher), EBQ(Excellent Bioneer Quencher), 및 ZEN-IBFQ(ZEN-Iowa Black FQ)으로 이루어진 군으로부터 선택되는 어느 하나 이상일 수 있다.As another embodiment of the present invention, the quenching material is IABkFQ (Iowa black FQ quencher), IAbRQSp (Iowa black RQ quencher), DABCYL (4-dimethylaminoazobenzene-4'-sulfonyl chloride), BHQ (Black Hole Quencher), EBQ ( Excellent Bioneer Quencher), and ZEN-IBFQ (ZEN-Iowa Black FQ) may be any one or more selected from the group consisting of.

또한, 본 발명은 상기 상기 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 프라이머 세트를 포함하는 칸디다균 3종 감별 검출용 multiplex LAMP 프라이머 세트를 포함하는 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출용 키트를 제공한다.In addition, the present invention provides Candida albican, Candida auris, and Candida glas comprising a multiplex LAMP primer set for differential detection of three Candida species including the Candida albican, Candida auris, and Candida glabrata primer sets. A kit for differential detection of Brata is provided.

본 발명의 일 구현예로서, 상기 키트는 증폭 반응을 수행하기 위한 시약을 추가로 포함할 수 있으며, 상기 시약에는 DNA 중합효소, dNTPs 및 버퍼로 이루어진 군으로부터 선택되는 하나 이상이 포함될 수 있다. In one embodiment of the present invention, the kit may further include a reagent for performing an amplification reaction, and the reagent may include one or more selected from the group consisting of DNA polymerase, dNTPs, and a buffer.

또한, 본 발명은 (1) 생물학적 시료로부터 게놈 DNA(gDNA)를 분리하는 단계; (2) 상기 분리된 gDNA를 주형으로 하고 상기 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 프라이머 세트를 포함하는 칸디다균 3종 감별 검출용 multiplex LAMP 프라이머 세트를 이용하여 등온증폭반응을 수행하여 표적 서열을 증폭하는 단계; 및 (3) 상기 증폭된 산물을 검출하는 단계를 포함하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출 방법을 제공한다.In addition, the present invention comprises the steps of (1) isolating genomic DNA (gDNA) from a biological sample; (2) using the isolated gDNA as a template and performing an isothermal amplification reaction using a multiplex LAMP primer set for differential detection of three Candida bacteria including the Candida albican, Candida auris, and Candida glabrata primer sets amplifying the target sequence; and (3) detecting the amplified product.

본 발명의 일 구현예로서, 상기 생물학적 시료는 혈액(blood), 객담(sputum), 기관지 흡인(bronchial aspiration), 구강세척액(oreal cavity swab), 및 소변(urine)으로 이루어진 군으로부터 선택된 하나 이상일 수 있다.In one embodiment of the present invention, the biological sample may be one or more selected from the group consisting of blood, sputum, bronchial aspiration, oral cavity swab, and urine. have.

본 발명의 다른 구현예로서, 상기 (2) 단계의 프라이머 세트는 internal control primer를 추가로 포함할 수 있다. In another embodiment of the present invention, the primer set in step (2) may further include an internal control primer.

본 발명의 다른 구현예로서, 상기 (3) 단계는 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정, 및 인광 측정으로 이루어진 군으로부터 선택되는 하나 이상의 방법으로 수행될 수 있으나, 바람직하게는 형광 측정 방법에 의할 수 있다. As another embodiment of the present invention, step (3) may be performed by one or more methods selected from the group consisting of DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, and phosphorescence measurement, but preferably fluorescence measurement can depend on the method.

본 발명의 또 다른 구현예로서, 상기 방법은 (3) 단계 이후에 (i) 칸디다 알비칸 프라이머 세트에 의해 증폭된 산물은 검출되나, 칸디다 아우리스 및 칸디다 글라브라타 프라이머 세트에 의해 증폭된 산물이 검출되지 않는 경우 칸디다 알비칸에, (ii) 칸디다 아우리스 프라이머 세트에 의해 증폭된 산물은 검출되나, 칸디다 알비칸 및 칸디다 글라브라타 프라이머 세트에 의해 증폭된 산물이 검출되지 않는 경우 칸디다 아우리스에, (iii) 칸디다 글라브라타 프라이머 세트에 의해 증폭된 산물은 검출되나, 칸디다 알비칸 및 칸디다 아우리스 프라이머 세트에 의해 증폭된 산물이 검출되지 않는 경우 칸디다 글라브라타에 감염된 것으로 판정하는 단계를 추가로 포함할 수 있다.In another embodiment of the present invention, in the method, after step (3), (i) the product amplified by the Candida albican primer set is detected, but the product amplified by the Candida auris and Candida glabrata primer set in Candida albican if not detected, (ii) the product amplified by the Candida auris primer set is detected, but the product amplified by the Candida albican and Candida glabrata primer sets is not detected in Candida auris (iii) determining that the patient is infected with Candida glabrata when the product amplified by the Candida glabrata primer set is detected but the product amplified by the Candida albican and Candida auris primer sets is not detected; may additionally include.

본 발명의 또 다른 구현예로서, 상기 방법은 (3) 단계 이후에 internal control primer에 의한 증폭산물이 검출되고 다른 프라이머 세트에 의한 증폭 산물은 검출되지 않는 경우 음성으로 해석하는 단계를 포함할 수 있다.As another embodiment of the present invention, the method may include the step of interpreting as negative when the amplification product by the internal control primer is detected after step (3) and the amplification product by the other primer set is not detected after step (3). .

본 발명의 또 다른 구현예로서, 상기 방법은 (3) 단계 이후에 (3) 단계의 검출 시간을 측정하여 칸디다 알비칸, 칸디다 아우리스 및/또는 칸디다 글라브라타를 정량화 하는 단계를 추가로 포함할 수 있다. 상기 “정량화”는 본 발명에 따른 프라이머 세트를 이용한 증폭반응 수행 시의 표준곡선과 비교하여 DNA 농도에 따른 형광물질 검출 시간을 정량화하는 것일 수 있으며, 바람직하게는 단계 (c)의 증폭 산물을 형광지표를 이용하여 검출함으로써 형광물질 검출 시간을 측정하여 DNA 농도를 정량화하는 것일 수 있다.In another embodiment of the present invention, the method further comprises quantifying Candida albican, Candida auris and/or Candida glabrata by measuring the detection time of step (3) after step (3). can do. The "quantification" may be to quantify the fluorescent substance detection time according to the DNA concentration compared to a standard curve when performing an amplification reaction using the primer set according to the present invention, and preferably, the amplification product of step (c) is fluorescence By detecting using an indicator, the detection time of the fluorescent substance may be measured to quantify the DNA concentration.

본 발명의 또 다른 구현예로서, 생물학적 시료로부터 RNA를 추출하고, 상기 RNA를 주형으로 역전사반응을 수행하여 전체 cDNA를 합성한 후, 상기 cDNA를 주형으로 상기 칸디다 알비칸, 칸디다 아우리스, 칸디다 글라브라타 프라이머 세트를 포함하는 multiplex LAMP 프라이머 세트를 이용하여 등온증폭반응을 수행할 수 있다.In another embodiment of the present invention, RNA is extracted from a biological sample, reverse transcription is performed using the RNA as a template to synthesize total cDNA, and then the Candida albican, Candida auris, and Candida glas are used as a template. The isothermal amplification reaction can be performed using the multiplex LAMP primer set including the Brata primer set.

본 발명은 칸디다 알비칸(Candida albicans), 칸디다 아우리스(Candida auris), 및 칸디다 글라브라타(Candida glabrata) 감별 검출을 위한 실시간 동시다중 등온증폭반응(real-time multiplex LAMP) 프라이머 세트에 관한 것으로서, ITS2 부위를 포함한 18s-28s rRNA 유전자 서열을 기반으로 제작된 바, 종래 PCR, real time PCR 기반의 검출과 비교하여 전기영동 과정이 불필요하고, 검사에 온도변화가 필요하지 않아, 칸디다균 검출 시간이 짧고, 경제적이고 가벼운 기기를 이용할 수 있는 장점이 있다. 또한, 본 발명은 추가적인 형광 프로브 및 상보적인 서열의 소광물질을 사용하여 한 튜브 안에서 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타를 동시에 감별하여 검출할 수 있다는 점에서 진단의 정확성을 유지하며 시간과 비용 측면에 유리한바, 기존의 진균 검출법을 대체하는 분자진단검사방법으로 이용될 것으로 기대된다. The present invention relates to a real-time multiplex LAMP primer set for differential detection of Candida albicans , Candida auris , and Candida glabrata , , since it was produced based on the 18s-28s rRNA gene sequence including the ITS2 region, the electrophoresis process is unnecessary compared to conventional PCR and real time PCR-based detection, and there is no temperature change required for the test, so Candida detection time This short, economical and lightweight device has the advantage of being available. In addition, the present invention maintains the accuracy of diagnosis in that it can detect and simultaneously detect Candida albican, Candida auris, and Candida glabrata in one tube using an additional fluorescent probe and a quencher of a complementary sequence. Since it is advantageous in terms of time and cost, it is expected to be used as a molecular diagnostic test method replacing the existing fungal detection method.

도 1은 칸디다 알비칸(Candida albicans)의 타겟 유전자인 18s rRNA 서열 특이적인 LAMP 프라이머 세트의 위치를 나타낸 것이다.
도 2는 칸디다 아우리스(Candida auris)의 타겟 유전자인 28s rRNA 서열 특이적인 LAMP 프라이머 세트의 위치를 나타낸 것이다.
도 3은 칸디다 글라브라타(Candida glabrata)의 타겟 유전자인 18s rRNA 서열 특이적인 LAMP 프라이머 세트의 위치를 나타낸 것이다.
도 4는 칸디다균 3종(칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타)의 LAMP 프라이머 세트를 이용하여 칸디다균 7종(칸디다 알비칸, 칸디다 아우리스, 칸디다 글라브라타, 칸디다 트로피컬리스(Candida tropicalis), 칸디다 크루세이(Candida krusei), 칸디다 파라프실로시스(Candida parapsilosis), 및 칸디다 구일리에르몬디(Candida guilliermondii))과 증류수(D.W.)를 대상으로 칸디다균 동시다중 등온증폭(multiplex LAMP) 프라이머 세트의 검출 테스트 결과를 나타낸 것이다. 상기 프라이머 세트의 형광 프로브로 HEX(칸디다 알비칸), Cy5(칸디다 아우리스), 및 텍사스 레드(칸디다 글라브라타)를 이용하였다.
1 shows the location of the 18s rRNA sequence-specific LAMP primer set, which is a target gene of Candida albicans .
Figure 2 shows the position of the LAMP primer set specific to the 28s rRNA sequence, which is a target gene of Candida auris .
Figure 3 shows the position of the 18s rRNA sequence-specific LAMP primer set, which is a target gene of Candida glabrata .
FIG. 4 shows 7 Candida species (Candida albican, Candida auris, Candida glabrata, Candida tropicalis) using the LAMP primer set of three Candida species (Candida albican, Candida auris, and Candida glabrata). ( Candida tropicalis ), Candida krusei ( Candida krusei ), Candida parapsilosis ( Candida parapsilosis ), and Candida guilliermondii ( Candida guilliermondii ) and distilled water (DW) for Candida simultaneous multiple isothermal amplification (multiplex) LAMP) shows the detection test results of the primer set. As fluorescent probes of the primer set, HEX (Candida albican), Cy5 (Candida auris), and Texas Red (Candida glabrata) were used.

본 발명자들은 현장에서 칸디다균의 감염 여부를 신속하고 정확하게 감별 및 진단하는 방법에 대해 예의 연구하여 본 발명을 완성하였다.The present inventors completed the present invention by intensively researching a method for rapidly and accurately discriminating and diagnosing Candida infection in the field.

구체적으로, 본 발명은 종래에 PCR, real time PCR 검출 기반으로 하는 것과 달리, 동시다중 실시간 등온증폭법(Multiplex real time LAMP)을 기반으로 프라이머 세트를 제작하여 칸디다 알비칸(Candida albicans), 칸디다 아우리스(Candida auris), 및 칸디다 글라브라타(Candida glabrata)균을 동시에 검출함으로써 Real-time PCR법과 conventional PCR법에 비해 분석에 소요되는 시간을 획기적으로 단축시켰다. Specifically, the present invention produces a primer set based on multiplex real time LAMP, unlike conventional PCR and real time PCR detection, by producing a primer set based on Candida albicans , Candida aureus. Res ( Candida auris ) and Candida glabrata ( Candida glabrata ) By simultaneously detecting bacteria, the time required for analysis was dramatically reduced compared to the real-time PCR method and the conventional PCR method.

또한, 본 발명은 기존의 PCR법으로 발생될 수 있는 결과 분석 소요 시간을 줄이고, 온도의 변화를 줄임으로써 종래 PCR 기기에 비해 단순하고 가벼운 기기를 사용할 수 있는 기반이 되는 발명이다. 또한, 다중진단(multiplex)으로 검사할 수 있어 한 번에 칸디다 알비칸(Candida albicans), 칸디다 아우리스(Candida auris), 및 칸디다 글라브라타(Candida glabrata)균을 모두 검출할 수 있다는 점에서 기존의 LAMP법과 비교하였을 때도 비용과 검사시간을 단축할 수 있다. In addition, the present invention is an invention that reduces the time required for analysis of results that can be generated by the conventional PCR method and reduces the change in temperature, thereby providing a basis for using a simpler and lighter apparatus compared to the conventional PCR apparatus. In addition, since it can be tested in multiplex, Candida albicans , Candida auris , and Candida glabrata can all be detected at once. Compared to the LAMP method of

구체적으로, 본 발명은 칸디다 알비칸(C. albicans)에 특이적으로 작용하는 프라이머 세트(C. albicans LAMP primer set), 칸디다 아우리스(C. auris)에 특이적으로 작용하는 프라이머 세트(C. auris LAMP primer set), 및 칸디다 글라브라타(C. glabrata)에 특이적으로 작용하는 프라이머 세트(C. glabrata LAMP primer set) 세트를 제공한다. 또한, 본 발명은 상기 프라이머 세트를 포함하는 칸디다균 3종(칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타) 감별 검출용 조성물을 제공한다. 표 1의 서열번호 1 내지 7은 칸디다 알비칸을 검출하기 위한 6개의 프라이머와 1개의 프로브를 포함하는 프라이머 세트이며, 서열번호 8 내지 14는 칸디다 아우리스를 검출하기 위한 6개의 프라이머와 1개의 프로브를 포함하는 프라이머 세트이며, 서열번호 15 내지 21은 칸디다 글라브라타를 검출하기 위한 6개의 프라이머와 1개의 프로브를 포함하는 프라이머 세트이다. 하기 표 1의 프라이머 세트 및 이를 포함하는 조성물은 multiplex LAMP법을 이용한 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출 방법에 사용될 수 있다.Specifically, the present invention provides a primer set that specifically acts on Candida albicans ( C. albicans ) (C. albicans LAMP primer set), a primer set that specifically acts on Candida auris ( C. auris ) (C. auris LAMP primer set), and a primer set that specifically acts on Candida glabrata (C. glabrata LAMP primer set). In addition, the present invention provides a composition for differential detection of three Candida species (Candida albican, Candida auris, and Candida glabrata) comprising the primer set. SEQ ID NOs: 1 to 7 of Table 1 are primer sets including six primers and one probe for detecting Candida albican, and SEQ ID NOs: 8 to 14 are six primers and one probe for detecting Candida auris A primer set comprising: SEQ ID NOs: 15 to 21 are primer sets including six primers and one probe for detecting Candida glabrata. The primer set of Table 1 and the composition including the same can be used for the differential detection method of Candida albican, Candida auris, and Candida glabrata using the multiplex LAMP method.

본 발명에서, 용어 “검출”이란 미생물의 존재 유무의 판별 또는 상대적 미생물 양의 정도, 또는 미생물 감염 위치의 판별을 의미하는 것으로, 상기 미생물은 단일 세포, 세포 클러스터 또는 다세포 유기체를 포함하는 미시적인 유기체를 지칭하며, 구체적으로 바이러스, 진균(곰팡이, fungi), 원생동물(protozoa), 세균(박테리아, bacteria) 등을 의미한다.In the present invention, the term “detection” refers to the determination of the presence or absence of microorganisms or the relative amount of microorganisms, or the determination of the location of microbial infection, wherein the microorganism is a microscopic organism including a single cell, a cell cluster, or a multicellular organism. Specifically, it means viruses, fungi (fungi), protozoa, and bacteria (bacteria).

본 발명에서, 용어 “감별”이란, 특정 미생물을 구별 또는 판별하는 것을 말하며, 특히 유사한 특징을 일부 공유하는 미생물 가운데 어떤 미생물에 감염되었는지를 정확하게 구별해낸다는 의미에서, 본 발명에서는 “감별 검출한다”는 용어를 사용하였다.In the present invention, the term "differentiation" refers to distinguishing or discriminating a specific microorganism, and in particular, in the sense of accurately discriminating which microorganism is infected among microorganisms sharing some similar characteristics, in the present invention, "differential detection is performed" used the term.

본 발명에서, 용어 “등온증폭반응(loop-mediated isothermal amplification, LAMP)”은 기존 PCR법과 달리 PCR 사이클이 필요없는 Bst, Gsp등의 중합효소를 이용하여 등온의 조건에서 반응을 수행하는 방법으로, 기본적으로 4개의 프라이머를 이용하여, 양끝을 고리(loop) 구조로 합성하여 유전자의 특정 부위를 무한대로 증폭하고, 증폭된 DNA 산물을 형광 검출용 시약을 이용하거나 침전 반응시켜 증폭유무를 확인하는 방법으로서, 바람직하게는 형광 검출용 시약을 이용할 수 있으나, 이에 한정되는 것은 아니다. 또한, 본 발명에 있어서, “실시간 다중 등온증폭반응(real time LAMP)”은 증폭유무를 실시간으로 확인하는 방법으로서, 다양한 유전자를 동시에 검출할 수 있으며, 바람직하게는 실시간으로 시료에서 칸디다 알비칸, 칸디다 아우리스 및/또는 칸디다 글라브라타를 동시에 검출 및 판별할 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the term “loop-mediated isothermal amplification (LAMP)” refers to a method of performing a reaction under isothermal conditions using polymerases such as Bst and Gsp that do not require a PCR cycle unlike the existing PCR method, Basically, by using four primers, both ends are synthesized into a loop structure to infinitely amplify a specific region of a gene, and the amplified DNA product is used for fluorescence detection or a precipitation reaction to confirm amplification. As such, a reagent for detecting fluorescence may be preferably used, but is not limited thereto. In addition, in the present invention, the "real time multiple isothermal amplification reaction (real time LAMP)" is a method of confirming the presence or absence of amplification in real time, and various genes can be simultaneously detected, preferably Candida albican, Candida auris and/or Candida glabrata can be simultaneously detected and discriminated, but is not limited thereto.

본 발명의 프라이머 세트는 등온증폭반응(LAMP; Loop-mediated isothermal amplification)에 사용되는 것이 바람직하며, 등온증폭반응은 표적 DNA를 LAMP에 의하여 증폭하는 단일-단계(one-step) LAMP일 수 있고, 실시간 LAMP (real-time LAMP)일 수 있으며, 또는 이들의 조합일 수 있다. The primer set of the present invention is preferably used for isothermal amplification (LAMP; Loop-mediated isothermal amplification), and the isothermal amplification reaction may be a one-step LAMP amplifying target DNA by LAMP, It may be a real-time LAMP (real-time LAMP), or a combination thereof.

본 발명에서 용어, "프라이머 (primer)"란 적절한 완충용액 중의 적절한 조건(예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, RNA 폴리머라제 또는 역전사 효소와 같은 중합제) 및 적당한 온도 하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드를 말한다. 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있으나, 통상 15 내지 30 뉴클레오티드이다. 짧은 프라이머 분자는 일반적으로 주형과 안정한 혼성체를 형성하기 위해서는 더 낮은 온도를 필요로 한다. 프라이머 서열은 주형과 완전하게 상보적일 필요는 없으나, 주형과 혼성화할 정도로 충분히 상보적이어야 한다. As used herein, the term "primer" refers to a template under suitable conditions (eg, four different nucleoside triphosphates and a polymerization agent such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and at an appropriate temperature. - Refers to single-stranded oligonucleotides that can serve as a starting point for directing DNA synthesis. The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence need not be completely complementary to the template, but must be sufficiently complementary to hybridize to the template.

본 발명의 프라이머는 예를 들면, 포스포르아미다이트 고체 지지체 방법과 같은 당 분야에 공지된 방법을 이용하여 화학적으로 합성할 수 있다. 또한, 공지된 방법으로 메틸화, 캡화 등으로 변형시킬 수 있다. 또한, 본 발명의 프라이머는 필요한 경우, 분광학적, 광화학적, 생화학적, 면역화학적 또는 화학적 수단에 의해 직접적으로 또는 간접적으로 검출 가능한 표지를 포함할 수 있다. 표지의 예로는, 효소(예를 들어, 호스래디쉬 퍼옥시다제, 알칼린 포스파타아제), 방사성 동위원소(예를 들어, 32P), 형광성 분자, 화학그룹(예를 들어, 바이오틴) 등이 있다.The primer of the present invention can be chemically synthesized using methods known in the art, such as, for example, a phosphoramidite solid support method. In addition, it can be modified by methylation, capping, etc. by a known method. In addition, if necessary, the primer of the present invention may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (eg horseradish peroxidase, alkaline phosphatase), radioactive isotopes (eg 32 P), fluorescent molecules, chemical groups (eg biotin), and the like. There is this.

본 발명에서, 용어 “내부 프라이머(inner primer)”는 주형 DNA에 결합하여 새로운 DNA 사슬 합성의 시작점으로 작용할 수 있는 단일가닥 올리고뉴클레오티드를 의미한다.As used herein, the term “inner primer” refers to a single-stranded oligonucleotide capable of binding to a template DNA and serving as a starting point for synthesis of a new DNA chain.

본 발명에서, 용어 “외부 프라이머(outer primer)”는 내부 프라이머가 주형 DNA에 결합한 위치보다 더 바깥쪽에서 주형 DNA에 결합하는 단일가닥 올리고뉴클레오티드를 의미하는 것으로, 내부 프라이머가 주형 DNA에 결합하여 DNA 사슬이 신장된 이후, 외부 프라이머와 주형 DNA의 결합으로 사슬 변위(strand displacement)가 발생하여 먼저 형성된 사슬이 떨어져 나오게 된다.In the present invention, the term “outer primer” refers to a single-stranded oligonucleotide that binds to the template DNA outside the position where the inner primer binds to the template DNA. After this elongation, a strand displacement occurs due to the binding of the external primer and the template DNA, and the previously formed chain is separated.

본 발명에서, 용어 “고리 프라이머(loop primer)”는 상기 내부 프라이머 및 외부 프라이머가 주형 DNA에 결합하여 형성된 초기 줄기 고리(stem loop) 구조 사슬이 고리(loop) 구조 생성 횟수를 증가시켜 결과적으로 전체 반응을 가속화시킬 수 있도록 하는, 뉴클레오티드 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레 오티드를 의미한다.In the present invention, the term “loop primer” means that the initial stem loop structure chain formed by binding the inner primer and the outer primer to the template DNA increases the number of loop structures and consequently the entire It refers to a single-stranded oligonucleotide that can act as a starting point for nucleotide synthesis, allowing the reaction to be accelerated.

본 발명에서는 F3(Forward 3) 프라이머, B3(Backward 3) 프라이머, FIP(Forward Internal Primer) 프라이머, BIP(Backward Internal Primer) 프라이머, LF(Loop Forward) 프라이머, LB(Loop Backward) 프라이머, 정방향(forward) 프라이머, 역방향(reverse) 프라이머 등이 사용되었다.In the present invention, F3 (Forward 3) primer, B3 (Backward 3) primer, FIP (Forward Internal Primer) primer, BIP (Backward Internal Primer) primer, LF (Loop Forward) primer, LB (Loop Backward) primer, forward (forward) ) primer, reverse primer, etc. were used.

본 발명에서, 용어 "프로브"란, 유전자 또는 mRNA와 특이적 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하는데, 올리고뉴클레오티드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있고, 보다 용이하게 검출하기 위하여 라벨링 될 수 있으나, 특별히 이에 제한되지는 않는다.In the present invention, the term   "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases as short as possible to achieve specific binding to a gene or mRNA, oligonucleotide   probe , single-stranded DNA probe, double-stranded DNA probe, RNA probe, etc., and can be labeled for easier detection, but is not particularly limited thereto.

상기 프로브에 부착되는 형광물질은 형광을 발하는 것이라면 제한되지 아니하나, 그 비제한적인 예로서 FAM(6-carboxyfluorescein), 텍사스 레드(texas red), 플루오레신(fluorescein), HEX(2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), 플루오레신 클로로트리아지닐(fluorescein chlorotriazinyl), 로다민 그린(rhodamine green), 로다민 레드(rhodamine red), 테트라메틸 로다민(tetramethyl rhodamine), FITC(fluorescein isothiocyanate), 오레곤 그린(oregon green), 알렉사 플루오로(alexa fluor), JOE(6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-XRhodamine), TET(Tetrachloro-Fluorescein), TRITC(tertramethylrodamine isothiocyanate), TAMRA(6-carboxytetramethyl-rhodamine), NED(N-(1-Naphthyl) ethylenediamine), 시아닌(Cyanine) 계열 염료 및 씨아디카르보시아닌(thiadicarbocyanine) 등이 있다. 본 발명에 있어서, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타에 대한 LAMP 프라이머/프로브 세트는 각각 HEX, Cy5, 및 텍사스 레드로 표지하여 하나의 튜브 안에서 칸디다균 3종을 동시에 검출할 수 있다.The fluorescent material attached to the probe is not limited as long as it emits fluorescence, but non-limiting examples thereof include FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein, HEX (2',4). ',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl Rhodamine (tetramethyl rhodamine), FITC (fluorescein isothiocyanate), Oregon green, Alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein) , ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro-Fluorescein), TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N- (1-Naphthyl) ethylenediamine), cyanine-based dyes and thiadicarbocyanine. In the present invention, LAMP primer/probe sets for Candida albican, Candida auris, and Candida glabrata are labeled with HEX, Cy5, and Texas Red, respectively, so that three Candida species can be simultaneously detected in one tube. have.

상기 프로브에 소광물질(퀀쳐, quencher)이 부착될 수 있으며, 상기 소광물질은 IABkFQ(Iowa black FQ quencher), IAbRQSp(Iowa black RQ quencher), DABCYL(4-dimethylaminoazobenzene-4'-sulfonyl chloride), BHQ (Black Hole Quencher; BHQ-1, BHQ-2 등), EBQ(Excellent Bioneer Quencher), 또는 ZEN-IBFQ(ZEN-Iowa Black FQ)일 수 있으나, 이에 제한되는 것이 아니고 당업계에 알려진 다양한 소광물질이 사용될 수 있다. 본 발명에서는 바람직하게는 BHQ1 또는 BHQ2가 사용될 수 있으며, 형광물질이 HEX, FAM, 또는 TEX인 경우 BHQ1가, Cy5인 경우 BHQ2가 사용될 수 있다.A quencher (quencher) may be attached to the probe, and the quencher is IABkFQ (Iowa black FQ quencher), IAbRQSp (Iowa black RQ quencher), DABCYL (4-dimethylaminoazobenzene-4'-sulfonyl chloride), BHQ (Black Hole Quencher; BHQ-1, BHQ-2, etc.), EBQ (Excellent Bioneer Quencher), or ZEN-IBFQ (ZEN-Iowa Black FQ), but is not limited thereto, and various matting materials known in the art can be used In the present invention, BHQ1 or BHQ2 may be preferably used, and BHQ1 may be used when the fluorescent material is HEX, FAM, or TEX, and BHQ2 may be used when Cy5 is used.

본 발명에서, 용어 “생물학적 시료”는 혈액(blood), 객담(sputum), 기관지 흡인(bronchial aspiration), 구강세척액(oreal cavity swab), 소변(urine) 등을 포함하는 신체의 다양한 부분의 세포 또는 조직을 포함할 수 있다. In the present invention, the term “biological sample” refers to cells of various parts of the body, including blood, sputum, bronchial aspiration, oral cavity swab, urine, or the like. may include organizations.

본 발명은 다양한 변환을 가할 수 있고 여러 가지 실시예를 가질 수 있는 바, 이하 특정 실시예들을 도면에 예시하고 상세한 설명에 상세하게 설명하고자 한다. 그러나, 이는 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술 범위에 포함되는 모든 변환, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.The present invention can apply various transformations and can have various embodiments. Hereinafter, specific embodiments are illustrated in the drawings and described in detail in the detailed description. However, this is not intended to limit the present invention to specific embodiments, and should be understood to include all modifications, equivalents, and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of a related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

실시예 1: 칸디다균 3종(칸디다 알비칸, 칸디다 아우리스, 칸디다 글라브라타) 검출용 LAMP 프라이머 세트, 중합효소연쇄반응 혼합물 조성 및 반응조건Example 1: LAMP primer set for detection of three Candida species (Candida albican, Candida auris, Candida glabrata), polymerase chain reaction mixture composition and reaction conditions

칸디다 알비칸 18s rRNA 유전자의 염기서열을 바탕으로 디자인된 칸디다 알비칸 LAMP 프라이머 세트(도 1), 칸디다 아우리스 28s rRNA 유전자의 염기서열을 바탕으로 디자인된 칸디다 아우리스 LAMP 프라이머 세트(도 2), 및 칸디다 글라브라타 18s rRNA 유전자의 염기서열을 바탕으로 디자인된 칸디다 글라브라타 LAMP 프라이머 세트(도 3) 서열 및 reference 논문 프라이머세트(real-time PCR 및 LAMP)를 표 1에 나타내었다. 하기 표 1에서 형광물질로 표기된 염기는 밑줄로 표시하였다. RT-LAMP 프라이머 혼합물의 조성은 표 2에, RT-LAMP 반응 혼합물의 시약 조성은 표 3에, RT-LAMP 반응 조건은 표 4에 나타내었다.Candida albican LAMP primer set designed based on the nucleotide sequence of Candida albican 18s rRNA gene (Fig. 1), Candida auris LAMP primer set designed based on the nucleotide sequence of Candida auris 28s rRNA gene (Fig. 2), and the Candida glabrata LAMP primer set (FIG. 3) designed based on the nucleotide sequence of the Candida glabrata 18s rRNA gene and the reference thesis primer set (real-time PCR and LAMP) are shown in Table 1. In Table 1 below, bases marked with fluorescent materials are underlined. The composition of the RT-LAMP primer mixture is shown in Table 2, the reagent composition of the RT-LAMP reaction mixture is shown in Table 3, and the RT-LAMP reaction conditions are shown in Table 4.

서열번호SEQ ID NO: Target genetarget gene NameName Sequence (5'-3')Sequence (5'-3') ReferenceReference 1One Candida albicans
(18s rRNA)
Candida albicans
(18s rRNA)
Candida albicans_F3Candida albicans_F3 CGATACGTAATATGAATTGCAGATCGATACGTAATATGAATTGCAGAT
22 Candida albicans_B3Candida albicans_B3 AGACCTAAGCCATTGTCAAAGACCTAAGCCATTGTCAA 33 Candida albicans_FIPCandida albicans_FIP AACGACGCTCAAACAGGCATCGTGAATCATCGAATCTTTGAACAACGACGCTCAAACAGGCATCGTGAATCATCGAATCTTTGAAC 44 Candida albicans_BIPCandida albicans_BIP CTGGGTTTGGTGTTGAGCAAATCCCGCCTTACCACTACCTGGGTTTGGTGTTGAGCAAATCCCGCCTTACCACTAC 55 Candida albicans_LFCandida albicans_LF CAGAGGGCGCAATGTGCCAGAGGGCGCAATGTGC 66 Candida albicans_LBCandida albicans_LB ACGACTTGGGTTTGCTTGAAAACGACTTGGGTTTGCTTGAAAA 77 Candida albicans_LB_P4_HEX Candida albicans_LB_P4_HEX CGGGCCCGTACAAAGGGAACACCCACACTCCG
ACGACTTGGGTTTGCTTGAAA
CGGGCCCGTACAAAGGGAACACCCACACTCCG
ACGACTTGGGTTTGCTTGAAAA
88 Candida auris
(28s rRNA)
Candida auris
(28s rRNA)
Candida auris_F3Candida auris_F3 GGATTGCCTCAGTAACGGCGGATTGCCTCAGTAACGGC
99 Candida auris_B3Candida auris_B3 GCTGCATTCCCAAACAACTCGCTGCATTCCCAAACAACTC 1010 Candida auris_FIPCandida auris_FIP TGGTGGCCACCTCCAGACTACGAGTGAAGCGGCAAGAGCTGGTGGCCACCTCCAGACTACGAGTGAAGCGGCAAGAGC 1111 Candida auris_BIPCandida auris_BIP TAGCAGCAGGCAAGTCCTTTGGGCCACAGGAAGCACTAGCTAGCAGCAGGCAAGTCCTTTGGGCCACAGGAAGCACTAGC 1212 Candida auris_LBCandida auris_LB AACAAGGCGCCAGCGAAACAAGGCGCCAGCGA 1313 Candida auris_LFCandida auris_LF CGGAGCGATTCCAAAGTTGACGGAGCGATTCCAAAGTTGA 1414 Candida auris_LF_P2_CY5 Candida auris_LF_P2_CY5 GTCAGTGCAGGCTCCCGTGTTAGGACGAGGGTAGG
CGGAGCGATTCCAAAGTTGA
GTCAGTGCAGGCTCCCGTGTTAGGACGAGGGTAGG
CGGAGCGATTCCAAAGTTGA
1515 Candida glabrata
(18s rRNA)
Candida glabrata
(18s rRNA)
C. glabrata_F3C. glabrata_F3 TCAGTATGTGGGACACGATCAGTATGTGGGACACGA
1616 C. glabrata_B3C. glabrata_B3 CGGGTAACCCTACCTGATCGGGTAACCCTACCTGAT 1717 C. glabrata_FIPC. glabrata_FIP CCTAATACAGTATTAACCCCCGCGCAAGCTTCTCTATTAATCTGCCCTAATACAGTATTAACCCCCGCGCAAGCTTCTCTATTAATCTGC 1818 C. glabrata_BIPC. glabrata_BIP CCAACTCGGTGTTGATCTAGGGTTGAGGTCAAACTTAAAGACGCCAACTCGGTGTTGATCTAGGGTTGAGGTCAAACTTAAAGACG 1919 C. glabrata_LBC. glabrata_LB TAAGTGAGTGTTTTGTGCGTGCTGG TAAGTGAGTGTTTTGTGCGTGCTGG 2020 C. glabrata_LFC. glabrata_LF GCTCGCGCAAACGAGCAGCTCGCGCAAACGAGCA 2121 C. glabrata_LF_P4_TEX C. glabrata_LF_P4_TEX CGGGCCCGTACAAAGGGAACACCCACACTCCG
GCTCGCGCAAACGAGCA
CGGGCCCGTACAAAGGGAACACCCACACTCCG
GCTCGCGCAAACGAGCA
2222 lamp_PROBE2_QUENCHER lamp_PROBE2_QUENCHER CCT ACC CTC GTC CTA ACA CGG GAG CCT GCA CTG AC-BHQ2CCT ACC CTC GTC CTA ACA CGG GAG CCT GCA CTG AC-BHQ2 2323 lamp_PROBE4_QUENCHER lamp_PROBE4_QUENCHER GAG TGT GGG TGT TCC CTT TGT ACG GGC CCG-BHQ1GAG TGT GGG TGT TCC CTT TGT ACG GGC CCG-BHQ1 2424 Reference
C. albicans
real-time PCR
Reference
C. albicans
real-time PCR
C. albicans
real-time PCR-f
C. albicans
real-time PCR-f
CTTGGTATTTTGCATGTTGCTCTCCTTGGTATTTTGCATGTTGCTCTC 1One
2525 C. albicans
real-time PCR-r
C. albicans
real-time PCR-r
GTCAGAGGCTATAACACACAGCAGGTCAGAGGCTATAACACACAGCAG
2626 C. albicans
real-time PCR-p
C. albicans
real-time PCR-p
TTTACCGGGCCAGCATCGGTTTTTTACCGGGCCAGCATCGGTTT
2727 Reference
C. auris
real-time PCR
Reference
C. auris
real-time PCR
C. auris
real-time PCR-f
C. auris
real-time PCR-f
CGTGATGTCTTCTCACCAATCTCGTGATGTCTTCTCACCAATCT 22
2828 C. auris
real-time PCR-r
C. auris
real-time PCR-r
TACCTGATTTGAGGCGACAACTACCTGATTTGAGGCGACAAC
2929 C. auris
real-time PCR-p
C. auris
real-time PCR-p
GCGGTGGCGTTGCGCGGTGGCGTTGC
3030 Reference
C. glabrata
real-time PCR
Reference
C. glabrata
real-time PCR
C. glabrata
real-time PCR-f
C. glabrata
real-time PCR-f
GCGCCCCTTGCCTCTCGCGCCCCTTGCCTCTC 1One
3131 C. glabrata
real-time PCR-r
C. glabrata
real-time PCR-r
CCCAGGGCTATAACACTCTACACCCCCAGGGCTATAACACTCTACACC
3232 C. glabrata
real-time PCR-p
C. glabrata
real-time PCR-p
TGGGCTTGGGACTCTCGCAGCTGGGCTTGGGACTCTCGCAGC
3333 Reference
C. albicans
LAMP
Reference
C. albicans
LAMP
Reference Candida albicans_F3Reference Candida albicans_F3 TCTGGTATTCCGGAGGGCTCTGGTATTCCGGAGGGC 33
3434 Reference Candida albicans_B3Reference Candida albicans_B3 AGTCCTACCTGATTTGAGGTAGTCCTACCTGATTTGAGGT 3535 Reference Candida albicans_FIPReference Candida albicans_FIP CTACCGTCTTTCAAGCAAACCCATGAGCGTCGTTTCTCCCTCTACCGTCTTTCAAGCAAACCCATGAGCGTCGTTTCTCCCT 3636 Reference Candida albicans_BIPReference Candida albicans_BIP TTGACAATGGCTTAGGTCTAACCAAAAGATATACGTGGTGGACGTTACTTGACAATGGCTTAGGTCTAACCAAAAGATATACGTGGTGGACGTTAC 3737 Reference Candida albicans_LBReference Candida albicans_LB CTCAACACCAAACCCAGCGGCTCAACACCAAACCCAGCGG 3838 Reference
C. auris
LAMP
Reference
C. auris
LAMP
Reference Candida auris_F3Reference Candida auris_F3 GGGAAAGGAACCCTGACCTGGGAAAGGAACCCTGACCT 44
3939 Reference Candida auris_B3Reference Candida auris_B3 GGACACAGCATTCGAAGTGTGGACACAGCATTCGAAGTGT 4040 Reference Candida auris_FIPReference Candida auris_FIP AGGCTACTGAGCTTGCTGGTGTAACCAAACCAACAGGAGAGGAGGCTACTGAGCTTGCTGGTGTAACCAAACCAACAGGAGAGG 4141 Reference Candida auris_BIPReference Candida auris_BIP ACGGTTTCAGGGTTAGCATGGCTCAACAAAGTCGCTGGTACAACGGTTTCAGGGTTAGCATGGCTCAACAAAGTCGCTGGTACA 4242 Reference Candida auris_LFReference Candida auris_LF CATCTCGAAGGCCTCGGTCATCTCGAAGGCCTCGGT 4343 Reference Candida auris_LBReference Candida auris_LB CACATACTCGAACGGAGTCCACATACTCGAACGGAGTC 4444 Reference
C. glabrata
LAMP
Reference
C. glabrata
LAMP
Reference C. glabrata_F3Reference C. glabrata_F3 TGGTAGTGAGTGATACTCGTTTGGTAGTGAGTGATACTCGTT 33
4545 Reference C. glabrata_B3Reference C. glabrata_B3 CTTAAAGACGTCTGTCTGCCCTTAAAGACGTCTGTCTGCC 4646 Reference C. glabrata_FIPReference C. glabrata_FIP GCAGATTAATAGAGAAGCTTGCGCTGAGTTAACTTGAAATTGTAGGCCGCAGATTAATAGAGAAGCTTGCGCTGAGTTAACTTGAAATTGTAGGCC 4747 Reference C. glabrata_BIPReference C. glabrata_BIP GCGGCGGGGGTTAATACTGTCACAAAACACTCACTTATCCCTGCGGCGGGGGTTAATACTGTCACAAAACACTCACTTATCCCT 4848 Reference C. glabrata_LFReference C. glabrata_LF GGTTTTACCAACTCGGTGTTGATCTGGTTTTACCAACTCGGTGTTGATCT

상기 표 1에서 reference는 다음과 같다.References in Table 1 are as follows.

(1) Brinkman NE, Haugland RA, Wymer LJ, Byappanahalli M, Whitman RL, Vesper SJ. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water. Appl Environ Microbiol. 2003;69(3):1775-82.(1) Brinkman NE, Haugland RA, Wymer LJ, Byappanahalli M, Whitman RL, Vesper SJ. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water. Appl Environ Microbiol . 2003;69(3):1775-82.

(2) Lima A, Widen R, Vestal G, Uy D, Silbert S. A TaqMan probe-based real-time PCR assay for the rapid identification of the emerging multidrug-resistant pathogen Candida auris on the BD Max system. J Clin Microbiol. 2019;57(7):e01604-18.(2) Lima A, Widen R, Vestal G, Uy D, Silbert S. A TaqMan probe-based real-time PCR assay for the rapid identification of the emerging multidrug-resistant pathogen Candida auris on the BD Max system. J Clin Microbiol . 2019;57(7):e01604-18.

(3) Kasahara K, Ishikawa H, Sato S, Shimakawa Y, Watanabe K. Development of multiplex loop-mediated isothermal amplification assays to detect medically important yeasts in dairy products. FEMS Microbiol Lett. 2014;357(2):208-16.(3) Kasahara K, Ishikawa H, Sato S, Shimakawa Y, Watanabe K. Development of multiplex loop-mediated isothermal amplification assays to detect medically important yeasts in dairy products. FEMS Microbiol Lett . 2014;357(2):208-16.

(4) Yamamoto M, Alshahni MM, Tamura T, Satoh K, Iguchi S, Kikuchi K, Mimaki M, Makimura K. Rapid detection of Candida auris based on loop-mediated isothermal amplification (LAMP). J Clin Microbiol. 2018;56(9):e00591-18.(4) Yamamoto M, Alshahni MM, Tamura T, Satoh K, Iguchi S, Kikuchi K, Mimaki M, Makimura K. Rapid detection of Candida auris based on loop-mediated isothermal amplification (LAMP). J Clin Microbiol . 2018;56(9):e00591-18.

C. albicans LAMP primerC. albicans LAMP primer uMuM C. auris LAMP primerC. auris LAMP primer uMuM C. glabrata LAMP primerC. glabrata LAMP primer uMuM Candida albicans_F3Candida albicans_F3 44 Candida auris_F3Candida auris_F3 44 C. glabrata_F3C. glabrata_F3 44 Candida albicans_B3Candida albicans_B3 44 Candida auris_B3Candida auris_B3 44 C. glabrata_B3C. glabrata_B3 44 Candida albicans_FIPCandida albicans_FIP 3232 Candida auris_FIPCandida auris_FIP 3232 C. gabrata_FIPC. gabrata_FIP 3232 Candida albicans_BIPCandida albicans_BIP 3232 Candida auris_BIPCandida auris_BIP 3232 C. glabrata_BIPC. glabrata_BIP 3232 Candida albicans_LFCandida albicans_LF 1010 Candida auris_LBCandida auris_LB 1010 C. glabrata_LBC. glabrata_LB 1010 Candida albicans_LBCandida albicans_LB 66 Candida auris_LFCandida auris_LF 66 C. glabrata_LFC. glabrata_LF 66 Candida albicans_LB_P4_HEXCandida albicans_LB_P4_HEX 44 Candida auris_LF_P2_CY5Candida auris_LF_P2_CY5 44 C. Glabrata_LF_P4_TEXC. Glabrata_LF_P4_TEX 44

구분division 부피volume RMRM 12.512.5 EMEM 22 Distilled waterDistilled water 0.30.3 Primer mixPrimer mix 1 (Candida albicans)1 (Candida albicans) 1 (Candida auris)1 (Candida auris) 1 (Candida glabrata)1 (Candida glabrata) QUENCHER (P4)QUENCHER (P4) 1.51.5 QUENCHER (P2)QUENCHER (P2) 0.70.7 TemplateTemplate 55 TOTALTOTAL 2525

실험 1. 원스텝 RT-LAMP검출실험Experiment 1. One-step RT-LAMP detection experiment 온도temperature 반응시간reaction time 60 ℃60 1분1 minute 50 Cycle50 Cycles 전체반응시간total reaction time 50분50 minutes

실시예 2: 다양한 칸디다균에 대한 칸디다 3종 LAMP 프라이머 세트의 특이도 테스트Example 2: Specificity test of Candida three LAMP primer sets against various Candida bacteria

칸디다균 7종(칸디다 알비칸(C. albicans), 칸디다 아우리스(C. auris), 칸디다 글라브라타(C. glabrata), 칸디다 크루세이(C. krusei), 칸디다 트로피컬리스(C. tropicalis), 칸디다 파라프실로시스(C. parapsilosis), 칸디다 구일리에르몬디(C. guilliermondii))를 대상으로 칸디다균 3종(칸디다 알비칸, 칸디다 아우리스, 칸디다 글라브라타)에 대한 multiplex LAMP 프라이머 세트의 성능을 평가하였다. 그 결과 칸디다균 3종에 대한 multiplex LAMP 프라이머 세트는 모든샘플에서 비특이 반응없이 타겟 칸디다균만 특이적으로 검출하는 결과를 타내었다(도 4 및 표 5).7 species of Candida ( Candida albicans ( C. albicans ), Candida auris ( C. auris ), Candida glabrata ( C. glabrata ), Candida krusei ( C. krusei ), Candida tropicalis ( C. tropicalis ), Candida parapsilosis ( C. parapsilosis ), and Candida guilliermondii ( C. guilliermondii ) The performance of the multiplex LAMP primer set against three Candida species (Candida albican, Candida auris, Candida glabrata) was evaluated. As a result, the multiplex LAMP primer set for three types of Candida specifically detected only the target Candida without a non-specific reaction in all samples ( FIGS. 4 and 5 ).

SamplesSamples C. albicans (Hex) C. albicans (Hex) C. auris (Cy5)C. auris (Cy5) C. glabrata (Texas Red) C. glabrata (Texas Red) CtCt RFURFU CtCt RFURFU CtCt RFURFU C. albicans DNA C. albicans DNA 18.2418.24 70157015 N/AN/A 353353 N/AN/A 87.487.4 C. glabrata DNA C. glabrata DNA N/AN/A 97.697.6 N/AN/A 996996 17.9717.97 1121011210 C. krusei DNA C. krusei DNA N/AN/A 1.331.33 N/AN/A 9.139.13 N/AN/A -1.23-1.23 C. tropicalis DNA C. tropicalis DNA N/AN/A 0.1920.192 N/AN/A 1111 N/AN/A -3.56-3.56 C. parapsilosis DNA C. parapsilosis DNA N/AN/A 0.2020.202 N/AN/A 10.910.9 N/AN/A -2.4-2.4 C. guilliermondii DNA C. guilliermondii DNA N/AN/A 2.762.76 N/AN/A 12.512.5 N/AN/A -1.88-1.88 C.auris DNA C. auris DNA N/AN/A 57.257.2 16.9616.96 74877487 N/AN/A 133133 DWDW N/AN/A 0.6580.658 N/AN/A 12.412.4 N/AN/A -1.5-1.5

실시예 3: 칸디다 3종 LAMP 프라이머 세트의 민감도 테스트Example 3: Sensitivity test of Candida three LAMP primer sets

칸디다 알비칸, 칸디다 아우리스 및 칸디다 글라브라타의 DNA 샘플을 1 ng/μl에서부터 1 fg/μl까지 희석하여 칸디다 monoplex와 multiplex LAMP 프라이머 세트, 논문에 발표된 칸디다균 3종 RT-PCR 및 LAMP 프라이머 세트와 민감도를 비교하였다(표 6, 표 7, 및 표 8). 칸디다 알비칸에 대해서는 본 발명의 monoplex와 multiplex LAMP 프라이머 세트 모두 100 fg/μl까지 검출했으나 reference 칸디다 알비칸 real-time PCR 프라이머와 reference 칸디다 알비칸 LAMP 프라이머세트는 1 pg/μl까지 검출하였다. 칸디다 아우리스의 경우는 본 발명의 프라이머세트 모두 1 pg/μl까지 검출하였고, reference 칸디다 아우리스 real-time PCR 프라이머는 1 pg/μl까지, reference 칸디다 아우리스 LAMP 프라이머 세트는 10 pg/μl까지 검출하였다. 칸디다 글라브라타의 경우에는 본 발명의 monoplex 프라이머 세트는 100 fg/μl까지, 본 발명의 multiplex 프라이머 세트의 경우는 1 pg/μl까지 증폭되는 것이 확인되었고, reference 칸디다 글라브라타 real-time PCR 프라이머는 1 pg/μl까지, reference 칸디다 글라브라타 LAMP 프라이머 세트는 10 pg/μl까지 검출하였다. 종합적으로 본 발명의 칸디다 multiplex LAMP 프라이머 세트는 한 단계 낮은 민감도를 나타낸 칸디다 글라브라타를 제외하고 칸디다 알비칸스, 아우리스 monoplex 결과와 유사했고, 기존 발표된 칸디다 real-time 프라이머 세트와 LAMP 프라이머 세트보다 빠르고 높은 민감도를 나타냈다.DNA samples of Candida albican, Candida auris, and Candida glabrata were diluted from 1 ng/μl to 1 fg/μl, and Candida monoplex and multiplex LAMP primer sets, Candida 3 strains RT-PCR and LAMP primer sets published in the paper and sensitivities were compared (Table 6, Table 7, and Table 8). For Candida albican, both the monoplex and multiplex LAMP primer sets of the present invention were detected up to 100 fg/μl, but the reference Candida albican real-time PCR primer and reference Candida albican LAMP primer set detected up to 1 pg/μl. In the case of Candida auris, all of the primer sets of the present invention were detected up to 1 pg/μl, the reference Candida auris real-time PCR primer was detected up to 1 pg/μl, and the reference Candida auris LAMP primer set was detected up to 10 pg/μl. did In the case of Candida glabrata, it was confirmed that the monoplex primer set of the present invention was amplified up to 100 fg/μl, and in the case of the multiplex primer set of the present invention up to 1 pg/μl, and the reference Candida glabrata real-time PCR primer was Up to 1 pg/μl, the reference Candida glabrata LAMP primer set was detected up to 10 pg/μl. Overall, the Candida multiplex LAMP primer set of the present invention was similar to the Candida albicans and auris monoplex results except for Candida glabrata, which showed a lower sensitivity, and compared to the previously published Candida real-time primer set and LAMP primer set. It was fast and showed high sensitivity.

Candida albicans DNA Candida albicans DNA 개발 C. albicans LAMP Monoplex Development of C. albicans LAMP Monoplex 개발 Candida 3종 LAMP Multiplex Developed Candida 3 LAMP Multiplex Reference RT-PCR
프라이머 세트
Reference RT-PCR
Primer set
Reference RT-LAMP
프라이머 세트
Reference RT-LAMP
Primer set
CTCT RFURFU CTCT RFURFU CTCT RFURFU CTCT RFURFU DNA 1 ng/ulDNA 1 ng/ul 14.0114.01 1462014620 18.4218.42 57145714 18.3418.34 1034810348 11.4311.43 1469614696 DNA 100 pg/ulDNA 100 pg/ul 15.6315.63 1510115101 21.9921.99 55955595 23.4923.49 93459345 13.8113.81 1219912199 DNA 10 pg/ulDNA 10 pg/ul 18.0418.04 1490114901 25.6225.62 56525652 29.3429.34 60776077 16.0116.01 1122711227 DNA 1pg/ulDNA 1 pg/ul 20.4420.44 1560515605 28.3128.31 57145714 32.8532.85 34683468 16.116.1 1442214422 DNA 100 fg/ulDNA 100 fg/ul 31.4431.44 1491214912 33.0933.09 56475647 N/AN/A 195195 N/AN/A 143143 DNA 10 fg/ulDNA 10 fg/ul N/AN/A 6.816.81 N/AN/A 2.212.21 N/AN/A 2.232.23 N/AN/A 177177 DNA 1 fg/ulDNA 1 fg/ul N/AN/A 274274 N/AN/A 3.743.74 N/AN/A 4.244.24 N/AN/A 91.791.7 DWDW N/AN/A 6.26.2 N/AN/A 2.532.53 N/AN/A -3.33-3.33 N/AN/A -48.1-48.1

C. auris DNA C. auris DNA 개발 C. auris LAMP Monoplex Development of C. auris LAMP Monoplex 개발 Candida 3종 LAMP Multiplex Developed Candida 3 LAMP Multiplex Reference RT-PCR
프라이머 세트
Reference RT-PCR
Primer set
Reference RT-LAMP
프라이머 세트
Reference RT-LAMP
Primer set
CTCT RFURFU CTCT RFURFU CTCT RFURFU CTCT RFURFU DNA 1 ng/ulDNA 1 ng/ul 12.6512.65 88568856 16.0116.01 66736673 21.8521.85 2701127011 11.8811.88 2828928289 DNA 100 pg/ulDNA 100 pg/ul 14.6714.67 87068706 18.3918.39 71377137 26.6726.67 2242622426 12.5712.57 2296222962 DNA 10 pg/ulDNA 10 pg/ul 17.1117.11 88528852 21.3521.35 71347134 31.3431.34 1498514985 14.4614.46 2050020500 DNA 1pg/ulDNA 1 pg/ul 20.1720.17 87028702 25.1625.16 69186918 35.9835.98 60396039 N/AN/A 77.377.3 DNA 100 fg/ulDNA 100 fg/ul N/AN/A 14.314.3 N/AN/A 8.628.62 N/AN/A 856856 N/AN/A 37.437.4 DNA 10 fg/ulDNA 10 fg/ul N/AN/A 16.916.9 N/AN/A 12.312.3 N/AN/A 129129 N/AN/A 64.964.9 DNA 1 fg/ulDNA 1 fg/ul N/AN/A 1414 N/AN/A 11.411.4 N/AN/A 177177 N/AN/A 53.453.4 DWDW N/AN/A 15.115.1 N/AN/A 2.572.57 N/AN/A 59.459.4 N/AN/A 161161

C. glabrata DNA C. glabrata DNA 개발 C. glabrata LAMP Monoplex Development of C. glabrata LAMP Monoplex 개발 Candida 3종 LAMP Multiplex Developed Candida 3 LAMP Multiplex Reference RT-PCR
프라이머 세트
Reference RT-PCR
Primer set
Reference RT-LAMP
프라이머 세트
Reference RT-LAMP
Primer set
CTCT RFURFU CTCT RFURFU CTCT RFURFU CTCT RFURFU DNA 1 ng/ulDNA 1 ng/ul 13.2213.22 1147811478 17.9117.91 96989698 21.3221.32 73587358 24.0224.02 1825218252 DNA 100 pg/ulDNA 100 pg/ul 1515 1237012370 20.5520.55 1003410034 25.9625.96 60976097 26.4626.46 1470414704 DNA 10 pg/ulDNA 10 pg/ul 17.6117.61 1212712127 23.9123.91 97759775 31.0331.03 36993699 N/AN/A 149149 DNA 1pg/ulDNA 1 pg/ul 19.2119.21 1219312193 27.3327.33 98239823 35.2335.23 14161416 N/AN/A 102102 DNA 100 fg/ulDNA 100 fg/ul 24.4424.44 1265912659 N/AN/A 0.1360.136 N/AN/A 3.043.04 N/AN/A 148148 DNA 10 fg/ulDNA 10 fg/ul N/AN/A -4.63-4.63 N/AN/A 0.5310.531 N/AN/A 0.6810.681 N/AN/A 109109 DNA 1 fg/ulDNA 1 fg/ul N/AN/A -5.55-5.55 N/AN/A 1.131.13 N/AN/A 1.321.32 N/AN/A 123123 DWDW N/AN/A -5.2-5.2 N/AN/A -3.3-3.3 N/AN/A 2.632.63 N/AN/A 99.899.8

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Korea University Research and Buisness Foundation <120> Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe <130> DP-2020-0686, DHP20-K159 <160> 48 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> Candida albicans <400> 1 cgatacgtaa tatgaattgc agat 24 <210> 2 <211> 19 <212> DNA <213> Candida albicans <400> 2 agacctaagc cattgtcaa 19 <210> 3 <211> 43 <212> DNA <213> Candida albicans <400> 3 aacgacgctc aaacaggcat cgtgaatcat cgaatctttg aac 43 <210> 4 <211> 38 <212> DNA <213> Candida albicans <400> 4 ctgggtttgg tgttgagcaa atcccgcctt accactac 38 <210> 5 <211> 17 <212> DNA <213> Candida albicans <400> 5 cagagggcgc aatgtgc 17 <210> 6 <211> 21 <212> DNA <213> Candida albicans <400> 6 acgacttggg tttgcttgaa a 21 <210> 7 <211> 53 <212> DNA <213> Candida albicans <400> 7 cgggcccgta caaagggaac acccacactc cgacgacttg ggtttgcttg aaa 53 <210> 8 <211> 19 <212> DNA <213> Candida auris <400> 8 ggattgcctc agtaacggc 19 <210> 9 <211> 20 <212> DNA <213> Candida auris <400> 9 gctgcattcc caaacaactc 20 <210> 10 <211> 39 <212> DNA <213> Candida auris <400> 10 tggtggccac ctccagacta cgagtgaagc ggcaagagc 39 <210> 11 <211> 40 <212> DNA <213> Candida auris <400> 11 tagcagcagg caagtccttt gggccacagg aagcactagc 40 <210> 12 <211> 16 <212> DNA <213> Candida auris <400> 12 aacaaggcgc cagcga 16 <210> 13 <211> 20 <212> DNA <213> Candida auris <400> 13 cggagcgatt ccaaagttga 20 <210> 14 <211> 55 <212> DNA <213> Candida auris <400> 14 gtcagtgcag gctcccgtgt taggacgagg gtaggcggag cgattccaaa gttga 55 <210> 15 <211> 18 <212> DNA <213> Candida glabrata <400> 15 tcagtatgtg ggacacga 18 <210> 16 <211> 18 <212> DNA <213> Candida glabrata <400> 16 cgggtaaccc tacctgat 18 <210> 17 <211> 45 <212> DNA <213> Candida glabrata <400> 17 cctaatacag tattaacccc cgcgcaagct tctctattaa tctgc 45 <210> 18 <211> 43 <212> DNA <213> Candida glabrata <400> 18 ccaactcggt gttgatctag ggttgaggtc aaacttaaag acg 43 <210> 19 <211> 25 <212> DNA <213> Candida glabrata <400> 19 taagtgagtg ttttgtgcgt gctgg 25 <210> 20 <211> 17 <212> DNA <213> Candida glabrata <400> 20 gctcgcgcaa acgagca 17 <210> 21 <211> 49 <212> DNA <213> Candida glabrata <400> 21 cgggcccgta caaagggaac acccacactc cggctcgcgc aaacgagca 49 <210> 22 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> lamp_PROBE2_QUENCHER <400> 22 cctaccctcg tcctaacacg ggagcctgca ctgac 35 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> lamp_PROBE4_QUENCHER <400> 23 gagtgtgggt gttccctttg tacgggcccg 30 <210> 24 <211> 24 <212> DNA <213> Candida albicans <400> 24 cttggtattt tgcatgttgc tctc 24 <210> 25 <211> 24 <212> DNA <213> Candida albicans <400> 25 gtcagaggct ataacacaca gcag 24 <210> 26 <211> 22 <212> DNA <213> Candida albicans <400> 26 tttaccgggc cagcatcggt tt 22 <210> 27 <211> 22 <212> DNA <213> Candida auris <400> 27 cgtgatgtct tctcaccaat ct 22 <210> 28 <211> 21 <212> DNA <213> Candida auris <400> 28 tacctgattt gaggcgacaa c 21 <210> 29 <211> 13 <212> DNA <213> Candida auris <400> 29 gcggtggcgt tgc 13 <210> 30 <211> 16 <212> DNA <213> Candida glabrata <400> 30 gcgccccttg cctctc 16 <210> 31 <211> 24 <212> DNA <213> Candida glabrata <400> 31 cccagggcta taacactcta cacc 24 <210> 32 <211> 21 <212> DNA <213> Candida glabrata <400> 32 tgggcttggg actctcgcag c 21 <210> 33 <211> 18 <212> DNA <213> Candida albicans <400> 33 tctggtattc cggagggc 18 <210> 34 <211> 20 <212> DNA <213> Candida albicans <400> 34 agtcctacct gatttgaggt 20 <210> 35 <211> 41 <212> DNA <213> Candida albicans <400> 35 ctaccgtctt tcaagcaaac ccatgagcgt cgtttctccc t 41 <210> 36 <211> 48 <212> DNA <213> Candida albicans <400> 36 ttgacaatgg cttaggtcta accaaaagat atacgtggtg gacgttac 48 <210> 37 <211> 20 <212> DNA <213> Candida albicans <400> 37 ctcaacacca aacccagcgg 20 <210> 38 <211> 19 <212> DNA <213> Candida auris <400> 38 gggaaaggaa ccctgacct 19 <210> 39 <211> 20 <212> DNA <213> Candida auris <400> 39 ggacacagca ttcgaagtgt 20 <210> 40 <211> 35 <212> DNA <213> Candida auris <400> 40 cctaccctcg tcctaacacg ggagcctgca ctgac 35 <210> 41 <211> 42 <212> DNA <213> Candida auris <400> 41 acggtttcag ggttagcatg gctcaacaaa gtcgctggta ca 42 <210> 42 <211> 18 <212> DNA <213> Candida auris <400> 42 catctcgaag gcctcggt 18 <210> 43 <211> 19 <212> DNA <213> Candida auris <400> 43 cacatactcg aacggagtc 19 <210> 44 <211> 21 <212> DNA <213> Candida glabrata <400> 44 tggtagtgag tgatactcgt t 21 <210> 45 <211> 20 <212> DNA <213> Candida glabrata <400> 45 cttaaagacg tctgtctgcc 20 <210> 46 <211> 48 <212> DNA <213> Candida glabrata <400> 46 gcagattaat agagaagctt gcgctgagtt aacttgaaat tgtaggcc 48 <210> 47 <211> 42 <212> DNA <213> Candida glabrata <400> 47 gcggcggggg ttaatactgt cacaaaacac tcacttatcc ct 42 <210> 48 <211> 25 <212> DNA <213> Candida glabrata <400> 48 ggttttacca actcggtgtt gatct 25 <110> Korea University Research and Business Foundation <120> Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe <130> DP-2020-0686, DHP20-K159 <160> 48 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> Candida albicans <400> 1 cgatacgtaa tatgaattgc agat 24 <210> 2 <211> 19 <212> DNA <213> Candida albicans <400> 2 agacctaagc cattgtcaa 19 <210> 3 <211> 43 <212> DNA <213> Candida albicans <400> 3 aacgacgctc aaacaggcat cgtgaatcat cgaatctttg aac 43 <210> 4 <211> 38 <212> DNA <213> Candida albicans <400> 4 ctgggtttgg tgttgagcaa atcccgcctt accactac 38 <210> 5 <211> 17 <212> DNA <213> Candida albicans <400> 5 cagagggcgc aatgtgc 17 <210> 6 <211> 21 <212> DNA <213> Candida albicans <400> 6 acgacttggg tttgcttgaa a 21 <210> 7 <211> 53 <212> DNA <213> Candida albicans <400> 7 cgggcccgta caaagggaac acccacactc cgacgacttg ggtttgcttg aaa 53 <210> 8 <211> 19 <212> DNA <213> Candida auris <400> 8 ggattgcctc agtaacggc 19 <210> 9 <211> 20 <212> DNA <213> Candida auris <400> 9 gctgcattcc caaacaactc 20 <210> 10 <211> 39 <212> DNA <213> Candida auris <400> 10 tggtggccac ctccagacta cgagtgaagc ggcaagagc 39 <210> 11 <211> 40 <212> DNA <213> Candida auris <400> 11 tagcagcagg caagtccttt gggccacagg aagcactagc 40 <210> 12 <211> 16 <212> DNA <213> Candida auris <400> 12 aacaaggcgc cagcga 16 <210> 13 <211> 20 <212> DNA <213> Candida auris <400> 13 cggagcgatt ccaaagttga 20 <210> 14 <211> 55 <212> DNA <213> Candida auris <400> 14 gtcagtgcag gctcccgtgt taggacgagg gtaggcggag cgattccaaa gttga 55 <210> 15 <211> 18 <212> DNA <213> Candida glabrata <400> 15 tcagtatgtg ggacacga 18 <210> 16 <211> 18 <212> DNA <213> Candida glabrata <400> 16 cgggtaaccc tacctgat 18 <210> 17 <211> 45 <212> DNA <213> Candida glabrata <400> 17 cctaatacag tattaacccc cgcgcaagct tctctattaa tctgc 45 <210> 18 <211> 43 <212> DNA <213> Candida glabrata <400> 18 ccaactcggt gttgatctag ggttgaggtc aaacttaaag acg 43 <210> 19 <211> 25 <212> DNA <213> Candida glabrata <400> 19 taagtgagtg ttttgtgcgt gctgg 25 <210> 20 <211> 17 <212> DNA <213> Candida glabrata <400> 20 gctcgcgcaa acgagca 17 <210> 21 <211> 49 <212> DNA <213> Candida glabrata <400> 21 cgggcccgta caaagggaac acccacactc cggctcgcgc aaacgagca 49 <210> 22 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> lamp_PROBE2_QUENCHER <400> 22 cctaccctcg tcctaacacg ggagcctgca ctgac 35 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> lamp_PROBE4_QUENCHER <400> 23 gagtgtgggt gttccctttg tacgggcccg 30 <210> 24 <211> 24 <212> DNA <213> Candida albicans <400> 24 cttggtattt tgcatgttgc tctc 24 <210> 25 <211> 24 <212> DNA <213> Candida albicans <400> 25 gtcagaggct ataacacaca gcag 24 <210> 26 <211> 22 <212> DNA <213> Candida albicans <400> 26 tttaccgggc cagcatcggt tt 22 <210> 27 <211> 22 <212> DNA <213> Candida auris <400> 27 cgtgatgtct tctcaccaat ct 22 <210> 28 <211> 21 <212> DNA <213> Candida auris <400> 28 tacctgattt gaggcgacaa c 21 <210> 29 <211> 13 <212> DNA <213> Candida auris <400> 29 gcggtggcgt tgc 13 <210> 30 <211> 16 <212> DNA <213> Candida glabrata <400> 30 gcgccccttg cctctc 16 <210> 31 <211> 24 <212> DNA <213> Candida glabrata <400> 31 cccagggcta taacactcta cacc 24 <210> 32 <211> 21 <212> DNA <213> Candida glabrata <400> 32 tgggcttggg actctcgcag c 21 <210> 33 <211> 18 <212> DNA <213> Candida albicans <400> 33 tctggtattc cggagggc 18 <210> 34 <211> 20 <212> DNA <213> Candida albicans <400> 34 agtcctacct gatttgaggt 20 <210> 35 <211> 41 <212> DNA <213> Candida albicans <400> 35 ctaccgtctt tcaagcaaac ccatgagcgt cgtttctccc t 41 <210> 36 <211> 48 <212> DNA <213> Candida albicans <400> 36 ttgacaatgg cttaggtcta accaaaagat atacgtggtg gacgttac 48 <210> 37 <211> 20 <212> DNA <213> Candida albicans <400> 37 ctcaacacca aacccagcgg 20 <210> 38 <211> 19 <212> DNA <213> Candida auris <400> 38 gggaaaggaa ccctgacct 19 <210> 39 <211> 20 <212> DNA <213> Candida auris <400> 39 ggacacagca ttcgaagtgt 20 <210> 40 <211> 35 <212> DNA <213> Candida auris <400> 40 cctaccctcg tcctaacacg ggagcctgca ctgac 35 <210> 41 <211> 42 <212> DNA <213> Candida auris <400> 41 acggtttcag ggttagcatg gctcaacaaa gtcgctggta ca 42 <210> 42 <211> 18 <212> DNA <213> Candida auris <400> 42 catctcgaag gcctcggt 18 <210> 43 <211> 19 <212> DNA <213> Candida auris <400> 43 cacatactcg aacggagtc 19 <210> 44 <211> 21 <212> DNA <213> Candida glabrata <400> 44 tggtagtgag tgatactcgt t 21 <210> 45 <211> 20 <212> DNA <213> Candida glabrata <400> 45 cttaaagacg tctgtctgcc 20 <210> 46 <211> 48 <212> DNA <213> Candida glabrata <400> 46 gcagattaat agagaagctt gcgctgagtt aacttgaaat tgtaggcc 48 <210> 47 <211> 42 <212> DNA <213> Candida glabrata <400> 47 gcggcggggg ttaatactgt cacaaaacac tcacttatcc ct 42 <210> 48 <211> 25 <212> DNA <213> Candida glabrata <400> 48 ggttttacca actcggtgtt gatct 25

Claims (11)

서열번호 1 내지 6의 프라이머와 서열번호 7의 프로브를 포함하고,
서열번호 8 내지 13의 프라이머와 서열번호 14의 프로브를 포함하고,
서열번호 15 내지 20의 프라이머와 서열번호 21의 프로브를 포함하는,
칸디다 알비칸(Candida albicans), 칸디다 아우리스(Candida auris), 및 칸디다 글라브라타(Candida glabrata) 감별 검출용 동시다중 등온증폭반응(multiplex loop-mediated isothermal amplification reaction, multiplex LAMP) 프라이머 세트.
It comprises a primer of SEQ ID NOs: 1 to 6 and a probe of SEQ ID NO: 7,
It comprises a primer of SEQ ID NO: 8 to 13 and a probe of SEQ ID NO: 14,
comprising a primer of SEQ ID NO: 15 to 20 and a probe of SEQ ID NO: 21,
A multiplex loop-mediated isothermal amplification reaction (multiplex LAMP) primer set for differential detection of Candida albicans , Candida auris , and Candida glabrata .
제1항에 있어서,
상기 서열번호 7, 14, 및 21의 프로브는 5' 말단에 형광물질이 부착된 것을 특징으로 하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출용 multiplex LAMP 프라이머 세트.
According to claim 1,
The probes of SEQ ID NOs: 7, 14, and 21 are multiplex LAMP primer sets for differential detection of Candida albican, Candida auris, and Candida glabrata, characterized in that a fluorescent material is attached to the 5' end.
제2항에 있어서,
상기 형광물질은 각각 상이한 파장을 발하는 것을 특징으로 하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출용 multiplex LAMP 프라이머 세트.
3. The method of claim 2,
A multiplex LAMP primer set for differential detection of Candida albican, Candida auris, and Candida glabrata, characterized in that the fluorescent materials emit different wavelengths, respectively.
제2항에 있어서,
상기 형광물질은 FAM(6-carboxyfluorescein), 텍사스 레드(texas red), 플루오레신(fluorescein), HEX(2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), 플루오레신 클로로트리아지닐(fluorescein chlorotriazinyl), 로다민 그린(rhodamine green), 로다민 레드(rhodamine red), 테트라메틸 로다민(tetramethyl rhodamine), FITC(fluorescein isothiocyanate), 오레곤 그린(oregon green), 알렉사 플루오로(alexa fluor), JOE(6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-XRhodamine), TET(Tetrachloro-Fluorescein), TRITC(tertramethylrodamine isothiocyanate), TAMRA(6-carboxytetramethyl-rhodamine), NED(N-(1-Naphthyl) ethylenediamine), 시아닌(Cyanine) 계열 염료 및 씨아디카르보시아닌(thiadicarbocyanine)으로 구성된 군으로부터 선택되는 어느 하나 이상인 것을 특징으로 하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출용 multiplex LAMP 프라이머 세트.
3. The method of claim 2,
The fluorescent material is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein) ), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, FITC (fluorescein isothiocyanate), oregon green , Alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), Tetrachloro-Fluorescein (TET), TRITC ( Any one or more selected from the group consisting of tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes and thiadicarbocyanine Characterized, Candida albican, Candida auris, and Candida glabrata multiplex LAMP primer set for differential detection.
제2항에 있어서,
상기 서열번호 7의 프로브는 5' 말단에 HEX(2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein)가 부착되었고,
상기 서열번호 14의 프로브는 5' 말단에 Cy5가 부착되었고,
상기 서열번호 21의 프로브는 5' 말단에 텍사스 레드(Texas RED)가 부착된 것을 특징으로 하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출용 multiplex LAMP 프라이머 세트.
3. The method of claim 2,
The probe of SEQ ID NO: 7 had HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein) attached to the 5' end,
Cy5 was attached to the 5' end of the probe of SEQ ID NO: 14,
The probe of SEQ ID NO: 21 is a multiplex LAMP primer set for differential detection of Candida albican, Candida auris, and Candida glabrata, characterized in that Texas RED is attached to the 5' end.
제1항에 있어서,
상기 서열번호 7, 14, 및 21의 프로브는 각각 소광물질을 포함하는 것을 특징으로 하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출용 multiplex LAMP 프라이머 세트.
According to claim 1,
The probes of SEQ ID NOs: 7, 14, and 21 each contain a quencher, Candida albican, Candida auris, and Candida glabrata multiplex LAMP primer set for differential detection.
제6항에 있어서,
상기 소광물질은 IABkFQ(Iowa black FQ quencher), IAbRQSp(Iowa black RQ quencher), DABCYL(4-dimethylaminoazobenzene-4'-sulfonyl chloride), BHQ (Black Hole Quencher), EBQ(Excellent Bioneer Quencher), 및 ZEN-IBFQ(ZEN-Iowa Black FQ)으로 이루어진 군으로부터 선택되는 어느 하나 이상인 것을 특징으로 하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출용 multiplex LAMP 프라이머 세트.
7. The method of claim 6,
The quenching material is IABkFQ (Iowa black FQ quencher), IAbRQSp (Iowa black RQ quencher), DABCYL (4-dimethylaminoazobenzene-4'-sulfonyl chloride), BHQ (Black Hole Quencher), EBQ (Excellent Bioneer Quencher), and ZEN- A multiplex LAMP primer set for differential detection of Candida albican, Candida auris, and Candida glabrata, characterized in that at least one selected from the group consisting of IBFQ (ZEN-Iowa Black FQ).
제1항의 프라이머 세트 및 증폭 반응을 수행하기 위한 시약을 포함하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출용 키트.
A kit for differential detection of Candida albican, Candida auris, and Candida glabrata, comprising the primer set of claim 1 and a reagent for performing an amplification reaction.
제8항에 있어서,
상기 증폭 반응을 수행하기 위한 시약은 DNA 중합효소, dNTPs 및 버퍼로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것을 특징으로 하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출용 키트.
9. The method of claim 8,
A reagent for performing the amplification reaction is a kit for differential detection of Candida albican, Candida auris, and Candida glabrata, characterized in that it comprises at least one selected from the group consisting of DNA polymerase, dNTPs, and a buffer.
(1) 생물학적 시료로부터 게놈 DNA(gDNA)를 분리하는 단계;
(2) 상기 분리된 gDNA를 주형으로 하고 제1항의 프라이머 세트를 이용하여 등온증폭반응을 수행하여 표적 서열을 증폭하는 단계; 및
(3) 상기 증폭된 산물을 검출하는 단계를 포함하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출 방법.
(1) isolating genomic DNA (gDNA) from the biological sample;
(2) amplifying the target sequence by using the isolated gDNA as a template and performing an isothermal amplification reaction using the primer set of claim 1; and
(3) Candida albican, Candida auris, and Candida glabrata differential detection method comprising the step of detecting the amplified product.
제10항에 있어서,
상기 (1) 단계의 생물학적 시료는 혈액(blood), 객담(sputum), 기관지 흡인(bronchial aspiration), 구강세척액(oreal cavity swab), 및 소변(urine)으로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 칸디다 알비칸, 칸디다 아우리스, 및 칸디다 글라브라타 감별 검출 방법.
11. The method of claim 10,
The biological sample of step (1) is at least one selected from the group consisting of blood, sputum, bronchial aspiration, oral cavity swab, and urine, characterized in that , Candida albican, Candida auris, and Candida glabrata differential detection method.
KR1020200161300A 2020-11-26 2020-11-26 Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe KR102453357B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020200161300A KR102453357B1 (en) 2020-11-26 2020-11-26 Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200161300A KR102453357B1 (en) 2020-11-26 2020-11-26 Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe

Publications (3)

Publication Number Publication Date
KR20220073327A true KR20220073327A (en) 2022-06-03
KR102453357B1 KR102453357B1 (en) 2022-10-07
KR102453357B9 KR102453357B9 (en) 2022-12-05

Family

ID=81983624

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200161300A KR102453357B1 (en) 2020-11-26 2020-11-26 Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe

Country Status (1)

Country Link
KR (1) KR102453357B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024143780A1 (en) * 2022-12-29 2024-07-04 드림디엑스 주식회사 Composition for detecting dominant fungus of periprosthetic joint infection, and use thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240087509A (en) 2022-11-28 2024-06-19 충북대학교 산학협력단 Dna aptamer specifically binding to dna polymerase and using the same

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020033027A (en) * 2000-10-19 2002-05-04 임영희 Multiplex primers for Candida albicans and Candida dubliniensis
KR20100058919A (en) * 2008-11-25 2010-06-04 굿젠 주식회사 Dna chip, kit for detecting or genotyping bacteria causing sexually transmitted diseases, genotyping antibacterial drug resistance and detecting or genotyping method using the same
KR20120103801A (en) * 2011-03-11 2012-09-20 (주)팸메드 Methods for simultaneously detecting sexually transmitted disease-inducible microorganisms
KR20150007054A (en) * 2013-07-10 2015-01-20 솔젠트 (주) Method for Detecting Fungi Contaminated in Therapeutic Cells or Biological Medicine By Using Polymerase Chain Reaction and Real-time Polymerase Chain Reaction and Kit for the Same Method
KR20200009054A (en) * 2017-05-17 2020-01-29 마이크로바이오 피티와이 엘티디 Biomarkers and Their Uses

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020033027A (en) * 2000-10-19 2002-05-04 임영희 Multiplex primers for Candida albicans and Candida dubliniensis
KR20100058919A (en) * 2008-11-25 2010-06-04 굿젠 주식회사 Dna chip, kit for detecting or genotyping bacteria causing sexually transmitted diseases, genotyping antibacterial drug resistance and detecting or genotyping method using the same
KR20120103801A (en) * 2011-03-11 2012-09-20 (주)팸메드 Methods for simultaneously detecting sexually transmitted disease-inducible microorganisms
KR20150007054A (en) * 2013-07-10 2015-01-20 솔젠트 (주) Method for Detecting Fungi Contaminated in Therapeutic Cells or Biological Medicine By Using Polymerase Chain Reaction and Real-time Polymerase Chain Reaction and Kit for the Same Method
KR20200009054A (en) * 2017-05-17 2020-01-29 마이크로바이오 피티와이 엘티디 Biomarkers and Their Uses

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Norihiro, T. et. al. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature protocols. 2008;3:5.

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024143780A1 (en) * 2022-12-29 2024-07-04 드림디엑스 주식회사 Composition for detecting dominant fungus of periprosthetic joint infection, and use thereof

Also Published As

Publication number Publication date
KR102453357B1 (en) 2022-10-07
KR102453357B9 (en) 2022-12-05

Similar Documents

Publication Publication Date Title
CN111004862B (en) Primer and probe for rapidly detecting and identifying cryptococcus and application thereof
KR102453357B1 (en) Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe
US8377656B2 (en) Compositions and methods for detecting Cryptococcus neoformans
CN113999933A (en) Method for accurately detecting cryptococcus neoformans
CN110055347A (en) A method of identifying five kinds of dermatophytes using high-resolution fusion curve
KR20220024253A (en) High sensitive multiplex loop-mediated isothermal amplification primer set for detection of novel coronavirus-19
KR102278112B1 (en) Composition for determining false positives using a unique artificial nucleotide sequence and method for determining false positives using the same
US9434986B2 (en) Methods and kits used in the detection of fungus
KR102274011B1 (en) Primer set for high sensitive multiplex loop-mediated isothermal amplification reaction for detection and identification of Mycobacterium tuberculosis and Nontuberculous mycobacteria
US8367814B2 (en) Assay for BCR/ABL gene rearrangement
KR20210097242A (en) Primer set for high sensitive multiplex loop-mediated isothermal amplification reaction for detection and identification of Mycobacterium tuberculosis and Nontuberculous mycobacteria
KR102388060B1 (en) Composition for distinguishing between Mycobacterium tuberculosis and Beijing family Mycobacterium tuberculosis and method for detecting Mycobacterium tuberculosis using the same
KR102409468B1 (en) Loop-mediated isothermal amplification(LAMP) primer set for detection of Severe fever with thrombocytopenia syndrome virus(SFTSV)
KR102692361B1 (en) Primer set for multiplex loop-mediated isothermal amplification reaction for detection of Candida pan and Candida albicans
US20150292039A1 (en) Method to amplify nucleic acids of fungi to generate fluorescence labeled fragments of conserved and arbitrary products
US20050065330A1 (en) Identification of Histoplasma capsulatum using a PCR assay
KR20100042464A (en) Method for detecting at least one of salmonella pullorum and salmonella gallinarum in sample and kit
KR102149373B1 (en) Primer set for detecting rift valley virus and uses thereof
KR102582278B1 (en) Primer and probe set for detecting influenza C virus
US20130034856A1 (en) Method for detecting and identifying candida species
KR102572368B1 (en) Primer set for detection and identification of parainfluenza virus type 1 and type 3 and use thereof
CN114250286B (en) Combination for nucleic acid detection, kit and application thereof
KR20230166731A (en) Loop-mediated isothermal amplification primer set for detection of group B streptococcus
KR102149396B1 (en) Primer set for detecting hantaan virus and uses thereof
KR20230083083A (en) A method of providing information for skin infection or inflammation diagnosis, a composition for skin infection or inflammation diagnosis, and a kit including the same

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
G170 Re-publication after modification of scope of protection [patent]