KR20220052299A - A method for determining the specificity of a TCR-antigen using a single cell analysis - Google Patents

Abstract

The present invention relates to a method for detecting TCR-antigen specificity using a single cell analysis, wherein the specificity is identified by simultaneous sequencing of TCR-antigens through single-cell genome analysis of antigen-presenting cell-T cell complexes formed through co-culture of antigen-presenting cells which present antigens on a surface and T-cells which express TCR on a surface thereof. The method of the present invention is cost-effective compared to conventional TCR-antigen specificity detection technology and makes it possible to identify TCR-antigen pairs with high throughput.

Description

A method for determining the specificity of a TCR-antigen using a single cell analysis

The present invention relates to methods for determining the specificity of TCRs and antigens.

Immunity can be broadly divided into innate immunity and acquired immunity. Unlike innate immunity, which operates by recognizing all foreign substances, acquired immunity recognizes a specific pathogen and specifically triggers a strong immune action to quickly cure disease and provide long-term protection. T cells are at the center of this acquired immunity. T cells have a T-cell receptor (TCR) on the cell surface. Using this, they recognize antigens, which are substances produced by pathogens, detect the presence of pathogens, and destroy infected cells or remove pathogens from the body. to protect

Antigens are presented in the form of peptides, peptide-MHC (pMHC), bound on Major Histocompatibility Complex (MHC) on the cell surface of pathogen-infected cells. That is, the T cell recognizes the pMHC of the infected cell through the TCR, recognizes a specific antigen, and initiates an immune response. Therefore, the specific correlation between TCR and antigen is very important in adaptive immunity.

Recently, T-cell immunotherapy, a treatment for removing infected cells and pathogens by administering disease-specific T cells, has emerged. This is a method that utilizes the core of acquired immunity, which is a strong immunity, and it is expected to be effective even for patients who are not effective even with drugs or various treatments. Therefore, if there is information on TCR and antigen, T cell therapy can be used more diversely.

Various studies are underway to identify the specificity, ie, correlation, of TCR and antigen. Specifically, in the proposed method, cells and antigen (peptide) are put together, and antigen (peptide) is placed on the MHC on the cell surface to make antigen-presenting cells, and the antigen-presenting cells and T cells are co-cultured to determine whether T cells are activated or not. A method for determining whether the antigen is specific to T cells is known ( Nat Med. 2019 25,1488-1499). However, the proposed method has disadvantages in that it takes a lot of time and money in that it is necessary to prepare an antigen and a cell that presents an MHC suitable for the antigen on the surface, respectively, and only one antigen-presenting cell and a T cell react at a time. There is a disadvantage that it is quite inefficient in that it can be checked.

As another method, a method of confirming specificity with TCR through fluorescence by presenting an antigen in the form of pMHC in which an antigen is bound to fluorescent MHC without using antigen-presenting cells and contacting it with T-cells has been proposed. ( The Journal of Immunology, 2018, 200.7: 2263-2279). This method also needs to synthesize pMHC by synthesizing antigen and MHC separately, there is a limitation in the types of fluorescent materials that can be used, and there is a risk of protein damage when many MHCs are used, so the number of antigens that can be reacted is limited. there is.

Therefore, there is a need to develop a new method that is cost-effective and can confirm the specificity of antigen-TCR with high throughput.

The Journal of Immunology, 2018, 200.7: 2263-2279 Nat Med. 2019 25,1488-1499

It is an object of the present invention to provide a method for specific identification of antigen-TCR that is cost-effective and with high throughput.

The present inventors co-culture antigen-presenting cells (APC) and T cells to generate specific T cell-APC complexes with TCR-pMHC affinity, and separately sort the T cell-antigen-presenting cell complexes using flow cytometry. And, by analyzing the sorted complex with single cells, by simultaneously confirming the antigen and TCR sequence specifically bound in the complex, it is cost-effective and high-throughput antigen-TCR specificity confirmation is possible when using this method did

Accordingly, the present invention

(1) transducing any antigen-encoding gene to prepare an antigen-presenting cell that presents the antigen on the surface;

(2) preparing T-cells;

(3) co-culturing the prepared APC and T-cells;

(4) separating the cell complex formed by the binding between the antigen presented on the surface of the APC and the T-cell TCR after culture; and

(5) performing single-cell sequencing of the complex to provide an antigen-TCR specificity detection method comprising the step of identifying an antigen expressed by APC and a TCR sequence expressed by T-cells from the complex .

Also, the present invention

(1) preparing a plurality of antigen-presenting cells that present the antigen on the surface by transduction with a gene encoding any antigen;

(2) preparing a plurality of T-cells;

(3) co-culturing the prepared APC and T-cells;

(4) separating the cell complexes formed by the binding between the antigen presented on the surface of the APC and the T-cell TCR after culture; and

(5) multiple antigen-TCR specificity detection method comprising the step of simultaneously performing single-cell sequencing of the complexes to identify the antigen expressed by APC and the TCR sequence expressed by T-cells from the complex provides

The antigen presenting cell (APC) of the present invention refers to a cell that processes a protein antigen in the cell to generate a peptide antigen, binds them to a major histocompatibility antigen protein, and presents it on the cell surface. Most cells can function as antigen-presenting cells in any form, but preferably, the antigen-presenting cells are cells that function to present antigens to T cells, such as macrophages, B cells, and dendritic cells (dendritic cells, DC) may be included.

In a specific embodiment of the present invention, dendritic cells were used as antigen-presenting cells. Dendritic cells are the most important specialized antigen-presenting cells of the immune system that can induce both innate and adaptive immune responses, and can activate the memory immune response. For this reason, it is considered “Nature's adjuvant”. In particular, unlike other antigen deficient cells, dendritic cells have a special ability to cross-present exogenous antigens through MHC class II as well as MHC class I, so they can effectively simultaneously activate CD4+ and CD8+ T cells. There are advantages to

The antigen-presenting cell produced in the present invention is characterized in that only the transduced antigen is presented on the surface of one antigen-presenting cell by transduction with a gene encoding any one antigen, and antigen-related inheritance Since the information is present in the cell, it is possible to identify the antigen presented on the cell surface through single cell analysis.

In addition, since antigen-related genes introduced into cells are automatically transcribed and translated within the cells, processed into peptides, bound to specific MHC and presented on the cell surface, there is no need to separately synthesize MHC and antigen (peptide). , since antigen-presenting cells can be simply produced using a known and known transduction method, a simple and low-cost antigen-presenting cell population can be prepared.

The antigen-presenting cell of the present invention can be prepared by 1) a method using a bacterial or viral vector, 2) a method in which DNA is bound to a liposome and transduced to protect DNA from enzymatic degradation or to be absorbed into an endosome 3) A method to increase the efficiency of DNA delivery into cells by binding a molecular conjugate composed of protein or a synthetic ligand to DNA [eg, Asialoglycoprotein, transferrin, polymeric IgA] , or 4) a novel DNA delivery system using a protein transduction domain (PTD), which increases the efficiency of DNA delivery into cells and thus can be transduced into a gene by a method for delivering antigen genes [eg, Mph-1].

Specifically, the antigen-presenting cell of the present invention can be transduced with a gene encoding an antigen by a viral vector. More specifically, the viral vector may be a vector from Canarypox virus, Newcastle disease virus, vaccinia virus, Sindbis virus, yellow fever virus, human papillomavirus, adenovirus, adeno-associated virus, or lentivirus, but is not limited thereto.

In a specific embodiment of the present invention, as shown in FIG. 2 , a gene encoding a desired antigen was transduced into dendritic cells using a lentiviral vector, and the antigen surface presentation efficiency was the best.

The antigen expressed on the surface by the antigen-presenting cell of the present invention may be related to a specific disease or virus. Accordingly, a plurality of antigens may exist, and a collection of antigen-presenting cells prepared to express each of these antigens may be referred to as an antigen-presenting cell library.

The step of preparing the T-cell may be obtained by preparing the T-cell to express any TCR related to the antigen, or by isolating the T-cell produced in the body by a specific disease or viral infection.

In a specific embodiment of the present invention, the present inventors prepared a Lymphocytic Choriomeningitis Virus (LCMV) mouse model, thereby presenting a T-cell library, a T-cell population generated from a mouse infected with LCMV, and antigens presenting LCMV-related antigens. The method of the present invention was validated by preparing a cell library.

The step of co-culturing the APC and T-cells prepared above in step (3) is to form an APC and T-cell complex, depending on the specificity between the antigen presented on the surface of the APC and the TCR expressed on the surface of the T-cell. . Herein, the “complex” may refer to a cell aggregate in which one or a plurality of T-cells having a TCR specific for the antigen are bound to an APC that presents one antigen on the surface. For example, a doublet consisting of one APC and one T-cell, or a multiple in which one APC and two or more T-cells are bound can be formed. At this time, the co-cultured T-cells and dendritic cells may be cultured at a ratio of 1:0.1-5, preferably 1:0.5-2. The co-culture time may be 30 minutes to 4 hours, and specifically, it was confirmed that the dimer formation rate was the best when 1 to 3 hours, most specifically, about 2 hours.

The APC and T-cells prepared before performing step (3) may be labeled with different fluorescent substances to check whether the complex is formed between the cells.

APC and T-cells that have formed dimers in step (4) can be sorted and distinguished from single cells that have not formed dimers through fluorescence analysis and flow cytometry.

Complexes of sorted APCs and T-cells, specifically dimer(s), or multipolymer(s) can be sequenced simultaneously, via single cell analysis.

As used herein, single cell analysis refers to a technique for isolating “one” cell, amplifying DNA or RNA from a trace amount of material, and sequencing it to analyze the genomic characteristics of the cell. The analysis method can be used when there is usually only one cell to be analyzed or only a trace amount of DNA/RNA equivalent thereto, or when heterogeneity exists between cells to be analyzed.

As a result of single-cell RNA sequencing of APC and T-cell dimer bound to heterogeneous cells, not single cells, the present inventors found that not only the antigen gene sequence introduced into APC but also the T-cell TCR sequence can be simultaneously detected. Confirmed, through this. It was finally confirmed that antigen-TCR specificity could be identified through single cell analysis of APC and T-cell dimers.

When the present invention is used, the cost for synthesizing antigenic peptides and MHCs is not required, and single cell assay (scRNA-seq) can be used to simultaneously identify antigens and TCRs of each cell, resulting in high-throughput antigen- TCR specificity detection is possible.

1 shows a schematic diagram of a method for identifying antigen-TCR specificity of the present invention.
2 shows a schematic diagram of a method for preparing an antigen-presenting cell using a dendritic cell and a lentiviral vector.
Figure 3 confirms that the antigen introduced using a lentiviral vector is expressed in dendritic cells and presented on the cell surface.
4 shows the formation of antigen-presenting cells and T-cell complexes by TCR-antigen specificity through co-culture of fluorescently labeled antigen-presenting cells and T-cells.
5 shows the results of confirming optimal culture conditions for co-culture of antigen-presenting cells and T-cells: (A) culture time, (B) T-cell:APC ratio, and (C) T-cell number.
6 shows the experimental results confirming the sensitivity of T cells to determine the size of the antigen library.
7 is a result of confirming through fluorescence analysis whether an antigen-presenting cell library and a T-cell library are co-cultured to specifically form an antigen-presenting cell-T-cell complex.
8 shows the results confirmed by adjusting the ratio of each T cell from 0.1% to 99.9% of all T cells and placing them in each well in order to confirm that the complex can be accurately detected even in low frequency T cells.
9 and 10 are schematic diagrams and results of the antigen-TCR specific detection method in the mouse lymphocytic choriomeningitis virus (LCMV) model.

Hereinafter, the present invention will be described in detail through examples. However, the following examples are only for illustrating the present invention in more detail, and it is obvious to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. something to do.

[Experimental method and materials]

[1-1] cell line

Human embryonic kidney HEK293T was purchased from the American Type Culture Collection (ATCC) in 2019 in DMEM supplemented with 10% heat inactivated fetal bovine serum (FBS; Gibco, USA) and 1% penicillin/streptomycin (Thermo Fisher Scientific, USA). cultured in medium. The DC2.4 mouse dendritic cell line was donated by Sang-Jun Ha, Department of Biochemistry, Yonsei University. The DC 2.4 cell line was cultured with 10% FBS and 1% penicillin/streptomycin at Roswell Park Memorial Institute (RPMI 1640, Gibco, USA).

[2-1] Animals

All animals were obtained from System Immunology Laboratory. 5-6 week old female C57BL/6 mice were purchased from Orient Bio, Inc. (Seongnam, Korea). LCMV Gp33-41 epitope-specific TCR transgenic P14 mice were obtained from Dr. Rafi Ahmed (Emory University School of Medicine, Atlanta, GA, USA) provided and OVA257-264-epitope-specific OT-1 mice were purchased from Jackson Laboratory. Age (6-12 weeks) was used for all experiments. All mice were maintained in a specific pathogen-free facility at Yonsei University. And the experiment was carried out with the approval of Yonsei University Animal Research Institute (IACUC) (IACUC-A-202008-1124-01).

[1-3] LCMV infection

For LCMV infection, 2×10 ⁵ plaque forming units (PFU) of LCMV-Armstrong (Arm) were diluted in 500 μL of serum-free RPMI medium and 6-week-old C57BL/6J mice were infected intraperitoneally (ip).

[1-4] Preparation of bone marrow-derived dendritic cells

Bone marrow-derived dendritic cells (BMDCs) were collected from female C57BL/6 mice aged 6 to 12 weeks by washing both the femur and tibia of the mouse. The spleens were passed through a 70 μm cell strainer (BD Falcon) and red blood cells were lysed using ACK lysis buffer (Gibco Laboratories). Leukocytes were cultured in BMDC complete medium [RPMI1640 with 10% FBS, 2-mercaptoethanol (Sigma), 1% penicillin/streptomycin, 10 ng/ml recombinant mouse IL-4 (JW CreaGene) and 20 ng/ml recombinant mouse GM-CSF (JW). CreaGene)] at 7.5 x 10 ⁵ /well and plated in TC untreated 6-well plates (BD Falcon). The medium was replaced on days 3, 6 and 8, respectively. On day 8, BMDCs were harvested and analyzed by Fluorescence Activated Cell Sorter (FACS). Only GFP+ cells were sorted and co-cultured with CD8+ T cells from LCMV-infected C57BL/6J mice.

[1-5] T cell preparation

The spleen was isolated from mice. CD8+ T cells were enriched from splenocytes using the MagniSort Mouse CD8 T Cell Enrichment Kit (Ref. 8804-6822-74, Invitrogen) following the protocol provided by the manufacturer. They were cultured in RPMI 1640 with 10% FBS and 1% penicillin/streptomycin.

[1-6] Construction of lentiviral plasmids

The lentiviral plasmid pLVX-EF1α-antigen-IRES-GFP was generated via a two-step cloning procedure. First, the pLVX-EF1α-GFP-IRES-GFP plasmid was generated from the pLVX-EF1α-GFP-IRES-Puromycin backbone plasmid. Specifically, pLVX-EF1α-GFP-IRES lacking the puromycin region was PCR amplified into two fragments using the following four primers (Table 1): Amp_giv_forward primer, bb_gfp_reverse primer, bb_gfp_forward primer, and Amp_giv_reverse primer. The GFP gene was amplified using the following primers: bb_gfp_forward primer, and bb_gfp_reverse primer.

Oligo Name Sequence 5’ to 3’ Amp_giv_fow primer TACGCGTCTGGAACAATCAAC (SEQ ID NO: 1) Amp_giv_rev primer CATGGACGAGCTGTACAAGTAAACGCGTCTGGAACAATCAACCTCTGGATTA (SEQ ID NO: 2) bb-gfp fwd primer TTGCCACAACCCACAAGGAGACGACCTTCCATGGTGAGCAAGGGCGAG (SEQ ID NO: 3) bb-gfp rev primer AAGGAGACGACCTTCC (SEQ ID NO: 4)

Fragments were selected for size on a 1.5% agarose gel. Three pieces of the pLVX-EF1α-GFP-IRES-Puromycin backbone plasmid were merged into one in the pLVX-EF1α-GFP-IRES-GFP backbone plasmid by Gibson assembly. The entire sequence was confirmed by NGS using tn5 tagmentation. Second, the upstream GFP region was removed from the pLVX-EF1α-GFP-IRES-GFP backbone plasmid by EcoR1 and BamH1 restriction enzyme digestion and the cleavage fragment size was confirmed with a 1.5% agarose gel. To generate the blunt-end antigen encoding region, antigens with genes encoding EcoR1 and BamH1 restriction sites were generated by annealing each pair of overlapping oligos using T4 DNA ligase. The annealed oligos were cloned directly into the backbone plasmid generated by restriction enzymes. Antigen insertion was confirmed by Sanger sequencing. For lentiviral vector production, a plasmid was prepared using the EndoFree Plasmid Maxi Kit (QIAGEN, USA) (FIG. 2).

[1-7] Lentiviral vector production

Lentiviral vectors were generated by co-transfection of 293T kidney cells (ATCC CRL 3216), passage 10, using the following three plasmids according to the manufacturer's instructions: (1) the target lentiviral vector plasmid (pLVX-EF1α) -antigen-IRES-GFP), (2) packaging plasmid psPAX2, and (3) envelope plasmid pMD2.G. Co-transfection was performed using the Lipofectamine3000 transfection kit (Life Technologies, USA) according to the manufacturer's instructions. The first and second viral supernatants were harvested approximately 48 and 72 hours after transfection, respectively. The supernatant was centrifuged at 800 g for 10 minutes to remove cell debris, and filtered through a 0.45 mm Acrodisc Supor Syringe Filter (PALL, USA). Virus titers were aliquoted and frozen at -80 °C. Titer measurements were performed on DC 2.4 cells after one freeze-thaw cycle.

[1-8] Lentiviral vector titration

Vector titration was performed on DC 2.4 cells according to the manufacturer's instructions. Lentiviral vector titration was determined by percentage of GFP+ cells by fluorescence activated flow cytometry 72 h post transduction. Briefly, DC 2.4 cells were seeded at a density of 1 x 10 ⁵ cells per 24 wells (TPP) approximately 4-5 hours prior to transduction. Serial dilutions of concentrated virus and 8 μg/ml polybrene (Sigma) at about 50% confluency were added to the wells. Stir gently to evenly distribute the plate, centrifuge at 800 g for 30 min and store overnight in a cell incubator. The next day, the medium with viral vectors was replaced with fresh medium without polybrene. After 72 hours, cells were analyzed to determine GFP-positivity. DC 2.4 cells were collected and washed with 1 ml of cold phosphate buffered saline (PBS). They were resuspended in 150 μl of FACS buffer and analyzed on a BD FACS Aria™ III cell sorter.

[1-9] Lentiviral vector transduction of DC 2.4 cell lines and BMDCs

The DC 2.4 cell line was transferred to 6-well tissue culture plates at a density of 4×10 ⁵ cells per well 4-5 hours prior to transduction according to the manufacturer's instructions. Transduction was performed at MOI 4 using 8 μg/ml polybrene (Sigma). Gently agitated to evenly distribute the plate, centrifuged at 800 g for 30 min, and stored overnight in a cell incubator. The next day, the medium with viral vectors was replaced with fresh medium without polybrene. Cells analyzed by FACS were harvested after 72 hours. Only GFP+ cells were collected to use antigen presenting cells.

For efficient transduction, BMDCs were transduced twice in the presence of 2 μg/ml polybrene at an MOI of 8 on days 3 and 4, the same. BMDCs were co-centrifuged with lentiviral vectors at 800 g for 90 min. On day 8, cells were harvested and analyzed by FACS. Only GFP+ cells were collected and used directly for antigen presenting cells.

[1-10] Co-culture assay

T cells and APCs were harvested as described above and washed twice with cold PBS. Both cells were stained with a fluorescent dye as shown in FIG. 2 according to the manufacturer's instructions. Cell counting was also performed according to the manufacturer's instructions. Resuspend 2×10 ⁵ T cells and 4×10 ⁵ APCs in 100 μl of complete medium in a 96-well U-bottom tissue culture plate, co-centrifuge at 800 g for 5 min and 5% CO ² , at 37 °C. They were co-cultured for 2 hours. Cells were harvested for flow cytometry and imaging.

[1-11] Visualization of dimers under the microscope

After T cells and APC co-culture, 20 μl of the cell mixture was obtained from the wells and transferred to slides. Microscopic analysis was performed using a laser scanning confocal microscope (Zeiss, LSM880). Images were collected and processed using Zen blue edition software.

[1-12] In vitro IFN-γ expression assay

For in vitro cytokine secretion assays, we co-cultured CD8+ T cells and LCMV-associated APCs from LCMV-Arm-infected mice in a 1:1 ratio. In addition, as controls, CD8+ T cells were stimulated with 25 ng/mL Phorbol myristate acetate (PMA) and 1 μM ionomycin (Sigma-Aldrich) without APC. They were incubated for 5 hours in a cell incubator in the presence of Golgi plug/Golgi stop (BD Biosciences) in complete RPMI medium containing 10% FBS. Thereafter, surface staining was performed and cells permeabilized with Cytofix/Cytoperm Kit (BD Biosciences) solution to stain intracellular cytokines according to the manufacturer's instructions, with Cytoflex LX (Beckman Coulter) and FlowJo software (Tree Star). ) was analyzed.

[1-13] Flow cytometry and sorting

Cells were suspended in ice-cold sorting buffer (PBS supplemented with 0.2 mM ethylenediaminetetraacetic acid, pH 8 and 0.5% bovine serum albumin). Samples were gated for CTFR+GFP+ to sort T cell-APC dimers. Cell populations were sorted using BD-FACS Aria Fusion (BD Biosciences) or BD Aria ARIA-II instruments (BD Biosciences) and analyzed using BD FACSDIVA software (BD Biosciences) and FlowJo software.

The isolated live cells were sorted into single cells in a semi-skirted 96-well PCR plate (Thermo Fisher Scientific, USA) containing 2 μl lysis solution for scRNA-seq and barcoded poly(T) reverse transcription primers. Immediately after sorting, each plate was rotated to allow the cells to be submerged in the lysis solution and stored at -80 °C until completion.

[1-14] Dimer library preparation

mRNA was obtained from the cells by lysing the sorted dimers in 96-well plates. mRNA was converted to cDNA using TSO and amplified with smart primers. The complementary DNA was then tagged using barcode-Tn5.

Oligo Name Sequence 5’ to 3’ Template Switching Oligo (TSO) AAGCAGTGGTATCAACAGAGTGAACGTrGrGrG (SEQ ID NO: 5) SMART PCR Primer AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO: 6)

rG: riboguanosine

[1-15] Tagging reaction and final PCR amplification

The pTXB1 vector encoding the Tn5 protein was obtained from the Rickard Sandberg group and the Tn5 enzyme was generated as previously described. For efficient tagging pool indexing, eight forward barcode sequences (Table 3) were added to Mosaic End Double-Stranded (MEDS) oligos to discriminate eight samples in a single Illumina index.

number barcode One ACTCGT (SEQ ID NO: 7) 2 TAGTCC (SEQ ID NO: 8) 3 CTATGC (SEQ ID NO: 9) 4 CATACG (SEQ ID NO: 10) 5 TGACTC (SEQ ID NO: 11) 6 ATTGCG (SEQ ID NO: 12) 7 GCAATG (SEQ ID NO: 13) 8 GTGACT (SEQ ID NO: 14)

For plasmid tagging, a mixture of MEDS solution and 2 μl of Tn5 was added to 100 ng of plasmid containing 4 μl of 5X TAPS-DMF and up to 20 μl of DW. The tagmentation mixture was incubated at 55° C. for 7 min, then 5 μl of 0.2% sodium dodecyl sulfate (SDS) solution was added and further incubated for 5 min at room temperature for Tn5 inactivation. Tagged samples were purified with 1.2X AMPure XP beads (Beckman Coulter, USA).

For cDNA tagging, the tagging mixture was prepared with the following composition: 4 μL 5X TAPS-DMF (50 mM TAPS-NaOH, 25 mM MgCl 2 , 50% v/v DMF at 25 °C (pH 8.5)), 4 μL 40% w /v PEG 8000, 1 μL Tn5 (1/50 dilution), 1 ng cDNA, DW max total volume 20 μL. Tagged samples were then incubated at 55 °C for 5 min, followed by the addition of inactivated 5 μL 0.2% SDS (0.02% final) at room temperature for 5 min for enzyme inactivation. After Tn5 enzyme inactivation, 10 μl of 8 tagged samples with different Tn5 barcodes were pooled and purified with 1X AMPure XP beads.

Tablets were added to 25 μl of 2X KAPA HiFi HotStart ReadyMix (Roche, Switzerland) and 2.5 μl each of 10 μM forward and reverse Illumina index primers and the pools were amplified as follows: (i) 72° C. for 3 min, (ii) 98° C. for 3 min. (iii) 98°C for 30 seconds, (iv) 60°C for 30 seconds, (v) 72°C for 30 seconds, repeat 16 cycles of steps (iii) to (v), (vi) 72°C for 5 minutes and (vii) 4°C for storage. The amplified target pool was washed with 0.6 volume of AMPure XP beads. Library quality was confirmed with the Agilent 4200 TapeStation high sensitivity (library size evaluation), qubit (double-stranded DNA quantity evaluation). Samples were sequenced on an Illumina NextSeq 500/550 platform.

Oligo Name Sequence 5’ to 3’ illumina P5 index primer AATGATACGGCGACCACCGAGATCTACAC [NNNNNNNN]ACACTCTTTCCCTACACGACGCT CTTCCGATC*T
(SEQ ID NO: 15) illumina P7 index primer CAAGCAGAAGACGGCATACGAGAT [NNNNNNNN]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
(SEQ ID NO: 16)

[NNNNNNNN] : 8bp sample index

[Experimental Example 1] Identification of specific binding of T cells and APCs

An experiment was performed to confirm whether the T cell specifically recognizes the antigen and produces a dimer having a specific APC ( FIG. 4 ). Well-known TCR-antigen pairs were used for validation. Specific pairs of T cell-APCs (OT-1 CD8+ T cells and OVA _257-264 presenting cells) and antigen Gp _33-41 presenting cells unrelated to these T cells were used. Each cell type was stained with a different fluorescent dye as described. OT-1 CD8+ T cells were stained with CTFR, Gp _33-41 presenting cells were stained with CTV, and OVA257-264 presenting cells were stained with PKH26. Three cells were simultaneously placed in 96 wells and co-cultured to form specific T cell-APC dimers. Then, confocal imaging and flow cytometry were performed to determine whether T cells dimerize with APCs expressing specific antigens (Fig. 4). As a result, several OT-1 CD8+ T cells bound to OVA _257-264 presenting cells were observed, but T cells bound to Gp _33-41 presenting cells were not identified. As expected, it was confirmed that only dimers showing specificity were formed, and these data showed that T cells specifically recognize and bind APC.

[Experimental Example 2] Method optimization

An experiment was performed to optimize co-culture conditions for using the above three cells for more effective T cell-APC dimer formation. Experiments were performed under three conditions: 1) co-culture time (0 min, 10 min, 1 h, 2 h, 4 h), 2) T cell:APC ratio (1:0.5, 1:1, 1:2) ), and 3) T cell density (2×10 ⁵ , 8×10 ⁵ , 16×10 ⁵ per 96 wells). As a result, the higher the cell density, the faster the dimer formation rate, but the specific enrichment decreased. The ratio of T cell to APC was less affected than other conditions, but in general, 1:2 showed the best results. Taken together, optimal results were achieved by co-culture for 2 h with a 1:2 T cell:APC ratio and 2×10 ⁵ T cells per well ( FIG. 5 ).

[Experimental Example 　3] T cell antigen sensitivity evaluation

In order to determine the size of the antigen library, an experiment was conducted to determine the sensitivity of T cells to the antigen. Among all APCs, the ratio of APCs having a specific antigen was varied from 0%, 0.1%, 1%, and 10% to 100%, and the observed results were expressed as enrichment (FIG. 6). Enrichment shows how well T cells react with cells with specific antigens compared to cells with nonspecific antigens. As a result, the enrichment of specific cells showed similar results regardless of the frequency. T cells bound 40-70 fold better on specific APCs than on nonspecific APCs. This was found to be detectable even if it was present in about 0.1% of the specific antigen present in APC (FIG. 6).

[Experimental Example 4] Evaluation of multi-dimer formation and detection of T-cell library and APC library

By experimenting with two types of T cells and two types of APCs, it was investigated whether specific dimer formation and detection was possible even in a library-to-library combination as shown in FIG. 7 . OT-1 CD8+ T cells and OVA _257-264 presenting cells, P14 CD8+ T cells and Gp _33-41 presenting cells were used as specific T cell-APC pairs. Cells presenting OT-1 with CTFR, P14 with CTV and OVA _257-264 were stained with PKH26 and expressed GFP. Gp _33-41 presenting cells are not stained but can be distinguished by GFP expression. The experiment was conducted in the same manner as in Experimental Example 1. In the confocal microscopy image, it was confirmed that each type of T cell binds to a specific APC ( FIG. 7 ). Despite the library-to-library combination situation, it was clearly confirmed that T cells bind to specific APCs.

In addition, in order to confirm that the correct combination of dimers can be detected even in low frequency T cells, the proportion of each T cell in all T cells was adjusted from 0.1% to 99.9% and placed in each well. As a result, the specificity tended to increase as the abundance decreased ( FIG. 8 ). Each APC reacted with a specific T cell, making it less accessible to other T cells, which was thought to increase the rate of dimer formation with specific APCs. Given that the proportion of predominant T cell clones in real organisms is less than 5%, the above results can be considered more promising than previous experiments. Through the above experiments, we verified that our platform can be used to generate and discriminate specific TCR-APC pairs in various situations similar to the real human immune environment.

[Experimental Example 5] Antigen-TCR specificity detection in mouse lymphocytic choriomeningitis virus (LCMV) model

The platform verified through the above experiment was applied to the actual disease model. We used a mouse lymphocytic choriomeningitis virus (LCMV) model that is well-studied and has relatively easy access to disease-associated antigens. First, LCMV-related antigen-expressing cells were constructed. In a published study, we selected 11 highly reactive LCMV-associated antigens and obtained their antigen sequences (Table 5). We designed, assembled, and cloned oligos with 11 different antigenic sequences into existing lentiviral vector plasmids.

# antigen Sequence One Gp _33-41 KAVYNFATC (SEQ ID NO: 17) 2 Gp _34-41 AVYNFATC (SEQ ID NO: 18) 3 Gp _118-125 ISHNFCNL (SEQ ID NO: 19) 4 Gp _276-286 SGVENPGGYCL (SEQ ID NO: 20) 5 Np _205-212 YTVKYPNL (SEQ ID NO: 21) 6 Np _238-248 SGYNFSLGAAV (SEQ ID NO: 22) 7 Np _396-404 FQPQNGQFI (SEQ ID NO: 23) 8 Lp _455-463 FMKIGAHPI (SEQ ID NO: 24) 9 Lp _689-697 KFMLNVSYL (SEQ ID NO: 25) 10 Lp _2062-2069 RSIDFERV (SEQ ID NO: 26) 11 OVA _257-264 SIINFEKL (SEQ ID NO: 27)

In addition, we wanted to observe differences between APCs with responding T cells and primary cells and cell lines obtained from the same individuals. In this experiment, in addition to the DC 2.4 cell line, bone-marrowed dendritic cells (BMDCs) obtained from mice were differentiated and used as a host for antigen-presenting cells. Then, LCMV from C57BL/6 mice infected with LCMV, a species derived from the DC 2.4 cell line. Reactive T cells were prepared and the reaction was triggered only by the antigen, not the individual difference. Harvest T cells when T cells are sufficiently enriched for LCMV. It was stained with CTFR for use in doublet formation experiments. APCs were not stained separately because they could be distinguished by GFP expression. The prepared T cells and APCs were subjected to a co-culture experiment in the same manner as the above-described experiment for dimer formation. The formed dimers were sorted and analyzed by scRNA-seq to obtain TCR-antigen sequence pairs (Fig. 9A). And it was confirmed whether each prepared APC was related LCMV by IFN-γ analysis using the prepared T cells (FIG. 9B). As a result, it was confirmed that APC expressed LCMV-related antigen, and T cells targeting LCMV proliferated well and were activated in response to APC ( FIG. 9B ).

Finally, as a result of performing co-culture experiments with LCMV-related APCs and T cells, both LCMV-related APCs of DC 2.4 and BMDCs showed a more significant dimer-forming ability than the control group (OVA257-264 expressing cells) (FIG. 9C). This suggested that T cells bind better with LCMV-associated APCs because of their affinity for specific antigens.

Then, T cell-APC dimers were sorted one per well in a 96-well plate and analyzed by scRNA-seq using smart-seq 3, as a result, several specific TCR-antigen pairs could be detected (Fig. 10).

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> A method for determining the specificity of a TCR-antigen using a single cell analysis <130> P21U16C1451 <150> KR 10-2020-0136348 <151> 2020-10-20 <160> 27 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Amp_giv_fow primer <400> 1 tacgcgtctg gaacaatcaa c 21 <210> 2 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Amp_giv_rev primer <400> 2 catggacgag ctgtacaagt aaacgcgtct ggaacaatca acctctggat ta 52 <210> 3 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> bb-gfp fwd primer <400> 3 ttgccacaac ccacaaggag acgaccttcc atggtgagca agggcgag 48 <210> 4 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> bb-gfp rev primer <400> 4 aaggagacga ccttcc 16 <210> 5 <211> 30 <212> DNA_RNA <213> Artificial Sequence <220> <223> Template Switching Oligo (TSO) <220> <223> 3' terminal three G: riboguanosine (rGrGrG) <400> 5 aagcagtggt atcaacagag tgaacgtggg 30 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SMART PCR Primer <400> 6 aagcagtggt atcaacgcag agt 23 <210> 7 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> barcode 1 <400> 7 actgt 6 <210> 8 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> barcode 2 <400> 8 tagtcc 6 <210> 9 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> barcode 3 <400> 9 ctatgc 6 <210> 10 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> barcode 4 <400> 10 catacg 6 <210> 11 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> barcode 5 <400> 11 tgactc 6 <210> 12 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> barcode 6 <400> 12 attgcg 6 <210> 13 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> barcode 7 <400> 13 gcaatg 6 <210> 14 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> barcode 8 <400> 14 gtgact 6 <210> 15 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> illumina P5 index primer <400> 15 aatgatacgg cgaccaccga gatctacacn nnnnnnnaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 16 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> illumina P7 index primer <400> 16 caagcagaag acggcatacg agatnnnnnn nngtgactgg agttcagacg tgtgctcttc 60 cgatct 66 <210> 17 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Gp33-41 <400> 17 Lys Ala Val Tyr Asn Phe Ala Thr Cys 1 5 <210> 18 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Gp34-41 <400> 18 Ala Val Tyr Asn Phe Ala Thr Cys 1 5 <210> 19 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Gp118-125 <400> 19 Ile Ser His Asn Phe Cys Asn Leu 1 5 <210> 20 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Gp276-286 <400> 20 Ser Gly Val Glu Asn Pro Gly Gly Tyr Cys Leu 1 5 10 <210> 21 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Np205-212 <400> 21 Tyr Thr Val Lys Tyr Pro Asn Leu 1 5 <210> 22 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Np238-248 <400> 22 Ser Gly Tyr Asn Phe Ser Leu Gly Ala Ala Val 1 5 10 <210> 23 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Np396-404 <400> 23 Phe Gln Pro Gln Asn Gly Gln Phe Ile 1 5 <210> 24 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Lp455-463 <400> 24 Phe Met Lys Ile Gly Ala His Pro Ile 1 5 <210> 25 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Lp689-697 <400> 25 Lys Phe Met Leu Asn Val Ser Tyr Leu 1 5 <210> 26 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Lp2062-2069 <400> 26 Arg Ser Ile Asp Phe Glu Arg Val 1 5 <210> 27 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> OVA257-264 <400> 27 Ser Ile Ile Asn Phe Glu Lys Leu 1 5

Claims (8)

(1) transducing any antigen-encoding gene to prepare an antigen-presenting cell that presents the antigen on the surface;
(2) preparing T-cells;
(3) co-culturing the prepared APC and T-cells;
(4) separating the cell complex formed by the binding between the antigen presented on the surface of the APC and the T-cell TCR after culture; and
(5) performing single-cell sequencing of the cell complex to identify an antigen expressed by APC and a TCR sequence expressed by T-cells from the cell complex. A method for detecting antigen-TCR specificity.
(1) preparing a plurality of antigen-presenting cells that present the antigen on the surface by transduction with a gene encoding any antigen;
(2) preparing a plurality of T-cells;
(3) co-culturing the prepared APC and T-cells;
(4) separating the cell complexes formed by the binding between the antigen presented on the surface of the APC and the T-cell TCR after culture; and
(5) multiple antigen-TCR specificity detection comprising the step of simultaneously performing single-cell sequencing of the cell complexes to identify an antigen expressed by APC and a TCR sequence expressed by T-cells from the complex Way.
3. The method of claim 1 or 2,
The antigen-presenting cell is transduced with one gene to present one gene on the surface, antigen-TCR specificity detection method.
3. The method of claim 1 or 2,
The gene transduced in step (1) is a gene encoding an antigen associated with a specific disease or infection, and the T cell prepared in step (2) is an antigen-TCR specificity, which is a T cell isolated from a patient with the specific disease or infection. detection method.
3. The method of claim 1 or 2,
The antigen-presenting cell is a dendritic cell antigen-TCR specificity detection method.
3. The method of claim 1 or 2,
Antigen-TCR specificity detection method in which the gene encoding the antigen in step (1) is transduced using a viral vector.
7. The method of claim 6,
The antigen-TCR specificity detection method wherein the virus is a lentivirus.
3. The method of claim 1 or 2,
The method further comprises the step of labeling the antigen-presenting cell and the T cell with a substance exhibiting different fluorescence, respectively, and the complex between the antigen-presenting cell and the T cell is classified according to whether or not all of the different fluorescence is emitted. A method for detecting antigen-TCR specificity.

Images