KR20220064904A - Use for inhibiting angiogenesis by Bifenthrin - Google Patents

Abstract

The present invention relates to a use of bifenthrin for inhibiting angiogenesis and vascular cell proliferation, wherein bifenthrin has caused loss of embryogenesis and vascular development in zebrafish embryos through an inflammatory reaction. Also, bifenthrin has increased ROS accumulation and inflammatory genes including tnfa, il6, il8, and ptgs2b in the intestine, causing embryonic death. In addition, bifenthrin has inhibited angiogenesis by down-regulating a VEGF receptor in the embryo. Accordingly, bifenthrin can be used to develop a reagent composition for inhibiting angiogenesis.

Description

Use for inhibiting angiogenesis by Bifenthrin

The present invention relates to the use of Bifenthrin for inhibiting angiogenesis and inhibiting vascular cell proliferation.

Since cells receive oxygen and nutrients from blood vessels to produce energy and maintain survival and proliferation, the formation of angiogenesis is very accelerated in benign and malignant tumor lesions that are excessively uncontrolled in cell proliferation. Therefore, studies are underway to discover the vascular inhibitory effects of various effective active substances and introduce them into tumor treatment. Factors mediating blood vessel formation in the body include VEGFA, VEGFB, VEGFC and their receptors VEGFR1, VEGFR2, VEGFR3, and the like, and mainly VEGFA binds to VEGFR2 to induce survival, proliferation, and migration of vascular endothelial cells. Therefore, when the expression level of VEGFA in the body decreases, the signal transduction of angiogenesis to vascular endothelial cells is weakened, and intracellular energy production is reduced, thereby reducing vascular proliferation. On the other hand, VEGFC and VEGFD promote the Wnt signaling pathway that binds to VEGFR3 and induces the formation of lymph nodes and blood vessels.

Bifenthrin is one of the pyrethroid insecticides, and is synthesized naturally in Chrysanthemum cinerariaefolium. The mechanism of action of bifenthrin is known to interfere with channel opening and reduction of sodium ion channels leading to neuronal dysfunction. Due to this mechanism, bifenthrin may induce neurotoxicity in the mammalian brain. Recently, studies on the toxicity of bifenthrin in vertebrates have been actively conducted, and the antiestrogenic effect of bifenthrin has been confirmed in fish embryos.

However, the effect of bifenthrin on embryonic development or organogenesis has hardly been studied, and the present inventors completed the present invention by studying the antiangiogenic effect of bifenthrin.

Korea Patent Publication No. 10-2016-0093685 (published on August 8, 2016)

It is an object of the present invention to provide a reagent composition for inhibiting angiogenesis containing Bifenthrin as an active ingredient.

Another object of the present invention is to provide a method for inhibiting angiogenesis, comprising the step of treating cells with bifenthrin in vitro.

The present invention provides a reagent composition for inhibiting angiogenesis containing Bifenthrin as an active ingredient.

In addition, the present invention provides a method for inhibiting angiogenesis, comprising the step of treating cells with bifenthrin in vitro.

The present invention relates to the use of bifenthrin to inhibit angiogenesis and to inhibit vascular cell proliferation, wherein bifenthrin causes loss of embryogenesis and vascular development in zebrafish embryos through an inflammatory response. Bifenthrin increased ROS accumulation in the intestine and inflammatory genes including tnfa, il6, il8 and ptgs2b, leading to embryonic death. In addition, bifenthrin inhibited angiogenesis by down-regulating the VEGF receptor in embryos. Accordingly, bifenthrin can be utilized to develop a reagent composition for inhibiting angiogenesis.

1 shows the morphology of a zebrafish embryo treated with bifenthrin. The dotted borders in Figure 1A indicate the respective regions of the eye, heart and yolk sac. The graphs of FIGS. 1B, 1C, 1D, 1E, and 1F show the area of the whole body, eye, heart, liver and yolk sac, respectively. Asterisks indicate significant data ( ^** P<0.01 and ^*** P<0.001), and scale bars indicate 1 mm.
Figure 2 shows the mRNA expression of the cell cycle regulatory gene. 2A to 2D show the detection of mRNA expression of ccnd1, ccne1, cdk2 and cdk6 by real-time quantitative PCR. Three replicates were performed for each sample, and the transcription level was analyzed with the SAS program. Asterisks indicate the significance of each data ( ^* P < 0.05, ^** P < 0.01 and ^*** P < 0.001).
3 shows the toxicity of bifenthrin in zebrafish embryos. Figure 2A shows the survival rate compared to the control group after treatment with bifenthrin in zebrafish embryos. Figure 2B shows the heart rate (counts/min) compared to the control group after treatment with bifenthrin in zebrafish embryos. Figure 2C shows the number of self-hatched embryos compared to the control group after treatment with bifenthrin in zebrafish embryos. FIG. 2D shows the results of detecting ROS generation under an upright fluorescence microscope using DCFH-DA after treatment with bifenthrin in zebrafish embryos. The intensity of fluorescence was measured using the image j program. Asterisks indicate the significance of each data ( ^* P < 0.05, ^** P < 0.01 and ^*** P < 0.001), and scale bars indicate 500 μm.
4 shows the inflammatory response-inducing effect of bifenthrin in zebrafish embryos. 4A to 4D show that RNA was extracted from zebrafish embryos after bifentri treatment, and mRNA expression of tnf-a, il6, il8 and ptgs2b was detected by real-time quantitative PCR. Three replicates were performed for each sample, and the transcription level was analyzed with the SAS program. Figure 4E shows that the zebrafish single cell suspension was stained with Annexin V and PI, and cell death by bifentri was confirmed by flow cytometry. The upper left of the quadrant shows the percentage of necrotic cells, and the upper right shows the percentage of apoptotic cells. Asterisks indicate the significance of each data ( ^* P < 0.05, ^** P < 0.01 and ^*** P < 0.001).
5 shows the antiangiogenic effect of bifenthrin on zebrafish embryos. 5A shows the detection of vascular morphology in the trunk region using transgenic fli:eGFP zebrafish embryos (n=10). Figure 5B shows the confirmation of mRNA expression levels of vegfaa, kdr, flt1 and flt4 by real-time qPCR in embryos. Asterisks indicate the significance of each data ( ^* P < 0.05, ^** P < 0.01 and ^*** P < 0.001), the scale bar at 5x represents 500 μm and the scale bar at 20× represents 125 μm.
6 shows the antiangiogenic effect of bifenthrin on HUVECs. Figure 6A will confirm the cell viability of HUVECs upon treatment with Bifenthrin using MTT analysis, and Figure 6B will confirm apoptosis according to treatment with Bifenthrin. The number of late apoptotic cells was expressed compared to the HUVEC control group (100%) not treated with bifenthrin. Figure 6C confirms the tube formation of HUVECs when treated with bifenthrin using a matrigel-coated plate. The tube formation rate showed the relative number of polygons compared to the HUVEC control that was not treated with bifenthrin. Asterisks indicate the significance of each data ( ^* P < 0.05, ^** P < 0.01 and ^*** P < 0.001), and the scale bar indicates 500 μm.
7 is a schematic diagram showing the developmental toxicity, inflammatory response and anti-angiogenic effects of bifenthrin. Bifenthrin disrupts normal organogenesis by down-regulating cell cycle genes. Bifenthrin may cause embryo death due to oxidative stress and an inflammatory response that induces apoptosis and necrosis of zebrafish embryos. In addition, bifenthrin can inhibit heart rate and blood vessel formation in vivo and in vitro. That is, bifenthrin inhibits organogenesis and angiogenesis as an inflammatory response during zebrafish embryogenesis.

Hereinafter, the present invention will be described in more detail.

The present inventors completed the present invention to inhibit angiogenesis by confirming the effect of Bifenthrin on inflammatory response, apoptosis and angiogenesis in vitro and in vivo.

The present invention provides a reagent composition for inhibiting angiogenesis containing Bifenthrin as an active ingredient.

Bifenthrin may be represented by the following formula.

The inhibition of angiogenesis may be performed in vitro, but is not limited thereto.

The inhibition of angiogenesis may be performed in cells or embryos, but is not limited thereto. The cell may be, for example, a vascular endothelial cell.

The bifenthrin may promote generation of reactive oxygen species and an inflammatory response.

The bifenthrin may increase the expression of one or more selected from the group consisting of tnf-a, il 6, il8 and ptgs2.

The bifenthrin may increase the expression of vegfaa. The bifenthrin may decrease the expression of one or more selected from the group consisting of kdr, flt1 and flt4.

The bifenthrin may promote apoptosis.

In addition, the present invention provides a method for inhibiting angiogenesis, comprising the step of treating cells with bifenthrin in vitro.

Preferably, the method down-regulates the VEGF receptor and may promote apoptosis, but is not limited thereto.

Preferably, the cell may be a human umbilical vein endothelial cell (HUVEC), but is not limited thereto.

Hereinafter, examples will be described in detail to help the understanding of the present invention. However, the following examples are merely illustrative of the content of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

<Experimental example>

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

1. Zebrafish model and experimental method

Wild-type zebrafish (Danio rerio) was obtained from the Zebrafish Center for Disease Modeling (KNRRC, Chungnam National University, Korea), and the transgenic fli:eGFP zebrafish was obtained from the Zebrafish Organogenesis Mutant Bank: ZOMB, Kyungpook National University, Korea). All zebrafish were maintained at 28.5°C in a 12-hour dark cycle and a 12-hour photoperiod.

In a 24-well plate, 6hpf zebrafish embryos were treated with bifenthrin (Cat No. N-11203, Chem Service, USA) and cultured for 48 hours. Viability and shape were confirmed with LEICA DM 2500 (Leica, Germany). The survival rate and hatching rate were measured daily, and compared with the results of the vehicle treatment group, it was shown as a graph. In addition, fluorescence of bifenthrin-treated fil:eGFP zebrafish embryos was detected with an upright fluorescence microscope (Zeiss Axio Imager, MI, ZEISSA, Germany). For all microscopic detection, embryos were anesthetized with tricaine methane sulfonate (MS-222, Sigma-Aldrich, USA) and fixed on slides with 3% methylcellulose. All zebrafish images were analyzed with Image J software (NIH, USA).

2. Analysis of ROS Generation in Zebrafish

The generation of intracellular reactive oxygen species (ROS) was visualized using dichloro-dihydro-fluorescein diacetate (DCFH-DA). Zebrafish embryos were treated with bifenthrin for 48 hours and further incubated for 1 hour in the dark state in embryo medium containing 30 μM DCFH-DA. Then, after washing with 1x embryo medium, the green fluorescence signal of oxidized DCFH-DA (DCF) was detected using an upright fluorescence microscope (Zeiss Axio Imager, MI, ZEISSA, Germany). Fluorescence intensity was measured using the 'RawIntDen' package of Image J software (NIH, USA), and compared with the vehicle-treated control group (100%), and graphed.

3. Annexin V Flow Cytometry in Zebrafish Single Cell Suspensions

After zebrafish embryos were treated with bifenthrin for 48 hours, zebrafish embryos were collected in each EP tube. Cells were detached by adding 0.25% trypsin-EDTA and collagenase mixture to the EP tube, followed by neutralization by adding DMEM-10% FBS medium. The cell suspension was spun and the pellet was washed with 1 ml of 1x PBS and filtered through a 70 μm mesh. 1 ml of the collected cells were stained with 5 μl of FITC Annexin V and PI for 15 minutes under dark conditions. Single cells were detected with an Accuri C6 Plus (BD Biosciences).

4. Real-time quantitative RT-PCR analysis

cDNA was synthesized using RNA extracted from zebrafish embryos, random hexamers, oligo primers, and AccuPower RT PreMix (Bioneer, Daejeon, Korea). Quantitative real-time PCR was performed using a StepOnePlus™ real-time PCR system (Applied Biosystems, Foster City, CA, USA) and SYBR ^® Green (Sigma). The primers listed in Table 1 were used and the expression of each gene was detected with a standard curve and CT value. PCR conditions were repeated 40 cycles of 3 minutes at 95°C, followed by 30 seconds at 95°C, 30 seconds at 60°C, and 30 seconds at 72°C. The experiment was repeated 3 times and normalized to gapdh. Relative expression levels of genes were quantified by the 2 ^{- ΔΔCT} method.

Gene GenBank no. Forward (5′→ 3′) Reverse(5′→ 3′) ccnd1 NM_131025.4 CCAGAACCTCACCAACTTCC TGGTCTCTGTGGAGATGTGC ccne1 NM_130995.1 CGCAGTATGCATCAGAAAGC TCCATAACGCGTGTATCTCG cdk2 NM_213406.1 GATCGGAGGGGAACATACG GCAGAGAGATCTCACGAATGG cdk6 NM_001144053.1 GGTGCAGACTGAGGAAGAGG TCCTGGAAACTGTGCATACG tnfa AY427649.1 CTGCTTCACGCTCCATAAGA GCCTGGTCCTGGTCATCTC il6 JN698962.1 GGTGAGAGACGGAGAGATGGAT CACGCTGGAGAAGTTGAACAG il8 XM_001342570.3 TGGCATTTCTGACCATCATTG TCTTCTTAACCCATGGAGCA ptgs2b NM_001025504.2 GGCTCATCCTTATTGGTGAGACTAT TCGGGATCAAACTTGAGCTTAAAATA vegfaa AF016244.1 ATTCATACCCAGCAGCTTCG GCAGACAGATGGAGGAGAGC kdr NM_001024653.2 CTTGGCAGCCAGAAATATCC GACGAGCATCTCCTTTACGG flt1 139515.1 BC CTGGTTATTCGGGATGTTGC TTTGGGGCTTCACATTTACC flt4 AY833404.1 TCACAACTGGATGGATTTGG GCCGACAGTCTTTTCTTTGC gapdh BC014175.2 TTTGCTTCAGGGTTTCATCC ACACTCGCTCAGCTTCTTGG

5. Vascular Endothelial Cell Culture

Human umbilical vein endothelial cell line (HUVEC) was purchased from Lonza Life Sciences. Cells were cultured at 37° C. and 5% CO ² using EGM™ BulletKit™ medium (Lonza, Basel, Switzerland), and the medium was replaced every 24 hours until the cells were 70% full in tissue culture dishes. Then, cells were detached with 0.25% trypsin-EDTA, neutralized with Trypsin Neutralizing Solution/1 TNS, and seeded into each culture dish.

6. Cell Viability (MTT) Analysis

Cell viability was measured with an MTT assay kit (Cat No. 114650007001, Roche, IN, USA) according to the manufacturer's instructions. HUVEC cells were seeded in 96-well plates and treated with 0, 1, 5, 10, 15 and 30 μM of bifenthrin for 48 hours. 10 μl of MTT labeling reagent was treated and incubated at 37° C. for up to 4 hours. 100 μl of solubilization buffer was added and incubated at 37° C. for an additional 16 hours. Absorbance was measured at 560 nm and 680 nm using a SPECTRO star Nano (BMG LABTECH, Thermo Fisher Scientific, USA).

7. Matrigel Angiogenesis Assay

96-well plates were coated with 75 μl of Matrigel at room temperature and incubated at 37° C. for an additional 30 minutes. 75 μl of 2X Bifenthrin Treatment Mixture was added to cure the matrix. 75 μl of 5.0 x 10 ⁵ HUVEC cells/ml were seeded into each 96-well, and incubated at 37° C., 5% CO ² for 12 to 16 hours. The medium was removed and tube formation of HUVECs was detected in each well using a LEICA DM 2500 (Leica, Germany). The number of polygons in each image was calculated and compared with the vehicle-treated group and expressed as a relative value (%).

8. Annexin V and PI Staining by Flow Cytometry

HUVEC cells were treated with bifenthrin and apoptosis was detected using FITC Annexin V Apoptosis Detection Kit I (BD Biosciences). 5.0 x 10 ⁵ cells were seeded in 6-well plates, treated with bifenthrin, and incubated in a 37° C. CO ² incubator for 48 hours. The supernatant and detached cells were collected, washed with 1x PBS and resuspended in 100 μl of 1x Annexin V binding buffer. Cells were stained with 5 μl of FITC Annexin V and PI for 15 minutes in the dark. Fluorescence of the stained cells was detected with a FACSCalibur (BD Biosciences).

9. Statistical Analysis

Analysis of variance (ANOVA) was performed on the data according to the general linear model (PROC-GLM) of the SAS program (SAS Institute, Cary, NC, USA) to confirm whether there was a significant difference according to the bifenthrin treatment. Differences with probability values of P<0.05 were considered statistically significant. Data are expressed as mean ± SEM.

<Example>

One. to bifenthrin abnormal development of the embryo

After zebrafish embryos were treated with 0, 15, and 30 μM of bifenthrin in a concentration-dependent manner and cultured for 48 hours, the degree of development was confirmed.

1A is the result of observing the pathological characteristics and deformation/transformation according to bifenthrin treatment in various organs including eyes, heart, liver, and yolk sac. 1B, 1C, 1D and 1E , Bifenthrin did not affect the entire embryonic body surface, but induced malformations of the eyes and edema of the pericardium and liver. . However, as shown in Fig. 1F, the yolk sac was hardly reduced upon treatment with Bifenthrin.

As shown in Figure 1A, 30 μM of bifenthrin induced intestinal damage in the abdominal yolk sac with a frequency of 11.7%. Bifenthrin has been shown to cause developmental abnormalities. Therefore, when bifenthrin was treated in whole embryonic bodies, the expression of cell cycle regulatory genes was confirmed. Referring to FIG. 2 , cell cycle regulators, including cyclin D1 (cyclin D1: ccnd1), ccne1, cyclin-dependent kinase 2: cdk2, and cdk4, were reduced by treatment with 30 μM of bifenthrin. That is, it can be seen that bifenthrin induced abnormal organogenesis in normal zebrafish embryos through inhibition of cell cycle progression during embryonic development.

2. Bifenthrin-induced reactive oxygen species generation and inflammatory response

The effect of bifenthrin on the survival rate of zebrafish embryos was confirmed. As shown in FIG. 3A , when 30 μM of bifenthrin was treated, the survival rate was reduced to 61% compared to the vehicle-treated embryos. Referring to FIGS. 3B and 3C , the heart rate and hatching rate were reduced to 70% and 43%, respectively. Since embryos are dynamically moving and hatching, the rate of hatching also decreases when the heart rate decreases and movement decreases. According to FIG. 3D , when bifenthrin was treated, the production of active oxygen was increased especially in the liver and intestine.

The relationship between the expression of inflammation-related genes and the inflammation induced by peroxide during bifenthrin treatment was confirmed. 4A to 4D , bifenthrin is a tumor necrosis factor a (tnf-a), interleukin 6 (interleukin 6: il 6), interleukin 8 (interleukin 8: il8) and prostaglandin- The mRNA expression of inflammatory cytokines and enzymes including endoperoxide synthase (prostaglandin-endoperoxide synthase 2b: ptgs2; cox2b) was significantly increased. In addition, as shown in FIG. 4E, from the induction of apoptosis according to necrotic and apoptosis by bifenthrin at the single cell level, it was confirmed that the peroxide-related inflammatory response increases the embryonic lethality. That is, bifenthrin can cause embryonic damage and death through an inflammatory reaction caused by a peroxidative environment.

3. Inhibition of Angiogenesis in Embryos by Bifenthrin

As shown in Fig. 1D, cardiac edema was observed as an important pathological feature caused by bifenthrin. Therefore, it was expected that bifenthrin-induced cardiotoxicity would affect cardiovascular development.

Transgenic fli:eGFP zebrafish were treated with bifenthrin and angiogenesis was observed during embryonic development. Referring to FIG. 5A , in zebrafish embryos treated with bifenthrin, green fluorescence indicating blood vessels in the dorsal part of trunk blood vessels was discontinuous and weakly detected. That is, bifenthrin interfered with embryonic vascular development in zebrafish embryos.

The mRNA expression level of pro-angiogenetic genes was confirmed. 5B to 5E , when bifenthrin treatment, mRNA expression of vascular endothelial growth factor Aa (vegfaa) increased, whereas vascular endothelial growth factor receptor 2 precursor: kdr), vascular endothelial growth factor receptor 1 precursor (flt1), and vascular endothelial growth factor receptor (vascular endothelial growth factor receptor 3: flt4) mRNA expression was decreased. These results suggest that bifenthrin inhibits vascular development by down-regulating the VEGF receptor in zebrafish embryos.

4. Confirmation of anti-angiogenic effect in human umbilical vein endothelial cells by bifenthrin

In order to confirm the anti-angiogenic efficacy of bifenthrin, human umbilical vein endothelial cells (HUVEC) were treated with bifenthrin. Referring to FIG. 6A , bifenthrin concentration-dependently decreased cell viability, and when treated with 30 μM bifenthrin, cell viability decreased to 33%. Also, referring to FIG. 6 , when HUVECs were treated with bifenthrin, apoptosis was increased to 485%.

In addition, in order to confirm the angiogenic function of HUVECs, a Matrigel-based angiogenesis assay was performed. As shown in FIG. 6C , tube formation of HUVECs, expressed by the number of polygons, decreased upon treatment with bifenthrin. These results indicate that bifenthrin induces apoptosis and inhibits the angiogenic function of endothelial cells.

Taken together, bifenthrin may induce an inflammatory response, leading to loss of embryogenesis and vascular development. Bifenthrin increased ROS accumulation in the intestine and inflammatory genes including tnf-a, il6, il8 and ptgs2b, leading to embryonic death. In addition, bifenthrin inhibited angiogenesis by down-regulating the VEGF receptor in embryos. Bifenthrin can reduce cell viability of HUVECs and inhibit angiogenesis.

Claims (6)

A reagent composition for inhibiting blood vessel formation containing Bifenthrin as an active ingredient. The reagent composition of claim 1, wherein the composition down-regulates the VEGF receptor. The reagent composition according to claim 1, wherein the composition promotes apoptosis. A method for inhibiting angiogenesis, comprising the step of treating cells with bifenthrin in vitro. The method of claim 4, wherein the method down-regulates the VEGF receptor and promotes apoptosis. The method of claim 4 or 5, wherein the cell is a human umbilical vein endothelial cell (HUVEC).

Images