KR20220061686A - Tumor-specific CRISPR/Cas9 delivery of HCV/E1E2 envelope glycoproteins-pseudotyped lentivirus to tumor and its use as antitumor therapeutics - Google Patents

Abstract

The present invention relates to a Clustered Regulated Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system carrier consisting of lentiviral vectors pseudotyped with envelope glycoprotein derived from Hepatitis C virus (HCV) capable of being expressed in cancer tissue, and to the use thereof as an anticancer therapeutic agent. The CRISPR/Cas9 system transporter includes a lentivirus vector containing a transgene. The lentivirus having no cancer targeting function is given a cancer targeting function, and the gene encoding KSP is edited to induce cell cycle arrest in mitosis, thereby suppressing tumor growth.

Description

CRISPR/Cas9 delivery using cancer-targeting cancer-targeting lentivirus pseudotyped with HCV/E1E2 envelope glycoprotein and its use as an anticancer agent {Tumor-specific CRISPR/Cas9 delivery of HCV/E1E2 envelope glycoproteins-pseudotyped lentivirus to tumor and its use as antitumor therapeutics}

The present invention relates to CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) consisting of lentiviral vectors that are pseudotyped with E1E2 envelope glycoproteins derived from HCV (Hepatitis C virus) that can be expressed in cancer tissues. )/Cas9 system transporter and its use as an anticancer agent. Specifically, the present invention provides a guide RNA sequence (gKSP) capable of gene editing by specifically recognizing a gene encoding KSP (kinesin spindle protein) with a CRISPR/Cas9 system and Streptococcus pyogenes -derived Cas9 Provided is a CRISPR/Cas9 system delivery system comprising a lentiviral vector including a transgene expressing an endonuclease. The lentiviral vector of the CRISPR/Cas9 system delivery system according to the present invention was pseudotyped with an E1E2 envelope glycoprotein that selectively binds to CD81 and Claudin-1 membrane proteins overexpressed in specific cancer tissues, thereby originally having a cancer-targeting function. The cancer-targeting function is conferred to a lentivirus that does not have this, and Cas9 and gKSP are expressed in specific cancer tissues, thereby genetically editing the gene encoding KSP and consequently inducing cell cycle arrest in mitosis. It can inhibit cancer, ie, tumor growth.

Cells with damaged genes or genomes cause problems in living or functioning of living things or organs of living things. DNA double-strand break is one of the most serious damages at the cellular level. Damaged DNA is repaired by nonhomologous end joining and homologous recombination, but unrepaired DNA is damaged or rearranged in genetic information. It can cause cell death, that is, apoptosis (apoptosis) can be induced. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas is an RNA-guided gene editing tool that uses a bacterial-induced endonuclease Cas and guide RNA (gRNA) to match the sequence between the guide RNA and genomic DNA. Double (or single) strand breaks can be introduced at specific locations in the genome. CRISPR/Cas-mediated gene knockout is expected to be more efficient than RNA interference-mediated gene knockdown and provides a useful experimental tool for studying gene function.

Studies have been reported that the CRISPR-Cas9 system can work in mammalian cells, and gene editing technology derived from the adaptive immunity of microorganisms includes Cas and guide RNA. Guide RNA includes crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA). It binds to Cas9 and guides it to a desired genomic sequence through base pair binding to the target sequence, resulting in double strand break (DSB). this is created The only criterion for defining the target sequence is the existence of a protospacer adjacent motif (PAM), which has a different sequence depending on the Cas protein that recognizes it. For example, Cas9 from Streptococcus pyogenes is 5'-NGG-3' (N is one of A, T, G, C); Cas9 from Streptococcus thermophilus is 5'-NNAGAAW-3'; Cas9 derived from Campylobacter jejuni is known as 5'-NNNNRYAC-3', and since the sequence is arranged at regular intervals on the human genome, it can be utilized for gene editing.

On the other hand, it has been reported that the CRISPR/Cas system can be applied to human cancer treatment (Oncotarget. 2016 Mar 15;7(11):12305-17). This suggests that modifying or excising one or more portions of the genome may increase the likelihood of providing a powerful treatment for cancer, based on multiple genetic mutations correlated with cancer induction.

Currently, diseases that can be treated using CRISPR/Cas include blood cancer including leukemia and lymphoma. In order to treat these diseases, CAR-T (Chimeric Using ex vivo gene editing that combines antigen receptor-T) and programmed cell death protein 1 (PD-1) immunotherapy (SciencseNews, AUGUST 14, 2019). The University of Pennsylvania has conducted a clinical trial on at least two patients, but the final results have not been reported and it is still in the proof-of-principle stage. Examples of second other diseases include blood disorders including beta thalassemia and sickle cell disease (SCD). CRISPR Therapeutics and Vertex Pharmaceuticals have clinically tested ex vivo CRISPR-based therapy in at least one patient with beta thalassemia and verified that the gene-edited cells work successfully in the body. Another example of a third disease is Leber Congenital Amaurosis (LCA), a hereditary blindness disease found in children. Adeno-associated virus) was directly injected into the patient's eye to verify that the photoreceptor gene could be edited.

However, gene editing using the CRISPR/Cas system has a problem in that it is difficult to deliver it to target cells in the body. We are faced with the limitation of relying on the method of re-injecting the gene-edited cells into the body after editing. For cancer treatment, the CRISPR/Cas system needs to be delivered to the cancer tissue through body injection, but it is impossible with the current level of technology. Direct injection of the CRISPR/Cas system into the patient's eye for LCA eye disease is possible because it avoids the complex biological environment expected from in vivo injection, and will only be possible in very exceptional diseases. Therefore, the problem of lack of cancer targeting that prevents such injection into the body is slowing the development of anticancer drugs using CRISPR/Cas.

Conventional efforts to improve cancer targeting can be divided into non-viral vectors and viral vectors. Development of a delivery system using a non-viral vector is a protein or mRNA through complex formation of Cas9 and gRNA with nanoparticles or complex formation with cationic peptides. was delivered in the form (Genome Research, 2017, 24, 1020; Angew, ChEM. Int. ED. Engl. 2017, 56, 1059). However, these non-viral vectors have limitations in that they cause a problem of endosomal entrapment of Cas9 and gRNA and that the efficiency of delivery to the nucleus is very low. In spite of advantages such as low immunity and low integration mutagenesis, in reality, due to problems such as low gene editing efficiency and low target cell targeting efficiency that occur when injected into the body, these non-viral vector methods are used for in vitro gene It is being used as an editing method.

As one of the gene editing efforts using a viral vector, there are studies using the tissue specificity of a specific AAV, but these viruses also showed a wide biodistribution in an in vivo model. For example, AAV4 showed simultaneous accumulation in the lungs, heart and kidneys when injected into the body, and AAV6 showed simultaneous accumulation in the heart, liver and muscle. As another effort to use a viral vector, a hepatocellular carcinoma clinical trial was conducted using a vesicular stomatitis virus capable of expressing INF-beta, but due to the lack of cancer cell targeting, it A limited method of direct injection had to be adopted, and as a result, gene editing in unwanted cells could not be avoided due to broad tropism (clinicaltrials.gov, 2012, Trial ID: NCT01628640). In addition, VSV (Vesicular stomatitis virus) vectors are known to have neurotropism that causes viral encephalitis, and because they are inactivated by human serum complement, the therapeutic effect in clinical practice is very poor. has a

On the other hand, as an effort to assign a target to a lentiviral vector, studies have been conducted to acquire target by pseudotyping various retrovirus-derived envelopes (Nat Biotechnol. 2008 Mar; 26(3): 326-34. ). Envelope-enclosed lentiviruses derived from other retroviruses can selectively deliver transgenes to specific cells as they acquire cellular targeting specific to each envelope. For example, lentiviruses surrounded by an envelope of Murine leukemia virus, Chandipura virus, or Human Immunodeficiency Virus (HIV) contain hematopoietic cells (hematopoietic cells) and fibroblasts ( fibroblasts), neuronal cells, T cells, or monocytes are known to deliver transgenes (Human Gene THERAPY: Methods, 2007, 28, 291). Such cell targeting is possible by the interaction between the glycoprotein anchored in the envelope and the cell surface membrane receptor that recognizes it, for example, gp70/mCAT-1, (unknown)/CNV-G, or gp160/CD4. . However, no envelope-specific lentiviruses are known yet.

On the other hand, it is known that the lentiviral vector is advantageous for human application of the CRISPR/Cas system due to some differentiation from other retroviruses (Human Gene THERAPY: Methods, 2007, 28, 291). Lentivirus can deliver genes not only in dividing cells but also in non-dividing cells, and is known to have low immunogenicity, high loading efficiency, and stability in the human body. However, the cancer cell target deficiency problem still remains to be solved for the human application of the lentiviral vector.

Since the discovery of paclitaxel, which targets mitotic spindle assembly, kinesin spindle protein (KSP) has received much attention as a potential anticancer drug (Nat. Rev. Cancer 2012, 12, 527). Inhibition of expression of motor kinesin causes mitotic defects and eventually induces apoptosis. It is known that KSP is involved in the formation of a bipolar spindle assembly during mitosis, and when the function of KSP is abnormal, mitotic abnormality is induced and cell cycle arrest appears.

Numerous low-molecular-weight compounds that can inhibit KSP function have been studied as cancer treatments, but none have been developed as effective treatments so far. This traditional anticancer drug development process is focused on inhibiting the function of the KSP protein without affecting the KSP gene. Since mitosis is a highly precisely regulated life phenomenon, cell division can only occur successfully when various proteins precisely perform their functions. It absolutely requires cell selectivity that does not cause knock-out and should only occur in cancer tissues.

To design a carrier capable of expressing Cas9 and guide RNA in Huh7 liver cancer tumor tissue in vivo based on lentivirus, a targeting technology capable of selectively delivering lentivirus to tumor is required. This targeting technique should not damage the lentivirus capsid assembly as well as the viral genome packaging, and the pseudotyped tumor recognition glycoprotein should not be affected by the tumor recognition mechanism due to the lentivirus.

Accordingly, the present inventors have developed a lentiviral vector including a guide RNA sequence (gKSP) capable of specifically recognizing a gene encoding KSP and capable of gene editing and a transgene expressing Streptococcus pyogenes Cas9 endonuclease. A viral transporter pseudotyped with the E1E2 envelope glycoprotein derived from HCV was developed. The viral carrier is an E1E2 envelope glycoprotein that selectively binds to CD81 and Claudin-1 membrane proteins that are overexpressed in specific cancer tissues. Accordingly, Cas9 and gKSP are expressed in specific cancer tissues, and by gene editing the KSP gene, as a result, it is possible to induce cell cycle arrest in mitosis to inhibit cancer growth. It is expected to solve the limitations in the application of anticancer drugs due to the delivery function.

One object of the present invention is to provide a CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoproteins.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer, comprising, as an active ingredient, a CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein.

Another object of the present invention is a CRISPR / Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein; to provide a treatment method for

Another object of the present invention is to provide a composition for inhibiting cancer tumor growth, comprising, as an active ingredient, a CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein.

Another object of the present invention is a CRISPR / Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein; To provide a method for inhibiting tumor growth.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present application fall within the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.

One aspect of the present invention for solving the above object provides a CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoproteins.

As used herein, the term "E1E2 envelope glycoproteins" refers to highly glycosylated surface proteins E1 and E2 of Hepatitis C virus (HCV), which are enveloped positive strand RNA viruses. The E1 and E2 form a protein complex, and is called E1E2.

In the present invention, the E1E2 envelope glycoprotein may be derived from HCV (Hepatitis C virus), but is not limited thereto.

As used herein, the term "pseudotyping/pseudotyped" refers to the process of producing a virus or viral vector together with a foreign viral envelope protein, and as a result, a similar type of virus particle, also called a pseudovirus, is produced. This method can use foreign viral envelope proteins to alter host tropism or increase or decrease the stability of viral particles. In addition, pseudotyping can be used to control the expression of envelope proteins. Envelope proteins integrated into pseudoviruses allow the virus to readily enter other cell types along with its host receptors.

A protein frequently used for pseudotyping is glycoprotein G (VSVg) of vesicular stomatitis virus (VSV), which mediates entry through the LDL receptor. However, in the conventional lentivirus-based Cas9 and guide RNA expression system pseudotyped with VSVg, the lentivirus did not selectively infect the tumor, and as a result, the intratumoral expression efficiency of Cas9 and guide RNA was very low, and the efficiency in vivo This had untested limitations.

On the other hand, the lentiviral vector according to the present invention may be pseudotyped with E1E2 envelope glycoprotein derived from HCV. Due to the pseudotyping, the surface of the lentiviral vector is surrounded by the HCV-derived E1E2 envelope glycoprotein, and the E1E2 envelope glycoprotein shows strong affinity and selective binding to CD81 and Claudin-1 membrane receptors of Huh7 hepatocarcinoma cells and selective binding force. By remarkably improving the tumor non-specific delivery effect of the conventional lentiviral vector, which has been limited in its application as an anticancer drug, it is possible to edit the gene by the CRISPR/Cas9 system specifically for Huh7 liver cancer tissue. That is, the CRISPR/Cas9 system delivery system including the lentiviral vector may specifically deliver the CRISPR/Cas9 system to Huh7 liver cancer tissue, but is not limited thereto.

As used herein, the term “CRISPR/Cas9 system” is a technology that is actively used worldwide to knock out a cell gene with the most recently developed third-generation gene scissors. The CRISPR/Cas9 system consists of a guide RNA (gRNA) and a Cas9 endonuclease, and when the gRNA introduced into the cell binds to the site to be knocked out on the genomic DNA, the Cas9 endonuclease recognizes this and cuts the genomic DNA site. gene can be knocked out. In the present invention, the guide RNA may be KSP (kinesin spindle protein) specific (pKSP), and the Cas9 may be derived from Streptococcus pyogenes .

In the present invention, the lentiviral vector comprises: i) a DNA plasmid comprising a KSP (kinesin spindle protein)-specific guide RNA and a Cas9-encoding transgene as a CRISPR/Cas9 system; and ii) an expression DNA plasmid comprising a gene encoding an E1E2 envelope glycoprotein derived from HCV, and further comprising a packaging DNA plasmid comprising gag and pol genes for lentiviral nucleation. may be, but is not limited thereto.

The KSP-specific guide RNA is not particularly limited as long as it is KSP-specific and includes a KSP target sequence, but may include any one or more sequences selected from the group consisting of SEQ ID NOs: 1 to 3.

The CRISPR/Cas9 system may be one that gene-edits a gene encoding KSP, wherein the gene-edited KSP induces cell cycle arrest in mitosis to induce cancer growth (ie, cancer tumor growth). ), but is not limited thereto.

The lentiviral vector pseudotyped with the E1E2 envelope glycoprotein according to the present invention has high stability against human serum complement, especially compared to the lentiviral vector pseudotyped with VSVg derived from VSV, which has been most used for pseudotyping conventional lentiviruses. And very low transfection efficiency for dendritic cells (FIG. 6) suggested the superiority of HCV/E1E2-pseudotyping in cancer treatment. In particular, as shown by the FACS dot distribution at the bottom of Fig. 6d, the VSVg-LV/GFP lentiviral vector showed high transfection efficiency in mature DCs, whereas the E1E2-LV/GFP lentiviral vector showed very poor transfection efficiency.

These results imply that the E1E2-LV/GFP lentiviral vector had a very low transfection rate for DCs due to its narrow tropism, whereas the VSVg-LV/GFP lentiviral vector had a very high transfection rate for DCs due to its broad tropism. Therefore, it was suggested that this difference in infection efficiency of DCs, which occupies an important position in the initial intrinsic immune response, is closely related to the difference in the induction of cytokine expression such as INF-α. In other words, the above results show that the VSVg-LV vector has a high transfection rate in cells other than liver cancer cells, for example DCs in this example due to its broad tropism, and causes gene editing in addition to the target cell cancer cells, which is not the purpose of the present invention. It can be seen that it can induce apoptosis of DC cells that are not Since infection with these DCs causes an undesired immune response (eg, increase in TNF-α, etc.) in the present invention, a vector for cancer cell gene editing, such as the E1E2-LV/GFP lentiviral vector, is not infected with DCs. It can be seen that the less it is, the better the effect is. That is, it can be seen that the E1E2-LV/GFP lentiviral vector does not kill cancer cells using immune cells by inducing an anticancer immune response, but only transfects specific liver cancer cells and kills them by gene editing.

In addition, the VSV-derived VSVg-pseudotyped lentiviral vector was transfected into cells without interaction with CD81 ( FIGS. 4 and 5 ), and significantly accumulated in the liver, kidney, and lungs when injected intraperitoneally in vivo ( FIGS. 10, 10 , 11), the HCV-derived E1E2-pseudotyped lentiviral vector according to the present invention is specifically transfected with Huh7 cells ( FIGS. 4 and 5 ), and has the advantage of selectively accumulating only in Huh7 liver cancer tissue when peritoneally injected in vivo. (Fig. 10, 11). That is, Cas9 and gKSP expressed from the lentiviral vector of the present invention are selectively expressed only in Huh7 liver cancer to edit the KSP-encoding gene, thereby effectively inhibiting tumor growth.

The improved E1E2-pseudotyped lentiviral vector of the present invention effectively suppressed the growth of tumor tissue while effectively maintaining the editing of the KSP-encoding gene in Huh7 liver cancer tissue when peritoneally injected in vivo (Fig. 12, 13).

The anticancer effect is exhibited due to the excellent tumor selective delivery efficiency of the E1E2-pseudotyped lentiviral vector and effective tumor infection. As a result, the Cas9 and gKSP expression systems can be successfully maintained in the Huh7 liver cancer tumor tissue in vivo. confirmed that there is.

Another aspect of the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising, as an active ingredient, a CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein.

The terms used herein are the same as described above.

In the present invention, the cancer is not particularly limited as long as it is known in the art. For example, the cancer is lung cancer (eg, non-small cell lung cancer, small cell lung cancer, malignant mesothelioma), mesothelioma, pancreatic cancer (eg, pancreatic duct cancer, pancreatic endocrine tumor), pharyngeal cancer, laryngeal cancer, esophageal cancer, gastric cancer (eg papillary adenocarcinoma, mucinous adenocarcinoma, adenosquamous carcinoma), duodenal cancer, small intestine cancer, colorectal cancer (eg colon cancer, rectal cancer, anal cancer, familial colorectal cancer, hereditary nasal polyposis colorectal cancer, gastrointestinal stromal tumor), breast cancer (eg invasive ductal cancer) Cancer, non-invasive ductal cancer, inflammatory breast cancer), ovarian cancer (e.g. epithelial ovarian carcinoma, extratesticular germ cell tumor, ovarian germ cell tumor, ovarian low-grade tumor), testicular tumor, prostate cancer (e.g. hormone- dependent prostate cancer, hormone-independent prostate cancer), liver cancer (eg hepatocellular carcinoma, primary liver cancer, extrahepatic cholangiocarcinoma), thyroid cancer (eg medullary thyroid carcinoma), kidney cancer (eg renal cell carcinoma, transitional epithelial carcinoma of the renal pelvis and ureter) tumor), uterine cancer (e.g. cervical cancer, body cancer, uterine sarcoma), brain tumor (e.g. medulloblastoma, glioma, pineal astrocytoma, cytoblastoma, diffuse astrocytoma, anaplastic astrocytoma, pituitary adenoma) , retinoblastoma, skin cancer (eg basal cell carcinoma, malignant melanoma), sarcoma (eg rhabdomyosarcoma, leiomyosarcoma, soft tissue sarcoma), malignant bone tumor, bladder cancer, blood cancer (eg multiple myeloma, leukemia, malignant lymphoma, ho Hodgkin's disease, chronic myeloproliferative disease), primary unknown cancer, etc., specifically, may be a carcinoma in which CD81, claudin-1, or SR-BI membrane protein, which is known to be involved in HCV virus cell infection, is overexpressed, and more specifically It may be a carcinoma in which CD81 or claudin-1 membrane protein is overexpressed, and more specifically, it may be a Huh7 liver cancer in which CD81 or claudin-1 membrane protein is overexpressed, but is not limited thereto.

The pharmaceutical composition of the present invention has the use of “prevention” and/or “treatment” of cancer. For prophylactic use, the pharmaceutical composition of the present invention may be administered to an individual having or suspected of having a disease or symptom described in the present invention. For therapeutic use, the pharmaceutical composition of the present invention is administered in an amount sufficient to treat or at least partially arrest the disease or condition described herein to a subject, such as a patient already suffering from a disease described herein. Amounts effective for such use will depend on the severity and course of the disease or condition, previous treatment, the individual's health and responsiveness to the drug, and the judgment of the physician or veterinarian.

The pharmaceutical composition of the present invention may further include an appropriate carrier, excipient or diluent commonly used. At this time, the content of the active ingredient included in the composition is not particularly limited thereto, but may include 0.0001 wt% to 10 wt%, preferably 0.001 wt% to 1 wt%, based on the total weight of the composition.

The pharmaceutical composition is any one selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-drying agents and suppositories It may have a dosage form, and may be oral or parenteral various dosage forms. In the case of formulation, it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include one or more compounds and at least one excipient, for example, starch, calcium carbonate, sucrose or lactose. It is prepared by mixing (lactose), gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.

The composition of the present invention can be administered to an individual in a pharmaceutically effective amount.

As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is dependent on the subject's type and severity, age, sex, and disease. It may be determined according to the type, drug activity, drug sensitivity, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs, and other factors well known in the medical field.

The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, and can be easily determined by those skilled in the art. The preferred dosage of the composition of the present invention varies depending on the patient's condition and body weight, the degree of disease, drug form, administration route and period, and administration may be administered once a day or divided into several administrations.

The composition is not particularly limited and can be administered as long as it is an individual for the purpose of preventing or treating cancer. The mode of administration includes without limitation as long as it is a conventional method in the art. The pharmaceutical composition may be administered parenterally, subcutaneously, intraperitoneally, intrapulmonary and intranasally, and for local treatment, if necessary, may be administered by a suitable method including intralesional administration. For example, it may be administered by oral, intraperitoneal, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebrovascular injection, but is not limited thereto.

The pharmaceutical composition of the present invention may be administered at a concentration of generally 0.001 to 1,000 mg/kg, specifically, a concentration of 0.05 to 1,000 mg/kg, more specifically, a concentration of 1 to 100 mg/kg, but limited thereto doesn't happen

The anticancer effect may be exhibited due to the excellent tumor-selective delivery efficiency of the HCV-derived E1E2-pseudotyped lentiviral vector and effective tumor infection thereby.

Another aspect of the present invention is a CRISPR / Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein; as an active ingredient, comprising administering a composition to an individual other than humans, cancer treatment methods are provided.

The terms used herein are the same as described above.

The cancer may be liver cancer, but is not limited thereto.

In the present invention, the term "subject" refers to any animal that has or has the potential to develop cancer, and by administering the pharmaceutical composition of the present invention to a subject suspected of cancer, the subject can be effectively treated. The subject is not particularly limited, and may be, for example, animals such as monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cattle, sheep, pigs, goats, etc., birds and fish, but is not limited thereto.

In the present invention, the term "administration" means introducing the pharmaceutical composition of the present invention to a subject suspected of cancer by any suitable method, and the administration route is oral or parenteral administration through various routes as long as it can reach the target tissue. can be The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount, and the pharmaceutically effective amount is as described above.

Another aspect of the present invention provides a composition for inhibiting cancer tumor growth, comprising, as an active ingredient, a CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein.

Another aspect of the present invention is a CRISPR / Cas9 system delivery system comprising a lentiviral vector pseudotyped with an E1E2 envelope glycoprotein; A method for inhibiting tumor growth is provided.

The terms used herein are the same as described above.

The cancer may be liver cancer, but is not limited thereto.

The cancer tumor growth inhibitory effect of the CRISPR/Cas9 system delivery system, including a lentiviral vector pseudotyped with the E1E2 envelope glycoprotein, is as described above.

To enable selective delivery to Huh7 liver cancer tissue according to the present invention, a lentivirus pseudotyped with an envelope to which E1E2 glycoprotein is immobilized is used for delivery of guide RNA (gKSP) specific for CRISPR/Cas9 and KSP genes. It is possible to specifically express Cas9 and gKSP and inhibit the growth of tumor tissue through gene editing, so it can be applied to gene therapy for cancer treatment.

1 shows the production process of HCV-derived E1E2-pseudotyped lentiviral vector, tumor targeting to CD81 and Claudin-1 membrane receptor overexpressing Huh7 hepatocarcinoma cells, and peritoneally injected E1E2-pseudotyped lentiviral vector. It is a schematic diagram showing inhibition of cancer growth through Cas9 and gKSP expression in Huh7 liver cancer tissue infected with a viral vector.
Figure 2a isolates the HCV-derived E1E2-pseudotyped lentiviral vector and VSVg-pseudotyped-lentiviral vector and electrophoresis to separate each component, followed by anti-p24 antibody, anti-E2 antibody, and anti- This is the result of immunostaining using VSVg antibody. These results show that the formation of the lentiviral nucleus is intact and that the E2 and VSVg glycoproteins are intactly assembled in each pseudotyped particle. 2B is the transfection efficiency of HCV-derived E1E2-pseudotyped lentiviral vectors and VSVg-pseudotyped lentiviral vectors in Huh7 cells.
Figures 3a and 3b show the cellular infection of HCV virus in Huh7, HepG2, Hep3B (abnormal human hepatocellular carcinoma), HeyA8 (human ovarian carcinoma), primary hepatocytes, and human foreskin fibroblasts (HFF). The expression levels of CD81, claudin-1, and SR-BI membrane receptors known to be involved were measured using FACS.
Figures 4a and 4b show GFP expression after transfection of GFP-expressing E1E2-pseudotyped lentiviral vectors and GFP-expressing VSVg-pseudotyped lentiviral vectors into Huh7, HepG2, Hep3B, HeyA8, primary hepatocytes, and HFF. These are the results of investigating whether or not selective transfection in each cell was measured using FACS. FIG. 4c shows Huh7 cells with an E1E2-pseudotyped lentiviral vector and a VSVg-pseudotyped lentiviral vector containing a gene encoding luciferase, followed by measuring the degree of bioluminescence in each cell. It is the result of measuring whether or not selective transfection is present. Figure 4d shows that Huh7 and HepG2 cells were transfected with Cy5.5-labeled E1E2-pseudotyped lentiviral vector and Cy5.5-labeled VSVg-pseudotyped lentiviral vector, respectively, with pseudotyped lentiviral vectors. This is the result of investigating the interaction between CD81 membrane receptors. Fig. 4e shows Huh7 cells pretreated with anti-CD81 antibody with GFP-expressing E1E2-pseudotyped lentiviral vector and GFP-expressing VSVg-pseudotyped lentiviral vector after transfection with each pseudotyped lentiviral vector. This is the result of investigating the interaction between CD81 membrane receptors.
Figure 5 shows each pseudotyped lentiviral vector by measuring the GFP expression level after transfection of GFP-expressing E1E2-pseudotyped lentiviral vector and GFP-expressing VSVg-pseudotyped lentiviral vector into Huh7 and HepG2 cells. is the result of comparing the relative transfection efficiency of
Figure 6a is the result of examining the inactivation of the pseudotyped lentiviral vector by human serum complement. Figure 6b is a result of investigating the inactivation of the pseudotyped lentiviral vector by serum complement in the same manner as in Figure 6a after inactivation of human serum or mouse serum at a high temperature. FIG. 6c shows that human complement serum was reacted with E1E2-pseudotyped lentiviral vectors and VSVg-pseudotyped lentiviral vectors containing various titers of luciferase-encoding genes at 37° C. for 1 hour and the degree of bioluminescence was measured. This is a result of measuring the percentage of hemolysis for human red blood cells. 6D shows the results of measuring the relative GFP expression levels of the GFP-expressing E1E2-pseudotyped lentiviral vector and the GFP-expressing VSVg-pseudotyped lentiviral vector in mature dendritic cells using FACS. The upper FACS dot distribution is the result of differentiating THP-1 cells into mature DCs by treatment with stimulatory factors rhGM-CSF, rhIL-4, rhTNF-α, and ionomycin, and the lower FACS dot distribution is Comparison of the relative transfection efficiency of each pseudotyped lentiviral vector by measuring the relative GFP expression levels of the GFP-expressing E1E2-pseudotyped lentiviral vector and the GFP-expressing VSVg-pseudotyped lentiviral vector in mature dendritic cells is a result FIG. 6e shows human PBMCs reacting with E1E2-pseudotyped lentiviral vector and VSVg-pseudotyped lentiviral vector for 6 hours or 24 hours, respectively, and then increased TNF-α and IFN-α levels using ELISA method It is the result of examining the intrinsic immune response by measuring.
7a is a schematic diagram showing a guide RNA that specifically recognizes a KSP gene. 7B is a result of measuring the expression level of Cas9 protein in Huh7 cells transfected with the E1E2-pseudotyped lentiviral vector and VSVg-pseudotyped lentiviral vector delivering the Cas9 gene using the Western blot method. FIG. 7c is a result of T7E1 analysis investigating whether indel mutation was induced in Huh7 cells transfected with E1E2-pseudotyped lentiviral vector and VSVg-pseudotyped lentiviral vector delivering Cas9 and gKSP. The results of indel mutation of 1E2-pseudotyped lentiviral vector containing scrambled gKSP as a negative control are shown. FIG. 7d is a result of measuring the degree of decrease in KSP expression in the experimental result of FIG. 7c using a Western blot method. FIG. 7e is a result of investigating whether gene editing in the KSP gene is performed using Sanger sequencing in the experimental results of FIG. 7c. 7f is a result showing whether or not the gene is edited in the KSP gene in the experimental result of FIG. 7c using NGS sequencing.
Figure 8a is a diagram showing the level of KSP expression in various cell lines by Western blot. Figure 8b shows the three RNA sequences (gKSP #1 ~ gKSP #3) that are specifically recognized for the KSP gene, after transfection in Cas9-expressing Huh7 stabilized cells, the degree of each indel mutation was measured using T7E1 analysis. It is the result. FIG. 8c is a result of measuring the decrease in KSP expression in the experimental result of FIG. 8b using western blot. FIG. 8d is a result of T7E1 analysis in which E1E2-LV/gKSP vector gene editing was investigated for four predicted potential off-target positions.
Figure 9a shows apoptosis using annexin v (annexin-v)/PI after transducing the E1E2-pseudotyped lentiviral vector and VSVg-pseudotyped lentiviral vector expressing Cas9/gKSP into Huh7 cells. The results measured by FACS are shown. Figure 9b shows cell cycle arrest using a cell cycle assay kit (Abcam) after transduction of Huh7 and HepG2 cells with E1E2-pseudotyped lentiviral vectors and VSVg-pseudotyped lentiviral vectors expressing Cas9/gKSP. These are the results measured by FACS. FIG. 9c shows the results of measuring cell death rates after transfection of Huh7 and HepG2 cells with the E1E2-pseudotyped lentiviral vector and VSVg-pseudotyped lentiviral vector expressing Cas9/gKSP. FIG. 9d shows the results of measuring the proliferation degree of cells 120 hours after transfection of Huh7 and HepG2 cells with the E1E2-pseudotyped lentiviral vector and VSVg-pseudotyped lentiviral vector expressing Cas9/gKSP.
10A is an in vitro NIRF image of orthotopic Huh7 mice implanted with Huh7 cells, in which major organs were removed 4 hours or 24 hours after peritoneal injection of Cy5.5-labeled E1E2-pseudotyped lentiviral vector. As a control, FIG. 10b is an in vitro NIRF image of major organs removed 4 hours or 24 hours after peritoneal injection of Cy5.5-labeled E1E2-pseudotyped lentiviral vector into non-tumor mice.
FIG. 11a is an in vitro NIRF image of orthotopic Huh7 mice implanted with Huh7 cells after intraperitoneal injection of Cy5.5-labeled VSVg-pseudotyped lentiviral vector and major organs were removed 4 hours or 24 hours later. FIG. 11b shows the results of in vitro NIRF images obtained by peritoneal injection of Cy5.5 dye into stereotaxic Huh7 mice and excising major organs 4 hours or 24 hours later using the IVIS system.
FIG. 12a shows orthotopic Huh7 mice expressing E1E2-pseudotyped lentiviral vector expressing Cas9/gKSP by peritoneal injection at weekly or 2-week intervals for 8 weeks or PBS or KSP siRNA/DOPC complex at weekly intervals for 8 weeks This is the result of resection of the tumor tissue from the liver after peritoneal injection. Figure 12b is a result of measuring the weight of the liver cancer tumor tissue excised from the result of Figure 12a. Figure 12c is a result of measuring the degree of KSP expression reduction by performing a Western blot on the liver cancer tissue excised from the results of Figure 12a. 12D is a result of measuring the degree of indel mutation in the liver cancer tissue by performing T7E1 analysis on the liver cancer tissue excised from the results of FIG. 12A .
13A is a result of measuring the expression level of KSP and Ki-67 (proliferation marker) by performing IHC staining on the liver cancer tissue excised from the results of FIG. 12A . Figure 13b is a result of imaging whether apoptosis in liver cancer tissue and normal liver tissue excised from the results of Figure 12a using TUNEL analysis.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the present invention is not limited by the following examples.

Example 1. Guide RNA design and pseudotyped lentivirus (pseudotyped lentiviral vector) preparation

A lentiCRISPR v2-gKSP plasmid was constructed by inserting a guide RNA (gKSP #1) specific for the KSP gene sequence into the lentiCRISPR v2 plasmid (Addgene) using the double-stranded DNA oligomer consisting of SEQ ID NOs: 4 and 5 using the BsmBI restriction site. .

SEQ ID NO: 4: Insert#1F, 5'- CACCG CGTGGAATTATACCAGCCAA -3'

SEQ ID NO: 5: Insert#1R,5'- AAAC TTGGCTGGTATAATTCCACG C -3'

In SEQ ID NOs: 4 and 5, the underlined sequence represents the gKSP target sequence, and the bolded sequence represents the BsmB1 restriction enzyme site.

The inserted plasmid was designed to express Cas9 (SEQ ID NO: 16) derived from Streptococcus pyogenes induced by the EF-1α promoter and gKSP induced by the U6 promoter, respectively.

In the same way, a transfer vector (lentiCRISPR v2-GFP-gKSP plasmid) capable of expressing GFP and gKSP was prepared using the lentiCRISPR v2-GFP plasmid (Addgene). Meanwhile, pNL4-3.Luc.R ^{-E -} was used as a transfer vector containing a firefly luciferase reporter gene. Finally, the completed plasmid was confirmed through DNA sequencing.

For HCV/E1E2 pseudotyping, the pCON1-HCV-E1E2 expression plasmid prepared in the laboratory of Professor Choong-Ho Lee of Dongguk University was used. The vector is regulated by the CMV promoter and encodes an E1E2 glycoprotein derived from 1b-type HCV (Hepatitis C virus) (Gene Therapy, 2000, 7, 1613). Also for VSVg pseudotyping, the pMD2.G envelope plasmid was used, which is regulated by the CMV promoter and encodes the VSVg glycoprotein. Meanwhile, a psPAX2 packaging plasmid (Addgene) containing gag and pol genes was used for lentivirus nuclear formation.

To prepare an E1E2-pseudotyped lentiviral vector (E1E2-LV/gKSP vector) expressing Cas9 and gKSP, the lentiCRISPR v2-gKSP plasmid (10 μg) prepared above, psPAX2 packaging plasmid (7.5 μg), and pCON1 -HCV-E1E2 expression plasmid (5 μg) was mixed with HEK293T cells with 80% confluency in a T-75 flask by adding 100 μL of Plus Reagent (Life Technologies) and 50 μL of Lipofectamine 2000. was used for transfection. After culturing in OptiMEM medium for 6 hours, it was replaced with DMEM medium containing 10% FBS (Fetal Bovine Serum) and 1% BSA (Bovine serum albumin)) and cultured for an additional 54 hours. The virus-containing media was centrifuged at 3000 g for 10 minutes, and purified using a 0.45 μm filter (Millipore). Purified samples were diluted in a 4:1 ratio (v/v) with sucrose-containing buffer (50 mM Tris-HCl, pH 7.4, 100 mM NaCl, and 0.5 mM EDTA) and centrifuged at 10000 rpm at 4 °C. to purify the virus. The supernatant was carefully removed, resuspended in a semi-dry tube to which PBS was added, and finally stored at 4 °C. The virus titer was 1.0Х10 ¹⁰ copies/mL when measured using the Lenti-X qRT-PCR titration kit (Takara).

In a similar manner, a VSVg-pseudotyped lentiviral vector was prepared using the pMD2.G envelope plasmid instead of the pCON1-HCV-E1E2 expression plasmid (VSVg-LV/gKSP).

In a similar manner, an E1E2-pseudotyped lentiviral vector (E1E2-LV/gKSP/GFP) expressing GFP, Cas9, and gKSP was prepared using the lentiCRISPR v2-GFP-gKSP plasmid instead of the lentiCRISPR v2-gKSP plasmid.

In addition, an E1E2-pseudotyped lentiviral vector (E1E2-LV/Luc) expressing a luciferase reporter was prepared by using the pNL4-3.Luc.R ^- E ^- plasmid instead of the lentiCRISPR v2-gKSP plasmid in a similar manner.

Example 2. Identification of components of pseudotyped lentivirus

1 x 10 ¹⁰ pseudotyped virus was prepared in RIPA buffer (150 mM NaCl, 1% Triton X-100, 1% deoxycholic acid sodium salt, 0.1% sodium dodecyl sulfate, 50 After digestion with mM Tris-HCl, and 2 mM EDTA, complete protease inhibitors (Roche)), electrophoresis on SDS-polyacrylamide gel and polyvinylidene difluoride membrane ( polyvinylidene difluoride membrane) (Immobilon-P, Millipore). Membranes were blocked with TBST buffer containing 5% skim milk and immunostained with anti-p24 monoclonal antibody (Invitrogen), anti-HCV E2 polyclonal (Abcam), or anti-mouse VSVg (F-6) monoclonal antibody (Abcam). did Antibodies were used at 1:1000 dilution with TBST buffer containing 5% BSA. Membranes were reacted with HRP-conjugated anti-mouse IgG secondary antibody (Santa Cruz Biotechnology) and developed using ECL solution (Bio-Rad). EZ Capture MG (Japan) was used to image the blot image. The p24, E2, and VSVg proteins constituting the E1E2-pseudotyped lentivirus and the VSVg-pseudotyped lentivirus were identified by this immunostaining method (FIG. 2a).

Example 3. Huh7 cell-specific transfection of E1E2-LV vector

First, the expression levels of CD81, Claudin-1, and SR-BI membrane proteins, which are known to be involved in HCV cell infection, were measured in various cell lines using FACS. For Huh7, HepG2, Hep3B, HeyA8 cells, hepatocytes, and human foreskin fibroblasts (HFF) cells, 1 Х 10 ⁴ cells were seeded in a 24-well plate and cultured until 70% confluency. . Cells removed using trypsin were fixed with 4% paraformaldehyde and blocked in PBS containing 5% BSA, and then anti-CD81 (Invitrogen), anti-claudin-1 (Claudin-1) (Abcam), or an anti-SR-BI antibody (Abcam) at 4° C. for 12 hours. The antibody was diluted 1:1000 with TBST and used. The washed cells were reacted with Alexa 488-conjugated anti-rabbit IgG (Invitrogen) or anti-mouse IgG secondary antibody (Invitrogen) for 1 hour. After resuspending in 500 μL PBS, the expression level of each membrane protein was measured using the Guava EasyCyte system and shown in the drawings ( FIGS. 3A and 3B ).

As a result, the expression levels of CD81 and claudin-1 specifically increased in Huh7 cells, and the expression levels of SR-BI were constant regardless of the cells.

Next, the cell-specific transfection efficiency of GFP-expressing E1E2-pseudotyped lentiviral vector (E1E2-LV/GFP) and GFP-expressing VSVg-pseudotyped lentiviral vector (VSVg-LV/GFP) was investigated. . For Huh7, HepG2, Hep3B, HeyA8 cells, hepatocytes, and HFF cells, each 1Х10 ⁴ cells were seeded in a 24-well plate and treated with E1E2-LV/GFP or VSVg-LV/GFP at 0.2 10 ⁶ copies/mL. were transfected. After 24 hours, the medium was exchanged and cultured for an additional 72 hours. Each cell was fixed with 4% paraformaldehyde, resuspended in 500 μL PBS, and the GFP expression level was measured using a Guava EasyCyte flow cytometer, and it is shown in the drawings ( FIGS. 4A and 4B ).

As a result, the VSVg-pseudotyped lentiviral vector showed GFP expression above a certain level regardless of cell type, whereas the E1E2-pseudotyped lentiviral vector showed significant GFP expression only in Huh7 cells.

In addition, the E1E2-pseudotyped lentiviral vector or VSVg-pseudotyped lentiviral vector capable of expressing luciferase was transfected into various cell lines in the same manner as above, and then the degree of bioluminescence in the transfected cells was measured. (Fig. 4c). As expected, the VSVg-pseudotyped lentiviral vector showed luciferase activity above a certain level regardless of cell type, whereas the E1E2-pseudotyped lentiviral vector showed significant luciferase activity only in Huh7 cells.

Taken together, these results show that high transfection in Huh7 cells with E1E2-pseudotyped lentiviral vectors is closely correlated with high expression levels of CD81 and claudin-1.

After transfection into Huh7 or HepG2 cells using Cy5.5-labeled E1E2-pseudotyped lentiviral vector or VSVg-pseudotyped lentiviral vector, immunostaining with anti-CD81 antibody and DAPI, followed by confocal fluorescence microscopy was measured ( FIG. 4D ). In Huh7 cells transfected with Cy5.5-labeled E1E2-pseudotyped lentiviral vector, co-localized signals released from CD81 and Cy5.5 were observed, whereas Cy5.5-labeled VSVg-pseudotyped lentiviral vectors were observed. Such a co-localized signal was hardly observed in Huh7 cells transfected with the viral vector.

These results suggest that cell uptake of the pseudotyped virus occurs due to the interaction between CD81 and E1E2 glycoproteins. In comparison, almost no Cy5.5 signal was observed in HepG2 cells transfected with the Cy5.5-labeled E1E2-pseudotyped lentiviral vector, which was presumed to be due to the lack of CD81 membrane protein. In HepG2 cells transfected with Cy5.5-labeled VSVg-pseudotyped lentiviral vector, almost no fluorescence signal emitted from CD81 was observed, but a large number of Cy5.5 signals were observed, indicating that VSVg-pseudotyped lentiviral vector was CD81 It has been shown that cells can be transfected without interaction with

In order to verify cell infection of E1E2-pseudotyped lentiviral vectors by the interaction between CD81 and E1E2 glycoprotein, the CD81 membrane protein of Huh7 cells was blocked using an anti-CD81 antibody, and then E1E2-LV/Luc After transfection with vector or VSVg-LV/Luc vector, the degree of bioluminescence was measured using FACS (FIG. 4e).

As a result, VSVg-LV/Luc vector did not decrease bioluminescence even when pre-treatment with anti-CD81 antibody occurred, but E1E2-LV/Luc vector significantly decreased. These results demonstrated cell infection of E1E2-pseudotyped lentiviral vectors by the interaction between CD81 and E1E2 glycoproteins. As a control, in the case of pretreatment with PBS or IgG, a decrease in transfection of the E1E2-pseudotyped lentiviral vector was not observed.

In addition, the difference in transfection efficiency of each pseudotyped lentiviral vector was investigated for Huh7 and HepG2 cells (FIG. 5). 1Х10 ⁴ cells were seeded in 24-well plates and transfected with 0.2 Х10 ⁶ copies/mL E1E2-LV/GFP or VSVg-LV/GFP vector. After culturing for 24 hours, the medium was exchanged and incubated for an additional 72 hours. Cells resuspended in PBS after fixing with 4% paraformaldehyde were measured for GFP expression using an LSM710 laser scanning confocal microscope (473nm laser, Carl Zeiss, Germany) and ZEN blue software. In Huh7 cells, both E1E2-LV/GFP and VSVg-LV/GFP vectors induced significant GFP expression, but in HepG2 cells, only VSVg-LV/GFP vector induced significant GFP expression. It was analyzed that cell infection with the E1E2-LV/GFP vector did not occur well because the expression level of CD81 membrane protein in HepG2 cells was very low.

Example 4. Investigation of inactivation of pseudotyped lentiviruses by human serum complement and intrinsic immune response

To investigate complement sensitivity, 1.0 Х 10 ³ Huh7 cells were placed in a 96-well plate (Costar 3610, Corning), and then 20 μL VSVg-LV/Luc or E1E2-LV/Luc vector (1.0 Х 10 ⁵ copies/ mL) was mixed with 0, 0.125, 0.25, 0.5, or 1 mL of fresh or heat-inactivated human serum sample. 1.0 mL medium was added to the mixture, and after reacting at 37°C for 1 hour, Huh7 cells were transfected. After 3 days, the degree of bioluminescence was measured.

In a similar manner, complement sensitivity to mouse serum was investigated ( FIGS. 6A and 6B ). The VSVg-LV/Luc vector was inactivated in response to human serum complement, and bioluminescence was significantly reduced, but the E1E2-LV/Luc vector was not inactivated. Neither the VSVg-LV/Luc nor the E1E2-LV/Luc vectors were inactivated for mouse serum complement. Likewise, neither VSVg-LV/Luc nor E1E2-LV/Luc vectors were inactivated against heat-inactivated human serum complement. In addition, neither VSVg-LV/Luc nor E1E2-LV/Luc vectors were inactivated against heat-inactivated mouse serum complement.

These results show that the VSVg-pseudotyped lentiviral vector is very susceptible to inactivation by human serum complement, whereas the E1E2-pseudotyped lentiviral vector is very stable. That is, it can be seen that the E1E2-pseudotyped lentiviral vector is more suitable for gene therapy for cancer treatment compared to the VSVg-pseudotyped lentiviral vector.

In addition, the reactivity of the E1E2-pseudotyped lentiviral vector to human serum complement was investigated using a hemolyic complement assay. Human complement serum (Sigma Aldrich) at 37°C for 1 hour at 1.0 x 10 ² , 1.0 x 10 ³ , 1.0 x 10 ⁴ , 1.0 x 10 ⁵ , and 1.0 x 10 ⁶ copies/mL VSVg-LV/Luc or E1E2- After pre-reacting with the LV/Luc vector, hemolytic analysis was performed on human red blood cells using the complement CH50 Eq EIA kit (MicroVue). The hemolytic percentage of the sample was calculated by comparing the absorbance of the sample to a reference curve ( FIG. 6C ).

As a result, the VSVg-LV/Luc vector had a 50% lysis-inducing titer of 1.3 x 10 ⁴ copies/mL, but the E1E2-LV/Luc vector had very poor hemolytic properties that could not be measured.

These results indicated that the E1E2-LV vector was stable to a significant level in human serum, whereas the VSVg-LV vector was highly reactive and easily inactivated.

Next, the transfection efficiency of VSVg-pseudotyped lentiviral vector and E1E2-pseudotyped lentiviral vector for dendritic cells (DCs) was compared. First, THP-1 cells (2 Х 10 ⁵ cells/mL) were resuspended in RPMI medium containing 10% FBS, and then transferred to a culture dish (final volume 10 mL). To differentiate into DCs, THP-1 cells were treated with 100 ng/mL stimulating factor rhGM-CSF (JW Creagene), 200 ng/mL rhIL-4 (JW Creagene), 20 ng/mL rhTNF-α (JW Creagene), and 200 ng/mL ionomycin (Sigma Aldrich). After culturing the cells for 5 days, the properties of mature DCs were confirmed using FACS (Fig. 6d top). Then, mature DCs cells were seeded in a DMEM medium containing 10% FBS at a cell density of 1 Х 10 ⁵ cells/well in a 12-well plate, and 24 hours later, VSVg-LV/GFP or E1E2-LV/GFP lentiviral vector s (5.0 Х 10 ⁵ copies/mL). After incubation for 72 hours, the infected cells were analyzed for GFP expression using a Guava EasyCyte flow cytometer.

As a result, as shown in the FACS dot distribution at the bottom of Fig. 6d, the VSVg-LV/GFP lentiviral vector showed high transfection efficiency in mature DCs, whereas the E1E2-LV/GFP lentiviral vector showed very poor transfection efficiency. .

These results imply that the E1E2-LV/GFP lentiviral vector had a very low transfection rate for DCs due to its narrow tropism, whereas the VSVg-LV/GFP lentiviral vector had a very high transfection rate for DCs due to its broad tropism. Therefore, it was suggested that this difference in infection efficiency of DCs, which occupies an important position in the initial intrinsic immune response, is closely related to the difference in the induction of cytokine expression such as INF-α. In other words, the above results show that the VSVg-LV vector has a high transfection rate in cells other than liver cancer cells, for example DCs in this example due to its broad tropism, and causes gene editing in addition to the target cell cancer cells, which is not the purpose of the present invention. It can be seen that it can induce apoptosis of DC cells that are not Since infection with these DCs causes an undesired immune response (eg, increase in TNF-α, etc.) in the present invention, a vector for cancer cell gene editing, such as the E1E2-LV/GFP lentiviral vector, is not infected with DCs. It can be seen that the less it is, the better the effect is. That is, it can be seen that the E1E2-LV/GFP lentiviral vector does not kill cancer cells using immune cells by inducing an anticancer immune response, but only transfects specific liver cancer cells and kills them by gene editing.

The intrinsic immune response of the pseudotyped vector was investigated by examining the expression levels of INF-α and TNF-α in human PBMC cells (FIG. 6e). Human PBMCs (KOMA Biotech.) in RPMI 1640 medium (heat-inactivated FBS (10%), L-glutamine (1%), and penicillin-streptomycin) (1%) After culturing for ²⁴ hours in a 96 ^- well plate using transfected. 1 μg/mL of lipopolysaccharide as a positive control for INF-α induction and 20 μg/mL of polyinosinic-polycytidylic acid as a positive control for TNF-α induction were treated. After 6 hours or 24 hours, the culture supernatant was collected by centrifugation (2000x g , 10 minutes), and TNF-α and IFN-α were quantified using a human TNF alpha ELISA kit and an IFN alpha human ELASA kit (Thermo Fisher Scientific). did TNF-α and IFN-α levels were calculated by comparing the absorbance of the sample to a reference curve.

As a result, as shown in FIG. 6e , the VSVg-LV/gKSP vector increased the INF-α level in human PBMCs by 2.2-fold, whereas the E1E2-LV/gKSP vector did not increase the INF-α to a detectable level.

The VSVg-LV/gKSP vector also increased TNF-α levels by 5.3-fold (6 hours) and 9.9-fold (24 hours), whereas the E1E2-LV/gKSP vector induced much lower levels of TNF-α. (3.6-fold (6 hours) and 3.7-fold (24 hours)). Early activation of the INF-α response is mainly initiated by the intrinsic immune system such as DCs, and it was analyzed that the high intrinsic immune response of the VSVg-LV/gKSP vector is closely related to the high transfection efficiency in DCs.

These results suggested that the E1E2 pseudotyped vector is more suitable for cancer treatment than the VSVg pseudotyped vector due to the low immune barrier.

Example 5. In vitro gene editing efficiency investigation by E1E2-LV/gKSP vector

7A is a schematic diagram of three guide RNA candidates targeting the KSP gene. PAM sequences are underlined and indicated in green. gKSP target locations are shown in red.

First, the results of measuring KSP expression levels in various cell lines using Western blot are shown in FIG. 8A . Next, to compare the gene editing efficiency of the three guide RNA candidate groups, chemically synthesized guide RNAs (gKSP #1 to #3) were complexed with lipofectamine in a Cas9-expressing Huh7 stable cell line, and then transfected. Next, to compare the frequency of indel mutations, Cas9/Huh7 stable cells (1.0 Х 10 ⁴ cells/well) were seeded in 24-well plates and cultured until 70% confluency. Each of the gKSP candidates (20 μM) was transfected with the same amount, and T7E1 analysis was performed after 72 hours. Genomic DNAs PureLink?? After isolation using a genomic DNA mini kit (Invitrogen), the target region was amplified by PCR reaction (2 min at 95 °C; 15 s at 95 °C, 30 s at 55 °C, and 35 at 72 °C for 30 s). Repeat twice; hold at 72 °C for 2 min and at 4 °C). The primers used at this time are as follows.

SEQ ID NO: 6: gKSP #1F, 5'-AAGTAGATAGGTTCCATTGG-3'

SEQ ID NO: 7: gKSP #1R, 5'-CTCCAAGTTCCTAATTCTTC-3'

SEQ ID NO: 8: gKSP #2F, 5'-GCCCAGCCTTGATCAGATTT-3'

SEQ ID NO: 9: gKSP #2R, 5'-GCTCCAAACACCTAACGAAA-3'

SEQ ID NO: 10: gKSP #3F, 5'-ACCATGCCCGCTAATTTTTG-3'

SEQ ID NO: 11: gKSP #3R, 5'-CAGTATTGGTTCTCTCTCTTAGTTA-3'

PCR products (20 μL) were purified using a Macherey-Nagel NucleoSpin gel and a PCR Clean-up kit (Thermo Fisher Scientific) and reannealed using a thermocycler. Next, 2 μL T7 endonuclease 1 (10 U/μL; NEB) was added and incubated at 37° C. for 15 minutes. The reaction was stopped by adding 1 μL 0.5 M EDTA, and the DNA fragment was electrophoresed on a 2% agarose gel. Indel percentage was calculated with the following formula;

Indel percentage (%) = 100 x (1 - (1 - (b + c)/(a + b + c))1/2)

Where a is the integration intensity of the undigested PCR product, b and c are the integration intensity of each cleavage product.

Electrophoretic band images were measured using iBright Analysis Software (Invitrogen) and EZ Capture MG (Atto Corp.), and gKSP #1 showed the highest indel percentage (Fig. 8b, 21.2%). In the KSP expression level investigation using Western blot, gKSP #1 decreased the expression level the most (FIG. 8c, 11.2%).

Then, the expression of Cas9 was confirmed in the cells transfected with the pseudotyped vector (Fig. 7b). When Huh7 cells were transfected with E1E2-LV/gKSP or VSVg-LV/gKSP vectors and then immunostained using an anti-Cas9 antibody, high levels of Cas9 expression were observed in both transfected cells.

To investigate gene editing in vitro, Huh7 cells were transfected with E1E2-LV/gKSP, VSVg-LV/gKSP, and scrambled E1E2-LV/SCR vectors, followed by the same method as previously described. T7E1 analysis was performed ( FIG. 7C ).

As a result, indel mutations were not observed in the E1E2-LV/SCR vector, but were measured to be 35.2% and 39.2% in the E1E2-LV/gKSP and VSVg-LV/gKSP vectors, respectively. As shown in FIG. 7d showing the KSP protein level measured by Western blot, the E1E2-LV/gKSP and VSVg-LV/gKSP vectors showed a decrease in expression of 92.2% and 94.8%, respectively. The KSP siRNA/DOPC complex used as a control showed a reduction in KSP protein of 84.7%, and the scrambled E1E2-LV/SCR vector did not reduce it at all.

For Sanger sequencing and Next-Generation sequencing (NGS), Huh7 cells (0.2 x 10 ⁶ cells) were transfected with E1E2-LV/gKSP vector (1.0 x 10 ⁶ copies/mL). After 5 days, genomic DNA was isolated using PureLink Genomic DNA Mini Kit (Invitrogen), and the target region (233 bp, chr10:92608939+92609171) was subjected to PCR reaction (2 min at 95 °C; 15 s at 95 °C, 55 °C). 30 s, and 30 s 35 times at 72° C.; 2 min at 72° C. and hold at 4° C.). The primers used at this time are as follows.

SEQ ID NO: 12: Sanger sequencing, 5'-AAGTAGATAGGTTCCATTGG-3'

SEQ ID NO: 13: Sanger sequencing, 5'-CTCCAAGTTCCTAATTCTTC-3'

SEQ ID NO: 14: NGS sequencing, 5'-TATTATAAAGGAGGCCCATG-3'

SEQ ID NO: 15: NGS sequencing, 5'-TCAGAAACATCAGATGATGG-3'

PCR products (20 μL) were purified using a Macherey-Nagel NucleoSpin gel and PCR Clean-up kit and reannealed using a thermal cycler. Sanger sequencing and NGS sequencing (Illumina Hiseq 2500 PE250) were commissioned by Microgen Inc.

The Sanger sequencing result shown in FIG. 7e indicates that gene editing was successfully induced in the KSP target region by the E1E2-LV/gKSP vector, and as a result, one or more overlapping peaks exist at the same nucleic acid position.

In addition, the NGS sequencing result shown in FIG. 7f suggested that gene editing occurred successfully in the target region, and the probability of KSP loss of function was very high because the frame-shift mutation was 95.2%.

Example 6. In vitro apoptosis investigation by E1E2-LV/gKSP vector

Apoptosis of Huh7 cells by E1E2-LV/gKSP vector was investigated using Annexin V (Annexin V)-FITC/PI staining and FACS. Huh7 cells (4.0 Х 10 ⁴ ) were seeded in 6-well plates and transfected with E1E2-LV/gKSP, E1E2-LV/SCR, or VSVg-LV/gKSP lentiviral vectors (4.0 Х 10 ⁴ copies/mL). made it After 120 hours, the cells were fixed with pre-chilled 70% ethanol and immunostained using annexin V-FITC/PI kit (BD Pharmingen). As a control, cells treated with PBS were used, and the apoptosis rate was measured using the Guava EasyCyte system and shown in the figure (FIG. 9a).

As a result, compared with cells treated with PBS, apoptosis was not observed in cells treated with E1E2-LV/SCR vector, but significant apoptosis was observed in cells treated with E1E2-LV/gKSP and VSVg-LV/gKSP vectors. (apoptosis 23.9% and apoptosis 27.3% (apoptosis + necrosis in E1E2-LV/gKSP-transfected cells); apoptosis 27.2% and apoptosis 30.1% in VSVg-LV/gKSP-transfected cells).

Next, cell cycle arrest induced by the E1E2-LV/gKSP vector was investigated. Huh7 and HepG2 cells were prepared in the same manner as above and transfected with E1E2-LV/gKSP and VSVg-LV/gKSP vectors. After 120 hours, the cells were detached by trypsinization and fixed with 4% paraformaldehyde. Cells were treated with RNAase (50 mg/mL) and stained using a cell cycle assay kit (Abcam). Cell cycle arrest was measured using the Guava EasyCyte system (FIG. 9b).

As a result, the E1E2-LV/gKSP vector exhibited cell cycle arrest (28.8%) in the G ₀ /G ₁ phase in Huh7 cells, but did not induce cell cycle arrest at all in HepG2 cells. It was analyzed that this induced cell cycle arrest because the E1E2-LV/gKSP vector could selectively transfect Huh7 cells. On the other hand, the VSVg-LV/gKSP vector exhibited 35.8% and 7.2% of G ₀ /G ₁ phase detention in both Huh7 and HepG2 cells, respectively, which was analyzed to be due to the broad tropism of the VSVg-LV/gKSP vector.

In addition, the apoptosis rate in cells treated with E1E2-LV/gKSP vector was investigated. HepG2 and Huh7 cells (2.0 x 10 ³ cells/well) were seeded in 96-well plates (2.0 x 10 ³ cells/well) and E1E2-LV/gKSP, E1E2-LV/SCR, VSVg-LV/gKSP vectors (1x10 ⁴ GC/mL) or PBS (control). After 120 hours, tetrazolium salt was added to each well containing EZ-CYTOX solution (DoGen) containing 10% tetrazolium salt, and the plate was reacted at 37°C for 3 hours. The cytotoxicity of the sample was calculated by measuring the absorbance of the sample at 450 nm using a Spectra MAX 340 microplate reader (Molecular Device) (FIG. 9c). The E1E2-LV/gKSP vector showed 65.9% apoptosis in Huh7 cells, but 13.8% apoptosis in HepG2 cells. On the other hand, the VSVg-LV/gKSP vector exhibited apoptosis of 85.8% and 59.5% in Huh7 and HepG2 cells, respectively. This result was also analyzed to be due to the difference in tropism of the two pseudotyped vectors.

In addition, it was investigated whether the E1E2-LV/gKSP vector inhibits cell proliferation using a colony formation assay ( FIG. 9d ). Huh7 and HepG2 cells (4.0 x 10 ⁴ cells/well) were seeded in 6-well plates and incubated for 12 hours. Next, after transfection with E1E2-LV/gKSP and VSVg-LV/gKSP vectors (1.0 Х 10 ⁷ copies/mL), they were cultured for 120 hours. Cells were washed with PBS buffer and fixed with 4% paraformaldehyde for 20 minutes, then 0.5% crystal violet dissolved in 20% ethanol was added and reacted at room temperature for 2 hours. The number of colonies was measured using EZ-Capture MG and Image J software.

As a result, E1E2-LV/gKSP treatment significantly inhibited cell proliferation in Huh7 cells by 56.8%, but not HepG2 cells. On the other hand, VSVg-LV/gKSP treatment reduced cell proliferation by 82.2% and 52.0% in both Huh7 and HepG2 cells, respectively.

These results show that the E1E2-LV/gKSP vector can induce apoptosis specifically in Huh7 cells.

Example 7. Cancer Targeting Investigation of E1E2-LV Lentiviral Vector in Orthotopic Huh7 Mice

First, in order to construct an orthotopic Huh7 mouse model, in Balb/c nude mice (4 weeks old, Amken), an incision was made about 5 mm below the ribs and the liver was exposed. Huh7 cells (2Х10 ⁶ ) were injected with an insulin syringe (31 G, BD). was used and injected into the liver. The injection site was restored with a tabotamp (Ethicon), the abdominal cavity was closed with absorbable suture materials (Prolene, Ethicon), and the skin was clamped with forceps.

For in vivo biodistribution analysis, Cy5.5-labeled E1E2-LV/gKSP vector (100 μL PBS containing 1.0 Х 10 ⁷ copies/mL) was injected into orthotopic Huh7 mice 4 weeks after Huh7 cell injection. Peritoneal injection. As a control, Cy5.5-VSVg-LV/gKSP and free Cy5.5 dye were injected in the same manner. 4 and 24 hours after injection, major organs were removed and in vitro fluorescence images were obtained using IVIS Spectrum System and IVIS Living Imaging Software (Caliper Life Science Inc.). In order to compare cancer targeting, normal Balb/c nude mice were also injected in the same manner, and in vitro fluorescence images were obtained ( FIGS. 10A and 10B ).

As a result, as shown in Fig. 10a, a strong fluorescence signal was observed in Huh7 tumor tissue generated in the liver 4 hours after injection of the Cy5.5-labeled E1E2-LV/gKSP vector, and a strong fluorescence signal was observed even after 24 hours. Could. However, such strong signals were not observed in liver tissues other than tumors, and strong fluorescence signals were not observed in other major organs, such as spleen, kidney, heart, and lungs.

These results indicated that the E1E2-LV/gKSP vector could selectively accumulate in Huh7 tumor tissues when injected peritoneally.

In addition, as shown in FIG. 10b , no Cy5.5-labeled E1E2-LV/gKSP vector accumulation was observed in the non-tumor mouse model, and these results also suggest the Huh7 specificity of the E1E2-LV/gKSP vector. did

As a control, when Cy5.5-labeled VSVg-LV/gKSP vector was intraperitoneally injected into orthotopic Huh7 mice in a similar manner, strong fluorescence signals were observed not only in liver tumors but also in the entire liver ( FIG. 11a ). In addition, the fluorescence signals observed in the kidneys and lungs indicated that the VSVg-LV/gKSP vectors were also accumulated in organs other than the liver.

These results suggested that the VSVg-LV/gKSP vector had lower cancer targeting compared to the E1E2-LV/gKSP vector.

On the other hand, when only Cy5.5 dye was peritoneally injected into orthotopic Huh7 mice, it did not accumulate in any major organs as well as cancer ( FIG. 11b ).

Example 8. Investigation of anticancer effect of E1E2-LV/gKSP vector in stereotactic Huh7 mouse model

Four weeks after Huh7 cell transplantation, E1E2-LV/gKSP (100 μL PBS containing 2.0 Х 10 ⁵ copies/mL) was intraperitoneally injected into orthotopic Huh7 mice at weekly or 2-week intervals for 8 weeks. The control group was intraperitoneally injected with PBS or KSP siRNA/DOPC (including 4 μg in 100 μL PBS) at weekly intervals for 8 weeks. One week after the last peritoneal injection, the liver was removed from the mouse and the weight of the hepatocellular carcinoma tissue was measured ( FIGS. 12A and 12B ).

As a result, compared with the tumor weight (1.7 ± 1.09 g) in the PBS-treated group, the tumor weight in the E1E2-LV/gKSP group injected peritoneally at weekly intervals was 0.18 ± 0.03 g, and peritoneally at intervals of 2 weeks. The tumor weight in the injected E1E2-LV/gKSP group was 1.5 ± 0.78 g.

This difference in tumor weight indicated that the E1E2-LV/gKSP vector effectively inhibited the growth of tumor tissue. The low tumor tissue growth inhibitory effect of the E1E2-LV/gKSP vector injected peritoneally at 2-week intervals was analyzed because the 2-week injection dose was insufficient to reach the dose required for effective tumor growth inhibition. As a control group, the tumor weight in the group treated with KSP siRNA/DOPC was 1.67 ± 0.15 g, and no tumor tissue growth inhibitory effect was observed.

When the expression level of KSP in the extracted tumor tissue was investigated using Western blot, the decrease in expression level (22.4%) in the E1E2-LV/gKSP group injected peritoneally at weekly intervals was significant, but E1E2 injected peritoneally at intervals of 2 weeks. The expression level decrease (75.2%) in the -LV/gKSP group was weak, and no decrease was observed in the group treated with KSP siRNA/DOPC as a control ( FIG. 12c ).

Also, when T7E1 analysis was performed on the excised tumor tissue, the indel mutation frequency was 29.8% in the E1E2-LV/gKSP group injected peritoneally at weekly intervals, but 8.7% in the E1E2-LV/gKSP group injected peritoneally at 2-week intervals. , No indel mutation was found in the group treated with KSP siRNA/DOPC as a control ( FIG. 12d ).

As shown in FIG. 13a , when immunohistochemical staining was performed on the excised tumor tissue, the expression of KSP and Ki-67 (a representative cell proliferation marker) was significantly reduced in the E1E2-LV/gKSP group injected peritoneally at weekly intervals. knew it was done.

These results suggested that the E1E2-LV/gKSP vector produced effective gene editing in a liver cancer tissue-specific manner, and as a result, KSP expression was reduced as well as cell proliferation was suppressed.

13b shows the results of TUNEL analysis on the extracted tumor tissue and normal liver tissue, and effective apoptosis was induced in the tumor tissue by the E1E2-LV/gKSP vector, but not in the normal tissue.

Through the above results, gene editing was selectively induced in the KSP target gene only in the liver cancer tissue of the mouse model injected with the E1E2-LV/gKSP vector peritoneally. it can be seen that

From the results of the above examples, the lentiviruses pseudotyped with the envelope in which the E1E2 glycoprotein derived from HCV is immobilized to enable selective delivery to Huh7 liver cancer tissue according to the present invention were prepared with guide RNA (gKSP) specific for CRISPR/Cas9 and KSP genes. ), it is possible to specifically express Cas9 and gKSP only in Huh7 liver cancer tissue and inhibit the growth of tumor tissue through gene editing, so it can be applied to gene therapy for cancer treatment.

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as including all changes or modifications derived from the meaning and scope of the claims described below rather than the above detailed description and their equivalents to be included in the scope of the present invention.

<110> KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY <120> Tumor-specific CRISPR/Cas9 delivery of HCV/E1E2 envelope glycoproteins-pseudotyped lentivirus to tumor and its use as antitumor therapeutics <130> KPA201185-KR <160> 16 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gKSP #1 <400> 1 cgtggaatta taccagccaa 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gKSP #2 <400> 2 gaagttagtg tacgaactgg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gKSP #3 <400> 3 cacctaatga agagtatacc 20 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Insert#1F <400> 4 caccgcgtgg aattatacca gccaa 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Insert#1R <400> 5 aaacttggct ggtataattc cacgc 25 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gKSP #1F <400> 6 aagtagatag gttccattgg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gKSP #1R <400> 7 ctccaagttc ctaattcttc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gKSP #2F <400> 8 gcccagcctt gatcagattt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gKSP #2R <400> 9 gctccaaaca cctaacgaaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gKSP #3F <400> 10 accatgcccg ctaatttttg 20 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> gKSP #3R <400> 11 cagtattggt tctctctctt agtta 25 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sanger sequencing <400> 12 aagtagatag gttccattgg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sanger sequencing <400> 13 ctccaagttc ctaattcttc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NGS sequencing <400> 14 tattataaag gaggcccatg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NGS sequencing <400> 15 tcagaaacat cagatgatgg 20 <210> 16 <211> 4107 <212> DNA <213> Unknown <220> <223> streptococcus pyogenes Cas9 <400> 16 atggataaga aatactcaat aggcttagat atcggcacaa atagcgtcgg atgggcggtg 60 atcactgatg attataaggt tccgtctaaa aagttcaagg ttctgggaaa tacagaccgc 120 cacagtatca aaaaaaatct tataggggct cttttatttg acagtggaga gacagcggaa 180 gcgactcgtc tcaaacggac agctcgtaga aggtatacac gtcggaagaa tcgtatttgt 240 tatctacagg agattttttc aaatgagatg gcgaaagtag atgatagttt ctttcatcga 300 cttgaagagt cttttttggt ggaagaagac aagaagcatg aacgtcatcc tatttttgga 360 aatatagtag atgaagttgc ttatcatgag aaatatccaa ctatctatca tctgcgaaaa 420 aaattggcag attctactga taaagcggat ttgcgcttaa tctatttggc cttagcgcat 480 atgattaagt ttcgtggtca ttttttgatt gagggagatt taaatcctga taatagtgat 540 gtggacaaac tatttatcca gttggtacaa acctacaatc aattatttga agaaaaccct 600 attaacgcaa gtagagtaga tgctaaagcg attctttctg cacgattgag taaatcaaga 660 cgattagaaa atctcattgc tcagctcccc ggtgagaaga aaaatggctt atttgggaat 720 ctcattgctt tgttattggg attgacccct aattttaaat caaattttga tttggcagaa 780 gatgctaaat tacagctttc aaaagatact tacgatgatg atttagataa tttattggcg 840 caaattggag atcaatatgc tgatttgttt ttggcagcta agaatttatc agatgctatt 900 ttactttcag atatcctaag agtaaatagt gaaataacta aggctcccct atcagcttca 960 atgattaaac gctacgatga acatcatcaa gacttgactc ttttaaaagc tttagttcga 1020 caacaacttc cagaaaagta taaagaaatc ttttttgatc aatcaaaaaa cggatatgca 1080 ggttatattg atgggggagc tagccaagaa gaattttata aatttatcaa accaatttta 1140 gaaaaaatgg atggtactga ggaattattg gcgaaactaa atcgtgaaga tttgctgcgc 1200 aagcaacgga cctttgacaa cggctctatt ccccatcaaa ttcacttggg tgagctgcat 1260 gctattttga gaagacaaga agacttttat ccatttttaa aagacaatcg tgagaagatt 1320 gaaaaaatct tgacttttcg aattccttat tatgttggtc cattggcgcg tggcaatagt 1380 cgttttgcat ggatgactcg gaagtctgaa gaaacaatta ccccatggaa ttttgaagaa 1440 gttgtcgata aaggtgcttc agctcaatca tttattgaac gcatgacaaa ctttgataaa 1500 aatcttccaa atgaaaaagt actaccaaaa catagtttgc tttatgagta ttttacggtt 1560 tataacgaat tgacaaaggt caaatatgtt actgagggaa tgcgaaaacc agcatttctt 1620 tcaggtgaac agaagaaagc cattgttgat ttactcttca aaacaaatcg aaaagtaacc 1680 gttaagcaat taaaagaaga ttatttcaaa aaaatagaat gttttgatag tgttgaaatt 1740 tcaggcgttg aagatcggtt taatgcgtca ttaggtacct accatgattt gctaaaaatt 1800 atcaaagata aagatttttt ggataatgaa gaaaatgaag atattttaga ggatattgtt 1860 ttaacattga ccttatttga agataaggaa atgattgagg aacgacttaa aaagtatgct 1920 cacctctttg atgataaggt gatgaaacag cttaaacgtc gccgttatac tggttgggga 1980 cgtttgtctc gaaaattgat taatggtatt agggataagc aatctggcaa aacaatatta 2040 gattttttga aatcagatgg ttttgccaat cgcaatttta tgcagctgat ccatgatgat 2100 agtttgacat ttaaagaaga tattcaaaaa gcacaagtgt ctggacaagg cgatagttta 2160 catgaacata ttgcaaattt agctggtagc cctgctatta aaaaaggtat tttacagact 2220 gtaaaagttg ttgatgaatt ggtcaaagta atggggcggc ataagccaga aaatatcgtt 2280 attgaaatgg cacgtgaaaa tcagacaact caaaagggcc agaaaaattc gcgtgagcgt 2340 atgaaacgta ttgaagaagg aataaaagaa ctaggaagtg atattctaaa ggagtatcct 2400 gttgaaaaca ctcaattaca aaatgaaaag ctctatctct attatctcca aaatggaaga 2460 gacatgtatg tggaccaaga attagatatt aatcgtttaa gtgattatga tgtcgatcac 2520 attgttccac aaagtttcct taaagacgat tcaatagaca ataaggtgtt aacgcgttct 2580 gataaaaatc gtggtaaatc ggataacgtt ccaagtgaag aagtagtcaa aaagatgaaa 2640 aactattgga aacaacttct aaacgccaag ttaatcactc aacgtaagtt tgataattta 2700 acaaaagctg aacgtggagg tttgagtgaa cttgataaag ctggttttat caaacgccaa 2760 ttggttgaaa ctcgccaaat cactaagcat gtggcacaaa ttttggatag tcgcatgaat 2820 actaaatacg atgaaaatga taaacttatt cgagaggtta gagtgattac cttaaaatct 2880 aaattagttt ctgacttccg aaaagatttc caattctata aagtacgtga gattaacaat 2940 taccatcatg cccatgatgc gtatcttaat gccgtcgttg gaactgcttt gattaagaaa 3000 tatccaaaac ttgaatcgga gtttgtctat ggtgattata aagtttatga tgttcgtaaa 3060 atgattgcta agtctgagca ggaaataggc aaagcaaccg caaaatattt cttttactct 3120 aatatcatga acttcttcaa aacagaaatt acacttgcaa atggagagat tcgcaaacgc 3180 cctctaatcg aaactaatgg ggaaactgga gaaattgtct gggataaagg gcgagatttt 3240 gccacagtgc gcaaagtatt gtccatgccc caagtcaata ttgtcaagaa aacagaagta 3300 cagacaggcg gattctccaa ggagtcaatt ttaccaaaaa gaaattcgga caagcttatt 3360 gctcgtaaaa aagactggga tccaaaaaaa tatggtggtt ttgatagtcc aacggtagct 3420 tattcagtcc tagtggttgc taaggtggaa aaagggaaat cgaagaagtt aaaatccgtt 3480 aaagagttac tagggatcac aattatggaa agaagttcct ttgaaaaaaa tccgattgac 3540 tttttagaag ctaaaggata taaggaagtt agaaaagact taatcattaa actacctaaa 3600 tatagtcttt ttgagttaga aaacggtcgt aaacggatgc tggctagtgc cggagaatta 3660 caaaaaggaa atgagctggc tctgccaagc aaatatgtga attttttata tttagctagt 3720 cattatgaaa agttgaaggg tagtccagaa gataacgaac aaaaacaatt gtttgtggag 3780 cagcataagc attatttaga tgagattatt gagcaaatca gtgaattttc taagcgtgtt 3840 attttagcag atgccaattt agataaagtt cttagtgcat ataacaaaca tagagacaaa 3900 ccaatacgtg aacaagcaga aaatattatt catttattta cgttgacgaa tcttggagct 3960 cccgctgctt ttaaatattt tgatacaaca attgatcgta aacgatatac gtctacaaaa 4020 gaagttttag atgccactct tatccatcaa tccatcactg gtctttatga aacacgcatt 4080 gatttgagtc agctaggagg tgactga 4107

Claims (15)

A CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoproteins.
The CRISPR/Cas9 system delivery system according to claim 1, wherein the E1E2 envelope glycoprotein is derived from Hepatitis C virus (HCV).
The method of claim 1, wherein the lentiviral vector is
i) a DNA plasmid comprising a kinesin spindle protein (KSP)-specific guide RNA and a transgene encoding Cas9 as a CRISPR/Cas9 system; and
ii) an expression DNA plasmid comprising a gene encoding the E1E2 envelope glycoprotein derived from HCV;
The CRISPR/Cas9 system delivery system according to claim 3, wherein the lentiviral vector further comprises a packaging DNA plasmid comprising gag and pol genes.
The CRISPR/Cas9 system delivery system according to claim 3, wherein the guide RNA comprises any one or more sequences selected from the group consisting of SEQ ID NOs: 1 to 3.
The CRISPR/Cas9 system delivery system according to claim 3, wherein the CRISPR/Cas9 system is a gene editing gene encoding a KSP.
7. The CRISPR/Cas9 system delivery system of claim 6, wherein the gene edited KSP inhibits cancer growth by inducing cell cycle arrest in mitosis.
The CRISPR/Cas9 system delivery system according to claim 7, wherein the cancer is a carcinoma in which CD81 or Claudin-1 membrane protein is overexpressed.
The CRISPR/Cas9 system delivery system according to claim 8, wherein the cancer is liver cancer.
The CRISPR/Cas9 system delivery system according to claim 1, wherein the CRISPR/Cas9 system delivery system comprising the lentiviral vector delivers the CRISPR/Cas9 system specifically to cancer tissue.
The CRISPR/Cas9 system delivery system according to claim 10, wherein the cancer is at least one selected from liver cancer and ovarian cancer.
A pharmaceutical composition for preventing or treating cancer, comprising a CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein as an active ingredient.
A method of treating cancer, comprising administering a composition comprising a CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein as an active ingredient, to a subject other than humans.
A composition for inhibiting cancer tumor growth, comprising, as an active ingredient, a CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein.
A method for inhibiting cancer tumor growth, comprising administering a composition comprising a CRISPR/Cas9 system delivery system comprising a lentiviral vector pseudotyped with E1E2 envelope glycoprotein as an active ingredient to a subject other than humans.

Images