KR20220052847A - Modeling atopic dermatitis with human pluripotent stem cell-derived skin organoids - Google Patents

Modeling atopic dermatitis with human pluripotent stem cell-derived skin organoids Download PDF

Info

Publication number
KR20220052847A
KR20220052847A KR1020210140422A KR20210140422A KR20220052847A KR 20220052847 A KR20220052847 A KR 20220052847A KR 1020210140422 A KR1020210140422 A KR 1020210140422A KR 20210140422 A KR20210140422 A KR 20210140422A KR 20220052847 A KR20220052847 A KR 20220052847A
Authority
KR
South Korea
Prior art keywords
skin
organoids
organoid
atopic dermatitis
days
Prior art date
Application number
KR1020210140422A
Other languages
Korean (ko)
Inventor
강경선
정송이
Original Assignee
주식회사 강스템바이오텍
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 강스템바이오텍 filed Critical 주식회사 강스템바이오텍
Priority to US18/249,560 priority Critical patent/US20230392127A1/en
Priority to AU2021365476A priority patent/AU2021365476A1/en
Priority to CN202180071683.8A priority patent/CN116724108A/en
Priority to JP2023524294A priority patent/JP2023547088A/en
Priority to EP21883286.3A priority patent/EP4234683A1/en
Priority to PCT/KR2021/014810 priority patent/WO2022086218A1/en
Publication of KR20220052847A publication Critical patent/KR20220052847A/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0697—Artificial constructs associating cells of different lineages, e.g. tissue equivalents
    • C12N5/0698—Skin equivalents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/0062—General methods for three-dimensional culture
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/155—Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • C12N2503/02—Drug screening
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • C12N2503/04—Screening or testing on artificial tissues
    • C12N2503/06—Screening or testing on artificial skin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/45—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2513/00—3D culture

Landscapes

  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method for manufacturing atopic dermatitis skin organoids from human pluripotent stem cells. According to the present invention, it is observed that air-liquid interface (ALI)-skin organoids are formed in a structure similar to the actual skin, such as skin cells, appendages, nerve cells, and fat cells, and hair follicle growth is greatly increased in comparison with skin organoids prepared by conventional culture methods. In addition, as a result of treating Staphylococcus aureus to generate an atopic dermatitis model, characteristics of atopic dermatitis, such as damaged skin barrier, increased epithelial cell-derived cytokines, decreased epidermal stem cell expression, and colonization of Staphylococcus aureus, were well simulated. Accordingly, the skin organoids can be usefully used as a real skin model and an atopic dermatitis model. The method comprises a pluripotent stem cell-derived organoid culturing step, culturing steps, and a culturing step at an air-liquid interface.

Description

만능성 줄기세포 유래 피부 오가노이드를 이용한 아토피 피부염 모델 제작 방법{Modeling atopic dermatitis with human pluripotent stem cell-derived skin organoids}Method for manufacturing atopic dermatitis model using pluripotent stem cell-derived skin organoids {Modeling atopic dermatitis with human pluripotent stem cell-derived skin organoids}

본 발명은 인간 만능성 줄기세포 유래 피부 오가노이드를 이용한 아토피 피부염 질병 모델 제작 방법 등에 관한 것이다.The present invention relates to a method for producing atopic dermatitis disease model using human pluripotent stem cell-derived skin organoids, and the like.

인간 피부는 체액 유지, 체온 조절, 외부 스트레스, 또는 외부 유해균들로부터의 보호의 기능을 가지며 촉감과 통증을 중재하는 중요한 역할을 한다. 피부는 표피층, 진피층, 그리고 피하층으로 구성되며 모낭, 피지선 및 신경 세포와 같은 부속물들이 존재한다. 특히, 표피층과 진피층 사이의 상호 작용은 피부 발달과 그 부속물 형성에 매우 중요하다.Human skin has functions of maintaining body fluid, regulating body temperature, external stress, or protecting from external harmful bacteria, and plays an important role in mediating touch and pain. The skin is composed of the epidermal layer, the dermal layer, and the subcutaneous layer, and there are appendages such as hair follicles, sebaceous glands, and nerve cells. In particular, the interaction between the epidermal layer and the dermal layer is very important for skin development and the formation of its appendages.

현재 인간 피부 발달 및 질환에 관련된 대부분의 연구는 동물 실험과 체외 인공피부 모델들을 사용해 진행되고 있다. 하지만, 동물 실험모델은 인체와 유전/생물적 특성 면에서 다르며, 독성 및 약물 스크리닝에 자주 쓰이는 인공피부 모델은 실제 피부에 존재하는 땀샘, 모낭, 멜라노사이트 등의 부속물을 생성하지 않는 기초적인 표피 및 진피만을 포함하고 있다. 이에, 생체 내 피부조직의 복잡성과 기능을 모사할 수 있는, 실제 피부와 보다 유사한 피부모델의 개발에 대한 필요성이 증가하고 있다. Currently, most studies related to human skin development and diseases are conducted using animal experiments and in vitro artificial skin models. However, the animal experimental model is different from the human body in terms of genetic/biological characteristics, and the artificial skin model frequently used for toxicity and drug screening is the basic epidermis and epidermis that do not generate appendages such as sweat glands, hair follicles, and melanocytes that exist in the actual skin. It contains only the dermis. Accordingly, there is an increasing need for the development of a skin model more similar to the actual skin, which can simulate the complexity and function of the skin tissue in vivo.

최근 인간 만능성 줄기세포(pluripotent stem cell)를 이용하여, 생체 장기 내의 조직과 기능을 모사 할 수 있는 3D 오가노이드 배양하는 방법이 개발되었으며, 3D 오가노이드는 실제 장기의 조직 또는 기관의 형태와 기능을 재현할 수 있는 배양체로, 장기유사체 또는 유사장기로도 부른다. 최근에는 다양한 인간 피부세포, 신경세포, 지방세포를 가지며 부속물 등이 형성 되는, 실제 피부와 유사한 피부 오가노이드 배양법이 개발된 바 있다. 그러나 기존 연구의 피부 오가노이드 배양법(비특허문헌 1 참조)으로 형성된 오가노이드는 실제 피부와 다른 삼차원 원형 구조를 나타내어 약물 독성 효능 실험, 피부이식 및 아토피 피부질환의 모델로서 이용하기 어렵다. Recently, using human pluripotent stem cells, a method for culturing 3D organoids that can mimic the tissues and functions of living organs has been developed. Cultures that can reproduce Recently, a method for culturing skin organoids similar to actual skin, in which various human skin cells, nerve cells, and adipocytes are formed, and appendages, has been developed. However, the organoids formed by the skin organoid culture method of the previous study (see Non-Patent Document 1) show a three-dimensional circular structure different from the actual skin, so it is difficult to use it as a model for drug toxicity efficacy experiments, skin transplantation, and atopic skin diseases.

한편, 아토피 피부염은 홍반, 가려움증, 발진과 피부각질을 동반하는 건조한 피부 병변 증상을 보이는 만성/난치성/염증성 피부 질환이다. 세계적으로 선진국 어린이의 15-30%와 성인의 2-10%에 영향을 미치고 현재 우리나라에서도 인구의 10%, 소아 인구의 20%가 아토피 피부염을 앓고 있다. 건강 보험 심사평가원 통계자료를 보면 국내 아토피질환으로 병원을 내원하는 환자는 매년 100만 명에 가깝고, 유병율에 따른 추정환자 수는 200만 명 정도이다. 현재 밝혀진 질환의 원인은 필라그린(filaggrin) 유전자 변이, 면역학적 요인, 피부장벽 손상 등 복합적 상호작용에 의하여 발생하는 것으로 알려져 있다. 또한, 최근 연구에 따르면 아토피 피부염의 잠재적인 원인으로서 피부에 황색포도상구균(Staphylococcus aureus) 집락(colonization)의 증가와 세균 다양성 감소(dysbiosis)가 제시되고 있다. 하지만 정확한 질병 메커니즘 및 적합한 치료제는 아직 밝혀지지 않았다. 또한, 아토피 피부염의 질병 메커니즘 및 약물 스크리닝 연구는 현재 기존의 세포주를 이용한 2차원 배양법, in vitro 인공피부 모델 및 동물 모델을 이용한 연구가 주를 이루고 있다. On the other hand, atopic dermatitis is a chronic/refractory/inflammatory skin disease that presents with dry skin lesions accompanied by erythema, itching, rash and dead skin cells. Atopic dermatitis affects 15-30% of children and 2-10% of adults in developed countries worldwide, and 10% of the population and 20% of the pediatric population in Korea suffer from atopic dermatitis. According to the statistical data of the Health Insurance Review and Assessment Service, approximately 1 million patients visit the hospital for atopic diseases every year in Korea, and the estimated number of patients according to the prevalence is about 2 million. It is known that the cause of the currently identified disease is caused by complex interactions such as filaggrin gene mutation, immunological factors, and skin barrier damage. In addition, according to recent studies, an increase in Staphylococcus aureus colonization and a decrease in bacterial diversity (dysbiosis) on the skin are suggested as potential causes of atopic dermatitis. However, the exact disease mechanism and suitable treatment have not yet been elucidated. In addition, the disease mechanism and drug screening studies of atopic dermatitis are currently mainly studies using a two-dimensional culture method using existing cell lines, an in vitro artificial skin model, and an animal model.

따라서, 보다 실제 피부와 유사한 구조를 갖고, 생체 내 피부조직의 복잡성과 기능을 모사할 수 있는 개선된 피부 오가노이드 모델 개발이 필요하다. Therefore, it is necessary to develop an improved skin organoid model that has a structure more similar to that of actual skin and can mimic the complexity and function of skin tissue in vivo.

3차원 피부모델의 최신 연구개발 동향, 장성재, BRIC View 2019-T21The latest research and development trend of 3D skin model, Sungjae Jang, BRIC View 2019-T21

이에, 본 발명자들은 실제 인간 피부와 유사한 삼차원 계층화 된 피부 오가노이드의 효율적인 제조를 위해 공기-액체 계면(Air-liquid interface; ALI) 배양법을 응용하여 인간 만능성 줄기세포로부터 삼차원 공기-액체 계면-피부 오가노이드 모델(ALI-피부 오가노이드)을 제조하였으며, ALI-피부 오가노이드에 황색포도상구균을 접종함으로써 아토피 피부질환 메커니즘 및 질병 요인을 규명 할 수 있고, 약물 스크리닝을 통한 질환 치료제의 효과 연구 진행이 가능한 아토피 피부염 오가노이드 모델을 개발하였다.Accordingly, the present inventors applied an air-liquid interface (ALI) culture method for the efficient production of three-dimensional layered skin organoids similar to actual human skin, and obtained three-dimensional air-liquid interface-skin from human pluripotent stem cells. An organoid model (ALI-skin organoid) was manufactured, and by inoculating Staphylococcus aureus into ALI-skin organoid, the mechanism and disease factor of atopic skin disease could be identified, and the effect of disease treatment through drug screening could be studied. A possible atopic dermatitis organoid model was developed.

따라서, 본 발명의 목적은 하기의 단계를 포함하는 인간 만능성 줄기세포(pluripotent stem cell)로부터 피부 오가노이드(organoid)를 제조하는 방법을 제공하는 것이다:Accordingly, it is an object of the present invention to provide a method for preparing skin organoids from human pluripotent stem cells comprising the steps of:

(a) 만능성 줄기세포 유래 오가노이드를 Wnt 작용제의 존재 하에 배양하는 단계;(a) culturing pluripotent stem cell-derived organoids in the presence of a Wnt agonist;

(b) 상기 단계 (a)의 배양물을 피부 오가노이드 성숙용 배지에서 40일 이상 배양하는 단계; 및(b) culturing the culture of step (a) in a medium for skin organoid maturation for at least 40 days; and

(c) 상기 단계 (b)의 배양물을 절단하여 공기-액체 계면에서 배양하는 단계(c) cutting the culture of step (b) and culturing at an air-liquid interface

본 발명의 다른 목적은 상기 방법으로 제조된 피부 오가노이드에 황색포도상구균을 처리하는 단계를 포함하는, 피부 오가노이드의 제작 방법으로서, 상기 피부 오가노이드는 아토피 피부염의 피부 모사 모델인 것을 특징으로 하는, 방법을 제공하는 것이다.Another object of the present invention is a method for producing a skin organoid comprising the step of treating Staphylococcus aureus to the skin organoid prepared by the above method, wherein the skin organoid is a skin-mimicking model of atopic dermatitis, characterized in that , to provide a method.

본 발명의 다른 목적은 상기 방법으로 제작된 피부 오가노이드로서, 상기 피부 오가노이드는 아토피 피부염의 피부 모사 모델인 것을 특징으로 하는, 피부 오가노이드를 제공하는 것이다.Another object of the present invention is to provide a skin organoid prepared by the above method, wherein the skin organoid is a skin-simulating model of atopic dermatitis.

본 발명의 또 다른 목적은 상기 피부 오가노이드에 아토피 피부염 치료제 후보물질을 처리하는 단계를 포함하는, 아토피 피부염 치료제의 스크리닝 방법을 제공하는 것이다.Another object of the present invention is to provide a screening method for a therapeutic agent for atopic dermatitis, comprising the step of treating the skin organoid with a candidate substance for a therapeutic agent for atopic dermatitis.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

따라서, 상기한 본 발명의 목적을 달성하기 위하여, Therefore, in order to achieve the above object of the present invention,

본 발명은 하기의 단계를 포함하는 인간 만능성 줄기세포(pluripotent stem cell)로부터 피부 오가노이드(organoid)를 제조하는 방법을 제공한다:The present invention provides a method for preparing a skin organoid from human pluripotent stem cells comprising the steps of:

(a) 만능성 줄기세포 유래 오가노이드를 Wnt 작용제의 존재 하에 배양하는 단계;(a) culturing pluripotent stem cell-derived organoids in the presence of a Wnt agonist;

(b) 상기 단계 (a)의 배양물을 피부 오가노이드 성숙용 배지에서 40일 이상 배양하는 단계; 및(b) culturing the culture of step (a) in a medium for skin organoid maturation for at least 40 days; and

(c) 상기 단계 (b)의 배양물을 절단하여 공기-액체 계면에서 배양하는 단계(c) cutting the culture of step (b) and culturing at an air-liquid interface

본 발명의 일 구현예에서, 상기 Wnt 작용제는 CHIR-99021일 수 있으나, 이에 제한되는 것은 아니다.In one embodiment of the present invention, the Wnt agonist may be CHIR-99021, but is not limited thereto.

본 발명의 다른 구현예에서, 상기 Wnt 작용제는 만능성 줄기세포의 배양 5 내지 7일차에 첨가되는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the Wnt agonist may be added to the 5th to 7th day of culture of pluripotent stem cells, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 피부 오가노이드 성숙용 배지는 글루타맥스, 2-메르캅토에탄올, B-27, N2, 및 노르모신으로 이루어진 군으로부터 선택된 하나 이상의 성분을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다. In another embodiment of the present invention, the medium for skin organoid maturation may include one or more components selected from the group consisting of glutamax, 2-mercaptoethanol, B-27, N2, and normosin. , but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 (a) 단계의 수행 전에, 하기 단계를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다:In another embodiment of the present invention, before performing step (a), it may include the following steps, but is not limited thereto:

(1) 만능성 줄기세포의 배아체를 배양하는 단계;(1) culturing the embryonic body of pluripotent stem cells;

(2) 상기 배아체를 비신경 외배엽으로 분화 유도하는 단계; 및(2) inducing differentiation of the embryoid body into non-neural ectoderm; and

(3) 상기 비신경 외배엽을 두개골 신경능선 유사 세포로 분화 유도하는 단계.(3) inducing differentiation of the non-neural ectoderm into cranial neural crest-like cells.

본 발명의 또 다른 구현예에서, 상기 단계 (1)은 Y-27632의 존재 하에 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the step (1) may be performed in the presence of Y-27632, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 단계 (2)는 SB431542, FGF2, 및 BMP4의 존재 하에 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the step (2) may be performed in the presence of SB431542, FGF2, and BMP4, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 단계 (3)은 FGF2 및 LDN193189의 존재 하에 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the step (3) may be performed in the presence of FGF2 and LDN193189, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 단계 (a)의 배양은 5일 내지 14일 동안 실시되는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the culturing of step (a) may be carried out for 5 to 14 days, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 단계 (b)의 배양은 40일 내지 100일 동안 실시되는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the culturing of step (b) may be carried out for 40 to 100 days, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 단계 (c)의 배양은 3주 내지 4주 동안 실시되는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the culturing of step (c) may be carried out for 3 to 4 weeks, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 방법은 (d) 상기 단계 (c)의 배양물을 1 내지 10일간 건조 조건에서 배양하는 단계를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the method (d) may be to further include the step of culturing the culture of step (c) in dry conditions for 1 to 10 days, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 단계 (d)는 피부 오가노이드의 각질층 성숙을 위한 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the step (d) may be for maturation of the stratum corneum of the skin organoids, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 단계 (c)는 단계 (b)의 배양물을 4 개의 균일한 크기로 절단하고, 콜라겐 코팅된 트랜스 웰 배양 삽입물 상에 진피층은 콜라겐 쪽으로, 표피층은 공기에 노출되도록 배양하는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, in step (c), the culture of step (b) is cut into four uniform sizes, and the dermal layer is on the collagen-coated transwell culture insert, and the epidermal layer is in the air. It may be cultured to be exposed, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 단계 (c)의 공기-액체 계면 배양은 피부 오가노이드 성숙용 배지에서 실시되는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the air-liquid interface culture of step (c) may be carried out in a skin organoid maturation medium, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 피부 오가노이드는 연골 형성이 억제된 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the skin organoid may be one in which cartilage formation is suppressed, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 피부 오가노이드는 직경 2 내지 20mm를갖는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the skin organoid may have a diameter of 2 to 20 mm, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 피부 오가노이드는 표피층 밑에 진피층 및 피하지방층이 위치하는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the skin organoid may be one in which the dermal layer and the subcutaneous fat layer are located under the epidermal layer, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 피부 오가노이드는 KRT5(Keratin 5, CK5), KRT10, KRT15, KRT17, 로리크린(Loricrin), 필라그린(Filaggrin), SOX2(SRY-Box Transcription Factor 2), 및 멜란-A로 이루어진 군으로부터 선택된 하나 이상을 발현하는 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the skin organoids are KRT5 (Keratin 5, CK5), KRT10, KRT15, KRT17, Loricrin, Filaggrin, SOX2 (SRY-Box Transcription Factor 2), And it may be to express one or more selected from the group consisting of melan-A, but is not limited thereto.

본 발명의 또 다른 구현예에서, 상기 만능성 줄기세포는 배아줄기세포, 또는 유도만능줄기세포인 것일 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the pluripotent stem cells may be embryonic stem cells, or induced pluripotent stem cells, but is not limited thereto.

또한, 본 발명은 상기 방법으로 제조된 피부 오가노이드에 황색포도상구균을 처리하는 단계를 포함하는, 피부 오가노이드의 제작 방법으로서, 상기 피부 오가노이드는 아토피 피부염의 피부 모사 모델인 것을 특징으로 하는, 방법을 제공한다.In addition, the present invention is a method for producing a skin organoid comprising the step of treating Staphylococcus aureus to the skin organoid prepared by the above method, wherein the skin organoid is a skin-mimicking model of atopic dermatitis, characterized in that, provide a way

또한, 본 발명은 상기 방법으로 제작된 피부 오가노이드로서, 상기 피부 오가노이드는 아토피 피부염의 피부 모사 모델인 것을 특징으로 하는, 피부 오가노이드를 제공한다.In addition, the present invention provides a skin organoid produced by the above method, wherein the skin organoid is a skin-mimicking model of atopic dermatitis.

본 발명의 일 구현예에서, 상기 피부 오가노이드는 하기 특징으로 이루어진 군으로부터 선택된 하나 이상의 특징을 갖는 것일 수 있으나, 이에 제한되는 것은 아니다:In one embodiment of the present invention, the skin organoid may have one or more characteristics selected from the group consisting of the following characteristics, but is not limited thereto:

피부 진피층의 세포 사멸 증가;increased cell death of the dermal layer of the skin;

피부 표피 장벽 관련 마커인 KRT5, KRT10, 필라그린(Filaggrin), 로리크린(Loricrin), 및 클라우딘4(Claudin4)로 이루어진 군으로부터 선택된 하나 이상의 발현 저하;decreased expression of one or more selected from the group consisting of skin epidermal barrier-related markers KRT5, KRT10, Filaggrin, Loricrin, and Claudin4;

각질형성세포 분화(Keratinocyte differentiation) 유전자인 KRT 또는 KRTAP의 발현 감소;decreased expression of KRT or KRTAP, which is a keratinocyte differentiation gene;

항균 펩타이드(antimicrobial peptides) 유전자인 β-디펜신, PGLYRP2(펩티도글리칸 인식 단백질 2), TLR1(Toll Like Receptor 1), TLR2, LGALS9(갈렉틴 9), LCN2(Lipocalin 2) 및 S100A(S100 칼슘 결합 단백질)로 이루어진 군으로부터 선택된 하나 이상의 발현 증가;Antimicrobial peptides genes β-defensin, PGLYRP2 (peptidoglycan recognition protein 2), TLR1 (Toll Like Receptor 1), TLR2, LGALS9 (galectin 9), LCN2 (Lipocalin 2) and S100A (S100) increased expression of one or more selected from the group consisting of calcium binding proteins);

표피 또는 진피세포 유래 염증성 사이토카인(inflammatory cytokines) 유전자인 Cxcl(CXC 모티프 케모카인 리간드), Ccl(CC 모티프 케모카인 리간드), TSLP(Thymic stromal lymphopoietin), IL-1(interleukin-1), TNF(tumor necrosis factor)로 이루어진 군으로부터 선택된 하나 이상의 발현 증가;Epidermal or dermal cell-derived inflammatory cytokines genes Cxcl (CXC motif chemokine ligand), Ccl (CC motif chemokine ligand), TSLP (Thymic stromal lymphopoietin), IL-1 (interleukin-1), TNF (tumor necrosis) factor) increased expression of one or more selected from the group consisting of;

표피 줄기세포 마커 KRT15의 발현 저하; 및decreased expression of the epidermal stem cell marker KRT15; and

황색포도상구균의 집락(colonization) 형성.Colonization of Staphylococcus aureus.

또한, 본 발명은 상기 피부 오가노이드에 아토피 피부염 치료제 후보물질을 처리하는 단계를 포함하는, 아토피 피부염 치료제의 스크리닝 방법을 제공한다.In addition, the present invention provides a screening method for an atopic dermatitis therapeutic agent comprising the step of treating the atopic dermatitis therapeutic agent candidate to the skin organoid.

또한, 본 발명은 상기 피부 오가노이드의 아토피 피부염 치료제 스크리닝 용도를 제공한다.In addition, the present invention provides a screening use of the skin organoid for atopic dermatitis therapeutic agent.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 아토피 피부염의 예방 또는 치료용 약학적 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for preventing or treating atopic dermatitis comprising Cutibacterium acnes or a culture solution thereof as an active ingredient.

본 발명의 일 구현예에서, 상기 조성물은 필라그린(Filaggrin)의 발현을 증가시키는 것일 수 있으나, 이에 제한되는 것은 아니다. In one embodiment of the present invention, the composition may increase the expression of filaggrin, but is not limited thereto.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 아토피 피부염의 예방 또는 개선용 식품 조성물을 제공한다.In addition, the present invention provides a food composition for preventing or improving atopic dermatitis comprising Cutibacterium acnes or a culture solution thereof as an active ingredient.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 아토피 피부염의 예방 또는 개선용 화장료 조성물을 제공한다.In addition, the present invention provides a cosmetic composition for preventing or improving atopic dermatitis comprising Cutibacterium acnes or a culture solution thereof as an active ingredient.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 약학적 조성물을 개체에 투여하는 단계를 포함하는 아토피 피부염의 예방 또는 치료 방법을 제공한다.In addition, the present invention provides a method for preventing or treating atopic dermatitis comprising administering to an individual a pharmaceutical composition comprising Cutibacterium acnes or a culture medium thereof as an active ingredient.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 약학적 조성물의 아토피 피부염의 예방 또는 치료 용도를 제공한다.In addition, the present invention provides a use for preventing or treating atopic dermatitis of a pharmaceutical composition comprising Cutibacterium acnes or a culture medium thereof as an active ingredient.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액의 아토파 피부염 예방 또는 치료 약제를 생산하기 위한 용도를 제공한다.In addition, the present invention provides a use for producing a medicament for preventing or treating atopa dermatitis of Cutibacterium acnes or a culture solution thereof.

본 발명자들은 Wnt 작용제를 6일차에 처리함에 따라 오가노이드 크기가 현저히 증가될 뿐만 아니라, 피부 오가노이드의 불필요한 구성요소인 연골의 형성이 억제되는 것을 확인하였다. 본 발명의 ALI-피부 오가노이드는 기존의 배양법에 제조된 피부 오가노이드에 비해 피부세포, 부속물, 신경세포, 지방세포 등이 실제 피부와 유사한 구조로 형성되고, 모낭 성장이 크게 향상된 것을 관찰 하였으며 실제 피부와 유사한 구조로 오가노이드가 형성됨을 확인하였다. 이에 더하여, 아토피 피부염 모델을 제작하기 위해 황색포도상구균을 처리한 결과, 손상된 피부 장벽, 상피세포 유래 사이토카인 증가, 피부 장벽 기능 관련 유전자 발현 저하, 각질세포 분화 관련 유전자 발현 저하, 항균 펩타이드(Antimicrobial peptides) 유전자 발현 증가, 표피 및 진피세포 유래 사이토카인 유전자 발현 증가 및 표피 줄기세포 발현 저하, 황색포도상구균 집락을 일으키는 등 아토피 피부염의 특징이 잘 모사되었는 바, 본 발명의 피부 오가노이드를 실제 피부 모델 및 아토피 피부염 모델로서 유용하게 활용할 수 있을 것으로 기대된다. The present inventors confirmed that as the Wnt agonist was treated on the 6th day, not only the organoid size was significantly increased, but also the formation of cartilage, an unnecessary component of skin organoids, was inhibited. In the ALI-skin organoid of the present invention, it was observed that skin cells, appendages, nerve cells, fat cells, etc. were formed in a structure similar to that of actual skin, and hair follicle growth was greatly improved compared to skin organoids prepared in the conventional culture method. It was confirmed that the organoid was formed in a structure similar to that of the skin. In addition, as a result of treating Staphylococcus aureus to produce atopic dermatitis model, damaged skin barrier, epithelial cell-derived cytokine increase, skin barrier function-related gene expression decrease, keratinocyte differentiation-related gene expression decrease, antimicrobial peptides ) Gene expression increase, epidermal and dermal cell-derived cytokine gene expression increase and epidermal stem cell expression decrease, and the characteristics of atopic dermatitis, such as causing Staphylococcus aureus colonization, were well simulated. It is expected to be useful as a model for atopic dermatitis.

또한 본 발명의 아토피 피부염 모델을 이용하여 마이크로바이옴 치료제로 유익한 인간 공생 박테리아인 큐티박테리움 아크네스(Cutibacterium acnes)가 황색포도상구균 감염으로 인한 피부 장벽 파괴를 구제하고 황색포도상구균 집락화에 대한 보호 메커니즘을 제공함을 확인하였다. 따라서, 큐티박테리움 아크네스의 황색포도상구균 매개 피부 장벽 파괴 및 세포 손상에 대해 유의한 예방 및 치료 효과를 통해 아토피 피부염 치료에 유용하게 사용할 수 있을 것으로 기대된다.In addition, using the atopic dermatitis model of the present invention, Cutibacterium acnes , a beneficial human symbiotic bacterium as a microbiome treatment, relieves skin barrier destruction due to Staphylococcus aureus infection and a protective mechanism against Staphylococcus aureus colonization. was confirmed to be provided. Therefore, it is expected that Cutibacterium acnes can be usefully used in the treatment of atopic dermatitis through significant preventive and therapeutic effects on Staphylococcus aureus-mediated skin barrier destruction and cell damage.

도 1은 기존 방법을 이용한 인간 유도만능줄기세포주를 이용한 피부 오가노이드 형성 타임라인(63일~138일)과 단계별 사진을 나타낸 것이다. Scale bars 500 μm
도 2는 기존 방법을 이용해 제작한 피부 오가노이드의 140일째 피부 오가노이드 사진으로, 피그멘티드(pigmented) 모낭(상단 패널)과 알비노(albino) 모낭(하단 패널)을 포함하고 있는 양상을 확인한 것이다. Scale bars 500 μm
도 3a 내지 도 3c는 기존 방법을 이용해 제작한 피부 오가노이드의 분화 마커 형광 염색 사진을 나타낸 것이다. 도 3a는 22일차 피부 오가노이드의 표피 전구세포 마커(TFAP+ KRT5+) 염색 사진(좌) 및 진피전구세포(TFAP+ PDGFRα+) 염색 사진(우)이며, 도 3b는 피부 모낭 진피유두세포 발현 마커(Sox2) 염색 사진으로, 67일차(좌), 및 83일차(우)의 사진이며, 도 3c는 유리연골(hyaline cartilage) 연골세포 분화 마커(S100α; 좌 및 Coll2A1; 우) 염색 사진을 나타낸 것이다. Scale bars 50 μm.
도 4는 기존 방법을 이용해 제작한 피부 오가노이드에서 표피층 형성 타임라인을 나타낸 것이다. KRT5 및 KRT14(기저막 마커), KRT10(유극층 마커), Loricrin 및 filaggrin(각질층 마커)에 대한 면역 조직 화학 분석 결과를 나타낸 것이다. Scale bars 50 μm
도 5는 Wnt 신호 전달 경로 활성화(0.5-8μM Wnt 작용제(CHIR-99021)) 첨가를 통한 본 발명의 인간 만능성 줄기세포로부터 삼차원 ALI-피부 오가노이드 배양 방법을 나타낸 것이다.
도 6은 6, 14, 25, 49, 85일째 피부 오가노이드의 이미지를 기반으로 한 피부 오가노이드 직경(mm)을 정량화한 결과를 나타낸 것이다. CHIR (-): CHIR-99021 첨가하지 않음, CHIR (+): CHIR-99021 첨가함. Mean ± SEM; n=9; ***은 P<0.0005을 나타냄.
도 7은 14, 25, 38, 65, 또는 85일째 유도 만능 줄기세포 유래 피부 오가노이드의 사진을 나타낸 것이다. CHIR (-): CHIR-99021 첨가하지 않음, CHIR (+): CHIR-99021 첨가함. CHIR (-) 38, 65, 85일째 되는 피부 오가노이드 사진에서의 빨강색 동그라미는 연골구조를 나타냄. Scale bars 1mm.
도 8은 69일째 된 유도만능 줄기세포 유래 피부 오가노이드에서 Real-time PCR을 통해 연골 발현 마커인 COL2A1, ACAN, 및 SOX9의 유전자 발현 수준을 분석한 결과이다. CHIR (-): CHIR-99021 첨가하지 않음, CHIR (+): CHIR-99021 첨가함. n=3; ***은 P<0.0005을 나타냄
도 9는 공기-액체 계면(Air-liquid interface; ALI) 배양법을 응용한 인간 유도 만능 줄기세포로부터 삼차원 공기-액체 계면-피부 오가노이드 모델(ALI-피부오가노이드)의 제조방법을 나타낸 것이다.
도 10a 및 도 10b는 ALI-피부 오가노이드와 기존의 프로토콜로 배양된 피부 오가노이드(Whole skin organoid)를 비교한 결과를 나타낸 것으로, 도 10a는 138 일째 ALI-피부 오가노이드와 기존 피부 오가노이드 비교의 대표 사진을 나타낸 것이며, 도 10b는 H&E(hematoxylin & Eosin) 조직 염색 결과를 나타낸 것이다. Scale bars 500 μm
도 11은 ALI-피부 오가노이드의 피하지방과 모낭 주위에 발달된 피지선을 Oil Red O 염색한 결과를 나타낸 것이다. x100 (좌) 및 x200 (우).
도 12는 총 119일째 된 ALI-피부 오가노이드의 모낭 H&E 염색 사진 (x200)을 나타낸 것이다. (피부 오가노이드 배양 68일 + ALI 배양 51일)
도 13a는 총 114일째 된 ALI-피부 오가노이드 사진으로써, 피부 오가노이드를 85일 동안 배양 하고 3주 동안 100% 습도 조건에서 ALI 배양한 다음, 건조 조건(dry condition)에서 피부 각질세포를 성숙화하기 위해 0일, 2일, 4일, 또는 6일 동안 ALI 배양한 것이다. Scale bars 500 μm.
도 13b는 총 114일째 된 ALI-피부 오가노이드에 대한 H&E(hematoxylin & Eosin) 조직 염색 결과를 나타낸 것이다. 피부 오가노이드를 85일 동안 배양 하고 3주 동안 100% 습도 조건에서 ALI 배양한 다음, 건조 조건(dry condition)에서 피부 각질세포를 성숙화하기 위해 0일, 2일, 4일, 또는 6일 동안 ALI 배양한 것이다. Scale bars 500 μm
도 14는 ALI-피부 오가노이드의 피부 표피층 구조 관련 마커의 형광 염색 사진을 나타낸 것이다. (a) ALI-피부오가노이드 기저막 (KRT5) 및 유극층(KRT10) 마커 염색 사진, (b) ALI-피부오가노이드 각질층(Loricrin) 마커 염색 사진, 및 (c) ALI-피부오가노이드 각질층(Filaggrin) 마커 염색 사진이다. Scale bars 50 μm
도 15는 ALI-피부 오가노이드 모낭구조 관련 마커의 형광 염색 사진을 나타낸 것이다. (a) ALI-피부 오가노이드 표피세포(E-cadherin) 및 진피세포(PDGGR) 마커 염색 사진, (b) ALI-피부 오가노이드 Hair bulge area(KRT15) 마커 염색 사진, (c) ALI-피부 오가노이드 표피층 멜라노사이트(melanA) 마커 염색 사진, (d) ALI-피부 오가노이드 모낭 모유두세포(Sox2) 및 멀켈 세포(Sox2) 마커 염색 사진, (e) ALI-피부오가노이드 모낭 멜라노사이트(MelanA) 마커 염색 사진, 및 (f) ALI-피부 오가노이드 Outer root sheat(KRT17) 마커 염색 사진이다. Scale bars 50 μm
도 16은 피부 오가노이드를 85일 동안 배양 하고 3주 동안 100% 습도 조건에서 ALI 배양한 다음, 건조 조건(dry condition)에서 피부 각질세포를 성숙화하기 위해 0일, 2일, 4일, 또는 6일 동안 ALI 배양한 피부 오가노이드의 피부 표피층 구조 관련 마커의 형광 염색 사진을 나타낸 것이다. a는 ALI-피부오가노이드 기저막(KRT5) 및 각질층(Filaggrin) 마커 염색 사진, b는 ALI-피부오가노이드 각질층(Loricrin) 및 유극층(KRT10) 마커 염색 사진이다. Scale bars 50 μm
도 17은 피부 오가노이드를 85일 동안 배양 하고 3주 동안 100% 습도 조건에서 ALI 배양한 다음, 건조 조건(dry condition)에서 피부 각질세포를 성숙화하기 위해 0일, 2일, 4일, 또는 6일 동안 ALI 배양한 피부 오가노이드의 피부 진피층 구조 관련 마커의 형광 염색 사진을 나타낸 것이다. ALI-피부오가노이드 기저막(KRT5; 빨강색), 진피층 콜라겐 3(COL3; 녹색; 좌) 및 비맨틴(VIM; 녹색; 우) 마커 염색 사진 이다. Scale bars 50 μm
도 18은 피부 오가노이드를 85일 동안 배양 하고 3주 동안 100% 습도 조건에서 ALI 배양한 다음, 건조 조건(dry condition)에서 피부 각질세포를 성숙화하기 위해 0일, 2일, 4일, 또는 6일 동안 ALI 배양한 피부 오가노이드의 피하지방(Lipid tox; 빨강색; 좌)과 모낭 주위에 발달된 피지선(Lipid tox; 빨강색; 우)을 염색한 결과를 나타낸 것이다. Scale bars 50 μm
도 19는 ALI-피부 오가노이드에 황색포도상구균을 표면에 접종 감염시켜 아토피 피부염 모델링한 사진을 나타낸 것이다. 구체적으로, 황색포도상구균(ATCC 29213; 0 CFU(PBS only), 1x105 CFU, 1x106 CFU 또는 1x107 CFU)을 ALI-피부 오가노이드에 표면 접종 24 시간 후, (위) ALI-피부 오가노이드 H&E 염색 사진, 및 (아래) 황색포도상구균(녹색) 및 기저 상피층(KRT5, 빨강색) 마커 염색 사진을 나타낸 것이다. Scale bars 50 μm
도 20는 ALI-피부 오가노이드에 황색포도상구균을 감염시켜 아토피 피부염을 모델링한 것으로, 황색포도상구균을 ALI-피부 오가노이드에 표면 접종 24 시간 후, (위) 세포 증식(Ki67; 녹색) 마커 및 기저 상피층(KRT5; 빨강색) 마커 염색사진, 및 (아래) 세포 사멸(TUNEL, 빨강색) 및 기저 상피층(KRT5; 녹색) 마커 염색 사진을 나타낸 것이다. Scale bars 50 μm
도 21은 ALI-피부 오가노이드에 황색포도상구균을 감염시켜 아토피 피부염을 모델링한 것으로, 황색포도상구균을 ALI-피부 오가노이드에 표면 접종 24 시간 후, (위) 각질층(Filaggrin; 녹색) 및 기저 상피층(KRT5; 빨강색) 마커 염색 사진, (중간) 각질층(Loricrin; 녹색) 및 기저 상피층(KRT14; 빨강색) 마커 염색 사진, 및 (아래) 유극층(KRT 10; 녹색) 및 기저 상피층(KRT5; 빨강색) 마커 염색 사진을 나타낸 것이다. Scale bars 50 μm
도 22는 ALI-피부 오가노이드에 황색포도상구균을 감염시켜 아토피 피부염을 모델링한 것으로, 황색포도상구균을 ALI-피부 오가노이드에 표면 접종 24 시간 후, 피부 상피세포 사이토카인 발현을 형광염색을 통해 확인한 결과이다. 황색포도상구균 감염 ALI-피부 오가노이드 상피세포 사이토카인(TSLP; 녹색) 및 기저 상피층(KRT14; 빨강색) 마커의 염색 사진을 나타낸 것이다. Scale bars 50 μm.
도 23은 ALI-피부 오가노이드에 황색포도상구균을 감염시켜 아토피 피부염을 모델링한 것으로, 황색포도상구균을 ALI-피부 오가노이드에 표면 접종 24 시간 후, 피부 표피 줄기세포 발현 감소를 형광염색을 통해 확인한 결과이다. (위) 황색포도상구균 감염 ALI-피부 오가노이드 표피 줄기세포(KRT15; 녹색) 및 기저 상피층(KRT5; 빨강색) 마커 염색 사진, 및 (아래) 표피 줄기세포 마커(p63; 녹색) 및 기저 상피층(KRT5; 빨강색) 마커의 염색 사진을 나타낸 것이다. Scale bars 50 μm.
도 24는 ALI-피부 오가노이드에 황색포도상구균을 감염시켜 아토피 피부염을 모델링한 것으로, 황색포도상구균을 ALI-피부 오가노이드에 표면 접종 24 시간 후, 피부 상피세포 사이토카인 발현을 형광염색을 통해 확인한 결과이다. 피부 장벽 집합 단백질(tight junctional protein) 마커인 집합 단백질(Claudin 4(CLDN4); 녹색) 및 기저 상피층(KRT5; 빨강색) 마커의 염색 사진을 나타낸 것이다. Scale bars 50 μm.
도 25a 내지 도 25f는 ALI-피부 오가노이드에 황색포도상구균을 감염시켜 아토피 피부염을 모델링한 것으로, 황색포도상구균을 ALI-피부 오가노이드에 표면 접종한 18 시간 후, 유전자 발현 변화를 RNA-sequencing 분석 방법으로 비교 분석한 결과이다. 황색포도상구균이 처리된 ALI-피부 오가노이드와 처리되지 않은 대조군 사이의 생물학적 복제물 사이에서 많은 수의 유전자 발현의 뚜렷한 차이를 나타내고 있음을 확인하였다.
도 25a는 차등적으로 발현된 유전자(Differentially expressed genes; DEG; 진한 파랑색)를 화산 플롯 (volcano plot)으로 나타낸 것이다.
도 25b에서는 차등적으로 발현된 유전자를 묘사하는 히트 맵 heat map)을 통해 시각화하여 나타낸 것이다. 4,255개의 차등적으로 발현된 유전자(DEG) 중 2,162개의 유전자가 높게 발현되었으며 2,093개의 유전자가 S. aureus 접종에 의해 낮게 발현되었다(조정된 p 값 < 0.05). 빨강색은 대조군, 파랑색은 황색포도상구균이 처리된 ALI-피부 오가노이드를 나타낸다.
도 25c는 황색포도상구균 감염된 ALI-피부 오가노이드와 처리되지 않은 대조군 사이의 피부 장벽 기능 관련 유전자 발현을 RNA-sequencing 분석으로 비교한 결과이다.
도 25d는 황색포도상구균 처리된 ALI-피부 오가노이드와 처리되지 않은 대조군 사이의 각질형성세포 분화(keratinocyte differentiation) 관련된 유전자 발현을 RNA-sequencing 분석으로 비교한 결과이다.
도 25e는 황색포도상구균이 처리된 ALI-피부 오가노이드와 처리되지 않은 대조군 사이의 항균펩타이드(Antimicrobial peptides; AMP) 관련된 유전자 발현을 RNA-sequencing 분석으로 비교한 결과이다.
도 25f는 황색포도상구균이 처리된 ALI-피부 오가노이드와 처리되지 않은 대조군 사이의 염증성 사이토카인(inflammatory cytokines) 관련 유전자 발현을 RNA-sequencing 분석으로 비교한 결과이다.
도 26a는 ALI 피부 오가노이드 배양 방법과 큐티박테리움 아크네스 전-처리 및 황색포도상구균 접종 방법을 나타낸 것이다.
도 26b는 큐티박테리움 아크네스 처리에 따른 필라그린(Filaggrin; 녹색)과 KRT5(빨강색)의 면역 조직 염색 분석 결과를 나타낸 것이다. Scale bars 50 μm.1 shows the skin organoid formation timeline (63 days to 138 days) and step-by-step photos using the human induced pluripotent stem cell line using the existing method. Scale bars 500 μm
2 is a photograph of skin organoids on day 140 of skin organoids produced using the existing method, confirming the aspect including pigmented hair follicles (upper panel) and albino hair follicles (lower panel) . Scale bars 500 μm
3A to 3C show photographs of differentiation marker fluorescence staining of skin organoids prepared using the conventional method. Figure 3a is an epidermal progenitor cell marker (TFAP+ KRT5+) staining photograph (left) and a dermal progenitor cell (TFAP+ PDGFRα+) staining photograph (right) of a skin organoid on day 22, and Figure 3b is a skin follicle dermal papilla cell expression marker (Sox2). ) staining pictures, pictures of days 67 (left) and 83 days (right), and FIG. 3c shows a picture of hyaline cartilage chondrocyte differentiation marker (S100α; left and Coll2A1; right) staining. Scale bars 50 μm.
4 shows a timeline for forming an epidermal layer in a skin organoid manufactured using an existing method. The results of immunohistochemical analysis for KRT5 and KRT14 (a basement membrane marker), KRT10 (a stratum corneum marker), Loricrin and filaggrin (stratum corneum marker) are shown. Scale bars 50 μm
5 shows a three-dimensional ALI-skin organoid culture method from human pluripotent stem cells of the present invention through addition of Wnt signaling pathway activation (0.5-8 μM Wnt agonist (CHIR-99021)).
6 shows the results of quantifying the skin organoid diameter (mm) based on the images of the skin organoids on days 6, 14, 25, 49, and 85. CHIR (-): CHIR-99021 not added, CHIR (+): CHIR-99021 added. Mean ± SEM; n=9; *** indicates P<0.0005.
7 shows photographs of induced pluripotent stem cell-derived skin organoids on days 14, 25, 38, 65, or 85. CHIR (-): CHIR-99021 not added, CHIR (+): CHIR-99021 added. CHIR (-) Red circles in skin organoid photos on days 38, 65, and 85 indicate cartilage structure. Scale bars 1mm.
8 is a result of analyzing the gene expression levels of cartilage expression markers COL2A1, ACAN, and SOX9 in skin organoids derived from induced pluripotent stem cells at day 69 through real-time PCR. CHIR (-): CHIR-99021 not added, CHIR (+): CHIR-99021 added. n=3; *** indicates P<0.0005
9 shows a method for preparing a three-dimensional air-liquid interface-skin organoid model (ALI-skin organoid) from human induced pluripotent stem cells to which an air-liquid interface (ALI) culture method is applied.
10a and 10b show the results of comparing ALI-skin organoids with whole skin organoids cultured with the existing protocol, and FIG. 10a shows ALI-skin organoids and conventional skin organoids on day 138 comparison is a representative photograph of , and FIG. 10b shows the results of hematoxylin & Eosin (H&E) tissue staining. Scale bars 500 μm
11 shows the results of Oil Red O staining of the sebaceous glands developed around the subcutaneous fat and hair follicles of ALI-skin organoids. x100 (left) and x200 (right).
12 shows a photograph (x200) of hair follicle H&E staining of ALI-skin organoids at a total of 119 days. (68 days of skin organoid culture + 51 days of ALI culture)
13a is a picture of ALI-skin organoids at 114 days in total, in which skin organoids were cultured for 85 days and ALI cultured under 100% humidity conditions for 3 weeks, followed by maturation of skin keratinocytes in dry conditions ALI culture for 0 days, 2 days, 4 days, or 6 days. Scale bars 500 μm.
13B shows the results of hematoxylin & Eosin (H&E) tissue staining for ALI-skin organoids of 114 days in total. Skin organoids were cultured for 85 days, followed by ALI culture at 100% humidity for 3 weeks, followed by ALI for 0 days, 2 days, 4 days, or 6 days to mature skin keratinocytes in dry conditions. it has been cultivated Scale bars 500 μm
14 is a photograph showing the fluorescent staining of ALI-skin organoids related to the structure of the epidermal layer of the skin. (a) ALI-skinorganoid basement membrane (KRT5) and stratum corneum (KRT10) marker staining pictures, (b) ALI-skinorganoid stratum corneum (Loricrin) marker staining pictures, and (c) ALI-skinorganoid stratum corneum (Filaggrin) ) is a picture of marker staining. Scale bars 50 μm
15 shows a photograph of fluorescent staining of ALI-skin organoid hair follicle structure-related markers. (a) ALI-skin organoid epidermal cell (E-cadherin) and dermal cell (PDGGR) marker staining picture, (b) ALI-skin organoid hair bulge area (KRT15) marker staining picture, (c) ALI-skin organoid staining picture Noid epidermal layer melanocyte (melanA) marker staining picture, (d) ALI-skin organoid hair follicle dermal papilla cell (Sox2) and Merkel cell (Sox2) marker staining picture, (e) ALI-dermal organoid hair follicle melanocyte (MelanA) marker Staining pictures, and (f) ALI-skin organoid outer root sheat (KRT17) marker staining pictures. Scale bars 50 μm
16 shows skin organoids cultured for 85 days and ALI cultured under 100% humidity conditions for 3 weeks, followed by 0 days, 2 days, 4 days, or 6 days for maturation of skin keratinocytes in dry conditions. A photograph of fluorescent staining of the skin epidermal layer structure-related markers of skin organoids cultured with ALI for one day is shown. a is ALI-skin organoid basement membrane (KRT5) and stratum corneum (Filaggrin) marker staining picture, b is ALI- skin organoid stratum corneum (Loricrin) and stratum corneum (KRT10) marker staining picture. Scale bars 50 μm
17 shows skin organoids cultured for 85 days and ALI cultured at 100% humidity for 3 weeks, followed by 0 days, 2 days, 4 days, or 6 days to mature skin keratinocytes in dry conditions. Fluorescent staining pictures of dermal dermal structure-related markers of skin organoids cultured with ALI for one day are shown. ALI-skin organoid basement membrane (KRT5; red), dermal collagen 3 (COL3; green; left) and vimantin (VIM; green; right) marker staining pictures. Scale bars 50 μm
18 shows skin organoids cultured for 85 days and ALI cultured under 100% humidity conditions for 3 weeks, then 0 days, 2 days, 4 days, or 6 days for maturation of skin keratinocytes in dry conditions This shows the results of staining the subcutaneous fat (Lipid tox; red; left) and the sebaceous glands (Lipid tox; red; right) developed around the hair follicles of skin organoids cultured with ALI for one day. Scale bars 50 μm
19 shows a photograph of modeling atopic dermatitis by inoculating and inoculating the surface with Staphylococcus aureus to ALI-skin organoids. Specifically, 24 hours after surface inoculation of Staphylococcus aureus (ATCC 29213; 0 CFU (PBS only), 1x10 5 CFU, 1x10 6 CFU or 1x10 7 CFU) into ALI-skin organoids, (top) ALI-skin organoids H&E staining pictures, and (bottom) Staphylococcus aureus (green) and basal epithelial layer (KRT5, red) marker staining pictures are shown. Scale bars 50 μm
20 is a model of atopic dermatitis by infecting ALI-skin organoids with Staphylococcus aureus. 24 hours after surface inoculation of Staphylococcus aureus into ALI-skin organoids, (top) cell proliferation (Ki67; green) markers and Basal epithelial layer (KRT5; red) marker staining pictures, and (bottom) cell death (TUNEL, red) and basal epithelial layer (KRT5; green) marker staining pictures are shown. Scale bars 50 μm
21 is a model of atopic dermatitis by infecting ALI-skin organoids with Staphylococcus aureus, and 24 hours after surface inoculation of Staphylococcus aureus into ALI-skin organoids, (top) stratum corneum (Filaggrin; green) and basal epithelial layer. (KRT5; red) marker staining pictures, (middle) stratum corneum (Loricrin; green) and basal epithelial layer (KRT14; red) marker staining pictures, and (bottom) stratum corneum (KRT 10; green) and basal epithelial layer (KRT5; Red) shows a photograph of marker staining. Scale bars 50 μm
22 is a model of atopic dermatitis by infecting ALI-skin organoids with Staphylococcus aureus, and 24 hours after surface inoculation of Staphylococcus aureus into ALI-skin organoids, skin epithelial cell cytokine expression was confirmed through fluorescence staining. It is the result. Staining pictures of Staphylococcus aureus infection ALI-skin organoid epithelial cytokine (TSLP; green) and basal epithelial (KRT14; red) markers are shown. Scale bars 50 μm.
23 is a model of atopic dermatitis by infecting Staphylococcus aureus in ALI-skin organoids, and 24 hours after surface inoculation of Staphylococcus aureus to ALI-skin organoids, the reduction in skin epidermal stem cell expression was confirmed through fluorescence staining. It is the result. (Top) Staphylococcus aureus-infected ALI-skin organoid epidermal stem cell (KRT15; green) and basal epithelial layer (KRT5; red) marker staining photograph, and (bottom) epidermal stem cell marker (p63; green) and basal epithelial layer ( KRT5; red) shows the staining photos of the markers. Scale bars 50 μm.
24 is ALI- skin organoids were infected with Staphylococcus aureus to model atopic dermatitis. 24 hours after surface inoculation of Staphylococcus aureus into ALI-skin organoids, skin epithelial cell cytokine expression was confirmed through fluorescence staining. It is the result. Staining photographs of the skin barrier aggregate protein (tight junctional protein) marker aggregate protein (Claudin 4 (CLDN4); green) and the basal epithelial layer (KRT5; red) marker are shown. Scale bars 50 μm.
25A to 25F are models of atopic dermatitis by infecting ALI-skin organoids with Staphylococcus aureus, and RNA-sequencing analysis of gene expression changes 18 hours after surface inoculation of Staphylococcus aureus into ALI-skin organoids. It is the result of comparative analysis by the method. It was confirmed that Staphylococcus aureus exhibited distinct differences in expression of a large number of genes between biological replicates between treated ALI-skin organoids and untreated controls.
25A is a volcano plot showing differentially expressed genes (DEG; dark blue).
In FIG. 25B, it is visualized through a heat map (heat map) depicting differentially expressed genes. Of the 4,255 differentially expressed genes (DEGs), 2,162 genes were highly expressed and 2,093 genes were low expressed by S. aureus inoculation (adjusted p value < 0.05). Red indicates control, and blue indicates ALI-skin organoids treated with Staphylococcus aureus.
25C is a result of comparing the expression of skin barrier function-related genes between Staphylococcus aureus-infected ALI-skin organoids and untreated controls by RNA-sequencing analysis.
25D is a result of RNA-sequencing analysis of gene expression related to keratinocyte differentiation between Staphylococcus aureus-treated ALI-skin organoids and untreated controls.
25E is a result of comparing the expression of antimicrobial peptides (AMP)-related genes between Staphylococcus aureus-treated ALI-skin organoids and untreated controls by RNA-sequencing analysis.
25f is a comparison result of inflammatory cytokines-related gene expression between Staphylococcus aureus-treated ALI-skin organoids and untreated controls by RNA-sequencing analysis.
Figure 26a shows the ALI skin organoid culture method, Cutibacterium acnes pre-treatment and Staphylococcus aureus inoculation method.
Figure 26b shows the results of immunohistochemical staining analysis of Filaggrin (green) and KRT5 (red) according to the cutibacterium acnes treatment. Scale bars 50 μm.

본 발명은 하기의 단계를 포함하는 인간 만능성 줄기세포(pluripotent stem cell)로부터 피부 오가노이드(organoid)를 제조하는 방법을 제공한다:The present invention provides a method for preparing a skin organoid from human pluripotent stem cells comprising the steps of:

(a) 만능성 줄기세포 유래 오가노이드를 Wnt 작용제의 존재 하에 배양하는 단계;(a) culturing pluripotent stem cell-derived organoids in the presence of a Wnt agonist;

(b) 상기 단계 (a)의 배양물을 피부 오가노이드 성숙용 배지에서 40일 이상 배양하는 단계; 및(b) culturing the culture of step (a) in a medium for skin organoid maturation for at least 40 days; and

(c) 상기 단계 (b)의 배양물을 절단하여 공기-액체 계면에서 배양하는 단계.(c) cutting the culture of step (b) and culturing at an air-liquid interface.

이하, 본 발명을 상세히 설명한다. Hereinafter, the present invention will be described in detail.

본 발명에서, "오가노이드"란 용어는 조직 또는 기관의 표면적 외관 또는 실제 구조 또는 기능을 모방하는 하나 이상의 세포 유형의 3차원 집합체를 지칭한다. 또한, 오가노이드는 인체의 생리활성기능을 유사하게 재현할 수 있고, 환자의 조직으로부터 장기유사체를 구축함으로써 환자의 유전정보를 기반으로 한 질병 모델링, 반복시험을 통한 약물 스크리닝 등을 할 수 있다.As used herein, the term "organoid" refers to a three-dimensional aggregate of one or more cell types that mimics the superficial appearance or actual structure or function of a tissue or organ. In addition, organoids can similarly reproduce the physiologically active functions of the human body, and by constructing organ analogues from the patient's tissue, disease modeling based on the patient's genetic information, drug screening through repeated tests, etc. can be performed.

본 발명에서, "오가노이드 배양"은 오가노이드를 생성하거나 유지시킬 수 있는 모든 행위를 포함한다. 예를 들면 세포 또는 특정 조직으로부터 분리된 세포가 특정 기능을 갖는 조직이나 기관 세포로 분화시키는 것일 수 있으며, 및/또는 오가노이드를 생존, 성장 또는 증식시키는 것일 수 있다.In the present invention, "organoid culture" includes any activity capable of generating or maintaining an organoid. For example, cells or cells isolated from specific tissues may be differentiated into tissue or organ cells having specific functions, and/or organoids may survive, grow, or proliferate.

본 발명에서, 만능성 줄기세포(pluripotent stem cell)는 내배엽, 중배엽, 외배엽을 구성하는 거의 모든 종류의 세포로 분화할 수 있는 줄기세포들을 통칭한다. 본 발명에서, 상기 만능성 줄기세포는 배아줄기세포, 또는 유도만능줄기세포인 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, pluripotent stem cells (pluripotent stem cells) collectively refers to stem cells capable of differentiating into almost all types of cells constituting the endoderm, mesoderm, and ectoderm. In the present invention, the pluripotent stem cells may be embryonic stem cells or induced pluripotent stem cells, but is not limited thereto.

본 발명에서 용어, "배아줄기세포(embryonic stem cell; ESC)"란 수정란이 모체의 자궁에 착상하기 직전인 포배기 배아에서 내세포괴를 추출하여 체외에서 배양한 것으로 동물의 모든 세포로 분화할 수 있는 다능성(pluripotency)을 가지는 세포를 의미하며, 바람직하게는 인간 유래의 인간 배아줄기세포이다.As used herein, the term "embryonic stem cell (ESC)" refers to the extraction of the inner cell mass from the blastocyst embryo just before implantation of the fertilized egg into the mother's uterus and culturing it in vitro. It refers to cells having pluripotency, preferably human-derived human embryonic stem cells.

본 발명에서 용어, "유도 만능줄기세포(induced pluripotent stem cell; iPSC, 역분화 줄기세포)란 동물의 체세포에 역분화 기술을 이용하여 배아줄기세포와 유사한 분화능을 가진 미분화 상태의 줄기세포를 확립하는 방식으로 만들어진 것으로, 분화능력이 ESC와 비슷한 수준인 줄기세포를 의미한다.As used herein, the term "induced pluripotent stem cells (iPSCs, iPSCs) is a method of establishing undifferentiated stem cells with differentiation ability similar to embryonic stem cells by using dedifferentiation technology in somatic cells of animals. It refers to stem cells with a differentiation capacity similar to that of ESCs.

본 발명에서 용어, "배아체(embryoid body)"란 부유배양 상태에서 생성된 구형체 모양의 줄기세포 유래 세포덩어리를 의미하며, 잠재적으로 내배엽, 중배엽, 외배엽으로 분화할 수 있는 능력을 가짐으로써 조직-특이적 분화 세포를 확보하기 위한 대부분의 분화유도 과정에서 전구체로 이용되고 있다.As used herein, the term "embryoid body" refers to a spheroid-shaped stem cell-derived cell mass generated in a suspended culture state, and potentially has the ability to differentiate into endoderm, mesoderm, and ectoderm. -It is used as a precursor in most differentiation induction processes to secure specific differentiated cells.

본 발명에서, 상기 Wnt 작용제는 CHIR-99021일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the Wnt agonist may be CHIR-99021, but is not limited thereto.

본 발명에서, 상기 Wnt 작용제는 유도만능줄기세포의 배양 5 내지 7일차에 첨가되는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the Wnt agonist may be added to the 5th to 7th day of culture of induced pluripotent stem cells, but is not limited thereto.

본 발명에서, 상기 피부 오가노이드 성숙용 배지는 글루타맥스, 2-메르캅토에탄올, B-27, N2, 및 노르모신으로 이루어진 군으로부터 선택된 하나 이상의 성분을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다. 본 명세서에서 사용된 용어, "피부오가노이드 성숙용 배지"는 만능성 줄기세포 또는 만능성 줄기세포 유래 오가노이드를 피부 오가노이드의 형태로 배양하는데 필요한 배지를 의미한다. 본 발명의 일 실시예에서, 피부 오가노이드 성숙 배지는 1:1 비율의 Advanced DMEM/F12 및 Neurobasal 배지에, 1X GlutaMax™, 0.5X B-27 마이너스 비타민 1 A, 0.5X N2, 보충제, 0.1mM 2-메르캅토에탄올 및 100㎍/ml 노르모신을 포함한다.In the present invention, the skin organoid maturation medium may include one or more components selected from the group consisting of glutamax, 2-mercaptoethanol, B-27, N2, and normosin, but is limited thereto not. As used herein, the term "skin organoid maturation medium" refers to a medium necessary for culturing pluripotent stem cells or pluripotent stem cell-derived organoids in the form of skin organoids. In one embodiment of the present invention, the skin organoid maturation medium is Advanced DMEM/F12 and Neurobasal medium in a 1:1 ratio, 1X GlutaMax™, 0.5X B-27 minus Vitamin 1 A, 0.5X N2, Supplement, 0.1 mM 2-mercaptoethanol and 100 μg/ml normosine.

본 발명에서, 상기 피부 오가노이드 성숙용 배지는 Advanced DMEM/F12 및 Neurobasal 배지의 혼합 배지일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the medium for skin organoid maturation may be a mixed medium of Advanced DMEM/F12 and Neurobasal medium, but is not limited thereto.

본 발명에서, “공기-액체 계면 배양(Air-liquid interface 배양; ALI 배양)”이란 부분적으로 개방된 배양 용기 또는 배지로 부분적으로 충전된 배양 용기에서 배양하는 것일 수 있으나, 이에 제한되는 것은 아니다. 공기-액체 계면 배양이란 세포 또는 오가노이드의 표면을 공기에 노출시키는 것일 수 있다.In the present invention, "air-liquid interface culture (ALI culture)" may refer to culturing in a partially opened culture vessel or a culture vessel partially filled with a medium, but is not limited thereto. The air-liquid interface culture may be exposing the surface of cells or organoids to air.

본 발명에서, 상기 공기-액체 계면 배양은 콜라겐 코팅된 플레이트에서 수행될 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the air-liquid interface culture may be performed on a collagen-coated plate, but is not limited thereto.

본 발명에서, 상기 (a) 단계의 수행 전에, 하기 단계를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다:In the present invention, before performing step (a), it may include the following steps, but is not limited thereto:

(1) 만능성 줄기세포의 배아체(Embryoid body)를 배양하는 단계;(1) culturing the embryonic body (Embryoid body) of pluripotent stem cells;

(2) 상기 배아체를 비신경 외배엽으로 분화 유도하는 단계; 및(2) inducing differentiation of the embryoid body into non-neural ectoderm; and

(3) 상기 비신경 외배엽을 두개골 신경능선 유사 세포로 분화 유도하는 단계.(3) inducing differentiation of the non-neural ectoderm into cranial neural crest-like cells.

본 발명에서, 상기 단계 (1)은 Y-27632의 존재 하에 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the step (1) may be performed in the presence of Y-27632, but is not limited thereto.

본 발명에서, 상기 단계 (2)는 SB431542, FGF2, 및 BMP4의 존재 하에 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the step (2) may be performed in the presence of SB431542, FGF2, and BMP4, but is not limited thereto.

본 발명에서, 상기 단계 (3)은 FGF2 및 LDN193189의 존재 하에 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the step (3) may be performed in the presence of FGF2 and LDN193189, but is not limited thereto.

본 발명에서, 상기 단계 (a)의 배양은 5일 내지 14일 동안 실시되는 것일 수 있으나, 이에 제한되는 것은 아니다. 예를 들어, 상기 단계 (a)의 배양은 5일 내지 13일, 5일 내지 12일, 5일 내지 11일, 5일 내지 9일, 6일 내지 13일, 6일 내지 12일, 6일 내지 11일, 6일 내지 10일, 6일 내지 9일, 7일 내지 13일, 7일 내지 12일, 7일 내지 11일, 7일 내지 10일, 7일 내지 9일, 또는 약 8일 동안 실시될 수 있다. In the present invention, the culture of step (a) may be carried out for 5 to 14 days, but is not limited thereto. For example, the culture of step (a) is 5 to 13 days, 5 to 12 days, 5 to 11 days, 5 to 9 days, 6 days to 13 days, 6 days to 12 days, 6 days. to 11 days, 6 to 10 days, 6 to 9 days, 7 to 13 days, 7 to 12 days, 7 to 11 days, 7 to 10 days, 7 to 9 days, or about 8 days. can be carried out during

본 발명에서, 상기 단계 (b)의 배양은 40일 내지 100일 동안 실시되는 것일 수 있으나, 이에 제한되는 것은 아니다. 예를 들어, 상기 단계 (b)의 배양은 40일 내지 95일, 40일 내지 90일, 45일 내지 95일, 45일 내지 90일, 45일 내지 80일, 50일 내지 80일, 40일 내지 75일, 40일 내지 70일, 55일 내지 75일, 58일 내지 75일, 59일 내지 74일, 60일 내지 72일, 또는 61일 내지 71일 동안 실시될 수 있다.In the present invention, the culturing of step (b) may be carried out for 40 to 100 days, but is not limited thereto. For example, the culture of step (b) is 40 days to 95 days, 40 days to 90 days, 45 days to 95 days, 45 days to 90 days, 45 days to 80 days, 50 days to 80 days, 40 days. to 75 days, 40 to 70 days, 55 to 75 days, 58 to 75 days, 59 to 74 days, 60 to 72 days, or 61 to 71 days.

본 발명에서, 단계 (c)는 단계 (b)의 배양물을 절단하여 공기-액체 계면에서 배양하는 단계일 수 있다. 본 발명의 일 실시예에서는 단계 (b)의 배양물을 가위로 4등분 절단한 뒤 절단된 각 배양물을 12 웰 인서트 플레이트 상에 펴서 ALI 배양법으로 3주 내지 4주간 100% 습도 조건 배양기에서 배양 후 2일에서 6일 동안 층상 상피층의 성숙을 위해 건조 조건(dry condition; 0% humidity condition incubator)에서 배양하였다. In the present invention, step (c) may be a step of culturing at an air-liquid interface by cutting the culture of step (b). In one embodiment of the present invention, after cutting the culture of step (b) into quarters with scissors, each cut culture is spread on a 12-well insert plate and cultured in an incubator under 100% humidity conditions for 3 to 4 weeks by ALI culture method After 2 to 6 days, the lamellar epithelial layer was incubated in a dry condition (0% humidity condition incubator) for maturation.

본 발명에서, 상기 단계 (c)는 단계 (b)의 배양물을 4 개의 균일한 크기로 절단하고, In the present invention, the step (c) cuts the culture of step (b) into four uniform sizes,

콜라겐 코팅된 트랜스 웰 배양 삽입물 상에 진피층은 콜라겐 쪽으로, 표피층은 공기에 노출되도록 배양하는 것일 수 있으나, 이에 제한되는 것은 아니다. The dermal layer on the collagen-coated transwell culture insert may be cultured such that the dermal layer is exposed to collagen and the epidermal layer is exposed to air, but is not limited thereto.

따라서, 본 발명에서, 상기 방법은 (d) 상기 단계 (c)의 배양물을 1 내지 10일간 건조 조건에서 배양하는 단계를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다. 상기 단계 (d)는 1 내지 10일, 1 내지 9일, 1 내지 8일, 1 내지 7일, 1 내지 6일, 2 내지 10일, 2 내지 9일, 2 내지 8일, 2 내지 7일, 2 내지 6일, 3 내지 10일, 3 내지 9일, 3 내지 8일, 3 내지 7일, 3 내지 6일, 4 내지 10일, 4 내지 9일, 4 내지 8일, 4 내지 7일, 또는 4 내지 6일간 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다. Accordingly, in the present invention, the method (d) may further include the step of culturing the culture of step (c) in dry conditions for 1 to 10 days, but is not limited thereto. Step (d) is 1 to 10 days, 1 to 9 days, 1 to 8 days, 1 to 7 days, 1 to 6 days, 2 to 10 days, 2 to 9 days, 2 to 8 days, 2 to 7 days , 2 to 6 days, 3 to 10 days, 3 to 9 days, 3 to 8 days, 3 to 7 days, 3 to 6 days, 4 to 10 days, 4 to 9 days, 4 to 8 days, 4 to 7 days , or may be carried out for 4 to 6 days, but is not limited thereto.

상기 단계 (d)는 피부 오가노이드의 각질층 성숙을 위한 것일 수 있으나, 이에 제한되는 것은 아니다. The step (d) may be for maturation of the stratum corneum of the skin organoids, but is not limited thereto.

본 발명에서, 상기 단계 (c)의 배양은 3주 내지 4주 동안 실시되는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the culturing of step (c) may be carried out for 3 to 4 weeks, but is not limited thereto.

본 발명에서, 상기 단계 (c)의 공기-액체 계면 배양은 피부 오가노이드 성숙용 배지에서 실시되는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the air-liquid interface culture of step (c) may be carried out in a skin organoid maturation medium, but is not limited thereto.

본 발명의 배양기간은 조직의 양과 종류, 사용한 배지의 종류, 목적하는 오가노이드의 크기와 양, 특성 등을 고려하여 조절될 수 있다.The culture period of the present invention can be adjusted in consideration of the amount and type of tissue, the type of medium used, the size, amount, and characteristics of the desired organoid.

본 발명에서, 상기 피부 오가노이드는 연골 형성이 억제된 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the skin organoid may be one in which cartilage formation is suppressed, but is not limited thereto.

본 발명에서, 상기 피부 오가노이드는 진피층 밑에 피하지방층이 위치하는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the skin organoid may be one in which the subcutaneous fat layer is located under the dermal layer, but is not limited thereto.

본 발명에서, 상기 피부 오가노이드는 KRT5(Keratin 5), KRT10, KRT15, KRT17, 로리크린(Loricrin), 필라그린(Filaggrin), SOX2(SRY-Box Transcription Factor 2), 멜란-A, 콜라겐3(COL3) 및 비멘틴(VMT)으로 이루어진 군으로부터 선택된 하나 이상을 발현하는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the skin organoids are KRT5 (Keratin 5), KRT10, KRT15, KRT17, Loricrin, Filaggrin, SOX2 (SRY-Box Transcription Factor 2), melan-A, collagen 3 ( COL3) and vimentin (VMT) may be to express one or more selected from the group consisting of, but is not limited thereto.

또한, 본 발명은 상기 방법으로 제조된 피부 오가노이드에 황색포도상구균을 처리하는 단계를 포함하는, 피부 오가노이드의 제작 방법으로서, 상기 피부 오가노이드는 아토피 피부염의 피부 모사 모델인 것을 특징으로 하는, 방법을 제공한다.In addition, the present invention is a method for producing a skin organoid comprising the step of treating Staphylococcus aureus to the skin organoid prepared by the above method, wherein the skin organoid is a skin-mimicking model of atopic dermatitis, characterized in that, provide a way

이하 본 발명의 방법을 상세히 설명하며, 상술한 피부 오가노이드를 제조하는 방법에 대한 설명과 중복되는 부분은 그 기재를 생략한다.Hereinafter, the method of the present invention will be described in detail, and parts overlapping with the description of the method for producing the above-described skin organoid will be omitted.

또한, 본 발명은 상기 방법으로 제작된 피부 오가노이드로서, 상기 피부 오가노이드는 아토피 피부염의 피부 모사 모델인 것을 특징으로 하는, 피부 오가노이드를 제공한다.In addition, the present invention provides a skin organoid produced by the above method, wherein the skin organoid is a skin-mimicking model of atopic dermatitis.

본 명세서에서, 상기 피부 오가노이드는 구형(sphere)이 아닌, 편평한 형태인 것을 특징으로 하나, 이에 제한되는 것은 아니다.In the present specification, the skin organoid is characterized in that it is not a sphere, but a flat shape, but is not limited thereto.

본 명세서에서, 상기 피부 오가노이드는 직경 2 내지 20mm를 갖는 것일 수 있으나, 이에 제한되는 것은 아니다. 본 발명의 일실시예에서, 본 발명의 상기 피부 오가노이드는 기존 배양 방법으로 배양된 오가노이드와 비교하여 직경이 큰 것을 확인하였다.In the present specification, the skin organoid may have a diameter of 2 to 20 mm, but is not limited thereto. In one embodiment of the present invention, it was confirmed that the skin organoid of the present invention has a larger diameter compared to the organoid cultured by the conventional culture method.

본 명세서에서, “아토피 피부염”이란 심한 가려움증과 전체적인 건조피부를 동반하며 습진 병변이 특정부위에 반복하여 재발하는 만성 염증성 피부질환으로, 유전적인 소인을 나타내고 음식물 알레르기, 알레르기 천식, 알레르기 비염 등 알레르기 질환과 동반하는 알레르기 행진을 하는 특징을 가지고 있다. 아토피 피부염의 병인은 크게 피부장벽과 연관된 병인과 비정상적인 면역반응과 연관된 병인으로 나누어지는데, 필라그린 유전자의 돌연변이가 아토피 피부염 환자의 40% 정도에서 나타나며 심한 증상을 나타내거나 성인까지 지속되는 경우에는 더 흔하게 나타난다고 보고되었다. 그 기전은, 선천적으로 손상된 피부장벽을 가진 사람에서 외부의 알레르겐이 더 쉽게 각질층을 통과하여 몸에 감작을 일으킴으로써 아토피 피부염을 유발시킨다.As used herein, the term “atopic dermatitis” is a chronic inflammatory skin disease in which eczema lesions recur repeatedly in a specific area accompanied by severe itching and dry skin. It is characterized by an allergic march that accompanies it. The etiology of atopic dermatitis is largely divided into the etiology associated with the skin barrier and the etiology associated with an abnormal immune response. reported to appear. The mechanism causes atopic dermatitis in a person with a congenitally damaged skin barrier, as external allergens pass through the stratum corneum more easily and sensitize the body.

본 발명에서, 상기 피부 오가노이드는 하기 특징으로 이루어진 군으로부터 선택된 하나 이상의 특징을 갖는 것일 수 있으나, 이에 제한되는 것은 아니다:In the present invention, the skin organoid may have one or more characteristics selected from the group consisting of the following characteristics, but is not limited thereto:

피부 진피층의 세포 사멸 증가;increased cell death of the dermal layer of the skin;

피부 표피 장벽 관련 마커인 KRT5, KRT10, 필라그린(Filaggrin), 로리크린(Loricrin), 및 클라우딘4(Claudin4)로 이루어진 군으로부터 선택된 하나 이상의 발현 저하;decreased expression of one or more selected from the group consisting of skin epidermal barrier-related markers KRT5, KRT10, Filaggrin, Loricrin, and Claudin4;

각질형성세포 분화(Keratinocyte differentiation) 유전자인 KRT 또는 KRTAP의 발현 감소;decreased expression of KRT or KRTAP, which is a keratinocyte differentiation gene;

항균 펩타이드(antimicrobial peptides) 유전자인 β-디펜신, PGLYRP2(펩티도글리칸 인식 단백질 2), TLR1(Toll Like Receptor 1), TLR2, LGALS9(갈렉틴 9), LCN2(Lipocalin 2) 및 S100A(S100 칼슘 결합 단백질)로 이루어진 군으로부터 선택된 하나 이상의 발현 증가;Antimicrobial peptides genes β-defensin, PGLYRP2 (peptidoglycan recognition protein 2), TLR1 (Toll Like Receptor 1), TLR2, LGALS9 (galectin 9), LCN2 (Lipocalin 2) and S100A (S100) increased expression of one or more selected from the group consisting of calcium binding proteins);

표피 또는 진피세포 유래 염증성 사이토카인(inflammatory cytokines) 유전자인 Cxcl(CXC 모티프 케모카인 리간드), Ccl(CC 모티프 케모카인 리간드), TSLP(Thymic stromal lymphopoietin), IL-1(interleukin-1), TNF(tumor necrosis factor)로 이루어진 군으로부터 선택된 하나 이상의 발현 증가;Epidermal or dermal cell-derived inflammatory cytokines genes Cxcl (CXC motif chemokine ligand), Ccl (CC motif chemokine ligand), TSLP (Thymic stromal lymphopoietin), IL-1 (interleukin-1), TNF (tumor necrosis) factor) increased expression of one or more selected from the group consisting of;

표피 줄기세포 마커 KRT15의 발현 저하; 및decreased expression of the epidermal stem cell marker KRT15; and

황색포도상구균의 집락(colonization) 형성.Colonization of Staphylococcus aureus.

본 명세서에서, “필라그린”은 각질형성세포가 분화단계에서 발현시키는 여러 구조 단백질 중 하나로 표피의 기저층으로부터 각질층까지 분화가 이루어지도록 하는데 관여하며, 피부 조직의 수분유지에 필수적인 천연보습인자(NMF)의 주체를 이루기도 해 피부의 수분 유지 및 피부막기능의 주요한 지표로 사용된다.As used herein, “filaggrin” is one of several structural proteins expressed by keratinocytes in the differentiation stage and is involved in differentiation from the basal layer of the epidermis to the stratum corneum, and is a natural moisturizing factor (NMF) essential for maintaining moisture in the skin tissue. It is also used as a major indicator of skin moisture retention and skin membrane function.

본 명세서에서, “로리크린”은 각질형성세포가 분화단계에서 발현시키는 피부 장벽 단백질 중 하나이다. As used herein, “loricrin” is one of the skin barrier proteins expressed by keratinocytes in the differentiation stage.

본 명세서에서, “Thymic stromal lymphopoietin(TSLP)”은 IL-7과 유사한 구조를 갖고 있는 사이토카인으로 피부의 각질형성세포, 상피세포, 평활근세포 및 폐의 섬유모세포 등에서 발현된다. TSLP는 수지상 세포를 활성화시켜 helper T 세포를 Th2 세포로 분화시키며, Th2 세포의 분화는 아토피피부염의 증상을 유발시키는데 중요하다.As used herein, “Thymic stromal lymphopoietin (TSLP)” is a cytokine with a structure similar to IL-7 and is expressed in keratinocytes, epithelial cells, smooth muscle cells, and lung fibroblasts of the skin. TSLP activates dendritic cells to differentiate helper T cells into Th2 cells, and the differentiation of Th2 cells is important for inducing symptoms of atopic dermatitis.

본 명세서에서, “황색포도상구균(Staphylococcus aureus)”은 아토피 환자에서 증가하며, 아토피 증상을 더욱 악화시키는 병원성 세균이다. In the present specification, " Staphylococcus aureus " is a pathogenic bacterium that increases in atopic patients and worsens atopic symptoms.

본 명세서에서, 황색포도상구균은 1×101 내지 1×1020 CFU, 1×101 내지 1×1018 CFU, 1×101 내지 1×1015 CFU, 1×101 내지 1×1010 CFU, 1×101 내지 1×108 CFU, 1×101 내지 1×107 CFU, 1×103 내지 1×1020 CFU, 1×103 내지 1×1018 CFU, 1×103 내지 1×1015 CFU, 1×103 내지 1×1011 CFU, 1×103 내지 1×109 CFU, 1×103 내지 1×107 CFU, 1×105 내지 1×1020 CFU, 1×105 내지 1×1015 CFU, 1×105 내지 1×1010 CFU, 또는 1×105 내지 1×107 CFU 농도로 처리될 수 있으나, 이에 제한되는 것은 아니다. In the present specification, Staphylococcus aureus is 1 × 10 1 to 1 × 10 20 CFU, 1 × 10 1 to 1 × 10 18 CFU, 1 × 10 1 to 1 × 10 15 CFU, 1 × 10 1 to 1 × 10 10 CFU, 1×10 1 to 1×10 8 CFU, 1×10 1 to 1×10 7 CFU, 1×10 3 to 1×10 20 CFU, 1×10 3 to 1×10 18 CFU, 1×10 3 to 1×10 15 CFU, 1×10 3 to 1×10 11 CFU, 1×10 3 to 1×10 9 CFU, 1×10 3 to 1×10 7 CFU, 1×10 5 to 1×10 20 CFU , 1×10 5 to 1×10 15 CFU, 1×10 5 to 1×10 10 CFU, or 1×10 5 to 1×10 7 CFU concentration, but is not limited thereto.

상기 피부 오가노이드는 생체 내에서 피실험자의 치료에 사용될 수 있다. 본 발명은 피실험자의 피부 질환의 치료 방법을 포함한다. 본 발명에 개시된 바와 같이, 하나의 태양에서 방법은 피부 질환의 증상의 개선, 치료 또는 경감이 필요한 피실험자에서 상기 증상의 개선, 치료 또는 경감을 포함한다. 상기 방법은 또한 피부 오가노이드를 상기 피실험자의 피부 질환의 치료에 유효한 양으로 투여함을 포함한다.The skin organoids may be used for treatment of subjects in vivo. The present invention includes a method of treating a skin condition in a subject. As disclosed herein, in one aspect the method comprises ameliorating, treating or ameliorating a symptom of a skin disorder in a subject in need thereof. The method also includes administering a skin organoid in an amount effective to treat a skin condition in the subject.

상기 피실험자의 치료 방법은 피부 오가노이드를 투여하거나 피부 오가노이드를 이식함을 추가로 포함할 수 있으며, 이때 투여 또는 이식 결과 상기 피실험자에서 피부 질환의 증상이 개선, 치료 또는 경감된다. 상기 개선, 치료 또는 경감은 자연적 감각 또는 인공 장치를 사용하여 탐지될 수 있는 상기 피부 질환 또는 상기 피부 질환의 증상의 임의의 변화일 수 있다.The method of treating the subject may further include administering a skin organoid or implanting a skin organoid, wherein the administration or implantation results in improvement, treatment, or alleviation of the symptoms of a skin disease in the subject. The amelioration, treatment or amelioration may be any change in the skin condition or symptoms of the skin condition that can be detected using natural sensory or artificial devices.

본 발명의 방법을 사용하여 치료될 수 있는 피부 질환은 피부에 나타난 질병 또는 상태, 예를 들어 비제한적으로 여드름, 아토피 피부염, 피부종기, 부스럼, 두드러기, 건선, 지루성 피부염, 접촉성 피부염, 피부 변색증, 세균성 피부염, 진균성 피부염, 습진, 부종, 돌발성 발진, 모낭염, 모공성 각화증, 사마귀, 광선각화증, 비립종, 피부 건조증, 한선염, 켈로이드성 질환, 알레르기성 피부염, 피부 농양, 및 신경성 피부염 등이다.Skin disorders that can be treated using the methods of the present invention include, but are not limited to, diseases or conditions present on the skin, such as, but not limited to, acne, atopic dermatitis, boils, bruises, urticaria, psoriasis, seborrheic dermatitis, contact dermatitis, skin discoloration. dermatitis, bacterial dermatitis, fungal dermatitis, eczema, edema, eruptive rash, folliculitis, keratosis pilaris, wart, actinic keratosis, milia, dry skin, hives, keloid disease, allergic dermatitis, skin abscess, and dermatitis nervosa, etc. am.

본 발명의 피부 오가노이드는 약학적 조성물에 1 pg 내지 30g w/v%로 포함될 수 있으나, 이에 제한되는 것은 아니다. The skin organoid of the present invention may be included in the pharmaceutical composition in an amount of 1 pg to 30 g w/v%, but is not limited thereto.

본 발명에서 “개체”란 척추동물이라면 제한되지 아니하나, 구체적으로는 인간, 마우스, 래트, 기니피그, 토끼, 원숭이, 돼지, 말, 소, 양, 영양, 개 및 고양이에 적용될 수 있으며, 바람직하게는 인간일 수 있다. In the present invention, "individual" is not limited as long as it is a vertebrate, but specifically, it can be applied to humans, mice, rats, guinea pigs, rabbits, monkeys, pigs, horses, cattle, sheep, antelopes, dogs and cats, preferably may be human.

본 발명에서, "투여"는 어떠한 적절한 방법으로 환자에게 본 발명의 약학적 조성물을 도입하는 것을 의미하며, 본 발명의 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다.In the present invention, "administration" means introducing the pharmaceutical composition of the present invention to a patient by any suitable method, and the administration route of the composition of the present invention is oral or parenteral as long as it can reach the target tissue. It can be administered through

본 발명에서 “예방”이란 본 발명에 따른 조성물의 투여에 의해 피부 질환을 지연시키는 모든 행위를 의미하고, “치료”란 본 발명에 따른 약학적 조성물의 투여에 의해 피부 질환 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, “개선”이란 본 발명에 따른 조성물의 투여에 의해 피부 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다. In the present invention, “prevention” refers to any action that delays skin disease by administration of the composition according to the present invention, and “treatment” means that skin disease symptoms are improved or changed to advantage by administration of the pharmaceutical composition according to the present invention It means all actions to be taken, and "improvement" means all actions that reduce the parameters related to skin diseases, for example, the degree of symptoms by administration of the composition according to the present invention.

본 발명에서 약학적 조성물(pharmaceutical composition)은 약학적 조성물의 제조에 통상적으로 사용되는 적절한 담체, 부형제, 및 희석제를 더 포함할 수 있다. In the present invention, the pharmaceutical composition may further include suitable carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions.

본 발명에서 "담체(carrier)"란 비이클(vehicle)이라고도 불리며, 세포 또는 조직 내로의 단백질 또는 펩타이드의 부가를 용이하게 하는 화합물을 의미하는 것으로서, 예를 들어 디메틸술폭사이드(DMSO)는 생물체의 세포 또는 조직 내로의 많은 유기물의 투입을 용이하게 하는 통상 사용되는 담체이다.In the present invention, "carrier" is also called a vehicle, and refers to a compound that facilitates the addition of proteins or peptides into cells or tissues. For example, dimethyl sulfoxide (DMSO) is a cell of an organism. or a commonly used carrier that facilitates the introduction of many organic substances into tissues.

본 발명에서 "희석제(diluent)"란 대상 단백질 또는 펩타이드의 생물학적 활성 형태를 안정화시킬 뿐만 아니라, 단백질 또는 펩타이드를 용해시키게 되는 물에서 희석되는 화합물로 정의된다. 버퍼 용액에 용해되어 있는 염은 당해 분야에서 희석제로 사용된다. 통상 사용되는 버퍼 용액은 포스페이트 버퍼 식염수이며, 이는 인간 체액의 염 상태를 모방하고 있기 때문이다. 버퍼 염은 낮은 농도에서 용액의 pH를 제어할 수 있기 때문에, 버퍼 희석제가 화합물의 생물학적 활성을 변형하는 일은 드물다. 여기에 사용된 아젤라산을 함유하는 화합물들은 인간 환자에게 그 자체로서, 또는 결합 요법에서와 같이 다른 성분들과 함께 또는 적당한 담체나 부형제와 함께 혼합된 약학적 조성물로서, 투여될 수 있다.In the present invention, "diluent" is defined as a compound that is diluted in water that not only stabilizes the biologically active form of the target protein or peptide but also dissolves the protein or peptide. Salts dissolved in buffer solutions are used as diluents in the art. A commonly used buffer solution is phosphate buffered saline because it mimics the salt state of human body fluids. Because buffer salts can control the pH of a solution at low concentrations, buffer diluents rarely modify the biological activity of a compound. As used herein, the compounds containing azelaic acid may be administered to a human patient as such, or as a pharmaceutical composition admixed with other ingredients as in combination therapy or in admixture with suitable carriers or excipients.

또한, 본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 외용제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있으며, 상기 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 분해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.In addition, the pharmaceutical composition according to the present invention may be formulated in the form of external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and the like and sterile injection solutions according to conventional methods, respectively. Carriers, excipients and diluents that may be included in the composition include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the compound, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, preservatives, etc. may be included. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.

본 발명의 약학적 조성물은 경구 또는 비경구, 바람직하게는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 근육 주입, 정맥내 주입, 피하 주입, 복강 주입, 국소 투여, 경피 투여 등으로 투여할 수 있다.The pharmaceutical composition of the present invention may be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, topical administration, transdermal administration, etc. can

본 발명의 약학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. A suitable dosage of the pharmaceutical composition of the present invention is variously prescribed depending on factors such as formulation method, administration method, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity of the patient. can be

본 발명의 약학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 대용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains. Or it can be prepared by putting it in a large-capacity container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant or stabilizer.

또한, 본 발명은 상기 피부 오가노이드에 아토피 피부염 치료제 후보물질을 처리하는 단계를 포함하는, 아토피 피부염 치료제의 스크리닝 방법을 제공한다.In addition, the present invention provides a screening method for an atopic dermatitis therapeutic agent comprising the step of treating the atopic dermatitis therapeutic agent candidate to the skin organoid.

또한, 본 발명은 상기 피부 오가노이드의 아토피 피부염 치료제 스크리닝 용도를 제공한다.In addition, the present invention provides a screening use of the skin organoid for atopic dermatitis therapeutic agent.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 아토피 피부염의 예방 또는 치료용 약학적 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for preventing or treating atopic dermatitis comprising Cutibacterium acnes or a culture solution thereof as an active ingredient.

본 발명에서, 상기 조성물은 필라그린(Filaggrin)의 발현을 증가시키는 것일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the composition may increase the expression of filaggrin, but is not limited thereto.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 아토피 피부염의 예방 또는 개선용 식품 조성물을 제공한다. In addition, the present invention provides a food composition for preventing or improving atopic dermatitis comprising Cutibacterium acnes or a culture solution thereof as an active ingredient.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 아토피 피부염의 예방 또는 개선용 화장료 조성물을 제공한다.In addition, the present invention provides a cosmetic composition for preventing or improving atopic dermatitis comprising Cutibacterium acnes or a culture solution thereof as an active ingredient.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 약학적 조성물을 개체에 투여하는 단계를 포함하는 아토피 피부염의 예방 또는 치료 방법을 제공한다.In addition, the present invention provides a method for preventing or treating atopic dermatitis comprising administering to an individual a pharmaceutical composition comprising Cutibacterium acnes or a culture medium thereof as an active ingredient.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 약학적 조성물의 아토피 피부염의 예방 또는 치료 용도를 제공한다.In addition, the present invention provides a use for preventing or treating atopic dermatitis of a pharmaceutical composition comprising Cutibacterium acnes or a culture medium thereof as an active ingredient.

또한, 본 발명은 큐티박테리움 아크네스 또는 이의 배양액의 아토파 피부염 예방 또는 치료 약제를 생산하기 위한 용도를 제공한다.In addition, the present invention provides a use for producing a medicament for preventing or treating atopa dermatitis of Cutibacterium acnes or a culture solution thereof.

본 발명에서, “큐티박테리움 아크네스(Cutibacterium acnes)”는 프로피오니박테리움 아크네스로도 명명되는 혐기성, 그람 양성 간균으로, 사람 피부 및 점막조직 표면의 정상 세균총에 해당한다. 혐기성 미생물인 프로피오니박테리움 아크네스(Propionibacterium acnes)는 모낭의 안쪽에서 성장한다.In the present invention, "Cutibacterium acnes" is an anaerobic, Gram-positive bacillus also named Propionibacterium acnes, and corresponds to a normal bacterial flora on the surface of human skin and mucosal tissues. The anaerobic microorganism, Propionibacterium acnes, grows inside the hair follicles.

본 발명에서 용어 '배양'이란 미생물을 적당히 인공적으로 조절한 환경 조건에서 생육시키기 위하여 수행하는 모든 행위를 의미하며, 본 발명에서는 '발효'를 포함하는 개념이다.In the present invention, the term 'cultivation' refers to all actions performed to grow microorganisms in an appropriately artificially controlled environmental condition, and in the present invention, it is a concept including 'fermentation'.

상기 '큐티박테리움 아크네스'의 균체는 배양 배지로부터 수득된 생균 그 자체뿐만 아니라, 당업자에게 알려진 유산균에 대한 임의의 가공형태를 포함하는 것으로 예를 들어 균체 파쇄물, 건조물, 동결물 등을 포함하며 이에 제한되지 않는다. 또한, 상기 용어 '배양액'은 '발효액'을 포함하는 의미이며, 액체배지에서 배양한 배양액 자체, 상기 배양액을 여과 또는 원심분리 하여 균주를 제거한 여액(원심분리한 상등액) 등의 배양액 자체로부터 파생되는 가공물을 포함한다.The cells of the 'Cutibacterium acnes' include not only the live cells obtained from the culture medium, but also any processed form of lactic acid bacteria known to those skilled in the art, for example, cell lysate, dried material, frozen material, etc. It is not limited thereto. In addition, the term 'culture solution' is meant to include 'fermentation solution', and the culture solution itself cultured in a liquid medium, the filtrate from which the strain is removed by filtration or centrifugation of the culture medium (centrifuged supernatant), etc. derived from the culture solution itself includes artifacts.

본 발명의 조성물 내의 상기 큐티박테리움 아크네스 또는 이의 배양액의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 적절히 조절 가능하며, 예컨대, 전체 조성물 중량을 기준으로 0.0001 내지 99.9중량%, 또는 0.001 내지 50중량%일 수 있으나, 이에 한정되는 것은 아니다. 상기 함량비는 용매를 제거한 건조량을 기준으로 한 값이다.The content of the Cutibacterium acnes or its culture medium in the composition of the present invention can be appropriately adjusted depending on the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight based on the total weight of the composition, Or it may be 0.001 to 50% by weight, but is not limited thereto. The content ratio is a value based on the dry amount from which the solvent is removed.

본 발명에서, 상기 약학적 조성물에 대한 설명은 전술한 바와 같다.In the present invention, the description of the pharmaceutical composition is as described above.

본 발명의 큐티박테리움 아크네스 또는 이의 배양액을 식품 첨가물로 사용할 경우, 상기 큐티박테리움 아크네스 또는 이의 배양액을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시 본 발명의 큐티박테리움 아크네스 또는 이의 배양액은 원료에 대하여 15 중량% 이하, 또는 10 중량% 이하의 양으로 첨가될 수 있다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.When using the Cutibacterium acnes or its culture solution of the present invention as a food additive, the Cutibacterium acnes or its culture solution can be added as it is or used with other foods or food ingredients, and used appropriately according to a conventional method can The mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). In general, in the production of food or beverage, the cutibacterium acnes or a culture solution thereof of the present invention may be added in an amount of 15% by weight or less, or 10% by weight or less with respect to the raw material. However, in the case of long-term intake for health and hygiene or health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.

상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.There is no particular limitation on the type of the food. Examples of foods to which the above substances can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and includes all health functional foods in the ordinary sense.

본 발명에 따른 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당 및 과당과 같은 모노사카라이드, 말토오스 및 수크로오스와 같은 디사카라이드, 덱스트린 및 시클로덱스트린과 같은 폴리사카라이드, 및 자일리톨, 소르비톨 및 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 mL당 일반적으로 약 0.01-0.20g, 또는 약 0.04-0.10g 이다.The health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, as in a conventional beverage. The above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetener, natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used. The proportion of the natural carbohydrate is generally about 0.01-0.20 g, or about 0.04-0.10 g per 100 mL of the composition of the present invention.

상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01-0.20 중량부의 범위에서 선택되는 것이 일반적이다.In addition to the above, the composition of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, Carbonating agents used in carbonated beverages, etc. may be contained. In addition, the composition of the present invention may contain the pulp for the production of natural fruit juice, fruit juice beverage, and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.

본 발명에 따른 화장료 조성물의 제형은 스킨로션, 스킨소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스쳐 로션, 영양로션, 맛사지크림, 영양크림, 미스트, 모이스쳐 크림, 핸드크림, 핸드로션, 파운데이션, 에센스, 영양에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 클렌징오일, 클렌징밤, 바디로션 또는 바디클렌저의 형태일 수 있다.The dosage form of the cosmetic composition according to the present invention includes skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nourishing lotion, massage cream, nourishing cream, mist, moisture cream, hand cream, hand lotion, foundation, It may be in the form of essence, nutritional essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, cleansing oil, cleansing balm, body lotion or body cleanser.

본 발명의 화장료 조성물은 수용성 비타민, 유용성 비타민, 고분자 펩티드, 고분자 다당, 및 스핑고 지질로 이루어진 군에서 선택된 조성물을 더 포함할 수 있다.The cosmetic composition of the present invention may further include a composition selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high molecular weight peptides, high molecular weight polysaccharides, and sphingolipids.

수용성 비타민으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 예를 들어 비타민 B1, 비타민 B2, 비타민 B6, 피리독신, 염산피리독신, 비타민 B12, 판토텐산, 니코틴산, 니코틴산아미드, 엽산, 비타민 C, 비타민 H 등을 들 수 있으며, 그들의 염(티아민염산염, 아스코르빈산나트륨염 등)이나 유도체(아스코르빈산-2-인산나트륨염, 아스코르빈산-2-인산마그네슘염 등)도 본 발명에서 사용할 수 있는 수용성 비타민에 포함된다. 수용성 비타민은 미생물 변환법, 미생물의 배양물로부터의 정제법, 효소법 또는 화학 합성법 등의 통상의 방법에 의해 수득할 수 있다.As water-soluble vitamins, any type of vitamin can be used as long as it can be formulated in cosmetics. Examples include vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, and vitamin H. and their salts (thiamine hydrochloride, sodium ascorbate salt, etc.) and derivatives (ascorbic acid-2-phosphate sodium salt, ascorbic acid-2-phosphate magnesium salt, etc.) are also water-soluble vitamins that can be used in the present invention. Included. Water-soluble vitamins can be obtained by conventional methods, such as a microbial transformation method, a purification method from a microbial culture, an enzymatic method, or a chemical synthesis method.

유용성 비타민으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 예를 들어 비타민 A, 카로틴, 비타민 D2, 비타민 D3, 비타민 E(d1-알파 토코페롤, d-알파 토코페롤, d-알파 토코페롤) 등을 들 수 있으며, 그들의 유도체(팔미틴산아스코르빈, 스테아르산아스코르빈, 디팔미틴산아스코르빈, 아세트산dl-알파 토코페롤, 니코틴산dl-알파 토코페롤비타민 E, DL-판토테닐알코올, D-판토테닐알코올, 판토테닐에틸에테르 등) 등도 본 발명에서 사용되는 유용성 비타민에 포함된다. 유용성 비타민은 미생물 변환법, 미생물의 배양물로부터의 정제법, 효소 또는 화학 합성법 등의 통상의 방법에 의해 취득할 수 있다.The oil-soluble vitamin may be any type of vitamin that can be formulated in cosmetics. Examples thereof include vitamin A, carotene, vitamin D2, vitamin D3, and vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol). , their derivatives (ascorbine palmitate, ascorbine stearate, ascorbine dipalmitate, dl-alpha tocopherol acetate, dl-alpha tocopherol nicotinic acid, vitamin E, DL-pantothenyl alcohol, D-pantothenyl alcohol, pantothenyl ethyl ethers, etc.) are also included in the oil-soluble vitamins used in the present invention. Oil-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a microbial culture, and an enzyme or chemical synthesis method.

고분자 펩티드로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 예를 들어 콜라겐, 가수 분해 콜라겐, 젤라틴, 엘라스틴, 가수 분해 엘라스틴, 케라틴 등을 들 수 있다. 고분자 펩티드는 미생물의 배양액으로부터의 정제법, 효소법 또는 화학 합성법 등의 통상의 방법에 의해 정제 취득할 수 있으며, 또는 통상 돼지나 소 등의 진피, 누에의 견섬유 등의 천연물로부터 정제하여 사용할 수 있다.The macromolecular peptide may be any compound as long as it can be formulated in cosmetics, and examples thereof include collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, and keratin. Polymeric peptides can be purified and obtained by conventional methods such as purification from a microbial culture solution, enzyme method or chemical synthesis method, or can be purified and used from natural products such as dermis of pigs or cattle, silk fiber of silkworms, etc.

고분자 다당으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 예를 들어 히드록시에틸셀룰로오스, 크산탄검, 히알루론산나트륨, 콘드로이틴 황산 또는 그 염(나트륨염 등) 등을 들 수 있다. 예를 들어, 콘드로이틴 황산 또는 그 염 등은 통상 포유 동물이나 어류로부터 정제하여 사용할 수 있다.The high molecular weight polysaccharide may be any compound as long as it can be formulated in cosmetics, and examples thereof include hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate or a salt thereof (sodium salt, etc.). For example, chondroitin sulfate or a salt thereof can be used after purification from mammals or fish.

스핑고 지질로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 예를 들어 세라미드, 피토스핑고신, 스핑고당지질 등을 들 수 있다. 스핑고 지질은 통상 포유류, 어류, 패류, 효모 또는 식물 등으로부터 통상의 방법에 의해 정제하거나 화학 합성법에 의해 취득할 수 있다.The sphingolipid may be any as long as it can be formulated in cosmetics, and examples thereof include ceramide, phytosphingosine, and sphingoglycolipid. Sphingo lipids can be purified by conventional methods from mammals, fish, shellfish, yeast or plants, or can be obtained by chemical synthesis.

본 발명의 화장료 조성물에는 상기 필수 성분과 더불어 필요에 따라 통상 화장품에 배합되는 다른 성분을 배합해도 된다.In the cosmetic composition of the present invention, in addition to the above essential ingredients, other ingredients usually blended in cosmetics may be blended as needed.

이외에 첨가해도 되는 배합 성분으로서는 유지 성분, 보습제, 에몰리엔트제, 계면 활성제, 유기 및 무기 안료, 유기 분체, 자외선 흡수제, 방부제, 살균제, 산화 방지제, 식물 추출물, pH 조정제, 알콜, 색소, 향료, 혈행 촉진제, 냉감제, 제한(制汗)제, 정제수 등을 들 수 있다.Other ingredients that may be added include oils and fats, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, UV absorbers, preservatives, bactericides, antioxidants, plant extracts, pH adjusters, alcohols, colorants, fragrances, A blood circulation promoter, a cooling agent, a restrictive agent, purified water, etc. are mentioned.

유지 성분으로서는 에스테르계 유지, 탄화수소계 유지, 실리콘계 유지, 불소계 유지, 동물 유지, 식물 유지 등을 들 수 있다.Examples of the fats and oils include ester fats and oils, hydrocarbon oils, silicone oils, fluorine oils, animal fats, and vegetable oils.

에스테르계 유지로서는 트리2-에틸헥산산글리세릴, 2-에틸헥산산세틸, 미리스틴산이소프로필, 미리스틴산부틸, 팔미틴산이소프로필, 스테아르산에틸, 팔미틴산옥틸, 이소스테아르산이소세틸, 스테아르산부틸, 리놀레산에틸, 리놀레산이소프로필, 올레인산에틸, 미리스틴산이소세틸, 미리스틴산이소스테아릴, 팔미틴산이소스테아릴, 미리스틴산옥틸도데실, 이소스테아르산이소세틸, 세바신산디에틸, 아디핀산디이소프로필, 네오펜탄산이소알킬, 트리(카프릴, 카프린산)글리세릴, 트리2-에틸헥산산트리메틸롤프로판, 트리이소스테아르산트리메틸롤프로판, 테트라2-에틸헥산산펜타엘리슬리톨, 카프릴산세틸, 라우린산데실, 라우린산헥실, 미리스틴산데실, 미리스틴산미리스틸, 미리스틴산세틸, 스테아르산스테아릴, 올레인산데실, 리시노올레인산세틸, 라우린산이소스테아릴, 미리스틴산이소트리데실, 팔미틴산이소세틸, 스테아르산옥틸, 스테아르산이소세틸, 올레인산이소데실, 올레인산옥틸도데실, 리놀레산옥틸도데실, 이소스테아르산이소프로필, 2-에틸헥산산세토스테아릴, 2-에틸헥산산스테아릴, 이소스테아르산헥실, 디옥탄산에틸렌글리콜, 디올레인산에틸렌글리콜, 디카프린산프로필렌글리콜, 디(카프릴,카프린산)프로필렌글리콜, 디카프릴산프로필렌글리콜, 디카프린산네오펜틸글리콜, 디옥탄산네오펜틸글리콜, 트리카프릴산글리세릴, 트리운데실산글리세릴, 트리이소팔미틴산글리세릴, 트리이소스테아르산글리세릴, 네오펜탄산옥틸도데실, 옥탄산이소스테아릴, 이소노난산옥틸, 네오데칸산헥실데실, 네오데칸산옥틸도데실, 이소스테아르산이소세틸, 이소스테아르산이소스테아릴, 이소스테아르산옥틸데실, 폴리글리세린올레인산에스테르, 폴리글리세린이소스테아르산에스테르, 시트르산트리이소세틸, 시트르산트리이소알킬, 시트르산트리이소옥틸, 락트산라우릴, 락트산미리스틸, 락트산세틸, 락트산옥틸데실, 시트르산트리에틸, 시트르산아세틸트리에틸, 시트르산아세틸트리부틸, 시트르산트리옥틸, 말산디이소스테아릴, 히드록시스테아르산 2-에틸헥실, 숙신산디2-에틸헥실, 아디핀산디이소부틸, 세바신산디이소프로필, 세바신산디옥틸, 스테아르산콜레스테릴, 이소스테아르산콜레스테릴, 히드록시스테아르산콜레스테릴, 올레인산콜레스테릴, 올레인산디히드로콜레스테릴, 이소스테아르산피트스테릴, 올레인산피트스테릴, 12-스테알로일히드록시스테아르산이소세틸, 12-스테알로일히드록시스테아르산스테아릴, 12-스테알로일히드록시스테아르산이소스테아릴 등의 에스테르계 등을 들 수 있다.As ester-based fats and oils, tri2-ethylhexanoate glyceryl, 2-ethylhexanoate cetyl, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, stearic acid Butyl, ethyl linoleate, isopropyl linoleate, ethyl oleate, isocetyl myristate, isostearyl myristate, isostearyl palmitate, octyldodecyl myristate, isocetyl isostearate, diethyl sebacate, adipine Diisopropyl acid, isoalkyl neopentanoate, tri(caprylic acid, capric acid) glyceryl, trimethylol propane tri-2-ethylhexanoate, trimethylol propane triisostearate, pentaelysitol tetra2-ethylhexanoate , cetyl caprylate, decyl laurate, hexyl laurate, decyl myristate, myristyl myristate, cetyl myristate, stearyl stearate, decyl oleate, cetyl ricinoleate, isostea laurate Lil, isotridecyl myristate, isocetyl palmitate, octyl stearate, isocetyl stearate, isodecyl oleate, octyldodecyl oleate, octyldodecyl linoleate, isostearic acid isopropyl, 2-ethylhexanoate cetoster Aryl, 2-ethyl stearyl hexanoate, hexyl isostearate, ethylene glycol dioctanoate, ethylene glycol dioleate, propylene glycol dicapric acid, di(caprylic acid, capric acid) propylene glycol, dicaprylic acid propylene glycol, dicapric acid Neopentyl glycol phosphate, neopentyl glycol dioctanoate, glyceryl tricaprylate, glyceryl triundecyl, glyceryl triisopalmitate, glyceryl triisostearate, octyldodecyl neopentanoate, isostearyl octanoate , isononanoate octyl, neodecanoate hexyldecyl, neodecanoate octyldodecyl, isostearate isocetyl, isostearyl isostearate, isostearic acid octyldecyl, polyglycerol oleate, polyglycerol isostearate, Triisocetyl citrate, triisoalkyl citrate, triisooctyl citrate, lauryl lactate, myristyl lactate, cetyl lactate, octyldecyl lactate, triethyl citrate, acetyl triethyl citrate, acetyl tributyl citrate, trioctyl citrate, dimalate Isostearyl, 2-ethylhexyl hydroxystearate, di2-ethylhexyl succinate, diisobutyl adipate, diisopropyl sebacate, dioctyl sebacate, Cholesteryl stearate, cholesteryl isostearate, cholesteryl hydroxystearate, cholesteryl oleate, dihydrocholesteryl oleate, phytsteryl isostearate, phytsteryl oleate, 12-stealoyl Ester type, such as hydroxy stearate isocetyl, 12-stealoyl hydroxy stearyl stearate, and 12-stealoyl hydroxy stearate isostearyl, etc. are mentioned.

탄화 수소계 유지로서는 스쿠알렌, 유동 파라핀, 알파-올레핀올리고머, 이소파라핀, 세레신, 파라핀, 유동 이소파라핀, 폴리부덴, 마이크로크리스탈린왁스, 와셀린 등의 탄화 수소계 유지 등을 들 수 있다.Examples of hydrocarbon-based fats and oils include hydrocarbon-based fats and oils such as squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, liquid isoparaffin, polybudene, microcrystalline wax, petrolatum.

실리콘계 유지로서는 폴리메틸실리콘, 메틸페닐실리콘, 메틸시클로폴리실록산, 옥타메틸폴리실록산, 데카메틸폴리실록산, 도데카메틸시클로실록산, 디메틸실록산ㆍ메틸세틸옥시실록산 공중합체, 디메틸실록산ㆍ메틸스테알록시실록산 공중합체, 알킬 변성 실리콘유, 아미노 변성 실리콘유 등을 들 수 있다.Examples of silicone-based oils and fats include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane/methylcetyloxysiloxane copolymer, dimethylsiloxane/methylstealloxysiloxane copolymer, and alkyl Modified silicone oil, amino modified silicone oil, etc. are mentioned.

불소계 유지로서는 퍼플루오로폴리에테르 등을 들 수 있다.Perfluoropolyether etc. are mentioned as fluorine-type fats and oils.

동물 또는 식물 유지로서는 아보카도유, 아르몬드유, 올리브유, 참깨유, 쌀겨유, 새플라워유, 대두유, 옥수수유, 유채유, 행인(杏仁)유, 팜핵유, 팜유, 피마자유, 해바라기유, 포도종자유, 면실유, 야자유, 쿠쿠이너트유, 소맥배아유, 쌀 배아유, 시아버터, 월견초유, 마커데이미아너트유, 메도홈유, 난황유, 우지(牛脂), 마유, 밍크유, 오렌지라피유, 호호바유, 캔데리러왁스, 카르나바왁스, 액상 라놀린, 경화피마자유 등의 동물 또는 식물 유지를 들 수 있다.As animal or vegetable oils, avocado oil, almond oil, olive oil, sesame oil, rice bran oil, saffron oil, soybean oil, corn oil, rapeseed oil, passerine oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil , Cottonseed Oil, Palm Oil, Kukui Nut Oil, Wheat Germ Oil, Rice Germ Oil, Shea Butter, Wormwood Colostrum, Marcus Damien Nut Oil, Meadow Oil, Egg Yolk Oil, Tallow Oil, Horse Oil, Mink Oil, Orange Raffy Oil, Jojoba Oil , animal or plant oils and fats such as candelabra wax, carnauba wax, liquid lanolin, and hydrogenated castor oil.

보습제로서는 수용성 저분자 보습제, 지용성 분자 보습제, 수용성 고분자, 지용성 고분자 등을 들 수 있다.Examples of the moisturizing agent include a water-soluble low-molecular moisturizer, a fat-soluble molecular moisturizer, a water-soluble polymer, and a fat-soluble polymer.

수용성 저분자 보습제로서는 세린, 글루타민, 솔비톨, 만니톨, 피롤리돈-카르복실산나트륨, 글리세린, 프로필렌글리콜, 1,3-부틸렌글리콜, 에틸렌글리콜, 폴리에틸렌글리콜B(중합도 n = 2 이상), 폴리프로필렌글리콜(중합도 n = 2 이상), 폴리글리세린B(중합도 n = 2 이상), 락트산, 락트산염 등을 들 수 있다.As water-soluble low molecular weight moisturizers, serine, glutamine, sorbitol, mannitol, pyrrolidone-sodium carboxylate, glycerin, propylene glycol, 1,3-butylene glycol, ethylene glycol, polyethylene glycol B (polymerization degree n = 2 or more), polypropylene Glycol (polymerization degree n=2 or more), polyglycerol B (polymerization degree n=2 or more), lactic acid, lactic acid salt, etc. are mentioned.

지용성 저분자 보습제로서는 콜레스테롤, 콜레스테롤에스테르 등을 들 수 있다.Cholesterol, cholesterol ester, etc. are mentioned as a fat-soluble low molecular weight humectant.

수용성 고분자로서는 카르복시비닐폴리머, 폴리아스파라긴산염, 트라가칸트, 크산탄검, 메틸셀룰로오스, 히드록시메틸셀룰로오스, 히드록시에틸셀룰로오스, 히드록시프로필셀룰로오스, 카르복시메틸셀룰로오스, 수용성 키틴, 키토산, 덱스트린 등을 들 수 있다.Examples of the water-soluble polymer include carboxyvinyl polymer, polyaspartate, tragacanth, xanthan gum, methyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, water-soluble chitin, chitosan, and dextrin. can

지용성 고분자로서는 폴리비닐피롤리돈ㆍ에이코센 공중합체, 폴리비닐피롤리돈ㆍ헥사데센 공중합체, 니트로셀룰로오스, 덱스트린지방산에스테르, 고분자 실리콘 등을 들 수 있다.Examples of the fat-soluble polymer include polyvinylpyrrolidone/eicocene copolymer, polyvinylpyrrolidone/hexadecene copolymer, nitrocellulose, dextrin fatty acid ester, and high molecular weight silicone.

에몰리엔트제로서는 장쇄아실글루타민산콜레스테릴에스테르, 히드록시스테아르산콜레스테릴, 12-히드록시스테아르산, 스테아르산, 로진산, 라놀린지방산콜레스테릴에스테르 등을 들 수 있다.Examples of the emollient include long-chain acylglutamic acid cholesteryl ester, hydroxystearic acid cholesteryl, 12-hydroxystearic acid, stearic acid, rosin acid, and lanolin fatty acid cholesteryl ester.

계면 활성제로서는 비이온성 계면 활성제, 음이온성 계면 활성제, 양이온성 계면 활성제, 양성 계면 활성제 등을 들 수 있다.Nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, etc. are mentioned as surfactant.

비이온성 계면 활성제로서는 자기 유화형 모노스테아르산글리세린, 프로필렌글리콜지방산에스테르, 글리세린지방산에스테르, 폴리글리세린지방산에스테르, 솔비탄지방산에스테르, POE(폴리옥시에틸렌)솔비탄지방산에스테르, POE 솔비트지방산에스테르, POE 글리세린지방산에스테르, POE 알킬에테르, POE 지방산에스테르, POE 경화피마자유, POE 피마자유, POEㆍPOP(폴리옥시에틸렌ㆍ폴리옥시프로필렌) 공중합체, POEㆍPOP 알킬에테르, 폴리에테르변성실리콘, 라우린산알카놀아미드, 알킬아민옥시드, 수소첨가대두인지질 등을 들 수 있다.Nonionic surfactants include self-emulsifying glycerin monostearate, propylene glycol fatty acid ester, glycerin fatty acid ester, polyglycerol fatty acid ester, sorbitan fatty acid ester, POE (polyoxyethylene) sorbitan fatty acid ester, POE sorbitan fatty acid ester, POE Glycerin fatty acid ester, POE alkyl ether, POE fatty acid ester, POE hydrogenated castor oil, POE castor oil, POE/POP (polyoxyethylene/polyoxypropylene) copolymer, POE/POP alkyl ether, polyether-modified silicone, lauric acid alkanolamides, alkylamine oxides, hydrogenated soybean phospholipids, and the like.

음이온성 계면 활성제로서는 지방산비누, 알파-아실술폰산염, 알킬술폰산염, 알킬알릴술폰산염, 알킬나프탈렌술폰산염, 알킬황산염, POE 알킬에테르황산염, 알킬아미드황산염, 알킬인산염, POE 알킬인산염, 알킬아미드인산염, 알킬로일알킬타우린염, N-아실아미노산염, POE 알킬에테르카르복실산염, 알킬술포숙신산염, 알킬술포아세트산나트륨, 아실화 가수분해 콜라겐펩티드염, 퍼플루오로알킬인산에스테르 등을 들 수 있다.Examples of the anionic surfactant include fatty acid soap, alpha-acyl sulfonate, alkyl sulfonate, alkyl allyl sulfonate, alkyl naphthalene sulfonate, alkyl sulfate, POE alkyl ether sulfate, alkyl amide sulfate, alkyl phosphate, POE alkyl phosphate, and alkyl amide phosphate. , alkyloylalkyltaurine salts, N-acylamino acid salts, POE alkylethercarboxylate salts, alkylsulfosuccinate salts, alkylsulfoacetate sodium, acylated hydrolyzed collagen peptide salts, perfluoroalkylphosphate esters, and the like. .

양이온성 계면 활성제로서는 염화알킬트리메틸암모늄, 염화스테아릴트리메틸암모늄, 브롬화스테아릴트리메틸암모늄, 염화세토스테아릴트리메틸암모늄, 염화디스테아릴디메틸암모늄, 염화스테아릴디메틸벤질암모늄, 브롬화베헤닐트리메틸암모늄, 염화벤잘코늄, 스테아르산디에틸아미노에틸아미드, 스테아르산디메틸아미노프로필아미드, 라놀린 유도체 제 4급 암모늄염 등을 들 수 있다.Examples of the cationic surfactant include alkyltrimethylammonium chloride, stearyltrimethylammonium chloride, stearyltrimethylammonium bromide, cetostearyltrimethylammonium chloride, distearyldimethylammonium chloride, stearyldimethylbenzylammonium chloride, behenyltrimethylammonium bromide, chloride Benzalkonium, diethylaminoethylamide stearate, dimethylaminopropylamide stearate, quaternary ammonium salt of lanolin derivative, etc. are mentioned.

양성 계면 활성제로서는 카르복시베타인형, 아미드베타인형, 술포베타인형, 히드록시술포베타인형, 아미드술포베타인형, 포스포베타인형, 아미노카르복실산염형, 이미다졸린 유도체형, 아미드아민형 등의 양성 계면 활성제 등을 들 수 있다.Examples of the amphoteric surfactant include carboxybetaine type, amidebetaine type, sulfobetaine type, hydroxysulfobetaine type, amidesulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type, amidamine type, etc. Amphoteric surfactant etc. are mentioned.

유기 및 무기 안료로서는 규산, 무수규산, 규산마그네슘, 탤크, 세리사이트, 마이카, 카올린, 벵갈라, 클레이, 벤토나이트, 티탄피막운모, 옥시염화비스무트, 산화지르코늄, 산화마그네슘, 산화아연, 산화티탄, 산화알루미늄, 황산칼슘, 황산바륨, 황산마그네슘, 탄산칼슘, 탄산마그네슘, 산화철, 군청, 산화크롬, 수산화크롬, 칼라민 및 이들의 복합체등의 무기 안료; 폴리아미드, 폴리에스테르, 폴리프로필렌, 폴리스티렌, 폴리우레탄, 비닐수지, 요소수지, 페놀수지, 불소수지, 규소수지, 아크릴수지, 멜라민수지, 에폭시수지, 폴리카보네이트수지, 디비닐벤젠ㆍ스티렌 공중합체, 실크파우더, 셀룰로오스, CI 피그먼트옐로우, CI 피그먼트오렌지 등의 유기 안료 및 이들의 무기 안료와 유기 안료의 복합 안료 등을 들 수 있다.Examples of organic and inorganic pigments include silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium-coated mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide. inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine blue, chromium oxide, chromium hydroxide, calamine, and complexes thereof; Polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenol resin, fluororesin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene/styrene copolymer, and organic pigments such as silk powder, cellulose, CI pigment yellow and CI pigment orange, and composite pigments of these inorganic pigments and organic pigments.

유기 분체로서는 스테아르산칼슘 등의 금속비누; 세틸린산아연나트륨, 라우릴린산아연, 라우릴린산칼슘 등의 알킬인산금속염 ; N-라우로일-베타-알라닌칼슘, N-라우로일-베타-알라닌아연, N-라우로일글리신칼슘 등의 아실아미노산 다가금속염 ; N-라우로일-타우린칼슘, N-팔미토일-타우린칼슘 등의 아미드술폰산 다가금속염 ; N-엡실론-라우로일-L-리진, N-엡실론-팔미토일리진, N-알파-파리토일올니틴, N-알파-라우로일아르기닌, N-알파-경화우지지방산아실아르기닌 등의 N-아실염기성아미노산 ; N-라우로일글리실글리신 등의 N-아실폴리펩티드 ; 알파-아미노카프릴산, 알파-아미노라우린산 등의 알파-아미노지방산 ; 폴리에틸렌, 폴리프로필렌, 나일론, 폴리메틸메타크릴레이트, 폴리스티렌, 디비닐벤젠ㆍ스티렌 공중합체, 사불화에틸렌 등을 들 수 있다.Examples of the organic powder include metal soaps such as calcium stearate; alkyl phosphate metal salts such as sodium cetylate, zinc laurylate, and calcium laurylate; acylamino acid polyvalent metal salts such as calcium N-lauroyl-beta-alanine, zinc N-lauroyl-beta-alanine, and calcium N-lauroyl glycine; amidesulfonic acid polyvalent metal salts such as calcium N-lauroyl-taurine and calcium N-palmitoyl-taurine; N such as N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoylizine, N-alpha-paritoylolnithine, N-alpha-lauroylarginine, N-alpha-hydrogenated beef fatty acid acylarginine, etc. -Acyl basic amino acid; N-acyl polypeptides, such as N-lauroyl glycyl glycine; alpha-amino fatty acids such as alpha-aminocaprylic acid and alpha-aminolauric acid; Polyethylene, polypropylene, nylon, polymethyl methacrylate, polystyrene, a divinylbenzene-styrene copolymer, ethylene tetrafluoride, etc. are mentioned.

자외선 흡수제로서는 파라아미노벤조산, 파라아미노벤조산에틸, 파라아미노벤조산아밀, 파라아미노벤조산옥틸, 살리실산에틸렌글리콜, 살리신산페닐, 살리신산옥틸, 살리신산벤질, 살리신산부틸페닐, 살리신산호모멘틸, 계피산벤질, 파라메톡시계피산-2-에톡시에틸, 파라메톡시계피산옥틸, 디파라메톡시계피산모노-2-에틸헥산글리세릴, 파라메톡시계피산이소프로필, 디이소프로필ㆍ디이소프로필계피산에스테르 혼합물, 우로카닌산, 우로카닌산에틸, 히드록시메톡시벤조페논, 히드록시메톡시벤조페논술폰산 및 그 염, 디히드록시메톡시벤조페논, 디히드록시메톡시벤조페논디술폰산나트륨, 디히드록시벤조페논, 테트라히드록시벤조페논, 4-tert-부틸-4'-메톡시디벤조일메탄, 2,4,6-트리아닐리노-p-(카르보-2'-에틸헥실-1'-옥시)-1,3,5-트리아진, 2-(2-히드록시-5-메틸페닐)벤조트리아졸 등을 들 수 있다.As UV absorbers, para-aminobenzoic acid, para-aminobenzoate ethyl, para-aminobenzoate amyl, para-aminobenzoate octyl, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicylate, butyl salicylate, homomentyl salicylate, benzyl cinnamate , para-methoxycinnamic acid-2-ethoxyethyl, para-methoxycinnamic acid octyl, dipara-methoxycinnamic acid mono-2-ethylhexaneglyceryl, para-methoxycinnamic acid isopropyl, diisopropyl diisopropyl cinnamic acid ester mixture, uro Cannic acid, ethyl urokanate, hydroxymethoxybenzophenone, hydroxymethoxybenzophenonesulfonic acid and salts thereof, dihydroxymethoxybenzophenone, sodium dihydroxymethoxybenzophenonedisulfonate, dihydroxybenzophenone , tetrahydroxybenzophenone, 4-tert-butyl-4'-methoxydibenzoylmethane, 2,4,6-trianilino-p-(carbo-2'-ethylhexyl-1'-oxy)-1 ,3,5-triazine, 2-(2-hydroxy-5-methylphenyl)benzotriazole, etc. are mentioned.

살균제로서는 히노키티올, 트리클로산, 트리클로로히드록시디페닐에테르, 크로르헥시딘글루콘산염, 페녹시에탄올, 레조르신, 이소프로필메틸페놀, 아줄렌, 살리칠산, 진크필리티온, 염화벤잘코늄, 감광소 301 호, 모노니트로과이어콜나트륨, 운데시렌산 등을 들 수 있다.Examples of disinfectants include hinokitiol, triclosan, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, zinc phyllithione, benzalkonium chloride, photosensitizer. So, No. 301, mononitroguaial sodium, undecyrenic acid, etc. are mentioned.

산화 방지제로서는 부틸히드록시아니솔, 갈릭산프로필, 엘리소르빈산 등을 들 수 있다.Examples of the antioxidant include butylhydroxyanisole, propyl gallic acid, and ellisorbic acid.

pH 조정제로서는 시트르산, 시트르산나트륨, 말산, 말산나트륨, 프말산, 프말산나트륨, 숙신산, 숙신산나트륨, 수산화나트륨, 인산일수소나트륨 등을 들 수 있다.Examples of the pH adjuster include citric acid, sodium citrate, malic acid, sodium malate, fmalic acid, sodium fumarate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, and the like.

알코올로서는 세틸알코올 등의 고급 알코올을 들 수 있다.As alcohol, higher alcohols, such as cetyl alcohol, are mentioned.

또한, 이외에 첨가해도 되는 배합 성분은 이에 한정되는 것은 아니며, 또, 상기 어느 성분도 본 발명의 목적 및 효과를 손상시키지 않는 범위 내에서 배합 가능하지만, 총중량에 대하여 0.01-5% 중량 백분율 또는 0.01-3% 중량 백분율로 배합될 수 있다.In addition, blending components that may be added other than this are not limited thereto, and any of the above components can be blended within a range that does not impair the object and effect of the present invention, but 0.01-5% by weight or 0.01-3 based on the total weight % by weight.

본 발명의 제형이 로션, 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물섬유, 식물섬유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the formulation of the present invention is a lotion, paste, cream or gel, animal fiber, vegetable fiber, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc. can be used

본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.

본 발명의 제형이 용액 또는 유탁액의 경우에는 담체 성분으로서 용매, 용매화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.When the formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol fatty esters, fatty acid esters of polyethylene glycol or sorbitan.

본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.When the formulation of the present invention is a suspension, as a carrier component, water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.

본 발명의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 리놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide as carrier components Ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolin derivative or ethoxylated glycerol fatty acid ester and the like may be used.

본 발명에서 사용되는 용어는 본 발명에서의 기능을 고려하면서 가능한 현재 널리 사용되는 일반적인 용어들을 선택하였으나, 이는 당 분야에 종사하는 기술자의 의도 또는 판례, 새로운 기술의 출현 등에 따라 달라질 수 있다. 또한, 특정한 경우는 출원인이 임의로 선정한 용어도 있으며, 이 경우 해당되는 발명의 설명 부분에서 상세히 그 의미를 기재할 것이다. 따라서 본 발명에서 사용되는 용어는 단순한 용어의 명칭이 아닌, 그 용어가 가지는 의미와 본 발명의 전반에 걸친 내용을 토대로 정의되어야 한다.The terms used in the present invention have been selected as currently widely used general terms as possible while considering the functions in the present invention, but these may vary depending on the intention or precedent of a person skilled in the art, the emergence of new technology, and the like. In addition, in a specific case, there is a term arbitrarily selected by the applicant, and in this case, the meaning will be described in detail in the description of the corresponding invention. Therefore, the term used in the present invention should be defined based on the meaning of the term and the overall content of the present invention, rather than the name of a simple term.

제1, 제2 등의 용어는 다양한 구성요소들을 설명하는데 사용될 수 있지만, 상기 구성요소들은 상기 용어들에 의해 한정되어서는 안 된다. 상기 용어들은 하나의 구성요소를 다른 구성요소로부터 구별하는 목적으로만 사용된다. 예를 들어, 본 발명의 권리 범위를 벗어나지 않으면서 제1 구성요소는 제2 구성요소로 명명될 수 있고, 유사하게 제2 구성요소도 제1 구성요소로 명명될 수 있다. 및/또는 이라는 용어는 복수의 관련된 기재된 항목들의 조합 또는 복수의 관련된 기재된 항목들 중의 어느 항목을 포함한다.Terms such as first, second, etc. may be used to describe various elements, but the elements should not be limited by the terms. The above terms are used only for the purpose of distinguishing one component from another. For example, without departing from the scope of the present invention, a first component may be referred to as a second component, and similarly, a second component may also be referred to as a first component. and/or includes a combination of a plurality of related listed items or any of a plurality of related listed items.

본 발명의 명세서 전체에서, 어떤 부분이 어떤 구성 요소를 "포함" 한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성 요소를 제외하는 것이 아니라 다른 구성 요소를 더 포함할 수 있는 것을 의미한다. 본 발명의 명세서 전체에서 사용되는 정도의 용어 "약", "실질적으로" 등은 언급된 의미에 고유한 제조 및 물질 허용오차가 제시될 때 그 수치에서 또는 그 수치에 근접한 의미로 사용되고, 본 발명의 이해를 돕기 위해 정확하거나 절대적인 수치가 언급된 개시 내용을 비양심적인 침해자가 부당하게 이용하는 것을 방지하기 위해 사용된다. Throughout the specification of the present invention, when a part "includes" a certain component, it means that other components may be further included, rather than excluding other components, unless otherwise stated. The terms "about", "substantially", etc. to the extent used throughout the specification of the present invention are used in or close to the numerical value when the manufacturing and material tolerances inherent in the stated meaning are presented, and the present invention It is used to prevent an unconscionable infringer from using the disclosure in which exact or absolute figures are mentioned to help the understanding of the

본 발명의 명세서 전체에서, 마쿠시 형식의 표현에 포함된 "이들의 조합"의 용어는 마쿠시 형식의 표현에 기재된 구성 요소들로 이루어진 군에서 선택되는 하나 이상의 혼합 또는 조합을 의미하는 것으로서, 상기 구성 요소들로 이루어진 군에서 선택되는 하나 이상을 포함하는 것을 의미한다.Throughout the specification of the present invention, the term "combination of these" included in the expression of the Markush form means one or more mixtures or combinations selected from the group consisting of the components described in the expression of the Markush form, It means to include one or more selected from the group consisting of components.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[실시예][Example]

실시예 1. 삼차원 피부 오가노이드 제작 및 기존 방법으로 제작된 오가노이드의 특성 분석Example 1. Preparation of three-dimensional skin organoids and characterization of organoids prepared by conventional methods

실시예 1-1. 인간 유도만능 줄기세포의 배양 Example 1-1. Culturing of human induced pluripotent stem cells

건강한 피험자 유래 유도만능 줄기세포주(iPSC; CMC3)는 Y-27632(10 μM)가 보충된 Essential 8(Gibco) 배양액에서 지지세포 없이 Vitronectin(ThermoFisher) 코팅된 배양접시 위에 배양하였다. 배양액은 매일 교체하였으며 약 5일을 주기로 ReLeSR™(Stem Cell Technology)를 이용하여 계대 배양하였다.An induced pluripotent stem cell line (iPSC; CMC3) derived from a healthy subject was cultured on a Vitronectin (ThermoFisher)-coated culture dish without support cells in Essential 8 (Gibco) culture medium supplemented with Y-27632 (10 μM). The culture medium was replaced every day, and subcultures were performed using ReLeSR™ (Stem Cell Technology) every 5 days.

실시예 1-2. 인간 유도만능 줄기세포주를 사용한 삼차원 피부 오가노이드 분화방법Example 1-2. Three-dimensional skin organoid differentiation method using human induced pluripotent stem cell line

유도만능 줄기세포주를 이용한 기존의 피부 오가노이드 분화 프로토콜이 개시된 문헌(Lee, J. et al. Hair-bearing human skin generated entirely from pluripotent stem cells. Nature 582, 399-404(2020))을 기반으로 피부 오가노이드를 배양하였다. 유도만능 줄기세포 콜로니를 ReLeSR™(Stem Cell Technology)를 이용하여 작은 세포군집 단위로 분리한 후, Accutase(ThermoFisher)를 사용하여 단일세포로 분리하였다. 배아체(embryoid body) 형성을 위해, 1000개의 단일세포를 U-bottom low-attachment 96-well plate(Corning)의 각 웰에 분주하였다. 배아체 배양액은 Y-27632(20μM)가 보충된 Essential 8(Gibco)을 사용하였다. 배아체가 300-500 μm의 크기로 성장할 때 까지 2일 동안 배양하였다. 분화 2일째에, 형성된 배아체를 비신경 외배엽(non-neural ectoderm) 분화 유도를 위해, 2 % 마트리젤(Matrigel; Corning), 10 μM SB431542(Tocris), 4 ng/ml FGF2(PeproTech) 및 15 ng/ml의 BMP4 PeproTech)를 포함하는 배양액으로 옮겨주었다. 6일째부터 두개골 신경능선 유사세포(Cranial neural crest cell)를 유도하기 위하여 배양액에 200 ng/ml의 FGF2 및 50 ㎍/ml의 LDN193189(Tocris)를 배지에 첨가하였다. 또한, 14일째, 오가노이드를 3 ml의 피부 오가노이드 성숙 배지가 담겨있는 6웰 플레이트(low-attachment 6-well plate; Corning)로 옮기고 Orbital shaker(65 rpm; Thermo Fisher)에서 분석 당일까지 피부 오가노이드를 배양하였다. 배지는 3 일마다 교체하였다. 피부 오가노이드 성숙 배지는 1:1 비율의 Advanced DMEM/F12(Gibco) 및 Neurobasal(Gibco) 배지에, 1X GlutaMax™(Gibco), 0.5X B-27 마이너스 비타민 1 A(Gibco), 0.5X N2(Gibco), 보충제, 0.1mM 2-메르캅토에탄올(Gibco) 및 100㎍/ml Normocin(Invivogen)을 포함한다. 분석 대상 피부 오가노이드는 EVOS XL Core 명시야 시스템 현미경(Thermo Fisher)으로 x 40배 배율로 촬영하였다. Based on the literature (Lee, J. et al. Hair-bearing human skin generated entirely from pluripotent stem cells. Nature 582 , 399-404 (2020)), the existing skin organoid differentiation protocol using an induced pluripotent stem cell line was disclosed. Organoids were cultured. Inducible pluripotent stem cell colonies were separated into small cell clusters using ReLeSR™ (Stem Cell Technology), and then separated into single cells using Accutase (ThermoFisher). To form an embryoid body, 1000 single cells were dispensed into each well of a U-bottom low-attachment 96-well plate (Corning). Essential 8 (Gibco) supplemented with Y-27632 (20 μM) was used as the embryo culture medium. Embryos were cultured for 2 days until they grew to a size of 300-500 μm. On day 2 of differentiation, the formed embryoid bodies were treated with 2% Matrigel (Corning), 10 μM SB431542 (Tocris), 4 ng/ml FGF2 (PeproTech) and 15 to induce non-neural ectoderm differentiation. ng/ml of BMP4 PeproTech) was transferred to the culture medium. From day 6, 200 ng/ml of FGF2 and 50 μg/ml of LDN193189 (Tocris) were added to the culture medium to induce cranial neural crest cells. Additionally, on day 14, the organoids were transferred to a low-attachment 6-well plate (Corning) containing 3 ml of skin organoid maturation medium, and the skin was mixed on an orbital shaker (65 rpm; Thermo Fisher) until the day of analysis. Nodes were cultured. The medium was changed every 3 days. Skin organoid maturation medium was mixed with Advanced DMEM/F12 (Gibco) and Neurobasal (Gibco) medium in a 1:1 ratio, 1X GlutaMax™ (Gibco), 0.5X B-27 minus vitamin 1 A (Gibco), 0.5X N2 ( Gibco), supplements, 0.1 mM 2-mercaptoethanol (Gibco) and 100 μg/ml Normocin (Invivogen). The skin organoids to be analyzed were photographed with an EVOS XL Core brightfield system microscope (Thermo Fisher) at x 40x magnification.

그 결과, 도 1에 나타난 바와 같이, 모낭은 60 내지 70일 째에 관찰되었다. 층화된 상피는 오가노이드 내부 층에 존재하며 진피 및 피하 층은 바깥쪽으로 둘러싸여 있었다.As a result, as shown in FIG. 1 , hair follicles were observed on days 60 to 70. The stratified epithelium was present in the inner layer of the organoids and the dermal and subcutaneous layers were surrounded outward.

또한, 도 2에 나타난 바와 같이, 피부오가노이드는 140일 만에 직경 5 mm 이상으로 성장했으며 여러 색소(도 2 상단) 또는 알비노 모낭(도 2 하단)을 포함하고 있었다. 기존의 피부 오가노이드 분화 방법(Lee 등 2020)으로 제작된 오가노이드는 둥근 응집체 모양을 하고 있으며 인사이드 아웃(inside-out) 형태를 갖고 있었다. In addition, as shown in FIG. 2, the skin organoids grew to more than 5 mm in diameter in 140 days and contained several pigments (top of FIG. 2) or albino hair follicles (bottom of FIG. 2). Organoids produced by the existing skin organoid differentiation method (Lee et al. 2020) had a round aggregate shape and had an inside-out shape.

실시예 1-3. 형광 면역 조직 염색Examples 1-3. Fluorescent immunohistochemistry

기존 배양 방법(Lee 등 2020)으로 분화된 피부 오가노이드를 동결 절삭 후 형광 염색을 통해 피부 마커 발현과 계층 구조를 확인하였다. 우선 형성된 피부 오가노이드를 4 % PFA로 고정한 후 30 % sucrose 용액에서 탈수 과정을 거쳤다. 탈수 작용을 마치고 나서, 젤라틴/sucrose 용액 내에 동결시켜 Cryostat 기기를 이용해 약 10-12 μm의 두께로 슬라이드를 제작하였다. 동결 절편은 5 % 정상 염소 혈청, 0.5 % 소 혈청 알부민, 0.25 % 어류 젤라틴 및 PBS 중 0.3% TritonX-100으로 구성된 차단 완충액에서 실온에서 1 시간 동안 차단하였다. 1차 항체는 4 ℃에서 밤새 차단 완충액에 희석하여 배양하였다. 그런 다음 섹션을 PBS로 3회 세척하고 차단 버퍼에서 2차 항체와 한 시간 동안 실온에서 함께 배양하였다. 절편은 PBS로 3회 세척하고 핵은 4’6’-diamidino-2-phenylindole(DAPI)를 사용하여 염색하였다. 마지막으로, 섹션을 PBS에서 한 번 세척하고 형광 장착매체(DAKO)로 장착하였다. 기존의 방법으로 배양된 피부 오가노이드를 형광 염색 분석을 통해 분화 마커를 확인하고 형성 및 구조를 동결 절편 슬라이드 염색법을 통해 확인하였다. 사용한 1차 항체는 다음과 같다: Anti-KRT5(1:500; abcam; ab52635), Anti-KRT10(1:100; Santa Cruz Biotechnology; sc-23877), Anti-KRT17(1:100; Santa Cruz Biotechnology; sc-393091), Anti-Filaggrin(1:100; Santa Cruz Biotechnology; sc-66192), Anti-Vimentin 비맨틴(1:100; Santa Cruz Biotechnology; sc-6260), Anti-COL3A 콜라겐3(1:100; Santa Cruz Biotechnology; sc-27124), Anti-Loricrin(1:500; abcam; ab85679), Anti-Staphylococcus aureus(1:100; Santa Cruz Biotechnology; sc-58038), Anti-PDGFRα(1:250; Cell Signaling Technology; 3164S), Anti-MelanA(1:250; abcam; ab51061), Anti-TSLP(1:250; abcam; ab47943), Anti-Lipid Tox(1:200; Invitrogen; H34477), Anti-Claudin4(1:200; Invitrogen; 32-9400), Anti-KRT15(1:200; Invitrogen MA5-11344), Anti-p63(1:250; abcam; ab735), Anti-TFAP(1:50; Santa Cruz Biotechnology; sc-12726), Anti-COL2A1(1:50; Millipore; ab261), Anti-Fibronectin(1:100; abcam; ab6328), Anti-S100α(1:50; Santa Cruz Biotechnology; sc-53438), Anti-E-cadherin(1:250; abcam; ab1416).Skin marker expression and hierarchical structure were confirmed through fluorescence staining after freeze-cutting skin organoids differentiated by the existing culture method (Lee et al. 2020). First, the formed skin organoids were fixed with 4% PFA and then dehydrated in 30% sucrose solution. After the dehydration action was completed, the slide was frozen in gelatin/sucrose solution to prepare a slide with a thickness of about 10-12 μm using a cryostat device. Frozen sections were blocked in blocking buffer consisting of 5% normal goat serum, 0.5% bovine serum albumin, 0.25% fish gelatin and 0.3% TritonX-100 in PBS for 1 h at room temperature. The primary antibody was diluted in blocking buffer and incubated overnight at 4°C. The sections were then washed 3 times with PBS and incubated with secondary antibody in blocking buffer for 1 hour at room temperature. Sections were washed three times with PBS and nuclei were stained with 4'6'-diamidino-2-phenylindole (DAPI). Finally, sections were washed once in PBS and mounted with fluorescence mounting medium (DAKO). Differentiation markers were identified through fluorescence staining analysis of skin organoids cultured by the conventional method, and formation and structure were confirmed through frozen section slide staining. The primary antibodies used were: Anti-KRT5 (1:500; abcam; ab52635), Anti-KRT10 (1:100; Santa Cruz Biotechnology; sc-23877), Anti-KRT17 (1:100; Santa Cruz Biotechnology) ; sc-393091), Anti-Filaggrin (1:100; Santa Cruz Biotechnology; sc-66192), Anti-Vimentin vimentin (1:100; Santa Cruz Biotechnology; sc-6260), Anti-COL3A collagen3 (1: 100; Santa Cruz Biotechnology; sc-27124), Anti-Loricrin (1:500; abcam; ab85679), Anti- Staphylococcus aureus ( 1:100; Santa Cruz Biotechnology; sc-58038), Anti-PDGFRα (1:250; Cell Signaling Technology; 3164S), Anti-MelanA (1:250; abcam; ab51061), Anti-TSLP (1:250; abcam; ab47943), Anti-Lipid Tox (1:200; Invitrogen; H34477), Anti-Claudin4 (1:200; Invitrogen; 32-9400), Anti-KRT15 (1:200; Invitrogen MA5-11344), Anti-p63 (1:250; abcam; ab735), Anti-TFAP (1:50; Santa Cruz Biotechnology) ; sc-12726), Anti-COL2A1 (1:50; Millipore; ab261), Anti-Fibronectin (1:100; abcam; ab6328), Anti-S100α (1:50; Santa Cruz Biotechnology; sc-53438), Anti -E-cadherin (1:250; abcam; ab1416).

도 3a에 나타난 바와 같이, 기존 방법으로 분화된 피부 오가노이드에서 표피전구세포(TFAP+ KRT5+; epidermal progenitor cells) 및 진피전구세포(TFAP+ PDGFRα+, dermal progenitor cells) 형성 및 구조를 확인하였다. As shown in Fig. 3a, the formation and structure of epidermal progenitor cells (TFAP+ KRT5+; epidermal progenitor cells) and dermal progenitor cells (TFAP+ PDGFRα+, dermal progenitor cells) were confirmed in skin organoids differentiated by the conventional method.

도 3b에 나타난 바와 같이, 67 일과 87 일 동안 배양된 피부 오가노이드 모낭에서 Sox2+ 진피 유두 세포(dermal papilla cells)의 발현을 확인하였다. 67 일 째 분화된 피부 오가노이드에서는 유리연골(hyaline cartilage)의 분화가 관찰되었다. As shown in FIG. 3b , the expression of Sox2+ dermal papilla cells was confirmed in the skin organoid hair follicles cultured for days 67 and 87. On day 67, differentiation of hyaline cartilage was observed in the differentiated skin organoids.

또한, 도 3c에 나타난 바와 같이, S100α+ 연골 세포와 Coll2A1이 연골을 생산하는 것으로 나타났다. In addition, as shown in FIG. 3c , it was found that S100α+ chondrocytes and Coll2A1 produced cartilage.

다음으로 기존 방법으로 배양된 피부 오가노이드에서 층상화 된(stratified) 표피층(epidermal layer) 형성 및 구조 타임라인을 동결 절편 슬라이드 염색법을 통해 조사 하였다. Next, the stratified epidermal layer formation and structure timeline in skin organoids cultured by the conventional method were investigated through frozen section slide staining.

도 4에 나타난 바와 같이, 33, 46, 67, 87 및 140 일된 피부 오가노이드에서 성숙한 표피 단백질 발현을 확인하였다. KRT5+ 및 KRT14+ 기저층은 33일 동안 배양된 피부오가노이드에 발현이 되는 것을 볼 수 있었고, KRT10을 발현하는 유극층 피부세포(spinous keratinocytes)는 대략 46일에 표면 상피에서 처음 관찰되었다. 로리크린(loricrin)과 필라그린(filaggrin)을 발현하는 각질화(cornified) 된 표피층(epidermal layer)은 각각 분화 67 일 후에 나타났다.As shown in FIG. 4 , mature epidermal protein expression was confirmed in skin organoids aged 33, 46, 67, 87 and 140 days. KRT5+ and KRT14+ basal layers were observed to be expressed in skin organoids cultured for 33 days, and KRT10-expressing spinous keratinocytes were first observed in the superficial epithelium at approximately 46 days. A cornified epidermal layer expressing loricrin and filaggrin appeared after 67 days of differentiation, respectively.

즉, 기존의 피부 오가노이드 제작 방법은 다음과 같은 분화 발현 특성을 보이고 있다. 1) 제작된 오가노이드는 둥근 응집체 모양을 하고 있으며 인사이드 아웃(inside-out) 형태를 갖고 있다. 층화된 상피는 오가노이드 내부층에 존재하며 진피 및 피하 층은 바깥쪽을 둘러싸고 있다. 2) 3D 피부 오가노이드의 가장 안쪽 코어에서 성숙된 각질화 표피층이 관찰되었다. 3)표피 및 진피층 분화 마커를 확인하고, 모낭구성세포, 모유두세포과 같은 피부 부속물과 유리연골의 형성 및 구조를 동결 절편 슬라이드 염색법을 통해 확인하였다 4)상피층의 각질화의 최종 성숙이 약 70일째에 시작되었다.That is, the existing skin organoid production method shows the following differentiation expression characteristics. 1) The prepared organoid has a round aggregate shape and has an inside-out shape. The stratified epithelium resides in the inner layer of the organoid, while the dermal and subcutaneous layers surround the outer layer. 2) A mature keratinized epidermal layer was observed in the innermost core of 3D skin organoids. 3) Epidermal and dermal differentiation markers were identified, and the formation and structure of skin appendages such as hair follicles and dermal papilla cells and free cartilage were confirmed through frozen section slide staining 4) The final maturation of keratinization of the epithelial layer started at about 70 days became

따라서, 본 발명자들은 삼차원 계층화 된 피부 오가노이드를 효율적으로 제조하고 실제 인간 피부와 유사한 피부 오가노이드 형성을 위해 기존의 삼차원 피부 오가노이드 배양법을 변형하였다. 본 발명은 공기-액체 계면(Air-liquid interface; ALI) 배양법을 응용하여 인간 만능성 줄기세포로부터 삼차원 공기-액체 계면-피부 오가노이드 모델(ALI-피부 오가노이드)을 제조하였다. ALI 배양법은 피부조직 배양에 널리 사용된 방법으로서, 표피의 층화를 촉진시키고 표피층을 공기에 노출시킴으로 생체 피부 분화 과정에 가깝다.Therefore, the present inventors modified the existing three-dimensional skin organoid culture method to efficiently prepare three-dimensional layered skin organoids and to form skin organoids similar to actual human skin. In the present invention, a three-dimensional air-liquid interface-skin organoid model (ALI-skin organoid) was prepared from human pluripotent stem cells by applying an air-liquid interface (ALI) culture method. The ALI culture method is a method widely used for skin tissue culture, and it is close to the biological skin differentiation process by promoting the stratification of the epidermis and exposing the epidermal layer to air.

실시예 2. Wnt 신호 전달 경로 활성화를 통한 ALI 피부 오가노이드 제작Example 2. ALI skin organoid production through Wnt signaling pathway activation

본 발명자들은 Wnt 신호 전달 경로 활성화(0.5-8 μM Wnt 작용제(CHIR-99021)) 실험을 통해 Wnt 신호 전달 경로가 피부 오가노이드에 미치는 영향을 확인하였다.The present inventors confirmed the effect of the Wnt signaling pathway on skin organoids through the Wnt signaling pathway activation (0.5-8 μM Wnt agonist (CHIR-99021)) experiment.

먼저, 피부 오가노이드는 실시예 1-2의 방법에 기초하되, 일부 단계를 변형하였다. 6 일째부터 두개골 신경능선 유사세포(Cranial neural crest cell)를 유도하기 위하여 배양액에 200 ng/ml의 FGF2 및 50 ㎍/ml의 LDN193189(Tocris)를 첨가하였다. 또한, Wnt 신호 전달 경로 활성화를 위해 0.5-8 μM Wnt 작용제(CHIR-99021)를 6일 째 배지에 첨가하였다(도 5 참고). 배양 14 일째에 오가노이드를 3 ml의 피부 오가노이드 성숙 배지가 담겨있는 6 웰 플레이트(low-attachment 6-well plate; Corning)로 옮기고 Orbital shaker(65 rpm; Thermo Fisher)에서 분석 당일까지 피부 오가노이드를 배양하였다. 배지는 3 일마다 교체하였다. 분석 대상 피부 오가노이드는 EVOS XL Core 명시야 시스템 현미경(Thermo Fisher)으로 x 40배 배율로 촬영하였다. First, skin organoids were based on the method of Example 1-2, with some steps being modified. From day 6, 200 ng/ml of FGF2 and 50 μg/ml of LDN193189 (Tocris) were added to the culture medium to induce cranial neural crest cells. In addition, 0.5-8 μM Wnt agonist (CHIR-99021) was added to the medium on day 6 to activate the Wnt signaling pathway (see FIG. 5 ). On day 14 of culture, the organoids were transferred to a low-attachment 6-well plate (Corning) containing 3 ml of skin organoid maturation medium and the skin organoids were placed on an orbital shaker (65 rpm; Thermo Fisher) until the day of analysis. was cultured. Medium was changed every 3 days. The skin organoids to be analyzed were photographed with an EVOS XL Core brightfield system microscope (Thermo Fisher) at x 40x magnification.

도 6 및 도 7에 나타난 바와 같이, 분화 6일 째, 배양액에 0.5-8 μM Wnt agonist인 CHIR-99021을 첨가한 결과, 기존의 방법에 의해 생성된 피부 오가노이드에 비해 오가노이드 크기가 현저히 증가되었다.6 and 7, as a result of adding 0.5-8 μM Wnt agonist CHIR-99021 to the culture medium on the 6th day of differentiation, the organoid size significantly increased compared to the skin organoids generated by the conventional method. became

또한, 도 7에 나타난 바와 같이, 기존 배양법에 따라 CHIR-99021을 처치하지 않은(CHIR (-)) 군은 38, 65, 85일째 되는 피부 오가노이드에서 연골이 분화되었다 (빨강색 동그라미는 연골을 나타냄). 하지만 CHIR-99021를 처치함으로써 Wnt를 활성화 시킨 피부 오가노이드는 크기가 커지고 연골형성이 되지 않은 구형 cysts로 분화됨을 확인하였는 바, Wnt 활성화가 피부 오가노이드에서 불필요한 구성요소인 연골 형성을 유의미하게 억제함을 나타낸다. In addition, as shown in FIG. 7 , in the group not treated with CHIR-99021 according to the conventional culture method (CHIR (-)), cartilage was differentiated from skin organoids on days 38, 65, and 85 (red circles indicate cartilage). indicated). However, by treatment with CHIR-99021, it was confirmed that Wnt-activated skin organoids increased in size and differentiated into spherical cysts that did not form chondrogenesis. indicates

실시예 3. Wnt 신호 전달 경로 활성화를 통한 ALI 피부 오가노이드의 연골 관련 유전자 마커의 발현 확인Example 3. Confirmation of expression of cartilage-related gene markers in ALI skin organoids through Wnt signaling pathway activation

유전자 발현을 평가하기 위한 방법으로서, 용해 버퍼(lysis buffer)를 이용해 세포를 용해시키고 유전자를 추출하였으며, RT-PCR를 사용하여 유전자 발현을 정량화하였다. 유전자 발현을 평가하기 위하여 총 RNA는 RNeasy 키트(Qiagen, 카탈로그 번호 74106)로 분리하고 cDNA는 Reverse transcriptase III(Thermo Fisher Scientific, 카탈로그 번호 4368814)를 사용하여 제조업체의 지침에 따라 준비하였다. Real-time PCR은 SRBR Green Master Mix(Thermo Fisher Scientific, 카탈로그 번호 A25776)를 사용하여 수행하고, 검출은 Step One Plus Real-time PCR 시스템(Applied Biosystems)를 사용하였다. 유전자의 발현은 GAPDH(glyceraldehyde-3-phosphate dehydrogenase)의 발현으로 정규화하였다. 유전자 발현 정도는 COL2A, ACAN, 및 SOX9 mRNA에 대해 특이적인 프라이머를 사용하여 평가하였다. 상기 프라이머의 구체적인 서열은 하기 표 1에 기재하였다. As a method for evaluating gene expression, cells were lysed using a lysis buffer and genes were extracted, and gene expression was quantified using RT-PCR. To evaluate gene expression, total RNA was isolated with an RNeasy kit (Qiagen, catalog number 74106) and cDNA was prepared using Reverse transcriptase III (Thermo Fisher Scientific, catalog number 4368814) according to the manufacturer's instructions. Real-time PCR was performed using SRBR Green Master Mix (Thermo Fisher Scientific, catalog number A25776), and detection was performed using a Step One Plus Real-time PCR system (Applied Biosystems). Gene expression was normalized to the expression of GAPDH (glyceraldehyde-3-phosphate dehydrogenase). Gene expression levels were assessed using primers specific for COL2A, ACAN, and SOX9 mRNA. Specific sequences of the primers are shown in Table 1 below.

mRNAmRNA sequencesequence 서열번호SEQ ID NO: COL2ACOL2A Forward-5‘CATGAGGGCGCGGTAGAGAC3’Forward-5 ‘CATGAGGGCGCGGTAGAGAC3’ 1One Reverse-5‘TCCCTTTGGTCCTGGTTGCC3’Reverse-5 ‘TCCCTTTGGTCCTGGTTGCC3’ 22 ACANACAN Forward-5’CTTCTCCGGAATGGAAACGTG3’Forward-5’CTTCTCCGGAATGGAAACGTG3’ 33 Reverse-5’ACATACCTCCTGGTCTATGTTACAG3’Reverse-5’ACATACCTCCTGGTCTATGTTACAG3’ 44 SOX9SOX9 Forward-5’GAAGCTCGCGGACCAGTACC3’Forward-5’GAAGCTCGCGGACCAGTACC3’ 55 Reverse-5’CTGCCCGTTCTTCACCGACT3’Reverse-5’CTGCCCGTTCTTCACCGACT3’ 66 GAPDHGAPDH forward-5’GTCAGTGGTGGACCTGACCT3’ forward-5’GTCAGTGGTGGACCTGACCT3’ 77 reverse-5’TGCTGTAGCCAAATTCGTTG3’reverse-5’TGCTGTAGCCAAATTCGTTG3’ 88

도 8에 나타난 바와 같이, CHIR-99021을 처리한 피부 오가노이드(CHIR(+))는 CHIR-99021 처치하지 않은 군(CHIR (-))에 비해 연골 발현 마커인 COL2A, ACAN, 및 SOX9의 유전자 발현 수준이 현저히 감소됨을 확인하였다. As shown in Figure 8, the skin organoids treated with CHIR-99021 (CHIR (+)) compared to the group not treated with CHIR-99021 (CHIR (-)), the cartilage expression markers COL2A, ACAN, and SOX9 genes It was confirmed that the expression level was significantly reduced.

실시예 4. 인간 유도만능 줄기세포를 유래 공기-액체 계면(Air-liquid interface; ALI) 배양법을 이용한 피부 오가노이드 제작 및 특성 확인Example 4. Manufacture of skin organoids using air-liquid interface (ALI) culture method derived from human induced pluripotent stem cells and confirmation of characteristics

실시예 4-1. 공기-액체 계면(Air-liquid interface; ALI) 배양법을 이용한 피부 오가노이드 제작Example 4-1. Fabrication of skin organoids using air-liquid interface (ALI) culture method

실시예 2의 피부 오가노이드를 약 40일 내지 100일 동안 배양한 후, 오가노이드를 4 개의 균일한 크기로 Dumount #3 forceps(Fine Science Tools) 과 Spring Scissors(Fine Science Tools)를 이용하여 절단하고 콜라겐(Corning) 코팅된 트랜스 웰 배양 삽입물(transwell culture insert, 구멍 크기 0.4 μm, 12웰 플레이트; Corning) 위에 진피층은 콜라겐 쪽으로 표피층은 공기에 노출되게 펼쳐서 배양하였다. ALI 피부 오가노이드는 피부 성숙배지와 함께 공기-액체 계면(air-liquid interface)에서 추가로 3주에서 4주동안 100% 습도 조건 배양기에서 배양 후 2일에서 6일 동안 층상 상피층의 성숙을 위해 건조 조건(dry condition; 0% humidity condition incubator)에서 배양하였다. ALI-피부 오가노이드 제작 방법은 도 9에 나타내었다. After culturing the skin organoids of Example 2 for about 40 to 100 days, the organoids were cut into 4 uniform sizes using Dumount #3 forceps (Fine Science Tools) and Spring Scissors (Fine Science Tools) and On collagen (Corning)-coated transwell culture insert (pore size 0.4 μm, 12-well plate; Corning), the dermal layer was spread to the collagen side and the epidermal layer was exposed to air for culture. ALI skin organoids are dried for maturation of the stratified epithelial layer for 2 to 6 days after incubation in an incubator under 100% humidity for 3 to 4 weeks at an air-liquid interface with skin maturation medium. Incubated in dry condition (0% humidity condition incubator). The ALI-skin organoid fabrication method is shown in FIG. 9 .

실시예 4-2. 공기-액체 계면(Air-liquid interface; ALI) 배양법을 이용한 피부 오가노이드의 특성 확인 : 조직학적 구조 확인Example 4-2. Characterization of skin organoids using air-liquid interface (ALI) culture method: histological structure confirmation

피부 오가노이드의 조직학적 구조를 확인하기 위하여, H&E 염색 및 Oil Red O 스테이닝을 수행하였다. H&E 염색 방법은 다음과 같다. 오가노이드를 4% 파라포르말린으로 고정한 후 알코올을 이용하여 탈수하고 자일렌(xylene)으로 투명화한 후, 파라핀에 포매하였다. 12 μm 두께로 동결 절편하여 슬라이드를 제작하고 Hematoxylin과 Eosin으로 염색한 후, 광학현미경(Olympus Ix70)으로 확인하였다.To confirm the histological structure of skin organoids, H&E staining and Oil Red O staining were performed. The H&E staining method is as follows. Organoids were fixed with 4% paraformalin, dehydrated using alcohol, and transparent with xylene, and then embedded in paraffin. Slides were prepared by frozen sectioning to a thickness of 12 μm, stained with hematoxylin and eosin, and confirmed with an optical microscope (Olympus Ix70).

Oil Red O 스테이닝 방법은 다음과 같다. 오가노이드를 4% 파라포르말린으로 고정한 후 12 μm 두께로 동결 절편하여 슬라이드를 제작하였다. 제작된 슬라이드는 15 분 동안 Oil O Red staining 솔루션(oil o red 0.5g(Sigma Aldrich) in 100ml isopropanol)으로 염색하고, Hematoxylin으로 염색후 광학현미경(Olympus Ix70)으로 확인하였다.The Oil Red O staining method is as follows. After fixing the organoids with 4% paraformalin, the slides were prepared by frozen sectioning to a thickness of 12 μm. The prepared slides were stained with Oil O Red staining solution (oil o red 0.5g (Sigma Aldrich) in 100ml isopropanol) for 15 minutes, stained with Hematoxylin, and checked with an optical microscope (Olympus Ix70).

도 10a에 나타난 바와 같이, 본 발명의 ALI-피부 오가노이드는 기존의 방법에 의해 배양된 피부 오가노이드에 비해 보다 실제 피부와 유사한 형태를 보였을 뿐만 아니라 모낭 성장이 크게 향상된 것을 관찰하였다. As shown in Fig. 10a, it was observed that the ALI-skin organoid of the present invention not only showed a more similar shape to the actual skin, but also significantly improved hair follicle growth compared to the skin organoid cultured by the conventional method.

더욱이, 도 10b에 나타난 바와 같이, 본 발명의 ALI-피부 오가노이드는 조직학적으로 연속적인 상피 구조로 발전하여 표면에 정상적인 바스켓 직조 패턴(normal basket weave pattern)을 갖는 성숙한 층상 상피층을 형성하는 반면, 기존 피부 오가노이드(whole skin organoid)는 층화된 상피를 나타내기는 하지만, 층이 오가노이드 내부에 존재하며 진피 및 피하층은 바깥쪽으로 둘러싸여 있어, 실제 피부조직과는 다른 인사이드 아웃(inside-out) 형태를 보였다. 따라서, 본 발명의 ALI-피부 오가노이드가 실제 피부조직을 나타내는 피부 모델로서 더욱 적합함을 확인하였다.Moreover, as shown in Fig. 10b, the ALI-skin organoids of the present invention histologically develop into a continuous epithelial structure to form a mature stratified epithelial layer with a normal basket weave pattern on the surface, whereas Existing whole skin organoids show stratified epithelium, but the layers exist inside the organoids and the dermis and subcutaneous layers are surrounded by the outside, so it has an inside-out shape that is different from the actual skin tissue. seemed Therefore, it was confirmed that the ALI-skin organoid of the present invention is more suitable as a skin model representing the actual skin tissue.

또한, 도 11에 나타난 바와 같이, 본 발명의 ALI 배양법으로 제조된 ALI-피부 오가노이드는 실제 피부와 유사하게 피하지방층이 진피층 아래쪽으로 분화가 된 것이 확인되었으며, 모낭 주위에 발달된 피지선 또한 분화 되는 것이 관찰되었다.In addition, as shown in Figure 11, it was confirmed that the ALI-skin organoids prepared by the ALI culture method of the present invention differentiated the subcutaneous fat layer down to the dermis layer similar to the actual skin, and the sebaceous glands developed around the hair follicles were also differentiated. that was observed

또한, 도 12에 나타난 바와 같이, 본 발명의 ALI 배양법으로 제조된 ALI-피부 오가노이드는 발달된 인간 모낭 구조가 형성되는 것을 볼 수 있었다. 모낭 벌지 줄기세포(hair follicle bulge stem cells) 피지선, 머리전구, 모간 등도 뚜렷하게 발현되는 것이 관찰되었다. 이는 인간 피부 구조를 연상시키는 모낭을 성장 발현시킬 뿐만 아니라, 기존 오가노이드와 비교하여 현저히 개선된 형태의 모낭을 나타낸다는 것을 시사한다. In addition, as shown in FIG. 12 , it could be seen that the ALI-skin organoid prepared by the ALI culture method of the present invention formed a developed human hair follicle structure. It was also observed that the hair follicle bulge stem cells, sebaceous glands, hair bulbs, and hair shafts were expressed clearly. This suggests that not only growth and expression of hair follicles reminiscent of human skin structures, but also significantly improved hair follicles compared to existing organoids.

또한, 도 13a에 나타난 바와 같이, 본 발명의 피부 각질세포의 성숙을 위해 0일, 2일, 4일, 또는 6일 동안 건조 조건에서 배양된 ALI-피부 오가노이드는 피부 조직과 유사한 형태를 보여 주었다.In addition, as shown in Figure 13a, the ALI-skin organoids cultured in dry conditions for 0 days, 2 days, 4 days, or 6 days for the maturation of dermal keratinocytes of the present invention show a morphology similar to that of skin tissue. gave.

또한, 도 13b의 H&E 염색 결과에 나타난 바와 같이, 마지막 건조 조건에서 4일 및 6일 째 배양된 ALI-피부 오가노이드에서는 성숙된 각질세포가 분화(빨갛게 염색된 부분)되는 것이 관찰되었다.In addition, as shown in the H&E staining result of FIG. 13B , it was observed that mature keratinocytes were differentiated (red-stained parts) in the ALI-skin organoids cultured on the 4th and 6th days in the last dry condition.

실시예 4-3. 공기-액체 계면(Air-liquid interface; ALI) 배양법을 이용한 피부 오가노이드의 특성 확인 : 형광 면역 조직 염색Example 4-3. Characterization of skin organoids using air-liquid interface (ALI) culture method: fluorescent immunohistochemistry

실시예 1-3의 형광 면역 조직 염색 방법을 사용하여, 본 발명의 ALI-피부 오가노이드에서 다양한 피부 관련 인자의 발현을 확인하였다.The expression of various skin-related factors in the ALI-skin organoids of the present invention was confirmed using the fluorescent immunohistostaining method of Examples 1-3.

도 14에 나타난 바와 같이, 본 발명의 ALI-피부 오가노이드에서는 성숙한 표피 성숙한 유극층 마커인 KRT10 발현되었으며, 표피의 각질층 마커인 loricrin과 filaggrin 분화 또한 관찰되었다. As shown in FIG. 14 , KRT10, a mature epidermal mature stratum corneum marker, was expressed in the ALI-skin organoid of the present invention, and differentiation of loricrin and filaggrin, a stratum corneum marker of the epidermis, was also observed.

또한, 도 15에 나타난 바와 같이, 본 발명의 ALI-피부 오가노이드에서는 길쭉한 모낭에서 진피유두와 멜라닌 세포의 발현이 관찰되었고, KRT15+ 모낭 벌지 줄기세포도 존재함을 확인할 수 있었다. 또한, ALI-피부 오가노이드는 모간 외피(outer sheaths of hair shafts)가 발현되는 것이 관찰되었다. 이는 본 발명의 ALI-피부 오가노이드가 인간 피부 구조를 연상시키는 개선된 모낭 성장과 발현 나타낸다는 것을 시사한다.In addition, as shown in FIG. 15 , in the ALI-skin organoid of the present invention, the expression of dermal papilla and melanocytes was observed in elongated hair follicles, and it was confirmed that KRT15+ hair follicle bulge stem cells were also present. In addition, ALI-skin organoids were observed to express outer sheaths of hair shafts. This suggests that the ALI-skin organoids of the present invention exhibit improved hair follicle growth and expression reminiscent of human skin structures.

또한, 도 16에 나타난 바와 같이, 본 발명의 ALI-피부 오가노이드에서는 성숙한 표피의 각질층 마커인 loricrin과 filaggrin 분화가 건조 조건에서 4일 또는 6일 째 배양된 ALI-피부 오가노이드에서 나타나기 시작한 것을 관찰 하였다.In addition, as shown in FIG. 16, in the ALI-skin organoid of the present invention, it was observed that differentiation of loricrin and filaggrin, which are markers of the stratum corneum of the mature epidermis, started to appear in the ALI-skin organoid cultured on the 4th or 6th day under dry conditions. did

또한, 도 17에 나타난 바와 같이, 본 발명의 마지막 단계 6일 동안 건조 조건에서 배양된 ALI-피부 오가노이드에서는 진피층 마커인 콜라겐3(COL3)과 비멘틴(VMT)이 분화된 것을 확인하였다.In addition, as shown in FIG. 17, it was confirmed that collagen 3 (COL3) and vimentin (VMT), which are dermal layer markers, were differentiated in ALI-skin organoids cultured in dry conditions for 6 days in the last step of the present invention.

또한, 도 18에 나타난 바와 같이, 본 발명의 마지막 단계 6일 동안 건조 조건에서 배양된 ALI-피부 오가노이드에서는 피하층과 피지선 지방 세포 발현을 Lipid tox로 확인할 수 있었다.In addition, as shown in FIG. 18 , the expression of subcutaneous layer and sebaceous gland adipocytes was confirmed by Lipid tox in ALI-skin organoids cultured in dry conditions for 6 days in the last stage of the present invention.

실시예 5. 황색포도상구균 감염에 의한 아토피 피부염 모델링Example 5. Modeling of atopic dermatitis caused by Staphylococcus aureus infection

실시예 5-1. 황색포도상구균 감염에 의한 아토피 피부염 모델링: 조직학적 구조 확인Example 5-1. Modeling atopic dermatitis caused by Staphylococcus aureus infection: Histological structure confirmation

피부 감염의 일반적인 원인인 황색포도상구균은 아토피 환자의 피부에서 자주 발견되지만 건강한 사람의 피부에서는 발견되지 않는다. 아토피 피부염을 모델링하기 위해, 황색포도상구균의 접종 시 피부 오가노이드의 표피층을 관통하는지 확인하고 ALI-피부 오가노이드를 이용하여 표피 황색포도상구균 집락(colonization) 형성에 대해 조사하였다. Staphylococcus aureus, a common cause of skin infections, is frequently found on the skin of atopic patients, but not on the skin of healthy people. To model atopic dermatitis, it was checked whether Staphylococcus aureus inoculation penetrates the epidermal layer of skin organoids, and the formation of epidermal Staphylococcus aureus colonization was investigated using ALI-skin organoids.

실시예 4에 기초하여 3주에서 4주간 배양된 ALI 피부 오가노이드를 황색포도상구균(S. aureus) 균주 ATCC 29213을 사용하여 감염시켰다. 현탁액을 100 x g에서 10분 동안 원심분리하고 600 nm에서 현탁액의 흡광도로부터 계산된 1x1010 CFU/ml, 1x109 CFU/ml, 1x108 CFU/ml의 농도로 인산염 완충 식염수에 재현탁 시켰다. 다음으로, ALI 피부 오가노이드 위에 세균 현탁액 1 μl를 37℃, 5% CO2 조건에서 24 시간 동안 접종하였다. 이후 실시예 1-3의 형광 면역 조직 염색법에 따라, 황색포도상구균, 기저 상피층 마커 KRT5, 세포증식 마커 Ki67, 각질층 마커 필라그린 및 로리크린, 기저 상피층 마커 KRT14, 유극층 마커 KRT10, 및 피부 표피 줄기세포 마커인 KRT15 및 p63을 확인하였다. 아울러, 세포 사멸은 TUNEL 분석을 통해 확인하였다.Based on Example 4, ALI skin organoids cultured for 3 to 4 weeks were infected with Staphylococcus aureus (S. aureus) strain ATCC 29213. The suspension was centrifuged at 100 x g for 10 min and resuspended in phosphate buffered saline at concentrations of 1x10 10 CFU/ml, 1x10 9 CFU/ml, and 1x10 8 CFU/ml calculated from the absorbance of the suspension at 600 nm. Next, 1 μl of the bacterial suspension was inoculated on ALI skin organoids at 37° C., 5% CO 2 condition for 24 hours. Then, according to the fluorescent immunohistochemical staining method of Example 1-3, Staphylococcus aureus, basal epithelial marker KRT5, cell proliferation marker Ki67, stratum corneum marker filaggrin and loricrin, basal epithelial layer marker KRT14, stratum corneum marker KRT10, and skin epidermal stem Cell markers KRT15 and p63 were identified. In addition, cell death was confirmed through TUNEL analysis.

도 19에 나타난 바와 같이, 황색포도상구균이 접종된 ALI-피부 오가노이드의 표피와 진피 모두에서 황색포도상구균이 면역 염색 분석에 의해 검출 되는 것을 확인하였다. 황색포도상구균은 표피층에서 모낭을 따라 ALI-피부 오가노이드의 진피층까지 현저하게 감염되었고 황색포도상구균은 집락(colonization)을 일으키는 것을 확인하였다. As shown in FIG. 19 , it was confirmed that Staphylococcus aureus was detected by immunostaining analysis in both the epidermis and dermis of the ALI-skin organoid inoculated with Staphylococcus aureus. Staphylococcus aureus was remarkably infected from the epidermal layer along the hair follicle to the dermal layer of ALI-skin organoids, and it was confirmed that Staphylococcus aureus caused colonization.

또한, 도 20에 나타난 바와 같이, 황색포도상구균에 접종된 ALI-피부 오가노이드의 진피층에서 세포사멸 수준이 증가되는 것을 볼 수 있었으며, KRT5의 발현 수준이 현저히 감소되었는 바, 접종된 ALI-피부 오가노이드의 표피층과 진피층의 구조적 손상이 관찰되었다. In addition, as shown in FIG. 20 , it was seen that the level of apoptosis in the dermal layer of ALI-skin organoids inoculated with Staphylococcus aureus was increased, and the expression level of KRT5 was significantly reduced. Structural damage to the epidermal and dermal layers of the noid was observed.

또한, 도 21에 나타난 바와 같이, 황색포도상구균에 접종된 ALI-피부 오가노이드의 표피층의 필라그린 및 로리크린의 발현 수준이 현저히 감소되었는 바, 피부 장벽이 손상되었음이 관찰되었다.In addition, as shown in FIG. 21 , it was observed that the expression levels of filaggrin and loricrin in the epidermal layer of ALI-skin organoids inoculated with Staphylococcus aureus were significantly reduced, and damage to the skin barrier was observed.

또한, 도 22에 나타난 바와 같이, 황색포도상구균에 접종된 ALI-피부 오가노이드에서 아토피 피부염 각질형성세포의 TSLP 발현이 유의미하게 증가되면서, 기저상피층 마커인 KRT14는 유의미하게 감소되는 것을 확인하였는 바, 아토피 피부염의 증상이 잘 유발되고 있음을 확인하였다.In addition, as shown in FIG. 22, TSLP expression of atopic dermatitis keratinocytes in ALI-skin organoids inoculated with Staphylococcus aureus was significantly increased, while KRT14, a basal epithelial marker, was significantly reduced. It was confirmed that the symptoms of atopic dermatitis were well induced.

또한, 도 23에 나타난 바와 같이, 황색포도상구균에 접종된 ALI-피부 오가노이드에서 피부 표피 줄기세포 마커인 KRT15 및 p63의 발현 수준이 유의미하게 감소되는 것을 확인하였다.In addition, as shown in FIG. 23 , it was confirmed that the expression levels of KRT15 and p63, which are skin epidermal stem cell markers, were significantly reduced in ALI-skin organoids inoculated with Staphylococcus aureus.

또한, 도 24에 나타난 바와 같이, 황색포도상구균에 접종된 ALI-피부 오가노이드에서 피부 장벽 집합 단백질 마커인 클라우딘 4(CLDN4) 및 KRT5가 유의미하게 감소되는 것을 확인하였다.In addition, as shown in FIG. 24 , it was confirmed that claudin 4 (CLDN4) and KRT5, which are skin barrier aggregation protein markers, were significantly reduced in ALI-skin organoids inoculated with Staphylococcus aureus.

실시예 5-2. 황색포도상구균 감염에 의한 아토피 피부염 모델링: RNA-sequencing을 이용한 유전자 발현 변화 분석Example 5-2. Modeling of atopic dermatitis caused by Staphylococcus aureus infection: Analysis of gene expression changes using RNA-sequencing

실시예 5-1의 방법에 따라 1x106 CFU의 황색포도상구균이 처리된 ALI-피부 오가노이드(n=3)와 처리되지 않은 ALI 피부 오가노이드(대조군; n=3) 사이의 유전자 발현을 비교 평가하기 위하여 RNA-sequencing 분석 방법을 이용하였다. 먼저, 실시예 3의 유전자 추출 방법을 사용하여 유전자를 추출하였다. 유전자의 품질 확인, 역전사reverse transcription) 및 시퀀싱(sequencing)은 Macrogen Inc.(Seoul, Korea)에서 Illumina 시퀀싱 플랫폼 및 프로토콜을 사용하여 수행하였다. 차등적으로 발현된 유전자는 발현의 >2배 변화 및 조정된 P 값 < 0.05를 갖는 것으로 정의되었다. 이어서, Gene Ontology 및 KEGG 데이터베이스를 사용하여 기능 주석 및 유전자 세트 농축 분석을 수행하였다. 확인된 46,427개의 유전자에서, 100만개의 매핑된 리드 전사체의 킬로베이스당 최소 하나의 0개의 단편이 있는 26,458개가 제외되었으며 차등적으로 발현된 유전자(Differentially expressed genes; DEG) 분석을 위해 처리되어야 하는 19,969개의 유전자를 남겨두었다.Comparison of gene expression between ALI-skin organoids treated with 1x10 6 CFU of Staphylococcus aureus (n=3) and untreated ALI skin organoids (control group; n=3) according to the method of Example 5-1 For evaluation, RNA-sequencing analysis method was used. First, the gene was extracted using the gene extraction method of Example 3. Gene quality check, reverse transcription, and sequencing were performed by Macrogen Inc. (Seoul, Korea) using the Illumina sequencing platform and protocol. Differentially expressed genes were defined as having >2-fold change in expression and an adjusted P value <0.05. Then, functional annotation and gene set enrichment analyzes were performed using the Gene Ontology and KEGG databases. Of the 46,427 genes identified, 26,458 with at least one fragment per kilobase of 1 million mapped read transcripts were excluded and should be processed for differentially expressed genes (DEG) analysis. 19,969 genes were left behind.

도 25a 및 도 25b에 나타난 바와 같이, 황색포도상구균을 ALI-피부 오가노이드에 표면 접종 18 시간 후, 유전자 발현 변화를 RNA-sequencing 분석 방법으로 비교 분석하였다. 황색포도상구균이 처리된 ALI-피부 오가노이드와 처리되지 않은 대조군 사이의 생물학적 복제물 사이에서 많은 수의 유전자 발현의 뚜렷한 차이를 나타내었으며, 4,255개의 차등적으로 발현된 유전자(DEG) 중 2,162개의 유전자가 높게 발현되었고 2,093개의 유전자가 황색포도상구균 접종에 의해 낮게 발현되었다.As shown in FIGS. 25A and 25B , after 18 hours of surface inoculation of Staphylococcus aureus into ALI-skin organoids, gene expression changes were compared and analyzed by RNA-sequencing analysis method. Staphylococcus aureus-treated ALI-skin organoids showed distinct differences in expression of a large number of genes between biological replicates between treated and untreated controls, with 2,162 of the 4,255 differentially expressed genes (DEGs) It was highly expressed and 2,093 genes were low expressed by Staphylococcus aureus inoculation.

도 25c에 나타난 바와 같이, 황색포도상구균이 처리된 ALI-피부 오가노이드에서는 대조군에 비해 FLG(필라그린), LCE(후기 각질화피막), Loricrin(로리크린)과 같은 피부 장벽 기능에 관련 유전자 발현이 현저히 감소하는 것을 발견하였다.As shown in Fig. 25c, in the Staphylococcus aureus-treated ALI-skin organoids, the expression of genes related to skin barrier function such as FLG (filaggrin), LCE (late keratinized film), and Loricrin (loricrin) was higher than that of the control group. was found to decrease significantly.

또한, 도 25d에 나타난 바와 같이, RNA-sequencing 분석 결과 황색포도상구균이 처리된 ALI-피부 오가노이드에서 대조군에 비해 KRT, KRTAP 등 각질형성세포 분화(keratinocyte differentiation) 관련된 유전자의 발현이 현저히 낮은 것을 확인하였다.In addition, as shown in FIG. 25D , as a result of RNA-sequencing analysis, it was confirmed that the expression of genes related to keratinocyte differentiation, such as KRT and KRTAP, was significantly lower in the Staphylococcus aureus-treated ALI-skin organoid compared to the control group. did

또한, 본 발명자들은 박테리아 인식, 항균 펩타이드(AMP) 생산 및 염증 신호를 포함한 박테리아 감염에 대한 숙주 세포 반응을 밝혀냈다. 도 25e에 나타난 바와 같이, RNA-sequencing 분석 결과에서는 황색포도상구균이 처리된 ALI-피부 오가노이드가 대조군에 비해 Defb(디펜신 베타), Pglyrp2(펩티도글리칸 인식 단백질 2), TLR1 및 TLR2(톨 유사 수용체 1 및 2), Lgals9(갈렉틴 9), Lcn2(리포칼린 2) 및 S100A(S100 칼슘 결합 단백질)와 같은 주요 항균펩타이드(Antimicrobial peptides; AMP) 관련된 유전자 발현이 증가하는 것을 확인하였다. In addition, we have elucidated host cell responses to bacterial infection, including bacterial recognition, antimicrobial peptide (AMP) production and inflammatory signaling. As shown in FIG. 25E , in the RNA-sequencing analysis results, Staphylococcus aureus-treated ALI-skin organoids compared to the control group, Defb (defensin beta), Pglyrp2 (peptidoglycan recognition protein 2), TLR1 and TLR2 ( Toll-like receptors 1 and 2), Lgals9 (galectin 9), Lcn2 (lipocalin 2) and S100A (S100 calcium binding protein), such as major antimicrobial peptides (antimicrobial peptides; AMP) related gene expression was confirmed to increase.

또한 도 25f에 나타난 바와 같이, CXCL(CXC 모티프 케모카인 리간드), CCL(CC 모티프 케모카인 리간드), TSLP, IL-1(interleukin-1), TNF(tumor necrosis factor) 등 염증성 사이토카인(inflammatory cytokines) 관련된 유전자의 발현이 현저히 증가하는 것을 확인하였다.Also, as shown in Figure 25f, CXCL (CXC motif chemokine ligand), CCL (CC motif chemokine ligand), TSLP, IL-1 (interleukin-1), TNF (tumor necrosis factor), such as inflammatory cytokines (inflammatory cytokines) related It was confirmed that the expression of the gene was significantly increased.

실시예 6. 황색포도상구균에 감염된 ALI 피부 오가노이드에 대한 큐티박테리움 아크네스(Example 6. Cutibacterium acnes against ALI skin organoids infected with Staphylococcus aureus ( Cutibacterium acnesCutibacterium acnes )의 치료 효과 확인) to confirm the therapeutic effect of

실시예 5에 나타난 결과에서는 황색포도상구균을 감염시킨 ALI 피부 오가노이드가 아토피 피부염의 특징을 잘 모사하고 있음을 확인하였다. 이에, 실시예 6에서는 건강한 인간 피부에서 발견되는 공생 미생물군을 공동 배양하는 것이 아토피 피부염 표현형을 예방하거나 감소시킬 수 있는지 여부를 조사하하였다. 큐티박테리움 아크네스(Cutibacterium acnes)는 건강한 인간 피부에서 발견되는 가장 흔한 공생 미생물 중 하나이다. 이에, 큐티박테리움 아크네스를 사용한 마이크로바이옴 치료제가 아토피 피부염 예방 및 피부 장벽 기능에 대한 치료 효과에 대해 조사하였다.From the results shown in Example 5, it was confirmed that the ALI skin organoids infected with Staphylococcus aureus well mimic the characteristics of atopic dermatitis. Therefore, in Example 6, it was investigated whether co-culturing of symbiotic microorganisms found in healthy human skin could prevent or reduce the atopic dermatitis phenotype. Cutibacterium acnes is one of the most common symbiotic microorganisms found in healthy human skin. Accordingly, the microbiome treatment using Cutibacterium acnes was investigated for the prevention of atopic dermatitis and the therapeutic effect on the skin barrier function.

실시예 4에 기초하여 3주에서 4주간 배양된 ALI 피부 오가노이드를 4일동안 건조 조건에서 배양 한 다음 실시예 5에 기초하여 큐티박테리움 아크네스를 1x109 CFU/ml의 농도로 인산염 완충 식염수에 현탁시켰다. 다음으로, ALI 피부 오가노이드 위에 세균 현탁액 1 μl를 37℃, 5% CO2 조건에서 48 시간 동안 접종하였다. 48 시간 동안 큐티박테리움 아크네스를 전-처리(pretreatment) 한 후 실시예 5에 기초하여 황색포도상구균을 1x109 CFU/ml의 농도로 인산염 완충 식염수에 현탁시켰다. 큐티박테리움 아크네스가 전-처리된 ALI 피부 오가노이드 위에 황색포도상구균 현탁액 1 μl를 37℃, 5% CO2 조건에서 18시간 동안 접종하여 건조 조건에서 배양하였다. 미처리군(0, 대조군), 황색포도상구균(SA) 1x106 단독, 큐티박테리움 아크네스(CA) 1x106 CFU + SA 1x106 CFU, 또는 CA 1x107 CFU + SA 1x106 CFU로 오가노이드에 접종하였다. ALI 피부 오가노이드 배양법 및 큐티박테리움 아크네스의 접종 방법은 도 26a에 도시하였다.Based on Example 4, ALI skin organoids cultured for 3 to 4 weeks were cultured in dry conditions for 4 days, and then, based on Example 5, Cutibacterium acnes was added to phosphate buffered saline at a concentration of 1x10 9 CFU/ml. was suspended in Next, 1 μl of the bacterial suspension was inoculated on ALI skin organoids at 37° C., 5% CO 2 condition for 48 hours. After pretreatment with Cutibacterium acnes for 48 hours, Staphylococcus aureus based on Example 5 was suspended in phosphate buffered saline at a concentration of 1× 10 9 CFU/ml. 1 μl of Staphylococcus aureus suspension on ALI skin organoids pre-treated with Cutibacterium acnes was inoculated at 37° C., 5% CO 2 conditions for 18 hours and cultured in dry conditions. Untreated group (0, control), Staphylococcus aureus (SA) 1x10 6 alone, Cutibacterium acnes (CA) 1x10 6 CFU + SA 1x10 6 CFU, or CA 1x10 7 CFU + SA 1x10 6 CFU to inoculate organoids did The ALI skin organoid culture method and the inoculation method of Cutibacterium acnes are shown in FIG. 26A.

접종 후, 큐티박테리움 아크네스가 황색포도상구균에 감염된 ALI 피부 오가노이드의 피부 장벽을 보호하는 효과가 있는지 확인하기 위해 피부장벽 기능을 하는 중요 단백질인 필라그린(Filaggrin)에 대한 면역 염색을 수행하였다. 실시예 1-3의 형광 면역 조직 염색법에 따라, 상피층 마커 KRT5(CK5)와 피부장벽 중요 단백질인 필라그린(Filaggrin)을 분석 및 확인하였다.After inoculation, immunostaining for Filaggrin, an important protein that functions as a skin barrier, was performed to confirm whether Cutibacterium acnes was effective in protecting the skin barrier of ALI skin organoids infected with Staphylococcus aureus. . According to the fluorescent immunohistostaining method of Example 1-3, the epithelial layer marker KRT5 (CK5) and the skin barrier important protein Filaggrin were analyzed and confirmed.

도 26b에 나타난 바와 같이, 1x106 황색포도상구균으로만 처리된 ALI 피부 오가노이드에서는 필라그린 발현이 현저히 감소되었다. 반면에, 1x106 CFU 큐티박테리움 아크네스로 전-처리된 ALI 피부 오가노이드는 황색포도상구균으로만 처리한 것보다 필라그린 발현 수준이 유의하게 증가되었다. 이러한 결과는 큐티박테리움 아크네스가 황색포도상구균 감염으로 인한 피부 장벽 파괴를 구제하고 황색포도상구균 집락화에 대한 보호 메커니즘을 제공함을 나타낸다. 따라서, 건강한 인간 피부에서 발견되는 공생 미생물군 중 하나인 큐티박테리움 아크네스가 황색포도상구균 매개 피부 장벽 파괴 및 세포 손상에 대해 유의한 예방 및 치료 효과를 보여 줌으로써 아토피 피부염 치료제 용도로 쓰여질 것으로 기대된다.As shown in FIG. 26B , filaggrin expression was significantly reduced in ALI skin organoids treated only with 1x10 6 Staphylococcus aureus. On the other hand, ALI skin organoids pre-treated with 1x10 6 CFU Cutibacterium acnes significantly increased filaggrin expression levels than those treated with Staphylococcus aureus alone. These results indicate that Cutibacterium acnes rescues the skin barrier destruction caused by Staphylococcus aureus infection and provides a protective mechanism against Staphylococcus aureus colonization. Therefore, it is expected that Cutibacterium acnes, one of the symbiotic microorganisms found in healthy human skin, will be used for the treatment of atopic dermatitis by showing significant preventive and therapeutic effects on Staphylococcus aureus-mediated skin barrier destruction and cell damage. .

종합하면, 본 발명의 Wnt 신호 전달 경로 활성화를 통해 생성된 피부 오가노이드는 기존의 방법에 의해 생성된 피부오가노이드에 비해 오가노이드 크기가 현저히 증가되었고 피부 오가노이드에서 불필요한 구성요소인 연골 형성을 억제하였다. 또한 본 발명의 ALI-피부 오가노이드는 기존의 배양법에 제조된 피부 오가노이드에 비해 피부세포, 부속물, 신경세포, 지방세포 등이 실제 피부와 유사한 구조로 형성되고, 모낭 성장이 크게 향상된 것을 관찰하였다. 또한, 본 발명의 아토피 피부염 오가노이드 모델은 손상된 피부 장벽, 상피세포 유래 사이토카인 증가 및 표피 줄기세포 발현 저하, 황색포도상구균 집락을 일으키는 등 아토피 피부염의 특징을 잘 모사하였는 바, 아토피 피부염 치료제의 스크리닝 모델로 유용하게 사용할 수 있을 것으로 기대된다.In summary, the skin organoids generated through the activation of the Wnt signaling pathway of the present invention significantly increased the organoid size compared to the skin organoids generated by the conventional method, and inhibited cartilage formation, which is an unnecessary component in the skin organoids. did In addition, it was observed that the ALI-skin organoid of the present invention has a structure similar to that of the actual skin, and the growth of hair follicles is greatly improved compared to the skin organoid prepared by the conventional culture method. . In addition, the atopic dermatitis organoid model of the present invention well simulated the characteristics of atopic dermatitis, such as damaged skin barrier, increased epithelial cell-derived cytokines, decreased epidermal stem cell expression, and Staphylococcus aureus colonization. It is expected to be useful as a model.

또한 본 발명의 아토피 피부염 모델을 이용하여 인간 공생 박테리아인 큐티박테리움 아크네스(Cutibacterium acnes)가 황색포도상구균 감염으로 인한 피부 장벽 파괴를 구제하고 황색포도상구균 집락화에 대한 보호 메커니즘을 제공함으로써 마이크로바이옴 치료제로서 유용하게 사용될 수 있음을 확인하였다. 상기 결과로부터 큐티박테리움 아크네스를 아토피 피부염 치료 용도로 사용할 수 있을 것으로 기대된다.In addition, using the atopic dermatitis model of the present invention, the human symbiotic bacterium, Cutibacterium acnes , rescues the skin barrier destruction due to Staphylococcus aureus infection and provides a protective mechanism against Staphylococcus aureus colonization by providing a protective mechanism to the microbiome It was confirmed that it can be usefully used as a therapeutic agent. From the above results, it is expected that Cutibacterium acnes can be used for the treatment of atopic dermatitis.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다. The description of the present invention described above is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> Kangstem Biotech CO., LTD. <120> Modeling atopic dermatitis with human pluripotent stem cell-derived skin organoids <130> MP20-217P1 <150> KR 10-2020-0136977 <151> 2020-10-21 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COL2A_F <400> 1 catgagggcg cggtagagac 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COL2A_R <400> 2 tccctttggt cctggttgcc 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ACAN_F <400> 3 cttctccgga atggaaacgt g 21 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ACAN_R <400> 4 acatacctcc tggtctatgt tacag 25 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SOX9_F <400> 5 gaagctcgcg gaccagtacc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SOX9_R <400> 6 ctgcccgttc ttcaccgact 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 7 gtcagtggtg gacctgacct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 8 tgctgtagcc aaattcgttg 20 <110> Kangstem Biotech CO., LTD. <120> Modeling atopic dermatitis with human pluripotent stem cell-derived skin organoids <130> MP20-217P1 <150> KR 10-2020-0136977 <151> 2020-10-21 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COL2A_F <400> 1 catgagggcg cggtagagac 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COL2A_R <400> 2 tccctttggt cctggttgcc 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ACAN_F <400> 3 cttctccgga atggaaacgt g 21 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ACAN_R <400> 4 acatacctcc tggtctatgt tacag 25 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SOX9_F <400> 5 gaagctcgcg gaccagtacc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SOX9_R <400> 6 ctgcccgttc ttcaccgact 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 7 gtcagtggtg gacctgacct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 8 tgctgtagcc aaattcgttg 20

Claims (28)

하기의 단계를 포함하는 인간 만능성 줄기세포(pluripotent stem cell)로부터 피부 오가노이드(organoid)를 제조하는 방법:
(a) 만능성 줄기세포 유래 오가노이드를 Wnt 작용제의 존재 하에 배양하는 단계;
(b) 상기 단계 (a)의 배양물을 피부 오가노이드 성숙용 배지에서 40일 이상 배양하는 단계; 및
(c) 상기 단계 (b)의 배양물을 절단하여 공기-액체 계면에서 배양하는 단계.
A method for preparing a skin organoid from human pluripotent stem cells comprising the steps of:
(a) culturing pluripotent stem cell-derived organoids in the presence of a Wnt agonist;
(b) culturing the culture of step (a) in a medium for skin organoid maturation for at least 40 days; and
(c) cutting the culture of step (b) and culturing at an air-liquid interface.
 제1항에 있어서,
상기 Wnt 작용제는 CHIR-99021인 것을 특징으로 하는, 방법.
According to claim 1,
The method of claim 1, wherein the Wnt agonist is CHIR-99021.
 제1항에 있어서,
상기 Wnt 작용제는 만능성 줄기세포의 배양 5 내지 7일차에 첨가되는 것을 특징으로 하는, 방법
According to claim 1,
The Wnt agonist, characterized in that added to the 5th to 7th day of culture of pluripotent stem cells, method
 제1항에 있어서,
상기 피부 오가노이드 성숙용 배지는 글루타맥스, 2-메르캅토에탄올, B-27, N2, 및 노르모신으로 이루어진 군으로부터 선택된 하나 이상의 성분을 포함하는 것을 특징으로 하는, 방법.
According to claim 1,
The medium for skin organoid maturation, characterized in that it comprises one or more components selected from the group consisting of glutamax, 2-mercaptoethanol, B-27, N2, and normosin.
 제1항에 있어서,
상기 (a) 단계의 수행 전에, 하기 단계를 포함하는 것을 특징으로 하는, 방법:
(1) 만능성 줄기세포의 배아체를 배양하는 단계;
(2) 상기 배아체를 비신경 외배엽으로 분화 유도하는 단계; 및
(3) 상기 비신경 외배엽을 두개골 신경능선 유사 세포로 분화 유도하는 단계.
According to claim 1,
Prior to performing step (a), a method comprising the steps of:
(1) culturing the embryonic body of pluripotent stem cells;
(2) inducing differentiation of the embryoid body into non-neural ectoderm; and
(3) inducing differentiation of the non-neural ectoderm into cranial neural crest-like cells.
 제5항에 있어서,
상기 단계 (1)은 Y-27632의 존재 하에 수행되는 것을 특징으로 하는, 방법
6. The method of claim 5,
The method, characterized in that step (1) is carried out in the presence of Y-27632
 제5항에 있어서,
상기 단계 (2)는 SB431542, FGF2, 및 BMP4의 존재 하에 수행되는 것을 특징으로 하는, 방법.
6. The method of claim 5,
The method, characterized in that step (2) is performed in the presence of SB431542, FGF2, and BMP4.
 제5항에 있어서,
상기 단계 (3)은 FGF2 및 LDN193189의 존재 하에 수행되는 것을 특징으로 하는, 방법.
6. The method of claim 5,
The method, characterized in that the step (3) is carried out in the presence of FGF2 and LDN193189.
 제1항에 있어서,
상기 단계 (a)의 배양은 5일 내지 14일 동안 실시되는 것을 특징으로 하는, 방법.
According to claim 1,
The culturing of step (a) is characterized in that it is carried out for 5 to 14 days, the method.
 제1항에 있어서,
상기 단계 (b)의 배양은 40일 내지 100일 동안 실시되는 것을 특징으로 하는, 방법.
According to claim 1,
The culturing of step (b) is characterized in that it is carried out for 40 to 100 days, the method.
 제1항에 있어서,
상기 단계 (c)의 배양은 3주 내지 4주 동안 실시되는 것을 특징으로 하는, 방법.
According to claim 1,
The culturing of step (c) is characterized in that it is carried out for 3 to 4 weeks, the method.
 제1항에 있어서,
상기 방법은 (d) 상기 단계 (c)의 배양물을 1 내지 10일간 건조 조건에서 배양하는 단계를 추가로 포함하는 것을 특징으로 하는, 방법.
The method of claim 1,
The method (d) characterized in that it further comprises the step of culturing the culture of step (c) in dry conditions for 1 to 10 days.
 제12항에 있어서,
상기 단계 (d)는 피부 오가노이드의 각질층 성숙을 위한 것을 특징으로 하는, 방법.
13. The method of claim 12,
The method, characterized in that step (d) is for stratum corneum maturation of skin organoids.
 제1항에 있어서,
상기 단계 (c)는 단계 (b)의 배양물을 4 개의 균일한 크기로 절단하고,
콜라겐 코팅된 트랜스 웰 배양 삽입물 상에 진피층은 콜라겐 쪽으로, 표피층은 공기에 노출되도록 배양하는 것을 특징으로 하는, 방법.

According to claim 1,
The step (c) cuts the culture of step (b) into four uniform sizes,
A method, characterized in that the dermal layer is cultured on the collagen-coated transwell culture insert so that the dermal layer is exposed to the collagen side and the epidermal layer is exposed to air.

 제1항에 있어서,
상기 단계 (c)의 공기-액체 계면 배양은 피부 오가노이드 성숙용 배지에서 실시되는 것을 특징으로 하는, 방법.
According to claim 1,
The air-liquid interface culture of step (c) is characterized in that it is carried out in a medium for skin organoid maturation, the method.
 제1항에 있어서,
상기 피부 오가노이드는 연골 형성이 억제된 것을 특징으로 하는, 방법.
According to claim 1,
The skin organoid is characterized in that cartilage formation is suppressed, the method.
 제1항에 있어서,
상기 피부 오가노이드는 직경 2 내지 20mm를 갖는 것을 특징으로 하는, 방법.
According to claim 1,
The method, characterized in that the skin organoids have a diameter of 2 to 20 mm.
 제1항에 있어서,
상기 피부 오가노이드는 표피층 밑에 진피층 및 피하지방층이 위치하는 것을 특징으로 하는, 방법.
According to claim 1,
The skin organoid is characterized in that the dermal layer and the subcutaneous fat layer are located under the epidermis layer.
 제1항에 있어서,
상기 피부 오가노이드는 KRT5(Keratin 5), KRT10, KRT15, KRT17, 로리크린(Loricrin), 필라그린(Filaggrin), SOX2(SRY-Box Transcription Factor 2), 및 멜란-A로 이루어진 군으로부터 선택된 하나 이상을 발현하는 것을 특징으로 하는, 방법.
According to claim 1,
The skin organoid is at least one selected from the group consisting of KRT5 (Keratin 5), KRT10, KRT15, KRT17, Loricrin, Filaggrin, SOX2 (SRY-Box Transcription Factor 2), and melan-A Characterized in expressing the, method.
 제1항에 있어서,
상기 만능성 줄기세포는 배아줄기세포, 또는 유도만능줄기세포인 것을 특징으로 하는, 방법.
According to claim 1,
The pluripotent stem cells are characterized in that the embryonic stem cells, or induced pluripotent stem cells, the method.
 제1항의 방법으로 제조된 피부 오가노이드에 황색포도상구균을 처리하는 단계를 포함하는, 피부 오가노이드의 제작 방법으로서, 상기 피부 오가노이드는 아토피 피부염의 피부 모사 모델인 것을 특징으로 하는, 방법.
A method for producing a skin organoid comprising the step of treating Staphylococcus aureus to the skin organoid prepared by the method of claim 1, wherein the skin organoid is a skin-mimicking model of atopic dermatitis, the method.
 제21항의 방법으로 제작된 피부 오가노이드로서,
상기 피부 오가노이드는 아토피 피부염의 피부 모사 모델인 것을 특징으로 하는, 피부 오가노이드.
As a skin organoid produced by the method of claim 21,
The skin organoid is characterized in that the skin model of atopic dermatitis, skin organoid.
 제22항에 있어서,
상기 피부 오가노이드는 하기 특징으로 이루어진 군으로부터 선택된 하나 이상의 특징을 갖는 것을 특징으로 하는, 피부 오가노이드:
피부 진피층의 세포 사멸 증가;
피부 표피 장벽 관련 마커인 KRT5, KRT10, 필라그린(Filaggrin), 로리크린(Loricrin), 및 클라우딘4(Claudin4)로 이루어진 군으로부터 선택된 하나 이상의 발현 저하;
각질형성세포 분화(Keratinocyte differentiation) 유전자인 KRT 또는 KRTAP의 발현 감소;
항균 펩타이드(antimicrobial peptides) 유전자인 β-디펜신, PGLYRP2(펩티도글리칸 인식 단백질 2), TLR1(Toll Like Receptor 1), TLR2, LGALS9(갈렉틴 9), LCN2(Lipocalin 2) 및 S100A(S100 칼슘 결합 단백질)로 이루어진 군으로부터 선택된 하나 이상의 발현 증가;
표피 또는 진피세포 유래 염증성 사이토카인(inflammatory cytokines) 유전자인 Cxcl(CXC 모티프 케모카인 리간드), Ccl(CC 모티프 케모카인 리간드), TSLP(Thymic stromal lymphopoietin), IL-1(interleukin-1), TNF(tumor necrosis factor)로 이루어진 군으로부터 선택된 하나 이상의 발현 증가;
표피 줄기세포 마커 KRT15의 발현 저하; 및
황색포도상구균의 집락(colonization) 형성.
23. The method of claim 22,
The skin organoid is characterized in that it has one or more characteristics selected from the group consisting of:
increased cell death of the dermal layer of the skin;
decreased expression of one or more selected from the group consisting of skin epidermal barrier-related markers KRT5, KRT10, Filaggrin, Loricrin, and Claudin4;
decreased expression of KRT or KRTAP, which is a keratinocyte differentiation gene;
Antimicrobial peptides genes β-defensin, PGLYRP2 (peptidoglycan recognition protein 2), TLR1 (Toll Like Receptor 1), TLR2, LGALS9 (galectin 9), LCN2 (Lipocalin 2) and S100A (S100) increased expression of one or more selected from the group consisting of calcium binding proteins);
Epidermal or dermal cell-derived inflammatory cytokines genes Cxcl (CXC motif chemokine ligand), Ccl (CC motif chemokine ligand), TSLP (Thymic stromal lymphopoietin), IL-1 (interleukin-1), TNF (tumor necrosis) factor) increased expression of one or more selected from the group consisting of;
decreased expression of the epidermal stem cell marker KRT15; and
Colonization of Staphylococcus aureus.
 제22항의 피부 오가노이드에 아토피 피부염 치료제 후보물질을 처리하는 단계를 포함하는, 아토피 피부염 치료제의 스크리닝 방법.
A screening method for a therapeutic agent for atopic dermatitis, comprising the step of treating a candidate substance for a therapeutic agent for atopic dermatitis to the skin organoid of claim 22.
 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 아토피 피부염의 예방 또는 치료용 약학적 조성물.
A pharmaceutical composition for preventing or treating atopic dermatitis comprising Cutibacterium acnes or a culture solution thereof as an active ingredient.
 제25항에 있어서,
상기 조성물은 필라그린(Filaggrin)의 발현을 증가시키는 것을 특징으로 하는, 약학적 조성물.
26. The method of claim 25,
The composition is characterized in that increasing the expression of filaggrin (Filaggrin), a pharmaceutical composition.
 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 아토피 피부염의 예방 또는 개선용 식품 조성물.
A food composition for preventing or improving atopic dermatitis comprising Cutibacterium acnes or a culture solution thereof as an active ingredient.
 큐티박테리움 아크네스 또는 이의 배양액을 유효성분으로 포함하는 아토피 피부염의 예방 또는 개선용 화장료 조성물.
A cosmetic composition for preventing or improving atopic dermatitis comprising Cutibacterium acnes or a culture solution thereof as an active ingredient.
KR1020210140422A 2020-10-21 2021-10-20 Modeling atopic dermatitis with human pluripotent stem cell-derived skin organoids KR20220052847A (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US18/249,560 US20230392127A1 (en) 2020-10-21 2021-10-21 Method for construction of atopic dermatitis model by using pluripotent stem cell-derived skin organoid
AU2021365476A AU2021365476A1 (en) 2020-10-21 2021-10-21 Method for construction of atopic dermatitis model by using pluripotent stem cell-derived skin organoid
CN202180071683.8A CN116724108A (en) 2020-10-21 2021-10-21 Method for constructing atopic dermatitis model using multipotent stem cell-derived skin organoids
JP2023524294A JP2023547088A (en) 2020-10-21 2021-10-21 Method for creating an atopic dermatitis model using skin organoids derived from pluripotent stem cells
EP21883286.3A EP4234683A1 (en) 2020-10-21 2021-10-21 Method for construction of atopic dermatitis model by using pluripotent stem cell-derived skin organoid
PCT/KR2021/014810 WO2022086218A1 (en) 2020-10-21 2021-10-21 Method for construction of atopic dermatitis model by using pluripotent stem cell-derived skin organoid

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200136977 2020-10-21
KR1020200136977 2020-10-21

Publications (1)

Publication Number Publication Date
KR20220052847A true KR20220052847A (en) 2022-04-28

Family

ID=81448083

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020210140422A KR20220052847A (en) 2020-10-21 2021-10-20 Modeling atopic dermatitis with human pluripotent stem cell-derived skin organoids

Country Status (1)

Country Link
KR (1) KR20220052847A (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
3차원 피부모델의 최신 연구개발 동향, 장성재, BRIC View 2019-T21

Similar Documents

Publication Publication Date Title
KR101975031B1 (en) Novel Bifidobacterium longum ATG-F5, and cosmetics composition comprising thereof
KR102157970B1 (en) Cosmetic composition containing lactic acid bacteria fermented extract of germinated sprout for skin barrier reinforcement
KR102222877B1 (en) Functional composition comprising exosome-rich conditioned medium of immortalized stem cells and rosebud extracts
KR101912258B1 (en) Composition for protecting cells and tissues against toxicity induced by particulate matter comprising lactobacillus casei
US20230000920A1 (en) Novel use of milk exosomes
KR102136346B1 (en) Composition for prevention and treatment of atopic dermatitis comprising bifidobacterium animalis subsp. lactis lm1017 derived from korean infants
KR101911078B1 (en) Composition for improving acneform skin conditions Comprising Complex Extracts of Swallow&#39;s Nest as Active Ingredient
KR20160105586A (en) COSMETIC COMPOSITIONS CONTAINING the plants extract of Cyperaceae AND PREPARING METHOD OF THE SAME
KR101229045B1 (en) Extracting method of nelumbo nucifera flower, leaf, stem, root, seed and cosmetic composition for anti-wrinkle containing extracts thereby
JP2012036128A (en) Collagen production promoter and skin-beautifying composition comprising the same
KR20220052847A (en) Modeling atopic dermatitis with human pluripotent stem cell-derived skin organoids
KR20060122603A (en) Cosmetic composition comprising the extract of cinnamomum camphora sieb. having inhibition activity of melanin synthesis
US20230392127A1 (en) Method for construction of atopic dermatitis model by using pluripotent stem cell-derived skin organoid
KR20220064341A (en) A composition for preventing, treating, or improving skin inflammatory diseases comprising a 2B4 agonist as an active ingredient
KR20220107964A (en) A Composition for promoting hair growth comprising extracellular vesicles derived from Lactobacillus curvatus as active ingredients
KR20160105584A (en) COSMETIC COMPOSITIONS CONTAINING Rhododendron micranthum EXTRACT AND PREPARING METHOD OF THE SAME
KR20150050631A (en) Cosmetic Composition and Topical Composition for Anti-inflammation Containing Coprisin Peptide Derivative CopA
KR102021557B1 (en) Novel lactic acid bacteria and composition and healthfunctional food comprising the same
CN116724108A (en) Method for constructing atopic dermatitis model using multipotent stem cell-derived skin organoids
KR101315638B1 (en) A cosmetic composition comprising rice stem cell extract for an anti-aging activity
CN111743921A (en) Application of lactobacillus paracasei or metabolite thereof in preparation of composition for promoting fatty acid metabolism
KR102629699B1 (en) Composition for promoting melanin synthesis comprising pinostrobin
KR102408170B1 (en) Composition for anti-aging or skin regeneration containing isoprocurcumenol
KR102370418B1 (en) A functional cosmetic composition that prevents and improves atopic dermatitis containing a compound separated from the gojiberry extract as an active ingredient
WO2023234698A1 (en) Skin improvement composition containing mugwort-derived exosome as active ingredient

Legal Events

Date Code Title Description
E902 Notification of reason for refusal