KR20220071901A - Pharmaceutical composition for treating bacterial infection comprising an SHMT inhibitor or MTHFR inhibitor as an active ingredient - Google Patents

Abstract

A serine hydroxymethyl transferase (SHMT) inhibitor or a methylenetetrahydrofolate reductase (MTHFR) inhibitor according to the present invention can inhibit infection by gram-positive and gram-negative bacteria without affecting growth of bacteria and can inhibit resistance for various antibiotics and lysostapins. In addition, since the SHMT inhibitor or the MTHFR inhibitor remarkably reduces a mortality rate of bacterial infection into a host, the SHMT inhibitor or the MTHFR inhibitor can be a potential target for multidrug-resistant strains. Accordingly, the SHMT inhibitor or the MTHFR inhibitor is easily used to manufacture a medicine for preventing, improving, or treating the bacterial infection, a cosmetic composition, a health food, an animal food, a food, or a feed additive. The SHMT inhibitor or the MTHFR inhibitor is usefully used for cleaning a medical container, having antibiotic resistance, and inhibiting toxic bacteria when treating the antibiotics.

Description

A composition for treating bacterial infection comprising an SHMT inhibitor or MTHFR inhibitor {Pharmaceutical composition for treating bacterial infection comprising an SHMT inhibitor or MTHFR inhibitor as an active ingredient}

The present invention relates to a composition for treating bacterial infection, and the like, comprising a SHMT inhibitor or an MTHFR inhibitor.

Bacterial pathogens continue to pose a serious threat to public health, as indicated by the worldwide re-emergence of bacterial diseases. In particular, Staphylococcus aureus ("S. aureus") is a bacterium that symbiotically colonizes more than 25% of the human population. Importantly, the organism breaks the initial site of colonization and can cause bacterial dissemination and disease. Staphylococcus aureus (S. aureus) is the leading cause of nosocomial infections, the most common causative agent of skin and soft tissue infections as well as infectious endocarditis, and one of the four leading causes of food-borne diseases. Overall, S. aureus infects more than 1.2 million patients annually in US hospitals.

Antibiotics are commonly used to treat bacterial infections, including S. aureus. Antibiotics are metabolites produced by microorganisms, and are used all over the world because they inhibit or kill the growth of other microorganisms in small amounts and show excellent efficacy in infection symptoms as drugs for treating infections caused by pathogens.

However, due to the abuse of antibiotics, the so-called super bacteria, which have developed the ability to resist pathogens themselves, and are able to resist any antibiotics by gradually increasing their resistance, first appeared in Japan in 1996. A problem has occurred. In the case of antibiotics, the bacteria-killing action induces mutations in bacteria, and in the process of mutagenesis, a gene that induces antibiotic resistance is created, which can create drug-resistant mutant bacteria, and these resistant bacteria transfer the resistance gene to other bacteria. The spread of resistant bacteria can be made quickly by delivering it to These super bacteria are typically MRSA (Methicillin-resistant Staphylococcus aureus), VRSA (Vancomycin-resistant Staphylococcus aureus) and VRE (Vancomycin-resistant Enterococci) with stronger antibiotic resistance, and antibiotic-resistant bacteria are resistant to antibiotics. , the resistance gradually becomes stronger and becomes resistant to any antibiotic.

Accordingly, there is a need to discover antibiotics that increase the effect of existing antibiotics on these drug-resistant bacteria or have better effects than existing antibiotics. In addition, antibiotics targeting a new mechanism can be used to reduce the dose of antibiotics or increase their activity by co-administration with existing antibiotics. Although studies on antibiotics with such a new mechanism have been reported (refer to Korean Patent Application Laid-Open No. 10-2015-0045216), the development of a therapeutic agent using this method is still insignificant.

Republic of Korea Patent Publication No. 10-2019-0113720

Accordingly, the present inventors have been devised to solve the problems of the prior art as described above, and as a new method for treating infectious diseases of susceptible or multidrug-resistant bacteria without generating resistance, discovering a novel target SHMT or MRHFR. As a result of research efforts, the survival rate of larvae treated with a strain in which SHMT or MRHFR is knocked out is improved, and when SHNT1, a SHMT inhibitor, is administered alone or in combination with an existing antibiotic, it has been found that the antibiotic sensitivity of multidrug-resistant bacteria is increased. Based on this, the present invention was completed.

Accordingly, an object of the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

To provide a pharmaceutical composition for preventing or treating bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

Another object of the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

To provide a food composition for preventing or improving bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

Another object of the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

It is to provide a cosmetic composition for preventing or improving bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

Another object of the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

It is to provide a quasi-drug composition for preventing or improving bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

Another object of the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

To provide an antibacterial composition comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

Another object of the present invention is to provide a screening method for preventing or treating a bacterial infection comprising the following steps.

(a) SHMT protein or mRNA thereof; and treating cells expressing one or more selected from the group consisting of MTHFR protein or mRNA thereof with a test substance;

(b) the SHMT protein or mRNA thereof in cells treated with the test substance and cells not treated with the test substance; and measuring the expression level of one or more selected from the group consisting of MTHFR protein or mRNA thereof; and

(c) a protein or mRNA thereof of SHMT compared to a control cell; and selecting a substance having a reduced expression level of one or more selected from the group consisting of MTHFR protein or mRNA thereof as a preventive or therapeutic agent for bacterial infection.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to solve the above problems, the present invention is SHMT (serine hydroxymethyl transferase) protein activity inhibitor or gene expression inhibitor; and

It provides a pharmaceutical composition for preventing or treating bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

In one embodiment of the present invention, the SHMT protein activity inhibitor may be at least one selected from the group consisting of a compound that specifically binds to SHMT protein, a peptide, a peptidomimetic, a matrix analog, an aptamer, and an antibody, but is limited thereto it is not

In another embodiment of the present invention, the MTHFR protein activity inhibitor may be at least one selected from the group consisting of a compound that specifically binds to MTHFR protein, a peptide, a peptidomimetic, a matrix analog, an aptamer, and an antibody, but is limited thereto it is not

In another embodiment of the present invention, the SHMT gene expression inhibitor may be one or more selected from the group consisting of antisense nucleotides, RNAi, siRNA, miRNA, shRNA, and ribozyme that complementarily bind to the mRNA of the SHMT gene, but is limited thereto. it is not going to be

In another embodiment of the present invention, the MTHFR gene expression inhibitor may be one or more selected from the group consisting of antisense nucleotides complementary to MTHFR gene mRNA, RNAi, siRNA, miRNA, shRNA, and ribozyme, but is limited thereto it is not going to be

In another embodiment of the present invention, the compound that specifically binds to the SHMT protein is SHIN1 (SHMT inhibitor 1), 6-Amino-4-isopropyl-3-methyl-4-(3-(pyrrolidin-1-yl) )-5-(trifluoromethyl)phenyl)-1,4-dihydropyrano[2,3-c]pyrazole-5-carbonitrile, Zoloft, 6-amino-4-(5-(hydroxymethyl)-[1, 1′-biphenyl]-3-yl)-4-isopropyl-3-methyl-1,4-dihydropyrano[2,3-c]pyrazole-5-carbonitrile, SEL302-01612, SEL302-00332, SEL302-00621, and 6-amino-4-[3-(hydroxymethyl)-5-(5-hydroxypent-1-yn-1-yl)phenyl]-3-methyl-4-(propan-2-yl)-1H,4H-pyrano [2,3-c] It may be one or more selected from the group consisting of pyrazole-5-carbonitrile, but is not limited thereto.

In another embodiment of the present invention, the bacteria are Staphylococcus aureus, Streptococcus ferus, Serratia marcescens, Vibrio parahaemolyticus ), Streptococcus pneumoniae, Staphylococcus saprophyticus, Campylobacter jejuni, Helicobactor pylori, Pseudomonas aeruginosa, Pseudomonas aeruginosa Bacillus cereus, Enterococcus fecalis, Bacillus licheniformis, Staphylococcus epidermidis, Corynebacterium diphtheriae, Krynebacterium diphtheriae Klebsiella pneumoniae, Listreia innocua, Burkholderia cepacia, Streptococcus parasanguinis, Salmonella typhimurium, Streptococcus Streptococcus sobrinus, Streptococcus sanguinis, Streptococcus iniae, Streptococcus pyogene, Streptococcus mytis (Streptococcus subspmitis, Listeria Ivanovii) ), Listeria monocytogenes (Listeria moncy) togenes), Streptococcus suis, Clostridium perfringens, Yersinia enterocolitica, Shigella boydii, Shigella flexneri ), Shigella sonnei, Salmonella choleraesuis subsp, Salmonella enteritidis, Salmonella bongori, Salmonella enterica (Salmonella enterica), Mycobacterium tuberculosis, Mycobacterium leprae, Clostridium botulinum, Bacillus anthracis, Yersinia pestis, Chlamydia pneumoniae Chlamydia pneumonia, Borrelia burgdorferi, Coxiella burnetii, Mycobacterium avium, Escherichia coli, Borrelia sp.), Bartonella sp., Chlamydia trachomatis, and Mycoplasma pneumoniae may be at least one selected from the group consisting of, but is not limited thereto.

In another embodiment of the present invention, the composition may be formulated or used in combination with an antibiotic, but is not limited thereto.

In another embodiment of the present invention, the antibiotic may be an antifolate, but is not limited thereto.

In another embodiment of the present invention, the antibiotic is pyrimethamine, trimetrexate, iclaprim, proguanil, cycloguanil, aminope Aminoprterin, Lometrexol, Nolatrexed, Brodimoprim, Pralatrexate, Pyritrexim, 5'-S-methyl-5' -Thioadenosine, methicillin, oxacillin, norfloxacin, vancomycin, amikacin, gentamicin, kanamycin, neomycin ), Netilmicin, Tobramycin, Paromomycin, Streptomycin, Spectinomycin, Geldanamycin, Herbimycin, Rifaximin (Rifaximin), Loracarbef, Ertapenem, Doripenem, Imipenem/Cilastatin, Meropenem, Cefadroxil, Cefazolin ), cefalothin, cefalexin, cefaclor, cefamandole, cefoxitin, cefprozil, cefuroxime, cefixime (Cefixime), Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten ), count Ceftizoxime, Ceftriaxone, Cefepime, Ceftaroline fosamil, Ceftobiprole, Teicoplanin, Telavancin , Dalbavancin, Oritavancin, Clindamycin, Lincomycin, Deptomycin, Azithromycin, Clarithromycin, D Diritromycin, Erythromycin, Roxithromycin, Troleandomycin, Telithromycin, Spiramycin, Aztreonam, Furazolidone, (Furazolidone), Nitrofurantoin, Linezolid, Posizolid, Radezolid, Torezolid, Amoxicillin, Ampicillin Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Nafcillin, Penicillin G, Penicillin V, Piperacillin, Temocillin, Ticarcillin, Amoxicillin/clavulanate, Ampicillin/Sulbactam Ampicillin/sulbactam), Piperacillin/tazobactam (Piperacillin/tazobactam), Ticarcillin/clavulanic acid (Ticarcillin/clavulanat) e), Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Inoxacin, Gatifloxacin, Gemifloxacin, Levofloxacin (Levofloxacin), Lomefloxacin, Moxifloxacin, Nalidixic acid, Ofloxacin, Trovafloxacin, Grepafloxacin, Spafloxacin Sparfloxacin, Temafloxacin, Mafenide, Sulfaacetamide, Sulfacetamide, Sulfadiazine, Silver sulfadiazine, Sulfadimethoxine, Sulfadimethoxine Sulfamethizole, Sulfamethoxazole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Trimethoprim-Sulfamethoxazole, TMP-Trimoxazole SMX), Sulfonamido chrysoidine, Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Clofazimine , Dapsone, Capreomycin, Cycloserine, Ethambutol, Ethionamide, Isoniazid, Pyrazinamide, Rifampicin, Rifampicin (Rifabutin), Lee Rifapentine, Arsphenamine, Chloramphenicol, Fosfomycin, Fusidi cacid, Metronidazole, Mupirocin, Platensimycin , Quinupristin / Dalfopristin (Quinupristin / Dalfopristin), thiamphenicol (Thiamphenicol), tigecycline (Tigecycline), tinidazole (Tinidazole), and may be one or more selected from the group consisting of trimethoprim (Trimethoprim), However, the present invention is not limited thereto.

In addition, the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

It provides a food composition for preventing or improving bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

In addition, the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

It provides a cosmetic composition for preventing or improving bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

In addition, the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

It provides a quasi-drug composition for preventing or improving bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

In addition, the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

It provides an antibacterial composition comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

In addition, the present invention provides a screening method for preventing or treating a bacterial infection comprising the following steps.

(a) SHMT protein or mRNA thereof; and treating cells expressing one or more selected from the group consisting of MTHFR protein or mRNA thereof with a test substance;

(b) the HMT protein or mRNA thereof in cells treated with the test substance and cells not treated with the test substance; and measuring the expression level of one or more selected from the group consisting of MTHFR protein or mRNA thereof; and

(c) a protein or mRNA thereof of said HMT compared to a control cell; and selecting a substance having a reduced expression level of one or more selected from the group consisting of MTHFR protein or mRNA thereof as a preventive or therapeutic agent for bacterial infection.

In addition, the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

MTHFR (Methylenetetrahydrofolate reductase) It provides a method for preventing, improving or treating a bacterial infection, comprising administering to an individual a composition comprising at least one selected from the group consisting of a protein activity inhibitor or a gene expression inhibitor as an active ingredient.

In addition, the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

MTHFR (Methylenetetrahydrofolate reductase) provides for the prevention, improvement or treatment of bacterial infection of a composition comprising at least one selected from the group consisting of inhibitors of protein activity or gene expression inhibitors as an active ingredient.

In addition, the present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

It provides a use for producing a medicament for preventing or treating one or more bacterial infections selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitors or gene expression inhibitors.

The SHMT inhibitor or MTHFR inhibitor according to the present invention can inhibit infection by gram-positive and gram-negative bacteria without affecting bacterial growth, and can inhibit resistance to various antibiotics and lysostaphin. In addition, as SHMT inhibitors or MTHFR inhibitors significantly reduce the bacterial infection lethality of the host, it is expected that SHMT or MTHFR inhibitors may become potential targets for multidrug-resistant strains. Therefore, the SHMT or MTHFR inhibitor can be easily used in the manufacture of pharmaceuticals, cosmetic compositions, health foods, animal feeds, food or feed additives, etc. for the prevention, improvement or treatment of bacterial infections, as well as washing or cleaning medical containers. Furthermore, it is expected to be useful for inhibiting bacteria that are resistant to antibiotics or are toxic when treated with antibiotics.

In addition, the present inventors have clearly confirmed through in vivo experiments that the SHMT inhibitor overcomes the resistance of the antifolate when combined with the existing antifolate-based antibiotic. it is expected that it will be possible

1a to 1e show the lysostaphin resistance pattern of ST72 isolates and the efficiency of lysostaphin binding to Staphylococcus aureus cell wall:
Figure 1a shows the lysostaphin-mediated death kinetics of lysostaphin-resistant Staphylococcus saprophyticus (lys ^r ) and lysostaphin-sensitive S. aureus USA300 (lys ^s ) using a cell turbidity reduction assay, S. aureus USA300 (lys ^s ) is S Compared to saprophyticus (lys ^r ), it showed a 70% reduction in cell turbidity.
Figure 1b is S. saprophyticus (lys ^r ) lysostaphin resistance was confirmed by colony forming unit (CFU; colony forming unit) counts according to the presence or absence of treatment with lysostapine, and did not show a significant difference in CFU count (control group: resource) group without tarpin treatment).
Figure 1c shows the differential resistance pattern in 11 isolates of S. aureus ST72 treated with 2U of lysostaphin and incubated for 5 minutes. K07-204 (human), 4-009 (soil) and 08-B-93 (animal) showed resistance to lysostapine compared to lysostapine-sensitive S. aureus USA300 (control).
Figure 1d shows lysostaphin colocalized with lysostaphin binding to a cell wall labeled with wheat germ agglutinin Alexa Fluor 488 (WGA-AF) (green fluorescence) and labeled with Texas Red (TR). red fluorescence) is shown.
1E shows (I) Texas red-labeled lysostaphin on agarose gel showing red fluorescent protein band, and (II) TR- on WGA-AF labeled green fluorescent cell wall of lysostaphin-resistant human isolate of ST72 K07-204. Represents colocalization of lysostapine. Here, (a) the green channel of the confocal micrograph shows the WGA-AF-labeled green fluorescent cell wall boundary of staphylococcal cells, and (b) the red channel of the confocal micrograph shows the red fluorescent cell wall upon TR-lysostaphin binding. shown, (c) merged green (a) and red (b) channels indicate yellow fluorescent cell borders, confirming the efficient binding of lysostaphin to the staphylococcal cell wall.
Figure 2 shows the phenotypic evaluation results of lysostaphin binding and catalytic cleavage activity (CCA) of the lysostaphin-resistant isolate of ST72. Confocal microscopy image of lysostaphin-resistant ST72 human isolate K07-204 upon TR-lysostapine treatment (A); Lysostaphin-resistant ST72 soil isolate 4-009 (B); Lysostaphin-resistant control S. saprophyticus (C); and lysostapine sensitive control S. aureus USA300 (D) were identified, where white arrows indicate broken cells after lysostapine treatment. TR-lysostaphin efficiently bound to both the ST72 isolate and S. aureus USA300, whereas TR-lysostaphin showed the least binding to S. saprophyticus.
Figures 3a and 3b confirm the cell wall lysostaphin-mediated changes and the resulting cell death:
Figure 3a shows staphylococcal cells with or without lysostaphin treatment to visualize changes in cell morphology through scanning electron microscopy (SEM). Here, (a) is K07-204; (b) S. saprophyticus; (c) is SAUSA300, (a') is K07-204 after lysostapine treatment; (b') is S. saprophyticus after lysostaphin treatment; (c') is SAUSA300 after lysostaphin treatment. Both K07-204 and S. saprophyticus (lys ^r ) did not show any change, whereas SAUSA300 (lys ^s ) cells contracted upon treatment with lysostapine due to the catalytic cleavage activity of lysostapine.
Figure 3b compares the live/dead staining of the ST72-resistant isolate with the image of SAUSA300 with a confocal microscope image to evaluate the resulting ratio of live/dead Staphylococcal cells. Here, SYTO9 stains whole cells (green), whereas propidium iodide (PI) stains only dead cells (red). Both K07-204 and S. saprophyticus showed fewer dead cells (red) when treated with lysostaphin 2U compared to SAUSA300.
Figures 4a-4c show novel mechanisms of lysostaphin resistance and associated metabolic pathways in ST72 isolates:
Figure 4a is a schematic diagram showing that the modification of the glycine residue of the pentaglycine bridge to serine is the underlying reason for lysostaphin resistance in staphylococcal cells.
Figure 4b shows that serine hydroxymethyltransferase (SHMT) is an essential enzyme for 1-carbon metabolism of serine/glycine interconversion and is linked to the folate/methionine cycle. Therefore, the glyA/shmT gene was hypothesized to be involved in lysostaphin resistance.
Figure 4c is a metabolic pathway showing the interdependence of the folate/methionine cycle and a key role in shmT serine/glycine homeostasis. 1-Carbon metabolism is responsible for transferring methyl groups to various substrates and cofactors in the folate, methionine cycle, and transsulfuration pathways. Various enzymes are shown in green font and substrates are shown in plain font. The abbreviation of the enzyme is DHPS (Dihydropteroate synthase); DHFS (Dihydrofolate synthase); Dihydrofolate reductase (DHFR); Serine hydroxymethyltransferase (SHMT); GcvPHT (glycine cleavage system); MTHFR (Methylene tetrahydrofolate reductase); MS (Methionine synthase); Methionine adenosyltransferase (MAT); MTases (Methyl transferases); AHCY (S-adenosylhomocysteine hydrolase), and CBS (Cystathionine beta-synthase) and substrates are THF (Tetrahydrofolate); 5, 10 CH2-THF (5, 10 methylene tetrahydrofolate); 5-CH2-THF (5-methylene tetrahydrofolate); Met (Methionine); SAM (S-adenosyl methionine); SAH (S-adenosyl homocysteine), and HCY (Homocysteine). 1-Carbon metabolism is important for cell homeostasis as it maintains cellular serine/glycine through folic acid cycle, methionine cycle (protein synthesis), DNA synthesis and repair, redox balance, and various methylation reactions.
5A-5I evaluate shmT expression and functional genomics to establish a role for shmT in lysostaphin resistance:
Figures 5a and 5b compared the expression of the shmT gene in the SAUSA300 recombinant strain including SAUSA300_EV, ΔshmT_EV and ΔshmT_Comp according to the presence or absence of aTc induction. The ΔshmT knockout (ΔshmT_EV) strain made with the empty vector was wild-type S. aureus USA300 (SAUSA300_EV) made with the empty vector; and ΔshmT complement strain (ΔshmT_Comp) made with pRMC2_shmT; no transcript trace was detected. In addition, it was found that in the ΔshmT_Comp strain, the expression of shmT was moderate without Tc induction, whereas it was significantly increased (3.5-fold) upon aTc induction.
5c and 5d show gene expression of shmT in SAUSA300 recombinant strains SAUSA300_EV and SAUSA300_OE constructed by expressing shmT in trans (plasmid: pRMC2_shmT) under a tetracycline inducible promoter in wild-type S. aureus USA300. The expression of shmT in SAUSA300_OE for SAUSA300_EV was found to be 2-fold and 53-fold higher without aTc induction (5c) and with induction (5d), respectively.
5E and 5F are evaluations of colony forming units (CFU) in the SAUSA300 recombinant strains SAUSA300_EV, ΔshmT_EV, and ΔshmT_Comp, while the ΔshmT_EV strain shows relative sensitivity compared to the SAUSA300_EV and ΔshmT_Comp strains, whereas the shmT by aTc induction It shows that the sensitivity of the ΔshmT_EV strain is improved with the increase in expression. The sensitivity of ΔshmT_EV indicated the involvement of shmT in lysostaphin resistance.
5g and 5h showed the sensitivity to lysostaphin by comparing the SAUSA300_OE strain and SAUSA300_EV with or without aTC induction. Both ΔshmT_Comp and SAUSA300_OE exhibited higher sensitivity to lysostapine compared to the empty vector control SAUSA300_EV upon aTc induction and overexpression of shmT.
Figure 5i shows the expression of shmT in ST72 in K07-204 vs. K07-561 isolates. K07-561 showed overexpression of shmT, which is why K07-561 is more sensitive to lysostaphin than K07-204.
6a to 6d demonstrate the role of shmT in the virulence potential of SAUSA300 using an in vitro mammalian cell and in vivo honeycomb moth larval infection model:
6A evaluates the internalization (penetration/phagocytosis) and viability of SAUSA300, ΔshmT knockout (EV), and ΔshmT complement (Comp) strains in in vitro mammalian cell culture conditions using murine macrophages RAW264.7. did it ΔshmT knockout showed significantly reduced survival inside macrophages compared to wild-type SAUSA300 and ΔshmT complement strains;
6B is a survival graph of honeycomb moth larvae infected with SAUSA300 and ΔshmT knockout (2.0×10 ⁵ bacterial cells). The number of beehive moth larvae in each group was 10 (n = 10).
Figure 6c is a result of evaluation of the toxicity of the SHMT inhibitor (SHIN1) to the honeycomb moth larvae (n = 10). Various concentrations of SHIN1 (0.1 μg, 0.5 μg and 1 μg in 20 μL solution) were injected into honeycomb moth larvae, and worm survival was observed for up to 80 hours with 20 μL placebo PBS control. SHIN1 was not toxic to worms up to 0.5 μg.
FIG. 6d shows that treatment with a SHIN1 inhibitor resulted in a 50% survival rate in beehive moth larvae infected with wild-type SAUSA300, indicating that SHIN1 inhibits the pathogenesis of wild-type SAUSA300.
7A to 7C are results of growth, toxicity evaluation, and enhancement of SXT by SHIN1 in the highly virulent MDR strain S. aureus USA300 of eight S. aureus strains:
7a and 7b show the toxicity of SHIN1 against 8 strains of S. aureus in TSB medium. Compared to the effective concentration (0.125 μg/mL) of SHIN1 used for SXT (SMX-TMP) enrichment or in vivo honeycomb infestation experiments, a 40-fold higher concentration of SHIN1 (5 μg/mL) was tested in TSB medium. . The negative control group was treated with TSB only without bacterial inoculum.
Figure 7c shows the combined synergistic effect of SHIN1 and SMX + TMP (SXT) to treat S. aureus USA300. The sensitivity of S. aureus USA300 to SXT was confirmed by varying the concentration of SHIN1 from 0.125 to 1 μg/mL. Reduction of the MIC of SXT with 0.125 μg/mL clarified the potentiating effect of SHIN1 on SXT at a concentration of 0.125 μg/mL. This is because SHIN1 had no growth inhibitory effect on 8 different strains of S. aureus.
8a to 8c show the effect of folic acid on the MIC of S. aureus for SMX + TMP + SHIN1. Three strains were tested, including USA300 WT, KO glyA, and KO metE. Based on the specific MICs of USA300 for SMX and TMP, with an optimal dose of 1.25 μg/mL for SMX, a sub-inhibitory dose of 0.25 μg/mL for SMX, an optimal dose of 0.625 μg/mL for TMP and a sub-inhibitory dose of TMP 0.125 μg/mL The experiment was carried out. At this time, SHIN1 was fixed at 50 ng/mL and folic acid was fixed at 10 mM.
9A to 9D show the expression of genes (glyA, metE, folA, folK) related to the folate pathway, and the methionine pathway in WT, KO glyA, KO metE.
Figures 10a and 10b confirm the role of glyA and metE on the toxicity of USA300 (FPR 3757) through a honeycomb moth larval infection model:
10a shows colony forming units (CFUs) recovered from USA300, KO SHMT, and KO MTHFR honeycomb moth larvae infection models.
Figure 10b shows the survival graph of USA300, KO SHMT, KO MTHFR honeycomb moth larvae infection model. 1 x 10 ⁷ S. aureus USA300 CFU dissolved in 10 μL TSB was injected into the left leg of the larvae. Mortality was checked every 6 hours until a total of 120 hours. All larvae were saturated and the supernatant was collected. The supernatant was diluted about 10 ⁸ times so that the final concentration was about 10 ³ CFU/mL. 100 μL vials were plated on TSA and inoculated at 37° C. for 16 hours. CFU was counted and analyzed by log10 calculations.
11A to 11D show the protective ability of SHIN1 + SXT in an in vivo model of MRSA infection (Galleria mellonella larvae). The method was similar to the survival analysis in FIG. 10 . This experiment confirmed the effect of SMX + TMP + SHIN1 on the survival and health of the larvae. High dose SMX 1.25 μg/mL, low dose SMX 0.25 μg/mL, high dose TMP 0.625 μg/mL, low dose TMP 0.125 μg/mL, and SHIN1 were fixed at 0.125 μg/mL. The DMSO concentration was set to 1% so as not to cause a detrimental biasing effect on worm survival:
Figure 11a shows the morphology of real-time honeycomb moth larvae.
11B is a result of survival analysis by Kaplan Meier curve (95% confidence interval) (5×10 ⁵ bacteria/worm).
11C is a colony forming unit (CFU) recovered from a honeycomb moth larval infection model.
Figure 11d shows the health index over time of the beehive moth larval infection model.
12a and 12b show the synergistic effect of SMX + TMP by SHIN1 in multidrug-resistant Gram-negative bacteria:
Figure 12a shows the MIC of Acinetobacter baumannii (A. baumannii) CCARM 12165 against SMX + TMP + PMBN + SHIN1. Because A.baumannii CCRM 12165 is highly resistant to multiple drugs, PMBN was used to increase the likelihood of SMX and TMP penetration into A.baumannii. PMBN was fixed at a dose of 10 μg/mL, and SHIN1 was fixed at 0.25 μg/mL.
Figure 12b shows the fold change of the MIC of A. baumannii CCRM 12165 for SMX or TMP after adding SHIN1. Based on the data in Fig. 12b, fold change was calculated to confirm the effect of SHIN1 on MIC reduction. Due to therapy involving two or more drugs, it was simply explained by the calculated fold change (top: SMX+TMP+PMBN+SHIN1, middle: SMX+TMP+PMBN, bottom: SMX+TMP).

Hereinafter, the present invention will be described in detail.

As used herein, the term "protein" is used interchangeably with "polypeptide" or "peptide", eg, refers to a polymer of amino acid residues as commonly found in proteins in their natural state.

As used herein, "polynucleotide" or "nucleic acid" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in the form of single or double strands. Unless otherwise limited, known analogs of natural nucleotides that hybridize to nucleic acids in a manner analogous to naturally occurring nucleotides are also included. In general, DNA consists of four bases: adenine (A), guanine (G), cytosine (C), and thymine (T), and RNA consists of uracil (U) instead of thymine (Uracil, U). has a In a double-stranded nucleic acid, A forms a hydrogen bond with T or U, and C forms a G base.

On the other hand, "mRNA (messenger RNA or messenger RNA)" is an RNA that serves as a blueprint for polypeptide synthesis (protein translation, translation) by transferring the genetic information of the nucleotide sequence of a specific gene to the ribosome during protein synthesis. Using the gene as a template, single-stranded mRNA is synthesized through the transcription process.

The present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; and

It provides a pharmaceutical composition for preventing or treating bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.

As used herein, "Serine hydroxymethyltransferase (SHMT)" is used interchangeably with glyA herein, and is a pyridoxal phosphate (PLP) (vitamin B6)-dependent enzyme (EC 2.1.2.1), glycine and tetrahydrofolate of L-serine. It plays an important role in the cell's one-carbon pathway by catalyzing the reversible simultaneous conversion to SHMT of the present invention may be SHMT of mammals or bacteria, including humans, but is not limited thereto. Specific nucleotide sequence and protein information of SHMT are known from NCBI. Human SHMT information may refer to the NCBI reference sequence information of AAA36020.1, AAA36019.1, or AAA36018.1. SHMT information of Staphylococcus aureus can refer to NCBI reference sequence information such as CPM04879.1, OHS90015.1, OHS83871.1, OHS78279.1, OHS75306.1. SHMT information of Krebsiella pneumoniae may refer to NCBI reference sequence information such as PNW58787.1, PNW51347.1, and the like. SHMT information of Acinetobacter baumani may refer to NCBI reference sequence information such as ANA38052.1, SUU42235.1, KRJ74118.1, QEE58055.1. SHMT information of Pseudomonas aeruginosa may refer to NCBI reference sequence information such as PWU39476.1, PWU34880.1, PWU34002.1, KGD89755.1. SHMT information of Enterococcus bacteria may refer to NCBI reference sequence information such as PQW03895.1, TEA56495.1, PQW14400.1, PQW06412.1. For SHMT information of pneumococci, NCBI reference sequence information such as KGI25692.1, WP_050153710.1, VTY33058.1, GBO91534.1, QIP99755.1, etc. can be referred to. For SHMT information of Enterobacteriaceae bacteria, NCBI reference sequence information such as WP_112334430.1, WP_000919159.1, WP_063100105.1, WP_109949355.1, WP_096858239.1, etc. can be referred to.

As used herein, "MTHFR (Methylenetetrahydrofolate reductase)" is used interchangeably with metE herein, and controls the production of the MTHFR enzyme. This enzyme changes the conformation of folic acid and is part of the process that converts homocystine to methionine, a major component of most proteins. MTHFR of the present invention may be MTHFR of mammals or bacteria, including humans, but is not limited thereto. Its specific nucleotide sequence and protein information are known from NCBI. For human MTHFR information, refer to NCBI reference sequence information such as XP_024302966.1, NP_001317287.1, XP_016856817.1, XP_011539798.1, XP_011539797.1, XP_005263520.1, XP_005263519.1, XP_005263517.1, or NP_005948.3. can For the MTHFR information of Staphylococcus aureus, NCBI reference sequence information such as CPL92517.1, BBA23023.1, WP_189829582.1, etc. can be referred to. MTHFR information of Krebsiella pneumoniae may refer to NCBI reference sequence information such as WP_204337520.1, WP_203191142.1, WP_201285786.1. MTHFR information of Acinetobacter baumani may refer to NCBI reference sequence information such as SUU43455.1, KRJ74909.1, QEY05007.1, QEY04351.1, OXS63124.1, and the like. MTHFR information of Pseudomonas aeruginosa may refer to NCBI reference sequence information such as KJJ15279.1, WP_208538034.1, and the like. For MTHFR information of Enterococcus bacteria, NCBI reference sequence information such as WP_185933165.1 may be referred to. MTHFR information of pneumococcus may refer to NCBI reference sequence information such as BBG81077.1, BBA59655.1, CVQ36883.1. For MTHFR information of Enterobacteriaceae bacteria, NCBI reference sequence information such as WP_002882952.1, WP_042325609.1, WP_040078036.1, WP_035892378.1, WP_000007517.1 can be referred to.

In the present invention, if the gene encoding the SHMT protein is a gene sequence encoding the SHMT protein, it is not limited thereto. Also, the above genetic variants are included in the scope of the present invention.

In the present invention, if the gene encoding the MTHFR protein is a gene sequence encoding the MTHFR protein, it is not limited thereto. Also, the above genetic variants are included in the scope of the present invention.

As used herein, the term “complementary” means that a targeting moiety in a nucleic acid molecule binds to a target (eg, SHMT or MTHFR gene) under predetermined hybridization or annealing conditions, specifically physiological conditions (in a cell). It means that it is sufficiently complementary to selectively hybridize, can have one or more mismatched base sequences, and encompasses both substantially complementary and perfectly complementary. and, more specifically, means completely complementary.

In the present specification, the activity inhibitor may be one or more selected from the group consisting of a compound that specifically binds to a target protein, a peptide, a peptidomimetic, a matrix analog, an aptamer, and an antibody, but is not limited thereto.

In the present specification, the expression inhibitor may be one or more selected from the group consisting of antisense nucleotides, RNAi, siRNA, miRNA, shRNA, and ribozyme that complementarily bind to the mRNA of the target gene, but is not limited thereto.

As used herein, the term "siRNA" refers to a sense strand (eg, a sequence corresponding to an SHMT or MTHFR gene mRNA sequence) and an antisense strand (eg, a sequence complementary to a SHMT or MTHFR gene mRNA sequence). It may have a structure that is positioned opposite to each other to form a double chain. In addition, the siRNA molecule that can be used in the present invention may have a single-stranded structure having self-complementary sense and antisense strands. siRNA is not limited to the complete pairing of double-stranded RNA segments that pair with each other, but pairing occurs due to mismatch (the corresponding bases are not complementary), bulge (there is no base corresponding to one chain), etc. It may contain parts that are not. Specifically, the total length is from 10 to 100 bases, more specifically from 15 to 80 bases, and even more specifically from 20 to 70 bases.

As used herein, the term "shRNA (small hairpin RNA or short hairpin RNA)" refers to a sequence of RNA that makes a strong hairpin turn, which can be used to silence gene expression through RNA interference. shRNA can be introduced into cells using any promoter capable of functioning in eukaryotic cells. The shRNA hairpin structure is degraded into siRNA, an intracellular machinery, and bound to an RNA-induced silencing complex. The complex described above binds to and degrades mRNA corresponding to the siRNA bound thereto. shRNA is transcribed by RNA polymerase III, and shRNA production in mammalian cells can also trigger an interferon response, as the cell recognizes shRNA as a viral attack and seeks a defense mechanism.

As used herein, the term "miRNA (microRNA, microRNA)" refers to a substance that binds to the 3'-UTR of mRNA (messengerRNA) as a single-stranded RNA molecule of 21-25 nucleotides to control gene expression in eukaryotes ( Bartel DP, et al., Cell, 23;116(2): 281-297 (2004)). Generation of miRNA is made into stem-loop precursor miRNA (pre-miRNA) by Drosha (RNase III type enzyme), moves to the cytoplasm, and is cleaved by Dicer to make mature miRNA.

As used herein, the term "antisense oligonucleotide" refers to DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to a sequence of a specific mRNA, and binds to a complementary sequence in the mRNA to convert the mRNA into a protein acts as an inhibitor. For example, the antisense sequence of the present invention refers to a DNA or RNA sequence that is complementary to SHMT or MTHFR and capable of binding to SHMT or MTHFR mRNA, translation of SHMT or MTHFR mRNA, translocation into the cytoplasm, maturation ( maturation) or all other essential activities for overall biological functions. The length of the antisense nucleic acid is 6 to 100 bases, specifically 8 to 60 bases, and more specifically 10 to 40 bases.

As used herein, the term "ribozyme" is a type of RNA and is an RNA having the same function as an enzyme that recognizes the base sequence of a specific RNA and cuts it by itself. A ribozyme is a complementary nucleotide sequence of a target messenger RNA strand and consists of a region that binds with specificity and a region that cuts the target RNA. As used herein, the term “aptamer” refers to an oligonucleotide (generally, an RNA molecule) that binds to a specific target. Specifically, “aptamer” as used herein refers to an oligonucleotide aptamer ( For example, RNA aptamer).

In the present specification, siRNA or shRNA may be modified with various modifications for improving in vivo stability of oligonucleotides, conferring nuclease resistance, and reducing non-specific immune responses. Modifications of the oligonucleotide include: -CH ₃ (methyl), -OCH ₃ (methoxy), -NH ₂ , -F, -O-2-methoxyethyl; -O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, -O-3-dimethylaminopropyl, -ON-methylacetamido or -O-dimethylamido modification by substitution with dooxyethyl; a modification in which the oxygen in the sugar structure in the nucleotide is substituted with sulfur; Or one or more modifications selected from the transformation of nucleotide bonds into phosphorothioate or boranophosphate, methyl phosphonate bonds may be used in combination, and PNA (peptide nucleic acid); Modification to LNA (locked nucleic acid) or UNA (unlocked nucleic acid) form is also possible.

In the present invention, the bacterial infection may be an inflammatory disease caused by a bacterial infection. Inflammatory diseases caused by bacterial infection of the present invention include bacterial infections and diseases accompanying bacterial infections occurring in mammals and birds, preferably Streptococcus pneumoniae, Haemophilus influenzae ( Haemophilus influenzae), Moraxella catarrhalis, Staphylococcus aureus or Peptostreptococcus pneumoniae, otitis media, sinusitis, bronchitis, tonsillitis and mastoiditis associated with infection ; pharyngitis, rheumatic fever and glomerulonephritis accompanying infection with Streptococcus pyogenes, groups C and G Streptococcus, Clostridium diptheriae or Actinobacillus haemolyticum ; To Mycoplasma pneumoniae, Legionella pneumophila, Streptococcus pneumoniae, Haemophilus influenzae or Chlamydia pneumoniae respiratory tract infection accompanying infection by Staphylococcus aureus, coagulase-positive staphylococcus (ie, S. epidermidis, S. hemolyticus, etc.), Streptococcus pio Genes (Streptococcus pyogenes), Streptococcus agalactiae (Streptococcus agalactiae), Streptococcus group C-F (micro-colony Streptococcus), Viridans (Viridans) Streptococcus, Corynebacterium minutissimum (Corynebacterium minutissimum) uncomplicated skin and soft tissue infections accompanying infection by the genus Clostridium or Bartonella henselae, boils, osteomyelitis and puerperal fever; non-complex acute urinary tract infections, urethritis and cervicitis accompanying infection by the genus Staphylococcus saprophyticus or Enterococcus; and Chlamydia trachomatis, Haemophilus ducreyi, Treponema pallidum, Ureaplasma urealyticum, or Neiserria gonorrheae) sexually transmitted diseases accompanying infection by S. aureus (food poisoning and toxin shock syndrome), toxin disease accompanying infection by groups A, B and C streptococcus; ulcers accompanying infection by Helicobacter pylori; systemic febrile syndrome accompanying infection by Borrelia recurrentis; Lyme disease accompanying infection by Borrelia burgdorferi; Chlamydia trachomatis (Chlamydia trachomatis), Neisseria gonorrhoeae (Neisseria gonorrhoeae), S. aureus (S. aureus), S. pneumoniae (S. pneumoniae), S. pyogenes (S. pyogenes), conjunctivitis, keratitis and dacryocystitis associated with infection by the genus H. influenzae or Listeria; Disseminated Mycobacterium Avium Syndrome (MAC) disease accompanying infection by Mycobacterium avium or Mycobacterium intracellulare; gastroenteritis accompanying infection by Campylobacter jejuni; odontogenic infection accompanying infection with Viridans streptococcus; persistent cough accompanying infection with Bordetella pertussis; gas necrosis accompanying infection by the genus Clostridium perfringens or Bacteroides; and atherosclerosis accompanying infection by Helicobacter pylori or Chlamydia pneumoniae. Bacterial infections that can be treated, prevented or ameliorated by the compositions of the present invention and diseases caused by these infections are described by J. P. Sanford et al., "The Sanford Guide To Antimicrobial Therapy", 26th Edition, Antimicrobial Therapy, Inc., 1996].

The bacterium of the present invention may be an antibiotic-resistant bacterium, but is not limited thereto. The antibiotic-resistant bacteria include, for example, methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant enterococci (VRE), peicillin-resistant pneumococci (PRSP), multidrug-resistant Pseudomonas aeruginosa (MRPA), multidrug-resistant acinetobacter (MRAB). , may be at least one selected from the group consisting of carbapenem-resistant enterococci (CRE), but is not limited thereto.

The inflammatory disease caused by bacterial infection of the present invention is most preferably a disease caused by bacterial infection of Acinetobacter genus or Staphylococcus genus.

Specifically, the infectious inflammatory disease of the present invention is salmonellosis, food poisoning, typhoid, paratyphoid, sepsis, septic shock, systemic inflammatory response syndrome (SIRS), multiple organ function Multiple organ dysfunction syndrome (MODS), pneumonia, pulmonary tuberculosis, tuberculosis, cold, influenza, respiratory tract infections, rhinitis, nasopharyngitis, otitis media, bronchitis, lymphadenitis, mumps, lymphadenitis, stomatitis, stomatitis, arthritis, myositis, dermatitis, Vasculitis, gingivitis, periodontitis, keratitis, conjunctivitis, wound infection, peritonitis, hepatitis, osteomyelitis, cellulitis, meningitis, encephalitis, brain abscess, encephalomyelitis, meningitis, osteomyelitis, nephritis, carditis, endocarditis, enteritis, gastritis, esophagitis, duodenitis, Colitis, urethritis, cystitis, vaginitis, cervicitis, salpingitis, erythema infectious, bacterial dysentery, abscesses and ulcers, bacteremia, diarrhea, dysentery, gastroenteritis, gastroenteritis, genitourinary abscess, open wound or wound infection, purulent inflammation, abscess , boil, pyoderma, impetigo, folliculitis, cellulitis, post-operative wound infection, skin laceration syndrome, skin burn syndrome, thrombotic thrombocytopenia, hemolytic uremic syndrome, renal failure, pyelonephritis, glomerulonephritis, nervous system abscess, otitis media, sinusitis, pharyngitis, Tonsillitis, mastitis, cellulitis, gingivitis, dacryocystitis, pleurisy, abdominal abscess, liver abscess, cholecystitis, splenic abscess, pericarditis, myocarditis, placentalitis, amniocentesis, mastitis, mastitis, puerperal fever, toxic shock syndrome syndrome), lyme disease, gas necrosis, atherosclerosis, mycobacterium avium syndrome (MAC), enterohaemorrhagic E. coli (EHEC) infection, enteropathogenic E. coli (EPEC) infection, intestinal invasive E. coli infection (EIEC) , selected from the group consisting of methicillin-resistant Staphylococcus aureus (MRSA) infection, vancomycin-resistant Staphylococcus aureus (VRSA) infection, and listerosis It can be more than one.

Staphylococcus (Staphylococcus, Staphylococcus) is a gram-positive cocci with single, pair or irregular grape-shaped arrangement. Staphylococcus is classified into about 40 species, and is further divided into 11 groups according to the 16s ribosomal RNA (rRNA) sequence. Among these, three species are mainly problematic in clinical practice: S. aureus, S. epidermidis, and S. saprophyticus.

S. aureus (Staphylococcus aureus) is a major causative agent of purulent inflammation and shows various infectious symptoms ranging from food poisoning to sepsis. and protein A, an intracellular component of S. aureus, acts as complement activation, local wheal and seizures. When infected with S. aureus, skin infections such as folliculitis, burns, cellulitis, impetigo, postoperative wound infection, skin laceration syndrome, bloodstream infection, pneumonia, arthritis, acute endocarditis, myocarditis, encephalitis, meningitis, genitourinary system, nervous system, and abdominal organs Abscesses, otitis media, conjunctivitis, and toxic shock syndrome appear as symptoms. Furthermore, S. aureus, which has become resistant to antibiotics, is particularly difficult to treat and becomes a triangular problem for opportunistic infection and disease management in places where people gather, such as hospitals, schools, and prisons. Methicillin-resistant Staphylococcus aureus (MRSA), which is resistant to beta-lactam antibiotics such as penicillin and methicillin, and vancomycin, a glycoprotein antibiotic vancomycin-resistant S. aureus (VISA), heterogenous vancomycin-intermediate S. aureus (hVISA), and high-level vancomycin-resistant S. aureus (VRSA). Coagulase-negative S. epidermidis, another pathogen of the genus Staphylococcus, is a nosocomial infective bacterium that can be infected by treatment devices, etc., and S. saprophyticus causes urinary tract infections.

In the present invention, the compound that specifically binds to the SHMT protein is SHIN1 (SHMT inhibitor 1), SHMT-IN-1, SHMT-IN-2 (6-Amino-4-isopropyl-3-methyl-4-(3) -(pyrrolidin-1-yl)-5-(trifluoromethyl)phenyl)-1,4-dihydropyrano[2,3-c]pyrazole-5-carbonitrile), Zoloft, 6-amino-4-(5 -(hydroxymethyl)-[1,1′-biphenyl]-3-yl)-4-isopropyl-3-methyl-1,4-dihydropyrano[2,3-c]pyrazole-5-carbonitrile, SEL302-01612, SEL302 -00332, SEL302-00621, and 6-amino-4-[3-(hydroxymethyl)-5-(5-hydroxypent-1-yn-1-yl)phenyl]-3-methyl-4-(propan-2- It may be at least one selected from the group consisting of yl)-1H,4H-pyrano[2,3-c]pyrazole-5-carbonitrile, but is not limited thereto.

In the present invention, the “SHIN1” is 6-Amino-1,4-dihydro-4-[5-(hydroxymethyl)[1,1'-biphenyl]-3-yl]-3-methyl-4-(1- It is named as methylethyl)pyrano[2,3-c]pyrazole-5-carbonitrile, and may be represented by the following Chemical Formula 1, but is not limited thereto.

[Formula 1]

In the present invention, the SHIN2 is 6-amino-4-[3-(hydroxymethyl)-5-(5-hydroxypent-1-yn-1-yl)phenyl]-3-methyl-4-(propan-2-yl )-1H,4H-pyrano[2,3-c]pyrazole-5-carbonitrile, and may be represented by the following Chemical Formula 2, but is not limited thereto.

[Formula 2]

In the present invention, the zoloft is named Sertraline (1S,4S)-4-(3,4-dichlorophenyl)-N-methyl-1,2,3,4-tetrahydronaphthalen-1-amine, and is represented by the following formula (3) may be, but is not limited thereto.

[Formula 3]

In the present invention, the 6-amino-4-(5-(hydroxymethyl)-[1,1′-biphenyl]-3-yl)-4-isopropyl-3-methyl-1,4-dihydropyrano[2,3- c]pyrazole-5-carbonitrile may be represented by the following Chemical Formula 4, but is not limited thereto.

In the present invention, the SHNT-IN-1 may be represented by the following Chemical Formula 5, but is not limited thereto.

[Formula 5]

In the present invention, the SHNT-IN-2 may be represented by the following Chemical Formula 6, but is not limited thereto.

[Formula 6]

In the present invention, the compound that specifically binds to the SHMT protein may be a compound known in the following literature, but is not limited thereto (Document: Molecular Cancer Therapeutics 18(10):molcanther.0037.2019, Oncotarget. 2016 Jan 26 ;7(4):4570-83. etc.)

In the present invention, the bacteria are Staphylococcus aureus, Streptococcus ferus, Serratia marcescens, Vibrio parahaemolyticus, Streptococcus new Streptococcus pneumoniae, Staphylococcus saprophyticus, Campylobacter jejuni, Helicobactor pylori, Pseudomonas aeruginosa, Bacillus aeruginosa cereus), Enterococcus fecalis, Bacillus licheniformis, Staphylococcus epidermidis, Corynebacterium diphtheriae, Kbsiella pneumoniae pneumoniae), Listreia innocua, Burkholderia cepacia, Streptococcus parasanguinis, Salmonella typhimurium, Streptococcus sobrinus soStreptococcus , Streptococcus sanguinis, Streptococcus iniae, Streptococcus pyogene, Streptococcus mitis (Streptococcus mitis), Listeria Ivanovii subsperia monosperia ivanobi (Listeria Ivanovii) Genes (Listeria monocytogenes), Streptococcus suis, Clostridium perfringens, Yersinia enterocolitica, Shigella boydii, Shigella flexneri, Shigella flexneri Gela sonnei (Shigella sonnei), Salmonella choleraesuis subsp), Salmonella enteritidis (Salmonella enteritidis), Salmonella bongori (Salmonella bongori), Salmonella enterica (Salmonella enterica), Mycobacterium tuberculosis Mycobacterium tuberculosis, Mycobacterium leprae, Clostridium botulinum, Bacillus anthracis, Yersinia pestis, Chlamydia pneumonia), Borrelia burgdorferi, Coxiella burnetii, Mycobacterium avium, Escherichia coli, Borrelia sp. , Bartonella genus (Bartonella sp.), Chlamydia trachomatis (Chlamydia trachomatis), and may be at least one selected from the group consisting of Mycoplasma pneumoniae, but is not limited thereto.

In the present invention, the composition may be formulated or used in combination with an antibiotic, but is not limited thereto.

In the present invention, the antibiotic may be an antifolate, but is not limited thereto.

As used herein, the term “antifolate” is used herein to mean a chemotherapeutic agent that has a diatom similar to folic acid, but differs sufficiently to block the activity of folic acid and disrupt the folate-dependent mechanism essential for cellular replication, and used in claims. In the present invention, antifolates are a class of antimetabolites.

In the present invention, the term “synergy” means that, as described in the literature, the effect generated when each component is administered in combination is greater than the sum of the effects generated when administered alone as a single component (Chou and Talalay, Adv. Enzyme. Regul., 22:27-55, 1984).

As used herein, the term “administered in combination” means that a compound or component is administered together to a subject. When each compound or ingredient is administered together, it is meant that each ingredient can be administered sequentially at the same time or in any order or at different times to obtain the desired therapeutic effect.

In the present invention, the antibiotic is pyrimethamine, trimetrexate, iclaprim (Iclaprim), proguanil (Proguanil), cycloguanil (Cycloguanil), aminopterin (Aminoprterin), Lometrexol, nolatrexed, brodimoprim, pralatrexate, piritrexim, 5'-S-methyl-5'-thioadenosine, methi methicillin, oxacillin, norfloxacin, vancomycin, amikacin, gentamicin, kanamycin, neomycin, netylmycin ( Netilmicin), Tobramycin, Paromomycin, Streptomycin, Spectinomycin, Geldanamycin, Herbimycin, Rifaximin, Laura Carbef (Loracarbef), Ertapenem (Ertapenem), Doripenem (Doripenem), Imipenem/Cilastatin (Imipenem/Cilastatin), Meropenem (Meropenem), Cefadroxil (Cefadroxil), Cefazolin (Cefazolin), Cephalotin (Cefalothin), Cefalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cef Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime (Cefti zoxime), ceftriaxone, cefepime, ceftaroline fosamil, ceftobiprole, teicoplanin, telavancin, dalbavancin (Dalbavancin), Oritavancin, Clindamycin, Lincomycin, Deptomycin, Azithromycin, Clarithromycin, Dirythromycin (Dirithromycin), Erythromycin, Roxithromycin, Troleandomycin, Telithromycin, Spiramycin, Aztreonam, Furazolidone , Nitrofurantoin, Linezolid, Posizolid, Radezolid, Torezolid, Amoxicillin, Ampicillin, Azrosillin (Azlocillin), Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Nafcillin, Penicillin G ( Penicillin G), Penicillin V, Piperacillin, Temocillin, Ticarcillin, Amoxicillin/clavulanate, Ampicillin/sulbactam ), piperacillin/tazobactam, ticacillin/clavulanate, bacitracin ( Bacitracin), Colistin, Polymyxin B, Ciprofloxacin, Inoxacin, Gatifloxacin, Gemifloxacin, Levofloxacin, Levofloxacin (Lomefloxacin), Moxifloxacin, Nalidixic acid, Ofloxacin, Trovafloxacin, Grepafloxacin, Spafloxacin, Sparfloxacin Floxacin, Mafenide, Sulfacetamide, Sulfadiazine, Silver sulfadiazine, Sulfadimethoxine, Sulfamethizole, Sulfamethizole Sulfamethoxazole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Trimethoprim-Sulfamethoxazole (Cotrimoxazole, TMP-SMX), Sulfonamidocri Sulfonamido chrysoidine, Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Clofazimine, Dapsone, Capsone Leomycin, Cycloserine, Ethambutol, Ethionamide, Isoniazid, Pyrazinamide, Rifampicin, Rifabutin, Rifabutin Rifape ntine), Arsphenamine, Chloramphenicol, Fosfomycin, Fusidiic acid (Fusidi cacid), Metronidazole, Mupirocin, Platensimycin, Quinupristine / may be at least one selected from the group consisting of / dalfopristin (Quinupristin / Dalfopristin), thiamphenicol (Thiamphenicol), tigecycline (Tigecycline), tinidazole (Tinidazole), and trimethoprim (Trimethoprim), but is limited thereto it is not In one embodiment of the present invention, one or more antibiotics selected from the group consisting of trimethoprim and sulfamethoxazole were used in combination with a SHMT inhibitor to confirm the synergistic effect of susceptibility to antibiotic resistance.

The composition of the present invention may be administered simultaneously or sequentially with the antibiotic, but is not limited thereto. In the present invention, the composition comprising the SHMT inhibitor and/or the MTHFR inhibitor as an active ingredient may be formulated to be present in one container in the form of a mixture with an antibiotic, and may be present in a separate container to be administered simultaneously or sequentially. can be formulated. In addition, the composition comprising the SHMT inhibitor and/or the MTHFR inhibitor as an active ingredient may be administered as a secondary therapy after treatment with an antibiotic, but is not limited thereto.

In the present invention, the SHMT inhibitor and antibiotic are 1: 0.1 to 1000, 1: 0.1 to 900, 1: 0.1 to 800, 1: 0.1 to 700, 1: 0.1 to 600, 1: 0.1 to 500, 1: 0.1 to 400, 1: 0.1 to 300, 1: 0.1 to 200, 1: 0.1 to 100, 1: 0.1 to 90, 1: 0.1 to 80, 1: 0.1 to 70, 1: 0.1 to 60, 1: 0.1 to 50, 1: 0.1 to 40, 1: 0.1 to 30, 1: 0.1 to 20, 1: 0.1 to 10, 1: 0.1 to 9, 1: 0.1 to 8, 1: 0.1 to 7, 1: 0.1 to 6, 1: 0.1 to 5, 1: 0.1 to 4, 1: 0.1 to 3, 1: 0.1 to 2, 1: 0.3 to 10, 1: 0.3 to 9, 1: 0.3 to 8, 1: 0.3 to 7, 1: 0.3 to 6, 1: 0.3 to 5, 1: 0.3 to 4, 1: 0.3 to 3, 1: 0.3 to 1, 1: 0.5 to 10, 1: 0.5 to 9, 1: 0.5 to 8, 1: 0.5 to 7, It may be included in a mass ratio of 1: 0.5 to 6, 1: 0.5 to 5, 1: 0.5 to 4, 1: 0.5 to 3, or 1: 0.5 to 2, but is not limited thereto.

In the present invention, the antibiotic may be sulfamethoxazole and/or trimethoprim, but is not limited thereto. The sulfamethoxazole and trimethoprim are 1: 0.1 to 10, 1: 0.1 to 8, 1: 0.1 to 7, 1: 0.1 to 6, 1: 0.1 to 5, 1: 0.1 to 4, 1: 0.1 to 3 , 1: 0.5 to 10, 1: 0.5 to 9, 1: 0.5 to 8, 1: 0.5 to 7, 1: 0.5 to 6, 1: 0.5 to 5, 1: 0.5 to 4, 1: 0.5 to 3, or It may be included in a mass ratio of about 1: 0.5 to 2, but is not limited thereto.

The present invention may also include a pharmaceutically acceptable salt of the SHMT inhibitor and/or MTHFR inhibitor as an active ingredient. As used herein, the term “pharmaceutically acceptable salt” includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases. As used herein, the term “food pharmaceutically acceptable salt” includes salts derived from pharmaceutically acceptable organic acids, inorganic acids, or bases. As used herein, the term "veterinary acceptable salt" includes salts derived from veterinary acceptable inorganic acids, organic acids, or bases.

Examples of suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid , benzoic acid, malonic acid, gluconic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, and the like. Acid addition salts can be prepared by conventional methods, for example, by dissolving the compound in an aqueous solution of an excess of acid, and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It can also be prepared by heating an equimolar amount of the compound and an acid or alcohol in water and then evaporating the mixture to dryness, or by suction filtration of the precipitated salt.

Salts derived from suitable bases may include, but are not limited to, alkali metals such as sodium and potassium, alkaline earth metals such as magnesium, and ammonium. The alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. In this case, as the metal salt, it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt, and the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).

The content of the SHMT inhibitor and / or MTHFR inhibitor in the composition of the present invention can be appropriately adjusted depending on the symptoms of the disease, the degree of progression of the disease, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight based on the total weight of the composition, or It may be 0.001 to 50% by weight, but is not limited thereto. The content ratio is a value based on the dry amount from which the solvent is removed.

The pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the preparation of pharmaceutical compositions. The excipient may be, for example, at least one selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a humectant, a film-coating material, and a controlled-release additive.

The pharmaceutical composition according to the present invention can be prepared according to a conventional method, respectively, in powders, granules, sustained-release granules, enteric granules, liquids, eye drops, elsilic, emulsions, suspensions, alcohols, troches, fragrances, and limonaade. , tablets, sustained release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusates, Warnings, lotions, pasta, sprays, inhalants, patches, sterile injection solutions, or external preparations such as aerosols can be formulated and used, and the external preparations are creams, gels, patches, sprays, ointments, warning agents , lotion, liniment, pasta, or cataplasma.

Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In the case of formulation, it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, di-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, phosphoric acid as additives for tablets, powders, granules, capsules, pills, and troches according to the present invention Calcium monohydrogen, calcium sulfate, sodium chloride, sodium hydrogen carbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methyl cellulose, sodium carboxymethyl cellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropyl methyl excipients such as cellulose (HPMC), HPMC 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, and Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose phthalate acetate, carboxymethylcellulose, calcium carboxymethylcellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethylcellulose, sodium methylcellulose, methylcellulose, microcrystalline cellulose, dextrin , hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, purified shellac, starch powder, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, polyvinylpyrrolidone, etc. Hydroxypropyl methylcellulose, corn starch, agar powder, methylcellulose, bentonite, hydroxypropyl starch, sodium carboxymethylcellulose, sodium alginate, calcium carboxymethylcellulose, calcium citrate, sodium lauryl sulfate, silicic anhydride, 1-hydroxy Propyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, Disintegrants such as amylopectin, pectin, sodium polyphosphate, ethyl cellulose, sucrose, magnesium aluminum silicate, di-sorbitol solution, light anhydrous silicic acid; Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopodite, kaolin, petrolatum, sodium stearate, cacao fat, sodium salicylate, magnesium salicylate, polyethylene glycol (PEG) 4000, PEG 6000, liquid paraffin, hydrogen Added soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acid, higher alcohol, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, A lubricant such as starch, sodium chloride, sodium acetate, sodium oleate, dl-leucine, light anhydrous silicic acid; may be used.

As additives for the liquid formulation according to the present invention, water, diluted hydrochloric acid, diluted sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (Twinester), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, etc. can be used.

In the syrup according to the present invention, a sucrose solution, other sugars or sweeteners may be used, and if necessary, a fragrance, colorant, preservative, stabilizer, suspending agent, emulsifying agent, thickening agent, etc. may be used.

Purified water may be used in the emulsion according to the present invention, and if necessary, an emulsifier, preservative, stabilizer, fragrance, etc. may be used.

Suspension agents according to the present invention include acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, HPMC 2910, etc. An agent may be used, and a surfactant, a preservative, a stabilizer, a colorant, and a fragrance may be used as needed.

Injectables according to the present invention include distilled water for injection, 0.9% sodium chloride injection, ring gel injection, dextrose injection, dextrose + sodium chloride injection, PEG (PEG), lactated ring gel injection, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; Solubilizing aids such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, tweens, nijeongtinamide, hexamine, and dimethylacetamide; Weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, buffers such as albumin, peptone, gum; isotonic agents such as sodium chloride; sodium bisulfite (NaHSO ₃ ) carbon dioxide gas, sodium metabisulfite (Na ₂ S ₂ O ₅ ), sodium sulfite (Na ₂ SO ₃ ), nitrogen gas (N ₂ ), stabilizers such as ethylenediaminetetraacetic acid; sulphating agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, disodium ethylenediaminetetraacetate, acetone sodium bisulfite; analgesic agents such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; suspending agents such as SiMC sodium, sodium alginate, Tween 80, or aluminum monostearate.

The suppository according to the present invention includes cacao fat, lanolin, witepsol, polyethylene glycol, glycerogelatin, methyl cellulose, carboxymethyl cellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lanet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolene (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Butyrum Tego -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydro Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium, A, AS, B, C, D, E, I, T, Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), Suppository IV type (AB, B, A, BC, BBG, E, BGF, C, D, 299), supostal (N, Es), Wecobi (W, R, S, M, Fs), tester triglyceride base (TG-95, MA, 57) and The same mechanism may be used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the extract, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs and other factors well known in the medical field may be determined.

The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention pertains.

The pharmaceutical composition of the present invention may be administered to an individual by various routes. All modes of administration can be contemplated, for example, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, rectal insertion, vaginal It can be administered according to internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, skin administration, transdermal administration, and the like.

The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient along with several related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and the severity of the disease.

In the present invention, "individual" means a subject in need of treatment for a disease, and is not limited if it is a vertebrate, specifically, a human, a mouse, a rat, a guinea pig, a rabbit, a monkey, a pig, a horse, a cow, Applicable to sheep, antelopes, dogs, cats, fish and reptiles.

In the present invention, "administration" means providing a predetermined composition of the present invention to an individual by any suitable method.

In the present invention, “prevention” means any action that suppresses or delays the onset of a target disease, and “treatment” means that the target disease and its metabolic abnormalities are improved or It means all actions that are beneficially changed, and “improvement” means all actions that reduce the desired disease-related parameters, for example, the degree of symptoms by administration of the composition according to the present invention.

SHMT (serine hydroxymethyl transferase) protein activity inhibitor or gene expression inhibitor of the present invention; And when one or more selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor is used as a food additive, it can be added as it is or used with other food or food ingredients, and can be used appropriately according to a conventional method can The mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). In general, in the production of food or beverage, the SHMT (serine hydroxymethyl transferase) protein activity inhibitor or gene expression inhibitor of the present invention; And at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor may be added in an amount of 15 wt% or less, or 10 wt% or less based on the raw material. However, in the case of long-term intake for health and hygiene or health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.

There is no particular limitation on the type of the food. Examples of foods to which the above substances can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and includes all health functional foods in the ordinary sense.

The health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, as in a conventional beverage. The above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetener, natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used. The proportion of the natural carbohydrate is generally about 0.01-0.20 g, or about 0.04-0.10 g per 100 mL of the composition of the present invention.

In addition to the above, the composition of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, Carbonating agents used in carbonated beverages, etc. may be contained. In addition, the composition of the present invention may contain the pulp for the production of natural fruit juice, fruit juice beverage, and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.

The dosage form of the cosmetic composition according to the present invention includes skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nourishing lotion, massage cream, nourishing cream, mist, moisture cream, hand cream, hand lotion, foundation, It may be in the form of essence, nutritional essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, cleansing oil, cleansing balm, body lotion or body cleanser.

The cosmetic composition of the present invention may further include a composition selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high molecular weight peptides, high molecular weight polysaccharides, and sphingolipids.

As water-soluble vitamins, any type of vitamin can be used as long as it can be formulated in cosmetics. Examples include vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, and vitamin H. Also, their salts (thiamine hydrochloride, sodium ascorbate salt, etc.) and derivatives (ascorbic acid-2-phosphate sodium salt, ascorbic acid-2-phosphate magnesium salt, etc.) are also included in the water-soluble vitamins that can be used in the present invention. Included. Water-soluble vitamins can be obtained by conventional methods, such as a microbial transformation method, a purification method from a microbial culture, an enzymatic method, or a chemical synthesis method.

The oil-soluble vitamin may be any type of vitamin that can be formulated in cosmetics, and for example, vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol), etc. , their derivatives (ascorbine palmitate, ascorbine stearate, ascorbine dipalmitate, dl-alpha tocopherol acetate, dl-alpha tocopherol nicotinic acid, vitamin E, DL-pantothenyl alcohol, D-pantothenyl alcohol, pantothenyl ethyl ethers, etc.) are also included in the oil-soluble vitamins used in the present invention. Oil-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a microbial culture, and an enzyme or chemical synthesis method.

The macromolecular peptide may be any compound as long as it can be formulated in cosmetics, and examples thereof include collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, and keratin. Polymeric peptides can be purified and obtained by conventional methods such as purification from a microbial culture solution, enzyme method or chemical synthesis method, or can be purified and used from natural products such as dermis of pigs or cattle, silk fiber of silkworms, etc.

The high molecular weight polysaccharide may be any compound as long as it can be formulated in cosmetics, and examples thereof include hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate, or a salt thereof (sodium salt, etc.). For example, chondroitin sulfate or a salt thereof can be used after purification from mammals or fish.

The sphingolipid may be any as long as it can be formulated in cosmetics, and examples thereof include ceramide, phytosphingosine, and sphingoglycolipid. Sphingo lipids can be purified by conventional methods from mammals, fish, shellfish, yeast or plants, or can be obtained by chemical synthesis.

In the cosmetic composition of the present invention, in addition to the above essential ingredients, other ingredients usually blended in cosmetics may be blended as needed.

Other ingredients that may be added include oils and fats, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, UV absorbers, preservatives, bactericides, antioxidants, plant extracts, pH adjusters, alcohols, colorants, fragrances, A blood circulation promoter, a cooling agent, a restrictive agent, purified water, etc. are mentioned.

Examples of the fats and oils include ester fats and oils, hydrocarbon oils, silicone oils, fluorine oils, animal fats, and vegetable oils.

As ester-based fats and oils, tri2-ethylhexanoate glyceryl, 2-ethylhexanoate cetyl, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, stearic acid Butyl, ethyl linoleate, isopropyl linoleate, ethyl oleate, isocetyl myristate, isostearyl myristate, isostearyl palmitate, octyldodecyl myristate, isocetyl isostearate, diethyl sebacate, adipine Diisopropyl acid, isoalkyl neopentanoate, tri(caprylic acid, capric acid) glyceryl, trimethylol propane tri-2-ethylhexanoate, trimethylol propane triisostearate, pentaelysitol tetra2-ethylhexanoate , cetyl caprylate, decyl laurate, hexyl laurate, decyl myristate, myristyl myristate, cetyl myristate, stearyl stearate, decyl oleate, cetyl ricinoleate, isostea laurate Lil, isotridecyl myristate, isocetyl palmitate, octyl stearate, isocetyl stearate, isodecyl oleate, octyldodecyl oleate, octyldodecyl linoleate, isostearic acid isopropyl, 2-ethylhexanoate cetoster Aryl, 2-ethyl stearyl hexanoate, hexyl isostearate, ethylene glycol dioctanoate, ethylene glycol dioleate, propylene glycol dicapric acid, di(caprylic acid, capric acid) propylene glycol, dicaprylic acid propylene glycol, dicapric acid Neopentyl glycol phosphate, neopentyl glycol dioctanoate, glyceryl tricaprylate, glyceryl triundecyl, glyceryl triisopalmitate, glyceryl triisostearate, octyldodecyl neopentanoate, isostearyl octanoate , isononanoate octyl, neodecanoate hexyldecyl, neodecanoate octyldodecyl, isostearate isocetyl, isostearyl isostearate, isostearic acid octyldecyl, polyglycerol oleate, polyglycerol isostearate, Triisocetyl citrate, triisoalkyl citrate, triisooctyl citrate, lauryl lactate, myristyl lactate, cetyl lactate, octyldecyl lactate, triethyl citrate, acetyl triethyl citrate, acetyl tributyl citrate, trioctyl citrate, dimalate Isostearyl, 2-ethylhexyl hydroxystearate, di2-ethylhexyl succinate, diisobutyl adipate, diisopropyl sebacate, dioctyl sebacate, Cholesteryl stearate, cholesteryl isostearate, cholesteryl hydroxystearate, cholesteryl oleate, dihydrocholesteryl oleate, phytsteryl isostearate, phytsteryl oleate, 12-stealoyl Ester type, such as hydroxy stearate isocetyl, 12-stealoyl hydroxy stearyl stearate, and 12-stealoyl hydroxy stearate isostearyl, etc. are mentioned.

Examples of hydrocarbon-based fats and oils include hydrocarbon-based fats and oils such as squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, liquid isoparaffin, polybudene, microcrystalline wax, petrolatum.

Examples of silicone-based oils and fats include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane/methylcetyloxysiloxane copolymer, dimethylsiloxane/methylstealloxysiloxane copolymer, and alkyl Modified silicone oil, amino modified silicone oil, etc. are mentioned.

Perfluoropolyether etc. are mentioned as fluorine-type fats and oils.

As animal or vegetable oils, avocado oil, almond oil, olive oil, sesame oil, rice bran oil, saffron oil, soybean oil, corn oil, rapeseed oil, passerine oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil , Cottonseed Oil, Palm Oil, Kukui Nut Oil, Wheat Germ Oil, Rice Germ Oil, Shea Butter, Wormwood Colostrum, Marcus Damien Nut Oil, Meadow Oil, Egg Yolk Oil, Tallow Oil, Horse Oil, Mink Oil, Orange Raffy Oil, Jojoba Oil , animal or plant oils and fats such as candelabra wax, carnauba wax, liquid lanolin, and hydrogenated castor oil.

Examples of the moisturizing agent include a water-soluble low-molecular moisturizer, a fat-soluble molecular moisturizer, a water-soluble polymer, and a fat-soluble polymer.

As water-soluble low molecular weight moisturizers, serine, glutamine, sorbitol, mannitol, pyrrolidone-sodium carboxylate, glycerin, propylene glycol, 1,3-butylene glycol, ethylene glycol, polyethylene glycol B (polymerization degree n = 2 or more), polypropylene Glycol (polymerization degree n=2 or more), polyglycerol B (polymerization degree n=2 or more), lactic acid, lactic acid salt, etc. are mentioned.

Cholesterol, cholesterol ester, etc. are mentioned as a fat-soluble low molecular weight humectant.

Examples of the water-soluble polymer include carboxyvinyl polymer, polyaspartate, tragacanth, xanthan gum, methyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, water-soluble chitin, chitosan, and dextrin. can

Examples of the fat-soluble polymer include polyvinylpyrrolidone/eicocene copolymer, polyvinylpyrrolidone/hexadecene copolymer, nitrocellulose, dextrin fatty acid ester, and high molecular weight silicone.

Examples of the emollient include long-chain acylglutamic acid cholesteryl ester, hydroxystearic acid cholesteryl, 12-hydroxystearic acid, stearic acid, rosin acid, and lanolin fatty acid cholesteryl ester.

Nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, etc. are mentioned as surfactant.

Nonionic surfactants include self-emulsifying glycerin monostearate, propylene glycol fatty acid ester, glycerin fatty acid ester, polyglycerol fatty acid ester, sorbitan fatty acid ester, POE (polyoxyethylene) sorbitan fatty acid ester, POE sorbitan fatty acid ester, POE Glycerin fatty acid ester, POE alkyl ether, POE fatty acid ester, POE hydrogenated castor oil, POE castor oil, POE/POP (polyoxyethylene/polyoxypropylene) copolymer, POE/POP alkyl ether, polyether-modified silicone, lauric acid alkanolamides, alkylamine oxides, hydrogenated soybean phospholipids, and the like.

Examples of the anionic surfactant include fatty acid soap, alpha-acyl sulfonate, alkyl sulfonate, alkyl allyl sulfonate, alkyl naphthalene sulfonate, alkyl sulfate, POE alkyl ether sulfate, alkyl amide sulfate, alkyl phosphate, POE alkyl phosphate, and alkyl amide phosphate. , alkyloylalkyltaurine salts, N-acylamino acid salts, POE alkylethercarboxylate salts, alkylsulfosuccinate salts, alkylsulfoacetate sodium, acylated hydrolyzed collagen peptide salts, perfluoroalkylphosphate esters, and the like. .

Examples of the cationic surfactant include alkyltrimethylammonium chloride, stearyltrimethylammonium chloride, stearyltrimethylammonium bromide, cetostearyltrimethylammonium chloride, distearyldimethylammonium chloride, stearyldimethylbenzylammonium chloride, behenyltrimethylammonium bromide, chloride Benzalkonium, diethylaminoethylamide stearate, dimethylaminopropylamide stearate, quaternary ammonium salt of lanolin derivative, etc. are mentioned.

Examples of the amphoteric surfactant include carboxybetaine type, amidebetaine type, sulfobetaine type, hydroxysulfobetaine type, amidesulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type, amidamine type, etc. Amphoteric surfactant etc. are mentioned.

Examples of organic and inorganic pigments include silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium-coated mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide. inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine blue, chromium oxide, chromium hydroxide, calamine, and complexes thereof; Polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenol resin, fluororesin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene/styrene copolymer, and organic pigments such as silk powder, cellulose, CI pigment yellow and CI pigment orange, and composite pigments of these inorganic pigments and organic pigments.

Examples of the organic powder include metal soaps such as calcium stearate; alkyl phosphate metal salts such as sodium cetylate, zinc laurylate, and calcium laurylate; acylamino acid polyvalent metal salts such as calcium N-lauroyl-beta-alanine, zinc N-lauroyl-beta-alanine, and calcium N-lauroyl glycine; amidesulfonic acid polyvalent metal salts such as calcium N-lauroyl-taurine and calcium N-palmitoyl-taurine; N such as N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoylizine, N-alpha-paritoylolnithine, N-alpha-lauroylarginine, N-alpha-hydrogenated beef fatty acid acylarginine, etc. -Acyl basic amino acid; N-acyl polypeptides, such as N-lauroyl glycyl glycine; alpha-amino fatty acids such as alpha-aminocaprylic acid and alpha-aminolauric acid; Polyethylene, polypropylene, nylon, polymethyl methacrylate, polystyrene, a divinylbenzene-styrene copolymer, ethylene tetrafluoride, etc. are mentioned.

As UV absorbers, para-aminobenzoic acid, para-aminobenzoate ethyl, para-aminobenzoate amyl, para-aminobenzoate octyl, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicylate, butyl salicylate, homomentyl salicylate, benzyl cinnamate , para-methoxycinnamic acid-2-ethoxyethyl, para-methoxycinnamic acid octyl, dipara-methoxycinnamic acid mono-2-ethylhexaneglyceryl, para-methoxycinnamic acid isopropyl, diisopropyl diisopropyl cinnamic acid ester mixture, uro Cannic acid, ethyl urokanate, hydroxymethoxybenzophenone, hydroxymethoxybenzophenonesulfonic acid and salts thereof, dihydroxymethoxybenzophenone, sodium dihydroxymethoxybenzophenonedisulfonate, dihydroxybenzophenone , tetrahydroxybenzophenone, 4-tert-butyl-4'-methoxydibenzoylmethane, 2,4,6-trianilino-p-(carbo-2'-ethylhexyl-1'-oxy)-1 ,3,5-triazine, 2-(2-hydroxy-5-methylphenyl)benzotriazole, etc. are mentioned.

Examples of disinfectants include hinokitiol, triclosan, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, zinc phyllithione, benzalkonium chloride, photosensitizer. So, No. 301, mononitroguaial sodium, undecyrenic acid, etc. are mentioned.

Examples of the antioxidant include butylhydroxyanisole, propyl gallic acid, and ellisorbic acid.

Examples of the pH adjuster include citric acid, sodium citrate, malic acid, sodium malate, fmalic acid, sodium fumarate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, and the like.

As alcohol, higher alcohols, such as cetyl alcohol, are mentioned.

In addition, blending components that may be added other than this are not limited thereto, and any of the above components can be blended within a range that does not impair the object and effect of the present invention, but 0.01-5% by weight or 0.01-3 based on the total weight % by weight.

When the formulation of the present invention is a lotion, paste, cream or gel, animal fiber, vegetable fiber, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc. can be used

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol fatty esters, fatty acid esters of polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.

When the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide as carrier components Ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolin derivative or ethoxylated glycerol fatty acid ester and the like may be used.

In addition, the present invention provides a quasi-drug composition for improving or improving the prevention of bacterial infection.

In the "quasi-drug composition for preventing or improving bacterial infection" according to the present invention, the quasi-drug is a preparation used for sterilization, insecticide, and similar uses for the prevention of infectious diseases described in Article 2, No. 7 (c) of the Pharmaceutical Affairs Act. It may mean a repellent, exterminant, repellent, insecticide, or attractant insecticide for flies and mosquitoes used for health.

The target to which the quasi-drug is applied may include all living things and inanimate objects as well as the individual, but is not limited thereto.

In addition, the quasi-drugs may include external preparations for skin and personal care products. For example, it may be a disinfectant cleaner, shower foam, gargrin, wet tissue, detergent soap, hand wash, or ointment, but is not limited thereto.

When the quasi-drug composition according to the present invention is used as a quasi-drug additive, the composition may be added as it is or used together with other quasi-drugs or quasi-drug ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be suitably determined according to the purpose of use.

The quasi-drug composition of the present invention may be prepared in the form of, for example, a general emulsified formulation and a solubilized formulation. For example, it may have formulations such as emulsions, creams, ointments, sprays, oil gels, gels, oils, aerosols, and smokers such as lotions, but is not limited as long as it exhibits the pest control inducing effect of the present invention. . In addition, in the quasi-drug composition, oil, water, surfactant, humectant, lower alcohol having 1 to 4 carbon atoms, thickener, chelating agent, pigment, preservative or fragrance, etc., which are generally formulated in quasi-drug composition in each formulation, are appropriately blended as needed. can be used by

The present invention is a serine hydroxymethyl transferase (SHMT) protein activity inhibitor or gene expression inhibitor; And MTHFR (Methylenetetrahydrofolate reductase) provides an antibacterial composition comprising at least one selected from the group consisting of a protein activity inhibitor or a gene expression inhibitor as an active ingredient.

In the present invention, "antibacterial" refers to inhibiting the growth of bacteria in the body to weaken or annihilate the action of bacteria invading the body, and more specifically, it means to inhibit the proliferation of bacteria, and the present invention The target bacteria of are as mentioned above.

In addition, the present invention provides a screening method for preventing or treating a bacterial infection comprising the following steps.

(a) SHMT protein or mRNA thereof; and treating cells expressing one or more selected from the group consisting of MTHFR protein or mRNA thereof with a test substance;

(b) the HMT protein or mRNA thereof in cells treated with the test substance and cells not treated with the test substance; and measuring the expression level of one or more selected from the group consisting of MTHFR protein or mRNA thereof; and

(c) a protein or mRNA thereof of said HMT compared to a control cell; and selecting a substance having a reduced expression level of one or more selected from the group consisting of MTHFR protein or mRNA thereof as a preventive or therapeutic agent for bacterial infection.

In the present specification, the cells expressing the mRNA or protein of SHMT and/or MTHFR include cells in which the mRNA or protein of SHMT and/or MTHFR is endogenous or transiently high expression, or SHMT and / or MTHFR-encoding nucleic acid may be introduced into a cell to be overexpressed by transformation, but is not particularly limited thereto.

As used herein, 'expression' means that a protein or nucleic acid is produced in a cell. The SHMT and/or MTHFR-expressing cell may be a cell endogenously expressing SHMT and/or MTHFR, and transformed with a recombinant expression vector comprising a polynucleotide encoding SHMT and/or MTHFR to form SHMT and/or MTHFR. It may be a cell that overexpresses MTHFR.

The term “test substance” used while referring to the screening method of the present invention refers to an unknown substance used in screening to test whether it affects the expression of SHMT and/or MTHFR of the present invention. The test substance is siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme, DNAzyme, PNA (peptide nucleic acids), antisense oligonucleotide, antibody, aptamer, natural extract or including, but not limited to, chemicals.

In addition, the cells used in step (a) may be provided in the form of an experimental animal. In this case, the screening method of the present invention further comprises inducing bacterial infection to the experimental animal, and Contact includes, but is not limited to, parenteral or oral administration, and stereotaxic injection, and a person skilled in the art will be able to select an appropriate method for testing the test substance in animals.

Treatment of the test substance means culturing the cells for a certain period of time after adding the test substance to the cell or tissue culture medium. When the cells are provided in the form of an experimental animal, contact with the test substance is not limited thereto, including parenteral or oral administration, or stereotaxic injection, and those skilled in the art can select an appropriate method for testing the test substance in animals. will be.

Measurement of mRNA expression level in step (b) of the present invention is RT-PCR, quantitative or semi-quantitative RT-PCR (Quentitative or semi-Quentitative RT-PCR), quantitative or semi-quantitative real-time RT-PCR (Quentitative or semi -Quentitative real-timeRT-PCR), Northern blot, and may be measured using one or more methods selected from the group consisting of DNA or RNA chips, but is not limited thereto.

In the step (b) of the present invention, the protein expression level is measured by Western blot, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, and immunoprecipitation analysis. , complement fixation analysis, FACS, and may be measured using one or more methods selected from the group consisting of a protein chip, but is not limited thereto.

The step (c) is a step of selecting a substance that reduces the expression level of the SHMT and/or MTHFR mRNA or protein as compared to the control cell as a preventive or therapeutic agent for bacterial infection.

The control cells may be cells that have not been treated with a test substance, but are not limited thereto.

Since the present invention can apply various transformations and can have various embodiments, specific embodiments are illustrated in the drawings and described in detail in the detailed description. However, this is not intended to limit the present invention to specific embodiments, it should be understood to include all modifications, equivalents and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of a related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Test method]

Experimental Example 1. Functional analysis of serine hydroxymethyltransferase in lysostaphin-resistant Staphylococcus aureus strain

1-1. Cells, Chemicals, and Reagents

The mammalian cell line used in the experiment was obtained from the American Type Culture Collection (ATCC). All chemicals used in the experiments were of analytical grade. The lyophilized lysostapine powder form (Cat #L7386, Sigma Aldrich, St. Louis, MO, USA) was purchased and 50 mM Tris-HCl and 50 mM Tris-HCl as described in Eur. J. Biochem. 1973, 38, 293-300 It was dissolved in a buffer containing 145 mM NaCl (pH 7.4). SHMT inhibitor SHIN1 (Cat #GC32773, GLPBIO, Montclair, CA, USA) was purchased to confirm the inhibitory effect on SHMT of Staphylococcus aureus.

1-2. Bacterial cell growth conditions

Various wild-type Staphylococcal strains, including Staphylococcus aureus ST72 isolate, were grown on tryptic soy agar (TSA) plates overnight at 37°C (see Table 1). Bacterial broth cultures were grown by inoculating single colonies in tryptic soy broth (TSB) medium under orbital shaking (200 rpm) culture conditions at 37° C. for 14 to 16 hours. Bacterial growth was monitored by measuring optical density at 600 nm (OD ₆₀₀ ) using a spectrophotometer (GE Healthcare, Chicago, IL, USA). Bacterial cells were harvested by centrifugation (3220 x g) at 4°C, and then washed with 1X phosphate buffered saline (PBS; pH 7.2). All primers used to generate the recombinant strains are shown in Table 2. A recombinant strain of S. aureus USA300 FPR3757 (SAUSA300) (NARSA, USA) containing an empty vector (pRMC2) or a derivative thereof was treated with a TSA plate and TSB containing 12.5 μg/mL and 25 μg/mL of chloramphenicol, respectively. Grown in broth medium. All bacterial strains used in the experiment are shown in Table 3.

1-3. Conjugation of TR-X Succinimidyl Ester and Lysostaphin

Lysostapine was conjugated with Texas Red (TR; Texas Red, AAT Bioquest, Sunnyvale, CA USA) as described in Infect. Immun. 2019, 87, e00119-19. 25U of lysostapine was buffer exchanged with 100 mM sodium carbonate buffer (pH 10) centrifuged (17000 x g) at 4° C. using a 3 kDa Amicon ultra centrifugal filter (Merck, Carrigtwohill, Ireland). The buffer-exchanged lysostapine was resuspended in 700 µL (220 nM) of carbonate buffer to which 11.3 µL of TR (3.9 mM stock) was added to maintain a 1:200 (lysostapine:TR) ratio. The final reaction volume was maintained at 1 mL. In addition, the reaction mixture was continuously mixed overnight at 4° C. using a mixer rocker. Then, unbound TR was removed by repeated washing with 0.1 M phosphate buffer using a 3 kDa Amicon ultra centrifugal filter. Finally, the conjugated TR-lysostapine was concentrated to 125 μL. Conjugation of lysostapine and TR was analyzed using SDS-PAGE and imaged using a gel documentation system (BIO-RAD, USA).

1-4. Evaluation of ST72 Response to Lysostaphin Treatment

After cells were harvested, the OD ₆₀₀ was maintained at 0.01 in 1 x PBS (1 x 10 ⁷ cells). Cells were treated with 2U of lysostapine at 37°C for 5 minutes. After treatment, treatment with 10 μM of phenanthroline, which chelates zinc ions, immediately increased lysostaphin activity. Both untreated control and treated cells were serially diluted, and various dilutions were plated on TSA plates to count colony-forming units (CFUs).

1-5. Turbidity Reduction Analysis

To estimate the killing kinetics of lysostapine, K07-204, K07-561, SAUSA300, and S. saprophyticus were grown from overnight cultures for 6 hours. Bacterial cells washed with PBS were treated with 5U of lysostapine, and killing-kinetics were measured for 30 minutes using a spectrophotometer (V730JASCO, Tokyo, Japan). After lysostapine treatment, the mortality rate was measured in terms of turbidity reduction for all Staphylococcus strains.

1-6. Evaluation of Lysostaphin Binding to Cell Wall of ST72 Isolate

All bacterial strains were grown to logarithmic stage in TSB. The harvested bacterial cells were washed with 1 x PBS, and the OD ₆₀₀ was maintained at 0.5 (~5.0 x 10 ⁸ cells/mL). Cells were labeled with wheat germ agglutinin Alexa Flour stain (WGA-AF) according to the manufacturer's instructions (ThermoFisher Scientific, Carlsbad, USA), and unbound dye was washed with 1x PBS. WGA-AF-labeled bacterial cells were incubated with TR-lysostapine for a short time (5 s) and phenanthroline was added immediately. For confocal imaging (LSM 510 Meta, Carl Zeiss, Oberkochen, Germany), bacterial slides were prepared by placing 100 μL of stained culture solution on a grease-free glass slide.

1-7. Evaluation of Lisostapine Endopeptidase Activity on ST72 Isolates Using SEM

Bacterial strains were treated with 2U of lysostapine at 37°C for 5 minutes. Cells were fixed in 2% glutaraldehyde (Glutaraldehyde solution Grade I, 8% in H ₂ O, Sigma) overnight at 4°C. Then, the cells were washed twice with PBS, dehydrated with 10%, 20%, 40%, 60%, 80% ethanol, and finally with 100% ethanol. Cells were mounted on a silicon wafer and dried before application to a scanning electron microscope (SEM). After drying, platinum sputtering was performed to visualize the sample by SEM (FESEMII/EDS/EBSD, JSM700, Jeol, Peadbody, MA, USA).

1-8. Live/Dead staining

ST72 isolates K07-204, K07-016, S. simulans and SAUSA300 were grown until log phase, and the turbidity of the cells was maintained at 1 at OD ₆₀₀ . Cells were treated with 5U of lysostapine at 37°C for 5 minutes. Cells were washed and stained with Live/Dead Baclight Bacterial Viability Kit (Cat #L7007; Invitrogen, Carlsbad, CA, USA). SYTO9 stained all cells green, whereas PI stained only dead cells red. After staining, cells were washed twice with PBS and imaged using confocal microscopy to measure lysostaphin endopeptidase activity-mediated cell death.

1-9. Assessment of presence and mutation analysis of genes known to be responsible for lysostaphin resistance

To analyze the presence or absence of a lysostaphin resistance gene, the genomic sequence was not available during the evolution of the mechanisms of lysostaphin resistance (K07-204, lys ^r ) and susceptibility K07-561 (lysostaphin sensitivity, lys ^s ) of ST72. , degenerate primers were designed. All gene sequence information was collected from Uniprot. Sequence alignment was performed using the multiple sequence alignment tool CLUSTALW. After finding the region with the most conserved sequence, degenerate primers were designed. The sequences of the degenerate primers are shown in Table 2. To investigate the presence or absence of genes involved in the mechanism of lysostaphin resistance, the epr, lss and fmhC genes of the ST72 isolate were PCR amplified using degenerate primers. To identify mutations in genes associated with lysostaphin resistance, femA, femB, femX, and lyrA, members of the femAB family, were PCR-amplified using CN1 genome-based primers. In this comparative analysis, SAUSA300 was used as a control, and K07-204 and K07-561 were used as lysostaphin-resistant and sensitive isolates, respectively. The femA, femB, femX and lyrA genes were PCR amplified and cloned into TOPO-TA vector (TOPO ^TM TACloning ^TM kit, Cat #450641, Invitrogen). Thereafter, the recombinant pCR2.1 TOPO vector containing the insert fragment was transformed with E. coli DH5α, and putative clones were X-gal (25 μg/mL), IPTG (1 mM), and kanamycin (50 μg/mL). Selected by blue-white selection on LB agar plate containing the plate. The plasmid of the positive clone was isolated using a plasmid purification kit (Qiagen, Hilden, Germany). Both strands were sequenced to achieve complete sequences of femA, femB, femX and lyrA, and mutations, if any, were analyzed. After obtaining the nucleotide sequence of the gene, the sequence was translated using the Expasy translation tool. The amino acid sequence of each gene was aligned using a multiplex alignment tool to identify mutations in the amino acid sequence that could cause lysostaphin resistance.

1-10. Comparative genomics-based metabolic pathway modeling

To further identify lysostaphin resistance genes, the genomes of K07-204 (lys ^r ) and K07-561 (lys ^s ) (JACSIU000000000.1 and JACORE000000000.1, respectively) were compared with that of the model organism S. aureus USA300. . A homology model was constructed based on comparative genomics to generate hypotheses for one carbon metabolism and lysostaphin resistance in serine/glycine homeostasis. The role of the folate cycle associated with shmT in antifolate antibiotic resistance and toxicity was studied based on a genomic model.

1-11. Functional genomics of shmT gene of K07-204 and cloning into pRMC2 vector

To prove the hypothesis that the shmT gene may contribute to the biosynthesis of amino acids, particularly the interconversion of serine to glycine in the tetrahydrofolate pathway, a functional genomics approach was used. The shmT gene of K07-204 was amplified by PCR, cloned into the pCR2.1TOPO cloning vector, and sequenced. The resulting pCR2.1TOPO_shmT vector was restriction digested using Kpn1 and EcoR1 (New England Biolab, MA, USA). The KpnI-EcoR1 digested shmT gene gel was purified and subcloned into the same site of pRMC2 (E. coli-S. aureus shuttle vector). Empty vector pRMC2 and shmT Recombinant plasmid pRMC2_shmT was transformed with E. coli DH5α and selected on LB agar plates supplemented with chloramphenicol (25 μg/mL). Plasmids pRMC2 and pRMC2_shmT were isolated and electroporated into S. aureus RN4220, followed by electroporation of WT S. aureus USA300 and ΔshmT knockout strains.

Electrocompetent S. aureus strains were washed with cold sucrose solution. Briefly, electrocompetent cells of S. aureus strains (S. aureus RN4220, WT S. aureus USA300, and ΔshmT knockout) were prepared using 20 mL of logarithmic growth cells (OD ₆₀₀ 0.6-0.8) in TSB. . After centrifugation (3220 x g) at 4 °C, the cell pellet was washed twice with 20 mL of 200 mM sucrose solution, and finally GTY medium (glucose 1 g/L, tryptone 5 g/L, yeast extract 2.5 g for electroporation). /L, pH 7.2) was resuspended in 2 mL. First, empty vectors pRMC2 and pRMC2_shmT were electroporated into S. aureus RN4220 electrocompetent cells. Electroporation for all S. aureus strains was performed using a 1 mm gap electroporation cuvette (Gene Pulser, Bio-Rad, Hercules, CA, USA) in an electric field of 22 kV/cm, 25 μF capacitance and 200 Ω resistance. Putative recombinants of all S. aureus strains were selected on TSB plates supplemented with chloramphenicol (25 μg/mL). Plasmids (pRMC2 and pRMC2_shmT) were extracted from S. aureus RN4220 and finally electroporated in WT S. aureus USA300 and ΔshmT knockouts. A list of recombinant strains is shown in Table 3 above.

1-12. Quantitative RT-PCR for expression analysis of shmT

Total mRNA was isolated from recombinant strains of SAUSA300 and ST72 isolates using the Qiagen RNeasy Mini Kit according to the manufacturer's protocol. Total mRNA was treated with DNase I to remove DNA contamination. It was confirmed that the DNase I-treated mRNA sample had no trace of genomic DNA contamination through PCR amplification of the target gene. cDNA was prepared from the isolated mRNA using a random hexamers premix (RNA to cDNA EcoDry ^TM premix, Takara Bio, Kusatsu, Japan). Primers for qRT-PCR were used with an annealing temperature of 55 ± 2 °C and an amplified product size of 200 bp. qRT-PCR was performed using SYBR Green Supermix (Bio-Rad), where the gyrA gene was maintained as a housekeeping gene. Expression of the shmT gene was normalized to that of the endogenous gyrA gene. Relative gene expression was analyzed using the 2 ^-ΔΔCT method. Three independent qRT-PCR experiments were performed, and statistical significance was calculated by Student's t-test (p < 0.05).

1-13. Toxicity evaluation of ST72 isolates

The virulence and pathogenic potential of S. aureus strains was evaluated using in vitro mammalian culture conditions and in vivo wax worm (Galleria mellonella) infection models.

1-13-1. In Vitro Infection Experiments

To evaluate the role of the shmT gene in the virulence of S. aureus, an in vitro infection experiment was performed using HEK293 and RAW264.7 mouse macrophage cell lines. Mammalian cells were grown in DMEM (Dulbecco's modified Eagle's medium) containing 10% FBS (fetal bovine serum) in a humidified 5% carbon dioxide incubator at 37 °C. Cells were split into 6-well plates (1.0×10 ⁶ cells/well) and incubated for 24 hours. After washing with 1×PBS, bacterial cells were provided with invasion medium (DMEM without FBS) 2 hours before infection. RAW264.7 and HEK293 cells were infected with SAUSA300 strain at moi (multiplicity of infection) 10 for 30 min. Extracellular cells were killed using lysostapine (5U) and gentamicin (400 μg/mL). Cells were washed 3 times with 1×PBS to remove residual antimicrobial agents. Cells were harvested via trypsinization and harvested by centrifugation. The cell pellet was washed once again with 1 x PBS and treated with 0.04% Triton-X100 to disrupt mammalian cells to recover intracellular bacterial cells. Intracellular bacterial cells were diluted with 1×PBS, and bacterial counts were determined by dilution plating of 100 μl on TSA plates for counting of CFU.

1-13-2. Honeycomb moth larval infection model

Wild-type SAUSA300 and its homologous shmT knockout strain were grown overnight in TSB medium under orbital shaking (200 rpm) culture conditions at 37°C. Cultures grown overnight were re-inoculated at 100-fold dilutions in TSB for 6 hours. Bacterial cells were collected by centrifugation (3220×g, 4° C.) and washed once with 1×PBS. Cell numbers were maintained by adjusting the optical density (OD ₆₀₀ =1) in 1 x PBS. Honeycomb moth larvae were used within one week of receipt. Each group of control or treatment groups contained 10 beehive moth larvae. 2.0x10 ⁵ cells (20 µL) were injected into the last left hind limb using a 0.3 mL syringe (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) into honeycomb moth larvae and incubated at 37 °C for observation. In each experiment, an untreated larval group was used as a control group, and 20 μl of 1×PBS was injected. The survival of the larvae was observed at different time intervals, and the experiment was terminated within 20 hours.

Experimental Example 2. Confirmation of synergistic effect of antibiotics targeting serine hydroxymethyltransferase in multidrug-resistant Staphylococcus aureus

2-1. Bacterial growth and culture conditions

TSB (Tryptic Soy Broth) was used for the growth experiment of S. aureus, Ca-MHB (Cation-adjusted Mueller Hinton broth) and Staphylococcus Minimal Media (MM; Minimal Media) were used for MIC measurement. Staphylococcus aureus minimal medium is aspartic acid, glutamic acid, proline, glycine, serine, threonine, alanine, lysine, iso leucine, leucine, histidine, valine, arginine, cysteine, phenylalanine, tyrosine, methionine, tryptophan, Nicotinic acid, thiamine, KH ₂ PO ₄ , Na ₂ HPO ₄ , (NH4) ₂ SO ₄ , NaCl, glucose, and MgSO ₄ were included. The minimal medium was maintained at pH 7.2. MIC ₅₀ and MIC ₉₉ for SXT are Staphylococcus aureus ( S. aureus ) USA300 (FPR3757), MRSA ST279, MRSA ST 239, MSSA ST630, MRSA ST5, MSSA29213, K07-561, K07-204, Acinetobacter baumannii CCARM 12165, and was determined against Acinetobacter.baumannii KAB03. Bacterial cultures were plated on blood agar, single colonies were picked and inoculated into TSB-broth. Tubes were incubated at 37° C. under shaking culture conditions (200 rpm) for 12 hours. A. baumanni strain was cultured similarly except that Ca-MHB was used. After overnight growth, the cultures were harvested by centrifugation at 4000 rpm at 4°C. The cell pellet was washed three times with PBS, and then the inoculum was used for growth and MIC measurements. Bacterial growth was confirmed with a spectrophotometer by measuring the optical density at 600 nm (OD _{600 nm} ).

2-2. In vitro sensitivity test using broth microdilution method

MIC ₅₀ and MIC ₉₉ for SXT were determined using broth microdilution method as previously described (CLSI, 2018 #21) (Richard Schwalbe, 2007 #22). TSB and Ca-MHB medium were used for the determination of MIC ₅₀ and MIC ₉₉ . A round bottom 96-well microtiter plate containing 200 μL medium per well was used for MIC measurement. According to the broth microdilution protocol, the number of bacteria inoculated into each well was 5 x 10 ⁵ CFU/mL. Throughout the MIC experiment, growth was measured by measuring the optical density (OD _{600 nm} ) at 600 nm. Growth of other bacterial strains was estimated after static growth at 37°C for 18 hours. Triplicate samples were maintained for statistical analysis for each experiment. Sulfamethoxazole (SMX) and Trimethoprim (TMP) stocks were prepared according to the instructions of the manufacturer's protocol. MIC ₅₀ and MIC ₉₉ were measured for SMX, TMP individually and SMX-TMP (SXT) combination.

2-3. SHIN1 inhibitor toxicity to bacteria

The toxicity of SHIN1 was estimated by measuring the growth inhibition of 8 strains of S. aureus. A single colony of each S. aureus strain obtained from the striped plate was inoculated into 5 ml of TSB in a 14 ml polypropylene round bottom disposable tube, and incubated overnight at 37° C. under shaking culture conditions. The initial inoculum for each bacterial strain was maintained at 5 x 10 ⁵ CFU/mL. The inhibitory effect of SHIN1 on the growth of Staphylococcus strains was measured at a final concentration of 5 μg/mL. For each strain, one positive control sample containing bacteria and TSB and one negative control sample containing only TSB were prepared. Growth was measured at OD _600nm at 0 hours (T ₀ ), 6 hours (T ₆ ), and 18 hours (T ₁₈ ).

2-4. Gene expression analysis by quantitative real-time PCR

Bacteria were treated with various concentrations of SXT and a fixed concentration of SHIN1 (0.125 μg/mL). Treated cells were harvested by centrifugation at 5000×g for 5 minutes. Cell pellets without supernatant were immediately treated with RNA-Protect reagent (QIAGEN). Total RNA was isolated using the QIAGEN RNeasy Mini kit according to the manufacturer's instructions. In both control and treated samples, a total of 1 μg of RNA was treated with DNase I (amplification grade, Sigma) at room temperature for 15 minutes. The reaction was stopped by addition of stop buffer, and the samples were incubated at 70° C. for 10 minutes to heat inactivation of DNaseI. The DNase I-treated RNA sample was subjected to PCR amplification of the target gene to confirm genomic DNA contamination. First strand cDNA synthesis was performed using Ecodry Premix (random hexamer) kit (Takara Bio, USA). The primers used for quantitative RT-PCR (qRT-PCR) (Table 3) ranged from 19 to 21 bp in length with an annealing temperature of 55 ± 2 °C and an amplified product size of 200 bp. Each qRT-PCR reaction consisted of 1X Taq universal SYBR Green supermix (Bio-Rad) containing 300 nM of forward and reverse primers, 100 ng of cDNA, and dNTP and Taq polymerase. Expression of the shmT(glyA), metE, folA, and folK genes was normalized to the endogenous housekeeping pyk or proC genes. Relative gene expression was analyzed using the 2 ^-ΔΔCT method (Schmittgen and Livak, 2008).

Gene names 5’ Forward primer 3’ 5’ Reverse primer 3’ proC CATCAAACCACATTACAA TTTCATCTTTAGATTTAGGG pyk AAAAGGTGTTAACTTACCTG TTTAGGGAATACTGAAATGT glyA TTAATGGTAGACATGGCACA CTGCAATAACATGCTCAAGA folA TGACTTGCAACGAGTAATTG AATTACATCAACGCCCTCTA metE ATTTCACGAACGAGAAAGAA ATAAGCTGGCATTTGGATAA folK TGGTGATAGAGAAAGCCAGT TGTCTTCAAACAACATTCCA

2-5. Enhancement of SXT with SHMT inhibitor SHIN1

Enrichment of SXT was confirmed using SHIN1, where MIC and FIC indices were estimated using broth microdilution method as described in 2-2. The sensitivity of S. aureus USA300 was confirmed in 96-well plates using various concentrations of SMX-TMP (SXT) and SHIN1. DMSO concentration was controlled at 1%.

2-6. In vivo toxicity evaluation using the Galleria mellonella infection model

2-6-1. Health-index evaluation of beehive moth larvae

Honeycomb larvae were quarantined for at least 24 hours after arrival at the laboratory, and the health index of all candidate honeycomb larvae was evaluated prior to in vivo infection experiments. Throughout the hive moth larvae experiments, in order to maintain the standard health of the hive moth larvae, the length and weight of each worm was measured prior to the experiment. Most were similar in length and weight. Some very large or concentratedly small parts were excluded. Only beehive moth caterpillars with a health index of 100 were selected.

The worm health index was identified based on four parameters: (a) activity, (b) cocoon formation, (c) melanization, and (d) survival (Loh, 2013 #25). These parameters were evaluated and data were collected every 6 hours for each worm up to 120 hours.

2-6-2. Establishing the anti-virulence target

The infectivity of S. aureus USA300 and its allogeneic mutants △glyA, △mate was evaluated using honeycomb moth larvae in a slightly modified in vivo infection model (Imdad, 2018 #23; Batool, 2020 #7). Briefly, individual worms were sterilized with 100% ethanol, and blood lymphocytes were placed near the cage on the leg (Halwani, 1997 #26). Thereafter, bacterial cells were injected into the blood lymph of the honeycomb larvae (Au - Ramarao, 2012 #24). S. aureus strain corresponding to 1 x 10 ⁷ CFU in 10 μL PBS was injected into the left leg of each worm. Infected honeycomb moth larvae were incubated at 37°C so that the injected bacteria could meet good growth conditions. Health and lethal events of the hive moth larvae were monitored every 6 h for a total of 120 h. Upon death of the beehive moth larvae, incisions were made with full haemolymph extract using a sterile autoclaved metal scapel. Subsequently, hemolymphs were saturated with PBS and serially diluted (approximately 10 ⁷ -10 ⁸ fold) to determine colony forming units (CFU).

2-6-3. Establishment of SHIN1 as an inhibitor of staphylococcal SHMT

SHIN1 is a known inhibitor of human SHMT. To establish SHIN1 as an inhibitor of SaSHMT, an in vivo honeycomb larval infection experiment was performed. High and low doses of SMX and TMP were treated after infection with S. aureus USA300. High dose of SMX 1.25 μg/mL and low dose of SMX 0.25 μg/mL; A high dose of TMP 0.625 μg/mL and a low dose of TMP 0.125 μg/mL were injected into infected honeycomb moth larvae. SHIN1 was fixed at 0.125 μg/mL. The DMSO concentration was maintained at 1% throughout the infection experiment. In addition, a placebo control group was maintained in each experiment to assess the deleterious biasing effect on hive moth larval survival.

Example 1. Lysostaphin resistance pattern of ST72 isolates

S. aureus has thick peptidoglycans responsible for maintaining cell shape and integrity. Lysostaphin is considered a potent enzyme as it is known to specifically target and lyse S. aureus cells by cleaving the pentaglycine bridge in the peptidoglycan layer of the cell wall. As more evidence supports the hypothesis that ST72 isolates are resistant to multiple antibiotics, it is necessary to determine whether lysostapine can be used to treat AMR ST72 infection. Therefore, lysostaphin-sensitive S. aureus USA300 (hereinafter, SAUSA300) and lysostaphin-resistant Staphylococcus saprophyticus to the ST72 isolate (Table 1) were evaluated for susceptibility to lysostaphin (see FIGS. 1A and 1B ). A time-dependent turbidity reduction assay was used to test lysostapine sensitivity for 30 minutes. The loss of turbidity revealed a complete loss of cellular integrity due to disruption of the cell wall architecture of SAUSA300 ( FIG. 1A ) compared to S. saprophyticus ( FIG. 1B ). Treatment of lysostaphin 2U killed most of the S. aureus ST72 isolates and SAUSA300. However, ST72 isolated from human K07-204, animal 08-B-93, and soil 4-009 showed differential resistance to lysostaphin (see FIG. 1C ). Percent turbidity loss was up to 37% for K07-204 (lysostaphin-resistant, lys ^r ), compared to 60% for K07-561 and SAUSA300 (lysostaphin-sensitive, lys ^s ) strains, where initial turbidity (OD ₆₀₀ = 1) was considered 100%. Of the 11, K07-204 (human isolate) and 4-009 (soil) were selected for further experiments to ensure lysostapine resistance, where lysostapine-sensitive (SAUSA300) and lysostaphin-resistant (S. saprophyticus) were selected. ) strain was used as a control.

K07-204, a human isolate with the highest levels of lysostaphin resistance, may provide answers to two related questions. That is, (a) does the ST72 resistant/susceptible isolate have similar lysostaphin binding activity? (b) Does lysostapine display differential catalytic cleavage activity (CCA) on the pentaglycine bridge of lysostaphin-resistant cell wall compared to susceptible ST72 isolates? Cooperation of lysostaphin (TR-lysostaphin) labeled with Texas Red (TR) and wheat germ agglutinin Alexa Fluor 488 (WGA-AF) to verify the interaction of lysostaphin with the cell wall in lys ^r K07-204 Colocalization was analyzed as in FIG. 1D . WGA-AF has a lectin residue known to bind to carbohydrate moieties in the cell wall of Gram-positive bacteria, specifically N-acetylglucosamine residues. Red fluorescent TR-lysostaphin (Fig. 1e(I)) protein colocalized with WGA-AF labeled cell wall (Fig. 1e(IIa)), resulting in the red observed upon binding of TR-labeled lysostaphin (Fig. 1e(IIb)). yellow fluorescence (Fig. 1e(IIc)) compared to fluorescence. These results clearly indicate that lysostaphin efficiently binds to the cell wall of ST72 K07-204. Therefore, it is expected that lysostaphin probably possesses a differential CCA to the peptidoglycan layer of the lys ^r K07-204 human isolate.

Example 2. Phenotypic evaluation of lysostaphin resistance in ST72 isolates

Confocal laser scanning microscopy (CLSM) was used to evaluate the differential catalytic cleavage activity of lysostaphin and loss of cell integrity.

As shown in FIGS. 2A and 2B , the staphylococcal cell wall did not interfere with the WGA-AF-labeled green fluorescent cell wall and exhibited red fluorescence at the bacterial boundary upon binding to TR-lysostaphin. Colocalization of green and red fluorescence was indicated by the merged yellow fluorescence images for K07-204 and 4-009 without visible cell lysis.

However, as shown in Figure 2d, lysostaphin treatment with SAUSA300 resulted in cell lysis, which is indicated by broken/distorted cells. These results indicated that lysostaphin could bind to the surface of both lys ^r and lys ^s strains of S. aureus, but the catalytic cleavage reaction was found to be lower for the lys ^r strain, resulting in differential cell lysis. lost.

In addition, as shown in Fig. 2c, TR-lysostaphin was found to interact weakly with the cell wall of S. saprophyticus, indicating a structural difference in the peptidoglycan structure of S. saprophyticus compared to the S. aureus strain. . Therefore, it appears that the resistance of S. saprophyticus is mainly due to the low binding affinity of lysostaphin.

Example 3. Confirmation of lysostaphin resistance of the ST72 isolate

Lysostaphin-induced lysis or alterations in cell wall structure and consequent changes in cell phenotype could not be clearly visualized using CLSM imaging, mainly due to low magnification. Therefore, using a scanning electron microscope (SEM; scanning electron microscopy) was observed the change of the cell surface with or without lysostapine treatment.

As shown in a' of FIG. 3a, in the SEM image, K07-204 and 4-009 (lys ^r ST72 isolate) had intact cell walls in response to lysostaphin treatment. In addition, the results are contrasted with the untreated control group in a in FIG. 3a and S. saprophyticus in b and b'. However, the lys ^s SAUSA300 cells of FIG. 3a c were contracted upon treatment with lysostaphin, resulting in cell death, which was expected to be due to the endopeptidase action of lysostaphin. On the other hand, as shown in b and b' of Fig. 3a, S. saprophyticus cells were not damaged upon treatment with lysostaphin in the SEM and CLSM images. Despite the equivalent interaction of TR-lysostaphin in both the ST72 isolate and lys ^s SAUSA300, the ST72 isolates from human (K07-204) and soil (4-009) were lysostaphin due to their differential catalytic cleavage activity. showed resistance to

To further confirm whether alterations in cell wall structure and consequent changes in cell phenotype lead to bacterial cell death, live/dead staining was performed using SYTO9/PI staining, where SYTO9 stains whole cells (green). On the other hand, propidium iodide (PI) stained exclusively dead cells (red).

As shown in Fig. 3b, SAUSA300 (lys ^s ) cells were completely stained with PI (red fluorescent cells) to indicate complete apoptosis. In contrast, the lys ^r isolates of ST72 K07-204, S. saprophyticus, and 4-009 showed intact cells, suggesting that they were lysostaphin resistant.

Example 4. Investigation of existing mechanisms of lysostaphin resistance

Since Staphylococcus simulans biovar staphylolyticus is a strain that produces lysostaphin, it has genes encoding lysostaphin endopeptidase (lss) and lysostaphin immune factor (lif) in the pACK1 plasmid for protection against its own lysostapine. The lys ^s SAUSA300 strain lacks this gene. To understand the differential CCA of lysostaphin against ST72, a comparative genomics approach was used for lysostaphin-resistant (lys ^r , S. simulans) and lysostaphin-sensitive (lys ^s , SAUSA300) strains. This allowed us to identify genes directly linked to lysostaphin resistance, such as lss and epr, which encode glycylglycine endopeptidase and endopeptidase resistance, respectively. We then attempted to identify mutations in genes known to contribute to the development of lysostaphin resistance through various mechanisms. Next, the presence of these genes or mutations in ST72 isolates that are sensitive or resistant to lysostaphin was assessed.

First, degenerate primers for amplification and replication of these genes were designed by collecting sequences from various staphylococcal genomes. The lss and epr genes were absent in the ST72 isolates (K07-204 and K07-561), whereas S. simulans harbored both lss and epr, enabling lysostaphin production and lysostaphin resistance, respectively. These results nullified the possibility that ST72 is a lysostaphin producer and possesses an autoimmune mechanism in lys ^r human isolates K07-204 and lys ^s K07-561. Genes known to be directly involved in the development of lysostaphin resistance are epr-like genes (fmhC/eprh) and femABX. This isolate has fmhC in its genome. However, in both lys ^r K07-204 and lys ^s K07-561 isolates, the sequence of the fmhC gene responsible for lysostaphin resistance was found to be 100% identical.

Second, we targeted lyrA and femABX, which generally play roles in resistance, by altering cell wall assembly. Because mutations in these genes are important for conferring lysostaphin resistance, full-length lyrA, femA, femB, and femX were amplified, cloned, and sequenced. The obtained sequences were translated and aligned to the lys ^r K07-204 and lys ^s K07-561 isolates to identify any mutations responsible for the differential CCA of lysostaphin. The sequencing results clearly indicated that the translated amino acid sequences were identical in the lysostaphin-resistant lys ^r K07-204 and susceptible lys ^s K07-561 strains. These results clearly indicate that there is no known lysostaphin resistance mechanism in lys ^r K07-204 (see Table 5 below).

Example 5. lys ^r K07-204 and lys ^s Comparative genomics analysis of K07-561

After screening for all known genes/mutations involved in various mechanisms of lysostaphin resistance in human isolates of ST72 K07-204 (lys ^r ) and K07-561 (lys ^s ) together with the control SAUSA300 (lys ^s ), differential It has been difficult to find clues as to how the mechanism of the lysostaphin reaction works. Therefore, by comparing the whole genome sequences of ST72 K07-204 (lys ^r ) and K07-561 (lys ^s ) (GenBank Accession no. JACSIU000000000.1 and JACORE000000000.1), in-depth comparative and subtractive genome analysis (in-depth comparative and subtractive genome analysis) and subtractive genomics analysis). This is to elucidate the unknown mechanism of lysostaphin resistance in lys ^r K07-204. Similar levels of binding of TR-labeled lysostaphin to the cell wall in lys ^r K07-204 and lys ^s K07-561 indicate differential CCA of lysostaphin to the pentaglycine bridge. Differential CCA of lysostaphin to the pentaglycine bridge is known to occur when a glycine residue is converted to a serine. Therefore, it was hypothesized that the enzyme involved in serine/glycine conversion may be related to resistance (see FIG. 4a ).

To verify this possibility, a metabolic pathway model of lys ^r K07-204 was constructed based on comparative genomic analysis. In this metabolic pathway model (see Fig. 4b), serine hydroxymethyltransferase is presumably in the folate cycle of 1-carbon metabolism, with serine homeostasis in tetrahydrofolate (THF) and 5,10-methylene tetrahydrofolate (MTHF) cell pools. found to play an important role in the /glycine interconversion. Thus, the role of the shmT gene in glycine/serine interconversion; and the role of contributing to differential lysostaphin resistance between human isolates lys ^r K07-204 and lys ^s K07-561;

Example 6. The role of shmT in lysostaphin resistance

To establish a role for shmT in lysostaphin resistance, the correlation between shmT expression and lysostaphin resistance was investigated. For this, an empty vector (SAUSA300_EV) and SAUSA300; An empty vector (ΔshmT_EV) was used to create a shmT knockout, ΔshmT complemented (ΔshmT_Comp.) strain.

Then, shmT gene expression was quantified by qRT-PCR. SAUSA300_EV and ΔshmT complemented strains showed similar levels of shmT expression without aTc (anhydrotetracycline) induction, but no transcript trace was detected in ΔshmT knockout (ΔshmT_EV) strains (see FIG. 5a ). aTc induction improved shmT expression by 3.5-fold in the complementing strain compared to wild-type SAUSA300 containing the empty vector (SAUSA300_EV) (see Fig. 5b).

In addition, a strain having shmT overexpression (shmT_OE) was created in wild-type SAUSA300 as an aTc-inducible promoter for ectopic overexpression of shmT. The expression level of shmT with or without aTc induction was found to be 2-fold or 53-fold higher, respectively, compared to the empty vector control, SAUSA300_EV (see FIGS. 5c and 5d ).

After confirming the expression level of shmT in each strain, the effect on lysostaphin resistance was investigated by CFU analysis treated with lysostaphin 2U. ΔshmT_EV was found to have insignificant effect compared to the empty vector control SAUSA300_EV without aTc induction and the complement strain (ΔshmT_Comp.) (see FIG. 5e ).

Interestingly, the enhancement of shmT expression by aTc induction showed significant sensitivity in ΔshmT_EV compared to the empty vector control SAUSA300_EV and the complement strain (ΔshmT_Comp.) (see FIG. 5f ).

CFU analysis was performed using shmT_OE according to the presence or absence of aTc induction.

5g and 5h , ectopic overexpression of shmT in the wild-type strain showed a higher level of sensitivity to lysostaphin compared to SAUSA300_EV. These results showed that a higher level of sensitivity to lysostaphin was induced by the overexpression of the shmT gene, compared to the control group in which the overexpression of the shmT gene was not induced.

To evaluate the correlation between lys ^r and lys ^s human isolates of ST72 and lysostaphin resistance/susceptibility to shmT gene expression, native shmT expression was monitored.

As shown in FIG. 5I , a 2-fold higher expression of the shmT gene was observed in the lys ^s K07-561 isolate than in the lys ^r K07-204 isolate. These results suggest that a higher level of shmT expression is responsible for the lysostaphin sensitivity of K07-561 compared to K07-204, which is completely consistent with the results of the shmT overexpressing strain of SAUSA300.

Serine hydroxymethyltransferase (EC 2.1.2.1) (SHMT) is a pyridoxal 50-phosphate-(PLP-dependent) enzyme that has been extensively studied in all areas of life, from bacteria to humans. SHMT1 (cytoplasmic SHMT, GlyC) and SHMT2 (mitochondrial SHMT, GlyM) are known to exist in humans. Human cytoplasmic and mitochondrial SHMTs show 45.5% and 42.0% identity to SHMTs of S. aureus USA300, respectively. A small molecule labeled SHIN1 (serine hydroxymethyltransferase inhibitor 1) is known to target human SHMT. Therefore, it was expected that SHIN1, a human SHMT inhibitor, would act as an inhibitor for staphylococcal SHMT. Interestingly, the phenotypic evaluation of lysostaphin resistance/susceptibility of K07-204 showed that upon SHIN1-mediated inhibition of SHMT, the lysostaphin resistance of K07-204 was slightly enhanced, whereas overexpression of shmT enhanced the lysostaphin resistance of K07-204. appeared to decrease. Overall, it was possible to confirm the role of shmT on lysostaphin resistance/susceptibility in both SAUSA300 and lys ^r K07-204ST72 isolates.

Example 7. The role of shmT in maintaining the virulence potential of S. aureus

In general, the shmT gene plays an important role in the tetrahydrofolate cycle in carbon metabolism, a key pathway important for folate metabolism, DNA synthesis and repair, methionine biosynthesis, and maintenance of the cellular redox state (see Fig. 4c). Therefore, in order to elucidate the role of the shmT gene in the virulence potential of SAUSA300, the potential for internalization (invasion and phagocytosis) of the recombinant strain was compared.

As shown in FIG. 6a , ΔshmT knockout showed a decrease in intracellular bacterial cells compared to wild-type SAUSA300, confirming that the shmT gene could contribute to the survival of SAUSA300 inside the host cell. Therefore, the shmT gene may play an important role in the virulence and pathogenesis of S. aureus.

In addition, to verify the in vitro infection results, the knockout strain was injected into honeycomb moth larvae (n = 10) to compare the role of shmT in relation to the pathogenic potential of SAUSA300.

As shown in FIG. 6b , in vivo infection experiment, ΔshmT knockout showed ≥80% survival in several experiments, whereas wild-type SAUSA300 resulted in 100% death of honeycomb larvae within 40 hours of infection. These results indicate that shmT is one of the most potent virulence factors and can be used as a novel drug target for the hypertoxic SAUSA300 to the host.

To test SHIN1 function to protect honeycomb larvae from in vivo infectious conditions, bacteria (0.1, 0.2, 0.5, 1, 5, 7, 10 µg/mL) and honeycomb larvae (0.1, 0.2, 0.5 and 1) The toxicity of SHIN1 was tested at various concentrations of μg/honeycomb larvae).

As shown in FIG. 6c , SHIN1 showed minimal inhibition of bacterial growth up to 2 μg/mL, and was found to be non-toxic up to 0.5 μg/beehive moth larvae. In vivo infection of wild-type SAUSA300 against honeycomb moth larvae killed 100% of the larvae within 40 hours of infection.

On the other hand, as shown in Fig. 6d, compared with ΔshmT knockout and PBS (placebo) controls, SHIN1 (0.5 μg/honeycomb larvae) showed ≥50% survival in the same number of wild-type SAUSA300-infected honeycomb moth larvae. . This clearly shows that shmT is a potent antiviral drug target, both in vitro and in vivo infection results.

Example 8. Diversity of MICs according to various Staphylococcus aureus (S. aureus) sequence types

Despite the effects of SMX (Sulfamethoxazole) and TMP (Trimethoprim) on the treatment of Gram-positive bacteria, there have been reports of resistance to S. aureus. The antibiotic resistance was either completely resistant to SMX + TMP, or moderate resistance developed to either SMX, and TMP.

Accordingly, the MIC (minimum inhibitory concentration) of SMX and TMP for the variable sequence type of S. aureus was confirmed. Strains including MRSA (Methicillin-resistant S. aureus) and MSSA (Methicillin-susceptible S. aureus) were selected. Bacteria 5 x 10 ⁵ CFU/mL were inoculated into each well. The MIC was determined by optical density measurements at 600 nm at the breakpoints of bacterial inhibition of 50% (MIC 50) and 99% (MIC 99) compared to positive controls (bacteria inoculated with TSB without antibiotics). Susceptibility test was confirmed over two times in triplicate (6 times in total) using one of the minimum medium (MM; Minimum Media) and TSB (Tryptic Soy Broth). Other parameters remained the same in the MIC readings 18 hours after inoculation, using a 37° C., 200 rpm shaking incubator.

As monotherapy, SMX or TMP showed a high MIC range against Gram-positive bacteria (minimum 2 μg/mL to maximum 4 μg/mL), except that MSSA ST 630 was 0.0625 μg/mL for TMP (see Table 6). . That is, the bacteriostatic effect of a wide range of SMX/TMP on S. aureus strains was confirmed once again. In addition, SMX + TMP (SXT) showed a synergistic effect against MSSA strains (ST 630, MSSA 29213) (see Table 7). However, as in other previous studies, moderate resistance was still present in most MRSA strains (ST279, ST 239, ST 5, and USA300). There was no difference in the MIC results of MM and TSB media.

Minimal inhibitory concentrations of antifolates [Sulfamethoxazole (SMX) and Trimethoprim (TMP)] against S. aureus of 8 sequence types, including both methicillin-sensitive and resistant S. aureus (MSSA&MRSA) SN Sequence types Antibiotics
(Single therapy) MIC _{50
(SAMM)
μg/mL} MIC _{99
(SAMM)
μg/mL} MIC _{50
(TSB)
μg/mL} MIC _{99
(TSB)
μg/mL} One S. aureus USA300 SMX 2 4 2 4 TMP One 2 One 2 2 MRSA ST279 SMX 2 4 2 4 TMP 2 4 2 4 3 MRSA ST239 SMX 2 4 2 4 TMP 2 4 2 4 4 MSSA ST630 SMX 2 4 One 2 TMP 0.0625 0.125 0.125 0.25 5 MRSA ST5 SMX One 2 2 4 TMP One 2 One 2 6 MSSA 29213 SMX 2 4 2 4 TMP 0.5 One One 2 7 K07-561 SMX 2 4 2 4 TMP 0.5 One One 2 8 K07-204 SMX One 2 2 4 TMP 0.25 0,5 0.5 One

The initial number of bacteria is 5 × 10 ⁵ Bacterial CFU/mL was inoculated into tryptic soy broth (TSB) and S. aureus minimal medium (SAMM).

Bacteria strains /
Sequence types Combination MIC SXT (μg/mL) FIC index ^J
Interpretation ^f
SMX TMP S. aureus USA300 2 2 1.5 Indifferent effect S. aureus MRSA ST279 4 2 1.5 Indifferent effect S. aureus MRSA ST239 4 4 2 Indifferent effect S. aureus MSSA ST630 0.125 0.125 0.5625 Synergistic effect S. aureus MRSA ST5 One 2 1.25 Indifferent effect S. aureus MSSA 29213 One One 0.75 Synergistic effect S. aureus K07-561 0.06 2 1.015 Indifferent effect S. aureus K07 - 204 0.5 One 1.125 Indifferent effect

Example 9. Cytosolic Serine hydroxymethyltransferase inhibitor (SHIN1) and SXT (Sulfamethoxazole-Trimethoprim) combined synergistic effect on S. aureus USA300 WT

The effect of SHIN1 was confirmed to improve the synergistic effect of the combination of SMX (Sulfamethoxazole) and TMP (Trimethoprim). First, in order to confirm that SHIN1 is not toxic to Staphylococcus aureus (S. aureus), growth phase observation was performed every 6 hours until 24 hours (FIG. 7a). To augment the evidence for this observation, the optical density at 600 nm was measured, and this experiment was repeated with 8 different Staphylococcus aureus strains, including MSSA and MRSA. The data showed that SHIN1 had no effect on both toxicity and growth rate for various Staphylococcus aureus.

In addition, by adding different concentrations of SHIN1 (increased from 0.125 μg/mL to 1 μg/mL), we aimed to enhance the effect of the SMX + TMP (SXT) treatment on Staphylococcus aureus USA300 FPR3757 (see Fig. 7b). SXT was maintained at a fixed dose with a sub-inhibitory bacteriostatic effect (TMP 0.125 μg/mL + SMX 0.06 μg/mL) during the checkboard assay. As a result, by adding SHIN1 ≥ 0.125 μg/mL, the sensitivity of S. aureus USA300 FPR3757 was increased 5 times compared to the case where SHIN1 was not added. SMX, TMP, and SHIN1 were dissolved in DMSO (dimethyl sulfoxide). In order to reduce the artifact effect due to the high concentration of DMSO, the range of DMSO was adjusted from 1% to 2%.

Therefore, the potential role of SHMT and SHIN1 on the resistance of S. aureus to SMX/TMP was confirmed.

To clarify the role SHIN1 contributes to SXT, the FICI of SXT was calculated before and after adding SHIN1. As a result, the FICI of SXT induced by the combination of SMX and TMP without SHIN1 was 1.5, and the FICI with SHIN1 was 0.0775 (Table 8).

Bacterial strain MIC Single therapy
(μg/mL) Combination MIC
(without SHIN1)
(μg/mL) Combination MIC
(with SHIN1*)
(μg/mL)
FIC Index without SHIN1
FIC Index with SHIN1 SMX TMP SMX TMP SMX TMP USA300 (WT) 4 2 2 2 0.06 0.125 1.5 ^e
Indifferent 0.0775 ^f
Synergistic

Example 10. Effect of acid folic on the MIC of S. aureus due to the combination of TMP (Trimethoprim), SMX (Sulfamethoxazole), and SHIN1

So far, no reference could be found mentioning the role of folic acid (vitamin B9) in improving or reducing bacterial antibiotic resistance. Based on the observation of the folate and methionine pathways in the metabolic properties of bacteria, it can interact with enzymes such as Tetrahydrofolate (THF), Dihydrofolate (DHF), Methylene tetrahydrofolate reductase (MTHFR), or Dihydropteridine reductase (DHPR), and I got the idea that there might be folic acid that might reduce the effect. Therefore, we aimed to identify the role of folic acid on the sensitivity characteristics of USA300 WT and knockout strains (KO glyA and KO metE) to SMX and TMP. According to the results of this study, the sub-inhibitory doses of TMP and SMX against the USA300 (FPR3757) strain were 0.125 μg/mL and 0.25 μg/mL, respectively. The high dose TMP and SMX for USA300 (FPR3757) were 0.625 μg/mL and 1.25 μg/mL, respectively. The SHIN1 concentration was 50 ng/mL and the folic acid was 10 nM.

As shown in FIGS. 8a to 8c , compared with USA300 WT, both knockout strains (KO glyA and KO metE) showed increased inhibitory effect due to high dose SXT treatment combined with SHIN1 (pink legend). In particular, 99% of KO glyA strains were inhibited by high doses of SMX and TMP. This is because, due to the deficiency of SHMT, the metabolism of 5,10-MTHF in THF is directly delayed and MTHFR is unable to produce 5-MTFH.

In addition, addition of 10 nM folic acid reduced bacterial inhibition in all groups, including KO glyA and KO metE strains (green legend). In particular, the results showed that folic acid could reverse the bacterial static of SMX and TMP against S. aureus in WT, KO glyA, or KO metE strains. These results support that SMX + TMP, which is essentially bacteriostatic, is strongly associated with glyA and metE, and that inhibition of glyA or metE is due to the strong effect of folic acid as an initial cascade of folic acid and methionine cycling, in Staphylococcus aureus. It supported the partial inhibition of folic acid metabolism.

Example 11. Expression and trans-sulfation of methionine cycle genes by SXT and SHIN1

The role of glyA in the toxicity of S. aureus USA300 and resistance to lysostapine has been reported. However, the properties of other essential genes (metE, folA, and folK) involved in one carbon metabolism in S. aureus were not known.

As shown in Figure 3, the original expression of genes intrinsically related to the folic acid pathway and the methionine pathway including glyA, metE, folA, and folK in USA300 WT, KO glyA, and KO metE were confirmed. As most of the components for confirming SHMT inhibition by SHIN1 are in the reaction chain, we were interested in the degradation of specific functions of one enzyme in the overall picture of the folate and methionine pathways. In this study, before treatment with SMX/TMP/SHIN 1, KO glyA and KO metE strains were identified by artificial inhibition of SHMT and MTHFR. ProC and pyK were used as housekeeping genes.

Relative normalization with proC and pyK housekeeping genes compared to control WT; The expression of glyA and metE; was not significantly changed in the KO metE strain and the KO glyA strain, respectively. These results show that the inhibition of glyA and metE does not have a specific mutual effect, at least at the gene expression level. It was analyzed that folA expression decreased slightly in KO glyA strain and increased 2.5-fold in KO metE strain. folK expression was increased in both the KO glyA strain (2.5-fold) and the KO metE strain (6.2-fold). This supports that knockout of single genes glyA or metE may have relative effects on other genes of the folate and methionine cycle. However, both folA and folK were significantly increased in the KO metE strain in contrast to KO glyA. That is, it was confirmed that glyA inhibition should be superior to metE inhibition for folic acid inhibition and should not lead to relative repulsive stimulation of folA and folK.

Example 12. The role of glyA and metE in the toxicity of USA300 determined by the honeycomb moth larval infection model

Due to the potentiating effect of SHIN1 on the susceptibility ability of MRSA USAS300 (FPR3757), and the gene expression correlation between KO glyA and KO metE with other genes in the folic acid cycle, glyA, and metE were detected in Staphylococcus aureus through a honeycomb larval infection model. was hypothesized to affect the virulence phenotype of Based on this, the role of glyA and metE in USA300 toxicity was confirmed.

As shown in FIG. 10b , it was confirmed that the survival rate of honeycomb moth larvae was significantly improved in KO glyA (SHMT) and KO metE (MTHFR) (the number of each group was 10, the experiment was independently repeated twice) (p value 95% CI = 0.0031). That is, both glyA and metE affect the toxic expression of USA300 (FPR3757).

In contrast, as shown in FIG. 10A , no significant difference between these groups could be identified in colony forming units (CFU). This means that the improvement in viability of the honeycomb moth larvae is not due to a decrease in the number of bacteria, but is due to the reduced toxicity in the knockout glyA or metE. This allows to examine the expression of important virulence genes in the contribution of genes related to the folate pathway and the methionine pathway.

Example 13. Confirmation of protective ability of SXT + SHIN1 in honeycomb larvae infection model according to USA300 treatment

After confirming the roles of glyA and metE in the survival analysis of beehive moth larvae, it was checked whether the survival of the worms was significantly improved when glyA was inhibited by SHIN1 following treatment with SMX and TMP. In addition, it was confirmed whether SHIN1 could actually exhibit as synergistic effect in the in vivo model as in the in vitro model.

Dosages of SMX, TMP, and SHIN1 adjusted for honeycomb moth larval weight were initially calculated according to the in vivo model dose calculation guidelines. All experimental worms weighed about 200 mg, corresponding to 200 μL in the total circulating volume. SMX, TMP, and SHIN1 were dissolved in DMSO and used, and the DMSO concentration range was 1 to 1.5% to limit the harmful effect of DMSO (cell lysis) on live worms.

10 μL of 5 x 10 ⁵ bacteria/worm was injected into the left leg of the worm. 3 hours after infection, 10 μL of the treatment was continuously injected. Negative controls were injected with PBS without infection. Samples were inoculated in a static incubator at 37°C. Mortality, health index records, and other parameters were checked every 6 hours until 72 hours.

11a and 11b, the knockout strains of glyA and metE improved the survival rate of worms, and the KO glyA strain had a higher worm survival rate. Treatment with SXT significantly improved the results of non-lethal worms at high concentrations of SXT. Within the group treated by adding SHIN1, the high-dose treatment SXT combined with SHIN1 showed the highest survival rate (80%) compared to the survival rate of 0% for WT and 100% for the negative control group. The USA300 WT-infected group had the fastest rate of death and the highest mortality rate (after 30 hours, all 10 worms/10 worms were killed). After 72 hours of observation, 100% mortality was observed in three groups: WT USA300, WT treated with low concentration SXT, and WT treated only with SHIN1. This supports that the synergistic effect of SMX + TMP is enhanced by adding SHIN1.

In addition, as shown in FIG. 11c , it was found that the recovered CFU was also significantly reduced in the treatment group compared to the WT.

As shown in Figure 11d, the health index was high concentration SXT (SMX of MIC 50 for USA300, TMP of MIC 50 for USA300) + SHIN 0.125 μg / mL when treated, compared to WT, the health index of infected worms It has actually been shown to improve. There was no lethal larvae in the negative control group, and the health index was maintained at 100 points until 72 hours of observation.

Example 14. Confirmation of synergistic effect of SXT by SHIN1 in multidrug-resistant Gram-negative bacteria

Multidrug-resistant bacteria are a problem due to the altered mechanism by which hospital-acquired infections, particularly gram-negative bacteria, become resistant. According to this problem, it was confirmed that the therapeutic agent SMX combined with TMP according to SHIN1 can exhibit an inhibitory effect on Gram-negative bacteria. In particular, the bacteria of the ESKAPE group showed very serious results. Acinetobacter baumannii (A.baumannii), one of the bacterial names of the ESKAPE group, is an essential pathogen that causes ICU admissions.

Based on the in vitro susceptibility test data and survival analysis results, the inhibitory effect on S. aureus USA300 was confirmed through the combination of SMX and TMP in terms of increasing the effect of the antibiotic by SHIN1. However, polymyxin B nonapeptide (PMBN) was added to improve the penetration of SXT and SHIN1 into Gram-negative in terms of cell membrane among the characteristics of resistant Gram-negative bacteria. The effect of SHIN1 was confirmed for A.baumannii CCARM KAB03 and A.baumannii CCARM 12165. As monotherapy, the MIC 50 of SMX against these strains was 1024 μg/mL and TMP 1024 μg/mL. In addition, PMBN alone could not produce an inhibitory effect on these strains, and the bacteria were fully grown at 512 μg/mL.

As shown in Figure 12a, SMX + TMP + SHIN1 (0.25 μg/mL) was added, confirming the reduced MIC of A. baumannii CCARM 12165.

In addition, as shown in Fig. 6b, compared to when only SMX + TMP was used without adding SHIN1, the fold change of the reduced MIC was calculated when SHIN1 was added. Interestingly, after the addition of SHIN1, the MIC of A. baumannii CCARM 12165 was reduced by 32-fold in TMP and 64-fold in SMX. However, this effect was not observed in A.baumannii CCRM KAB03. It may be because PMBN could not enhance penetration of SXT and SHIN1 due to resistance to Colistin.

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

Claims (15)

serine hydroxymethyl transferase (SHMT) protein activity inhibitors or gene expression inhibitors; and
A pharmaceutical composition for preventing or treating bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.
According to claim 1,
The SHMT protein activity inhibitor is a compound that specifically binds to the SHMT protein, a peptide, a peptidomimetic, a matrix analog, an aptamer and at least one selected from the group consisting of an antibody, a pharmaceutical composition for preventing or treating bacterial infection .
According to claim 1,
The MTHFR protein activity inhibitor is a compound that specifically binds to the MTHFR protein, a peptide, a peptidomimetic, a matrix analog, an aptamer and at least one selected from the group consisting of an antibody, a pharmaceutical composition for preventing or treating bacterial infection .
According to claim 1,
The SHMT gene expression inhibitor is an antisense nucleotide complementary to the mRNA of the SHMT gene, RNAi, siRNA, miRNA, shRNA, and ribozyme, characterized in that at least one selected from the group consisting of, bacterial infection prevention or treatment pharmaceutical composition .
According to claim 1,
The MTHFR gene expression inhibitor is an antisense nucleotide complementary to the mRNA of the MTHFR gene, RNAi, siRNA, miRNA, shRNA, and a pharmaceutical composition for the treatment of bacterial infection, characterized in that at least one selected from the group consisting of .
3. The method of claim 2,
The compound that specifically binds to the SHMT protein is SHIN1 (SHMT inhibitor 1), 6-Amino-4-isopropyl-3-methyl-4-(3-(pyrrolidin-1-yl)-5-(trifluoromethyl)phenyl) -1,4-dihydropyrano[2,3-c]pyrazole-5-carbonitrile, Zoloft, 6-amino-4-(5-(hydroxymethyl)-[1,1′-biphenyl]-3-yl )-4-isopropyl-3-methyl-1,4-dihydropyrano[2,3-c]pyrazole-5-carbonitrile, SEL302-01612, SEL302-00332, SEL302-00621, and 6-amino-4-[3- (hydroxymethyl)-5-(5-hydroxypent-1-yn-1-yl)phenyl]-3-methyl-4-(propan-2-yl)-1H,4H-pyrano[2,3-c]pyrazole- A pharmaceutical composition for preventing or treating bacterial infection, characterized in that at least one selected from the group consisting of 5-carbonitrile.
According to claim 1,
The bacteria include Staphylococcus aureus, Streptococcus ferus, Serratia marcescens, Vibrio parahaemolyticus, Streptococcus pneumoniae (Streptococcus). pneumonia), Staphylococcus saprophyticus, Campylobacter jejuni, Helicobactor pylori, Pseudomonas aeruginosa, Bacillus cereus, Bacillus cereus Enterococcus fecalis, Bacillus licheniformis, Staphylococcus epidermidis, Corynebacterium diphtheriae, Klebsiella pneumoniae, Klebsiella pneumoniae Listreia innocua, Burkholderia cepacia, Streptococcus parasanguinis, Salmonella typhimurium, Streptococcus sobrinus, Streptococcus sobrinus Streptococcus sanguinis, Streptococcus iniae, Streptococcus pyogene, Streptococcus mitis, Listeria monocytogenes (Listeria Ivanovii, Listeria monocytogenes) ), Streptococcus Suis (Streptococcus suis), Clostridium perfringens (Clostridium perfringens), Yersinia enterocolitica (Yersinia enterocolitica), Shigella boydii, Shigella flexneri (Shigella flexneri), Shigella cattle Nei (Shigella sonnei), Salmonella choleraesuis subsp), Salmonella enteritidis (Salmonella enteritidis), Salmonella bongori (Salmonella bongori), Salmonella enterica (Salmonella enterica), Mycobacterium tuber Mycobacterium tuberculosis), Mycobacterium leprae, Clostridium botulinum, Bacillus anthracis, Yersinia pestis, Chlamydia pneumonia , Borrelia burgdorferi, Coxiella burnetii, Mycobacterium avium, Escherichia coli, Borrelia sp., bar Tonella genus (Bartonella sp.), Chlamydia trachomatis (Chlamydia trachomatis), and Mycoplasma pneumoniae (Mycoplasma pneumonia) characterized in that at least one selected from the group consisting of, the composition.
According to claim 1,
The composition is characterized in that it is formulated or used in combination with an antibiotic, composition.
9. The method of claim 8,
The antibiotic is an antifolate, characterized in that the pharmaceutical composition.
9. The method of claim 8,
The antibiotic is pyrimethamine, trimetrexate, iclaprim, proguanil, cycloguanil, aminopterin (Aminoprterin), lometrexol ( Lometrexol), nolatrexed, brodimoprim, pralatrexate, piritrexim, 5'-S-methyl-5'-thioadenosine, methicillin , oxacillin, norfloxacin, vancomycin, amikacin, gentamicin, kanamycin, neomycin, netilmicin, toh Bramycin, Paromomycin, Streptomycin, Spectinomycin, Geldanamycin, Herbimycin, Rifaximin, Loracarbef ), Ertapenem, Doripenem, Imipenem/Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cefalothin, Cefalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir ), Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefepime, Ceftaroline fosamil, Ceftobiprole, Teicoplanin, Telavancin, Dalbavancin , Oritavancin, Clindamycin, Lincomycin, Deptomycin, Azithromycin, Clarithromycin, Dirithromycin , Erythromycin, Roxithromycin, Troleandomycin, Telithromycin, Spiramycin, Aztreonam, Furazolidone, Nitrofuran Nitrofurantoin, Linezolid, Posizolid, Radezolid, Torezolid, Amoxicillin, Ampicillin, Azlocillin , Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Nafcillin, Penicillin G , Penicillin V, Piperacillin, Temocillin, Ticarcillin, Amoxicillin/clavulanate, Ampicillin/sulbactam, Piperacillin Peracillin/tazobactam, Ticarcillin/clavulanate, Bacitracin in), Colistin, Polymyxin B, Ciprofloxacin, Inoxacin, Gatifloxacin, Gemifloxacin, Levofloxacin, Levofloxacin (Lomefloxacin), Moxifloxacin, Nalidixic acid, Ofloxacin, Trovafloxacin, Grepafloxacin, Spafloxacin, Sparfloxacin Floxacin, Mafenide, Sulfacetamide, Sulfadiazine, Silver sulfadiazine, Sulfadimethoxine, Sulfamethizole, Sulfamethizole Sulfamethoxazole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Trimethoprim-Sulfamethoxazole (Cotrimoxazole, TMP-SMX), Sulfonamidocri Sulfonamido chrysoidine, Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Clofazimine, Dapsone, Capsone Leomycin, Cycloserine, Ethambutol, Ethionamide, Isoniazid, Pyrazinamide, Rifampicin, Rifabutin, Rifabutin Rifapentine), Arsphenamine, chloramphenicol, fosfomycin, fusidi cacid, metronidazole, mupirocin, platensimicin, quinupristine/dalfopristin (Quinupristin / Dalfopristin), thiamphenicol (Thiamphenicol), tigecycline (Tigecycline), tinidazole (Tinidazole), and trimethoprim (Trimethoprim), characterized in that at least one selected from the group consisting of, the composition.
serine hydroxymethyl transferase (SHMT) protein activity inhibitors or gene expression inhibitors; and
A food composition for preventing or improving bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.
serine hydroxymethyl transferase (SHMT) protein activity inhibitors or gene expression inhibitors; and
A cosmetic composition for preventing or improving bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.
serine hydroxymethyl transferase (SHMT) protein activity inhibitors or gene expression inhibitors; and
A quasi-drug composition for preventing or improving bacterial infection comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.
serine hydroxymethyl transferase (SHMT) protein activity inhibitors or gene expression inhibitors; and
An antibacterial composition comprising at least one selected from the group consisting of MTHFR (Methylenetetrahydrofolate reductase) protein activity inhibitor or gene expression inhibitor as an active ingredient.
A screening method for preventing or treating a bacterial infection, comprising the steps of:
(a) SHMT protein or mRNA thereof; and treating cells expressing one or more selected from the group consisting of MTHFR protein or mRNA thereof with a test substance;
(b) the HMT protein or mRNA thereof in cells treated with the test substance and cells not treated with the test substance; and measuring the expression level of one or more selected from the group consisting of MTHFR protein or mRNA thereof; and
(c) a protein or mRNA thereof of said HMT compared to a control cell; and selecting a substance having a reduced expression level of one or more selected from the group consisting of MTHFR protein or mRNA thereof as a preventive or therapeutic agent for bacterial infection.

Images