KR20220049503A - Stress diagnosis technology using exosome-derived miRNA - Google Patents

Stress diagnosis technology using exosome-derived miRNA Download PDF

Info

Publication number
KR20220049503A
KR20220049503A KR1020220044688A KR20220044688A KR20220049503A KR 20220049503 A KR20220049503 A KR 20220049503A KR 1020220044688 A KR1020220044688 A KR 1020220044688A KR 20220044688 A KR20220044688 A KR 20220044688A KR 20220049503 A KR20220049503 A KR 20220049503A
Authority
KR
South Korea
Prior art keywords
seq
mir
stress
exosome
derived
Prior art date
Application number
KR1020220044688A
Other languages
Korean (ko)
Inventor
우정민
성민경
서민수
강경구
성수은
최주희
이시준
김길수
Original Assignee
재단법인 대구경북첨단의료산업진흥재단
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 대구경북첨단의료산업진흥재단, 경북대학교 산학협력단 filed Critical 재단법인 대구경북첨단의료산업진흥재단
Priority to KR1020220044688A priority Critical patent/KR20220049503A/en
Publication of KR20220049503A publication Critical patent/KR20220049503A/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a composition for diagnosis of stress using the expression pattern of exosome-derived miRNA that changes under stress. In the present invention, by comparatively evaluating the expression of miRNA of nerve-derived exosomes in normal animals and animal models subjected to high-intensity stress, miRNAs whose expression levels specifically change under stress conditions are identified. Therefore, the miRNA is expected to be utilized not only as a biomarker related to stress diseases, but also to be effectively used for the development of products related to the diagnosis of stress.

Description

엑소좀 유래 miRNA를 이용한 스트레스 진단기술{Stress diagnosis technology using exosome-derived miRNA}Stress diagnosis technology using exosome-derived miRNA

본 발명은 스트레스 하에서 엑소좀 유래 miRNA의 발현 양상이 변화한다는 점을 이용한 스트레스 진단용 조성물 등에 관한 것이다.The present invention relates to a composition for diagnosing stress using the fact that the expression pattern of exosome-derived miRNA changes under stress.

일반적으로 스트레스(Stress)란, 생체에 가해지는 여러 상해 또는 자극에 대하여 체내에서 일어나는 비특이적인 생물반응을 의미한다. 외부의 일시적인 스트레스에 대한 반응은 자연스런 현상일 수 있지만, 스트레스에 대한 반응이 오랫동안 지속될 경우에는 정신적 또는 신체적으로 손상을 입게 될 수 있다. 특히, 스트레스는 스트레스가 가해지는 대상이 언제나 자각할 수 있는 것은 아니고 동물의 경우 스트레스 상태에 있는 것을 인지하기 어려운 경우도 있으므로 스트레스 상태인지 객관적으로 진단할 수 있는 방법이 필요하다.In general, stress refers to a non-specific biological response occurring in the body to various injuries or stimuli applied to the living body. Response to external temporary stress may be a natural phenomenon, but if the response to stress persists for a long time, mental or physical damage may occur. In particular, stress is not always perceptible to the subject to which the stress is applied, and in the case of animals, it is sometimes difficult to recognize that they are in a state of stress.

한편, 엑소좀은 세포 내부에서 형성되어 다중소낭체를 통해 세포 외부로 분비되는 직경 약 200 nm 이하의 작은 세포외소포체이다. 모세포의 단백질과 유전정보를 포함하고 있는 엑소좀은 최근 다양한 질환의 바이오마커로 활용 가능성이 제시되고 있다.On the other hand, exosomes are small extracellular vesicles with a diameter of about 200 nm or less that are formed inside the cell and secreted out of the cell through multivesicles. Exosomes, which contain protein and genetic information of parental cells, have recently been suggested to be useful as biomarkers for various diseases.

다만 엑소좀을 이용하여 스트레스를 진단하는 방법에 대한 기술은 아직 연구된 바 없어 이에 대한 심도 깊은 연구가 요구되고 있다.However, a technique for diagnosing stress using exosomes has not yet been studied, so an in-depth study is required.

대한민국 공개특허공보 10-2016-0042703Korean Patent Publication No. 10-2016-0042703

본 발명의 목적은 엑소좀 유래 특정 miRNA의 발현 수준을 측정하는 제제를 포함하는 스트레스 진단용 조성물을 제공하는 것이다.It is an object of the present invention to provide a composition for diagnosing stress comprising an agent for measuring the expression level of a specific miRNA derived from an exosome.

본 발명의 다른 목적은 상기 조성물을 포함하는 스트레스 진단용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for diagnosing stress comprising the composition.

본 발명의 또 다른 목적은 개체의 액소좀 유래 특정 miRNA의 발현 수준을 대조군의 엑소좀 유래 해당 miRNA의 발현 수준과 비교하는 단계를 포함하는, 스트레스 진단을 위한 정보제공 방법을 제공하는 것이다.Another object of the present invention is to provide an information providing method for diagnosing stress, comprising comparing the expression level of a specific miRNA derived from an exosome of an individual with the expression level of the corresponding miRNA derived from an exosome of a control group.

상기 본 발명의 목적을 달성하기 위해 본 발명은 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p 및 miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 엑소좀 유래 miRNA의 발현 수준을 측정하는 제제를 포함하는, 스트레스 진단용 조성물을 제공한다.In order to achieve the above object of the present invention, the present invention provides let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c- 5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR- It provides a composition for diagnosing stress, comprising an agent for measuring the expression level of one or more exosome-derived miRNAs selected from the group consisting of 425-5p and miR-93-5p.

본 발명의 일 구현예로 상기 엑소좀은 신경 유래 엑소좀 일 수 있다.In one embodiment of the present invention, the exosome may be a nerve-derived exo.

본 발명의 일 구현예로 상기 제제는 상기 하나 이상의 엑소좀 유래 miRNA에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 것일 수 있다.In one embodiment of the present invention, the agent may include a primer or probe that specifically binds to the one or more exosome-derived miRNAs.

또한, 본 발명은 상기 조성물을 포함하는 스트레스 진단용 키트를 제공한다.In addition, the present invention provides a kit for diagnosing stress comprising the composition.

또한, 본 발명은 (a) 개체의 생물학적 시료로부터 엑소좀을 분리하는 단계; 및In addition, the present invention comprises the steps of (a) isolating the exosomes from the biological sample of the individual; and

(b) 상기 (a)단계에서 분리된 엑소좀에서 유래한 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p 및 miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준을 대조군 시료의 해당 엑소좀 유래 miRNA의 발현 수준과 비교하는 단계를 포함하는, 스트레스 진단을 위한 정보제공 방법을 제공한다.(b) let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let- 7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c- Information for diagnosing stress, comprising comparing the expression level of one or more miRNAs selected from the group consisting of 5p, miR-425-5p and miR-93-5p with the expression level of the corresponding exosome-derived miRNA in a control sample provide a method for providing

본 발명의 일 구현예로 상기 생물학적 시료는 혈액일 수 있다.In one embodiment of the present invention, the biological sample may be blood.

본 발명의 일 구현예로 상기 엑소좀은 신경 유래 엑소좀 일 수 있다.In one embodiment of the present invention, the exosome may be a nerve-derived exo.

본 발명의 일 구현예로 상기 (b)단계에서 개체의 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p 및 miR-98-3p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준이 대조군에 비해 고발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함할 수 있다.In one embodiment of the present invention, let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let from the group consisting of -7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p and miR-98-3p The method may further include determining that the subject is in a stress state when the expression level of the selected one or more miRNAs is higher than that of the control group.

본 발명의 일 구현예로 상기 (b)단계에서 개체의 let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p 및 miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준이 대조군에 비해 저발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함할 수 있다.In one embodiment of the present invention, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p of the subject in step (b) , when the expression level of one or more miRNAs selected from the group consisting of miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p and miR-93-5p is low compared to the control group The method may further include determining that the subject is in a state of stress.

본 발명은 정상 동물 및 고강도 스트레스 처리 동물 모델의 신경 유래 엑소좀의 miRNA의 발현을 비교 평가한 결과 스트레스 상태에서 특이적으로 발현정도가 변화하는 miRNA를 확인하였는 바, 이러한 miRNA는 스트레스 질환 관련 바이오마커로 활용될 수 있을 뿐만 아니라 스트레스 진단에 관한 제품개발에도 유용하게 이용될 것으로 기대된다.As a result of comparative evaluation of the expression of miRNAs in neuronal-derived exosomes in normal animals and high-intensity stress-treated animal models, the present invention confirmed miRNAs that specifically change their expression level under stress. These miRNAs are stress disease-related biomarkers. It is expected that not only can it be used as a tool, but it will also be usefully used for product development related to stress diagnosis.

도 1은 급성 고강도 스트레스 동물 모델을 구축하기 위한 실험설계 내용을 개략적으로 나타낸 것이다.
도 2a 및 2b는 스트레스 처리한 마우스에서 스트레스 관련 특이 호르몬(코티솔, 코르티코스테론)의 분비 양상을 시간별로 나타낸 것이다.
도 3a는 급성 고강도 스트레스 유발 이후 1일, 3일 및 7일째에 뇌의 해마(hippocampus) 부위에 GFAP, BDNF, Cox2 및 TNF-alpha의 발현 양상을 면역염색기법으로 확인한 결과이다.
도 3b는 정상군 대비 급성 고강도 스트레스의 해마에서 특정 단백질 발현의 변화를 확인한 것이다.
도 4a는 혈청 유래 엑소좀의 특이적 표면항원 발현을 FACS 로 확인한 것이다.
도 4b는 혈청 유래 엑소좀의 특이적 표면항원 발현을 웨스턴 블롯으로 확인한 것이다.
도 4c는 혈청 유래 엑소좀의 형태학적 확인을 위한 전자현미경 관찰 결과이다.
도 4d는 엑소좀의 크기 확인을 위한 DLS 측정 결과를 나타낸 것이다.
도 5a는 혈청 유래 엑소좀에서 신경유래 엑소좀을 추출하는 방법을 개략적으로 나타낸 것이다.
도 5b는 신경 유래 엑소좀의 증명을 위하여 신경 특이마커인 CD171, TUJ1 및 NSE의 발현을 western으로 확인한 결과이다.
도 6은 정상군 대비 급성 고강도 스트레스 유발군에서 신경 유래 엑소좀의 miRNA 발현 양상을 NGS를 통하여 비교 분석한 결과를 나타낸 것이다.
1 schematically shows the contents of the experimental design for constructing an acute high-intensity stress animal model.
2a and 2b show the secretion pattern of stress-related specific hormones (cortisol, corticosterone) in mice treated with stress over time.
Figure 3a is the result of confirming the expression patterns of GFAP, BDNF, Cox2 and TNF-alpha in the hippocampus of the brain on the 1st, 3rd and 7th day after acute high intensity stress induction by immunostaining technique.
Figure 3b confirms the change of specific protein expression in the hippocampus of acute high-intensity stress compared to the normal group.
Figure 4a confirms the specific surface antigen expression of the serum-derived exosomes by FACS.
Figure 4b confirms the specific surface antigen expression of the serum-derived exosomes by Western blot.
Figure 4c is an electron microscope observation results for the morphological confirmation of the serum-derived exosomes.
Figure 4d shows the DLS measurement results for confirming the size of the exosomes.
Figure 5a schematically shows a method for extracting the nerve-derived exosomes from the serum-derived exosomes.
Figure 5b is the result of confirming the expression of the nerve-specific markers CD171, TUJ1 and NSE in western to prove the nerve-derived exosome.
6 shows the results of comparative analysis through NGS of miRNA expression patterns of nerve-derived exosomes in the acute high-intensity stress-induced group compared to the normal group.

본 발명은 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p 및 miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 엑소좀 유래 miRNA의 발현 수준을 측정하는 제제를 포함하는, 스트레스 진단용 조성물을 제공한다.The present invention is let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let -7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i -5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p and miR-93-5p It provides a composition for diagnosing stress, comprising an agent for measuring the expression level of one or more exosome-derived miRNAs selected from the group consisting of.

본 발명에서 "miRNA(microRNA)"는, mRNA의 3' 비번역 영역(UTR) 부위와의 염기결합을 통해 전사후 억제자 역할을 하는 대략 22 nt의 비번역 RNA를 의미한다.In the present invention, "miRNA (microRNA)" refers to an approximately 22 nt untranslated RNA that acts as a post-transcriptional repressor through base binding with the 3' untranslated region (UTR) region of mRNA.

엑소좀 miRNAs의 검출은 통상적으로는 시료부터 엑소좀을 추출하여, 추출물 중의 엑소좀 miRNAs을 검출함으로써 실시할 수 있다. 이러한 엑소좀 miRNAs의 검출은 하이브리드화 반응 및 증폭반응에 의해 측정될 수 있으나, 이에 제한되지 않고 당업계에 공지된 다양한 기술을 이용하여 용이하게 실시될 수 있다.Detection of exosome miRNAs can be carried out by extracting exosomes from a sample and detecting exosome miRNAs in the extract. Detection of these exosomes miRNAs can be measured by hybridization and amplification reactions, but is not limited thereto and can be easily carried out using various techniques known in the art.

한편 본 발명에서 언급되는 miRNA의 염기서열을 아래와 같다.Meanwhile, the base sequence of miRNA mentioned in the present invention is as follows.

miRNAsmiRNAs 염기서열(5'→3')Base sequence (5'→3') 서열번호SEQ ID NO: let-7a-1-3plet-7a-1-3p CUAUACAAUCUACUGUCUUUCCCUAUACAAUCUACUGUCUUUCC 1One let-7a-5plet-7a-5p UGAGGUAGUAGGUUGUAUAGUUUGAGUAGUAGGUUGUAUAGUU 22 let-7b-3plet-7b-3p CUAUACAACCUACUGCCUUCCCCAUUACAACCUACUGCCUUCCC 33 let-7b-5plet-7b-5p UGAGGUAGUAGGUUGUGUGGUUUGAGGUAGGUUGUGUGGUU 44 let-7c-2-3plet-7c-2-3p CUAUACAAUCUACUGUCUUUCCCUAUACAAUCUACUGUCUUUCC 55 let-7c-5plet-7c-5p UGAGGUAGUAGGUUGUAUGGUUUGAGUAGUAGGUUGUAUGGUU 66 let-7d-3plet-7d-3p CUAUACGACCUGCUGCCUUUCUCUAUACGACCUGCUGCCUUUCU 77 let-7f-1-3plet-7f-1-3p CUAUACAAUCUAUUGCCUUCCCUAUACAAUCUAUUGCCUUCC 88 let-7f-5p let-7f-5p UGAGGUAGUAGAUUGUAUAGUUUGAGGUAGAUUGUAUAGUU 99 miR-126a-5p miR-126a-5p CAUUAUUACUUUUGGUACGCGCAUUAUUACUUUUGGUACGCG 1010 miR-3473 miR-3473 UCUAGGGCUGGAGAGAUGGCUAUCUAGGGCUGGAGAGAUGGCUA 1111 miR-466b-3p miR-466b-3p AUACAUACACACACACAUACACAUACAUACACACACACAUACAC 1212 miR-98-3p miR-98-3p CUAUACAACUUACUACUUUCCCUAUACAACUUACUACUUUCC 1313 let-7d-5p let-7d-5p AGAGGUAGUAGGUUGCAUAGUUAGAGGUAGUAGGUUGCAUAGUU 1414 let-7g-5p let-7g-5p UGAGGUAGUAGUUUGUACAGUUUGAGGUAGUAGUUUGUACAGUU 1515 let-7i-5p let-7i-5p UGAGGUAGUAGUUUGUGCUGUUUGAGGUAGUAGUUUGUGCUGUU 1616 miR-140-3p miR-140-3p UACCACAGGGUAGAACCACGGUACCACAGGGUAGAACCACGG 1717 miR-17-5p miR-17-5p CAAAGUGCUUACAGUGCAGGUAGCAAAGUGCUUACAGUGCAGGUAG 1818 miR-191a-5p miR-191a-5p CAACGGAAUCCCAAAAGCAGCUGCAACGGAAUCCCAAAAGCAGCUG 1919 miR-19b-3p miR-19b-3p UGUGCAAAUCCAUGCAAAACUGAUGUGCAAAUCCAUGCAAAACUGA 2020 miR-24-3p miR-24-3p UGGCUCAGUUCAGCAGGAACAGUGGCUCAGUUCAGCAGGAACAG 2121 miR-30c-5p miR-30c-5p UGUAAACAUCCUACACUCUCAGCUGUAAACAUCCUACACUCUCAGC 2222 miR-425-5p miR-425-5p AAUGACACGAUCACUCCCGUUGAAAUGACACGAUCACUCCCGUUGA 2323 miR-93-5p miR-93-5p CAAAGUGCUGUUCGUGCAGGUAGCAAAGUGCUGUUCGUGCAGGUAG 2424

본 발명에서 상기 엑소좀은 신경 유래 엑소좀 일 수 있다.In the present invention, the exosome may be a nerve-derived exosome.

본 발명의 엑소좀 miRNA의 발현 수준을 측정하는 제제는 스트레스 상태에서 생물학적 시료의 검체에서 발현 수준이 감소되는 마커인 엑소좀 miRNA 및 발현 수준이 증가되는 마커인 엑소좀 miRNA의 발현 수준을 확인함으로써 마커의 검출에 사용될 수 있는 분자를 의미한다.The agent for measuring the expression level of exosomal miRNA of the present invention is a marker by confirming the expression level of exosome miRNA, a marker whose expression level is decreased, and exosome miRNA, a marker whose expression level is increased, in a sample of a biological sample under stress. molecules that can be used for the detection of

본 발명에서 상기 제제는 상기 하나 이상의 엑소좀 유래 miRNA에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 것일 수 있다.In the present invention, the agent may include a primer or probe that specifically binds to the one or more exosome-derived miRNAs.

즉, 핵산의 검출은 핵산 분자 또는 상기 핵산 분자의 상보물에 하이브리드화되는 하나 이상의 올리고뉴클레오타이드 프라이머를 사용하는 증폭반응에 의해 수행될 수 있다. 예컨대, 프라이머를 이용한 엑소좀 miRNAs의 검출은 PCR과 같은 증폭 방법을 사용하여 유전자 서열을 증폭한 다음 당 분야에 공지된 방법으로 유전자의 증폭 여부를 확인함으로써 수행될 수 있다.That is, the detection of a nucleic acid may be performed by an amplification reaction using one or more oligonucleotide primers hybridized to a nucleic acid molecule or a complement of the nucleic acid molecule. For example, detection of exosome miRNAs using primers can be performed by amplifying the gene sequence using an amplification method such as PCR and then confirming whether the gene is amplified by a method known in the art.

프라이머는 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 갖는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성이 개시될 수 있다. 본 발명에서는 상기 하나 이상의 miRNA에 특이적으로 결합하는 센스 및 안티센스 프라이머를 이용하여 PCR 증폭을 실시하여 발현 수준을 확인함으로써 스트레스 여부를 진단할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다.A primer is a nucleic acid sequence having a short free 3' hydroxyl group. A short nucleic acid sequence capable of forming a base pair with a complementary template and serving as a starting point for template strand copying. means Primers can initiate DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in appropriate buffers and temperatures. In the present invention, the presence or absence of stress can be diagnosed by performing PCR amplification using the sense and antisense primers specifically binding to the one or more miRNAs to check the expression level. PCR conditions, the length of the sense and antisense primers can be modified based on what is known in the art.

프로브는 짧게는 수 염기 내지 길게는 수십 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며 라벨링되어 있다. 프로브는 올리고뉴클로타이드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 본 발명에서는 위 하나 이상의 miRNA와 상보적인 프로브를 이용하여 혼성화를 실시하여 발현 수준을 확인함으로써 스트레스 여부를 진단할 수 있다. 적당한 프로브의 선택 및 혼성화 조건은 당업계에 공지된 것을 기초로 변형할 수 있다.The probe refers to a nucleic acid fragment, such as RNA or DNA, corresponding to several bases to several tens of bases as long and is labeled. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. In the present invention, stress can be diagnosed by performing hybridization using one or more of the above miRNAs and complementary probes and checking the expression level. Selection of appropriate probes and hybridization conditions can be modified based on those known in the art.

이러한 프라이머 또는 프로브는 공지된 서열을 바탕으로 당업자가 적절히 디자인할 수 있다.Such primers or probes can be appropriately designed by those skilled in the art based on known sequences.

예컨대, 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.For example, primers or probes can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoros. amidates, carbamates, etc.) or charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

miRNA의 발현 수준은 당해 분야에서 통상 사용되는 방법에 따라 측정될 수 있는데, 예컨대 역전사효소 중합효소반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(Competitive RT-PCR), 실시간 역전사효소 중합효소반응 (Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 또는 유전자 칩 등이 포함되며 이들로 제한되는 것은 아니다.The expression level of miRNA can be measured according to a method commonly used in the art, for example, reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (Competitive RT-PCR), real-time reverse transcriptase polymerase reaction (Real-time RT-PCR), RNase protection assay (RPA; RNase protection assay), Northern blotting (Northern blotting), or gene chip, and the like are included, but are not limited thereto.

본 발명의 다른 양태로서 본 발명은 상기 조성물을 포함하는 스트레스 진단용 키트를 제공한다.As another aspect of the present invention, the present invention provides a kit for diagnosing stress comprising the composition.

상기 키트에는 상기 엑소좀 miRNA의 발현 수준을 측정하는 제제뿐만 아니라, 스트레스 진단 키트로 사용되기에 적합하도록 사용되는 당 분야에서 일반적으로 사용되는 도구, 시약 등이 포함될 수 있다.The kit may include not only an agent for measuring the expression level of the exosome miRNA, but also tools, reagents, etc. commonly used in the art that are used to be suitable for use as a stress diagnosis kit.

상기 도구 또는 시약의 일 예로, 적합한 담체, 검출 가능한 신호를 생성할 수 있는 표지 물질, 발색단(chromophores), 용해제, 세정제, 완충제, 안정화제 등이 포함되나 이에 제한되지 않는다. 표지물질이 효소인 경우에는 효소 활성을 측정할 수 있는 기질 및 반응 정지제를 포함할 수 있다. 담체는 가용성 담체, 불용성 담체가 있고, 가용성 담체의 일 예로 당 분야에서 공지된 생리학적으로 허용되는 완충액, 예를 들어 PBS가 있고, 불용성 담체의 일 예로 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 가교 덱스트란, 폴리사카라이드, 라텍스에 금속을 도금한 자성 미립자와 같은 고분자, 기타 종이, 유리, 금속, 아가로오스 및 이들의 조합일 수 있다.Examples of the tool or reagent include, but are not limited to, a suitable carrier, a labeling material capable of generating a detectable signal, chromophores, solubilizers, detergents, buffers, stabilizers, and the like. When the labeling material is an enzyme, it may include a substrate capable of measuring enzyme activity and a reaction terminator. The carrier includes a soluble carrier and an insoluble carrier, and an example of the soluble carrier is a physiologically acceptable buffer known in the art, for example, PBS, and an example of the insoluble carrier is polystyrene, polyethylene, polypropylene, polyester, poly It may be acrylonitrile, fluororesin, crosslinked dextran, polysaccharide, polymer such as magnetic fine particles plated with metal in latex, other paper, glass, metal, agarose, and combinations thereof.

본 발명의 키트는 상술한 조성물을 구성으로 포함하므로, 중복된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.Since the kit of the present invention includes the above-described composition as a component, redundant descriptions are omitted in order to avoid excessive complexity of the present specification.

본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 개체의 생물학적 시료로부터 엑소좀을 분리하는 단계; 및According to another aspect of the present invention, the present invention comprises the steps of (a) isolating the exosomes from the biological sample of the individual; and

(b) 상기 (a)단계에서 분리된 엑소좀에서 유래한 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p 및 miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준을 대조군 시료의 해당 엑소좀 유래 miRNA의 발현 수준과 비교하는 단계를 포함하는, 스트레스 진단을 위한 정보제공 방법을 제공한다.(b) let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p, miR-98-3p, let- 7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c- Information for diagnosing stress, comprising comparing the expression level of one or more miRNAs selected from the group consisting of 5p, miR-425-5p and miR-93-5p with the expression level of the corresponding exosome-derived miRNA in a control sample provide a method for providing

상기 “대조군 시료의 해당 엑소좀 유래 miRNA 발현 수준과 비교” 한다는 것은 진단의 대상인 개체의 엑소좀에서 유래한 특정 miRNA와 동일한 종류의 대조군 miRNA의 발현 정도를 비교한다는 것이다.The “comparison with the expression level of the miRNA derived from the exosome of the control sample” refers to comparing the expression level of the same type of control miRNA with the specific miRNA derived from the exosome of the subject to be diagnosed.

본 발명의 상기 (b)단계에서 개체의 let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p, let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p 및 miR-98-3p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준이 대조군에 비해 고발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함할 수 있다.Let-7a-1-3p, let-7a-5p, let-7b-3p, let-7b-5p, let-7c-2-3p, let-7c-5p of the subject in step (b) of the present invention , let-7d-3p, let-7f-1-3p, let-7f-5p, miR-126a-5p, miR-3473, miR-466b-3p and at least one selected from the group consisting of miR-98-3p When the expression level of miRNA is higher than that of the control, the method may further include determining that the subject is in a stress state.

본 발명의 상기 (b)단계에서 개체의 let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b-3p, miR-24-3p, miR-30c-5p, miR-425-5p, miR-93-5p로 이루어지는 군으로부터 선택된 1종 이상의 miRNA의 발현 수준이 대조군에 비해 저발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함할 수 있다.Let-7d-5p, let-7g-5p, let-7i-5p, miR-140-3p, miR-17-5p, miR-191a-5p, miR-19b of the subject in step (b) of the present invention When the expression level of one or more miRNAs selected from the group consisting of -3p, miR-24-3p, miR-30c-5p, miR-425-5p, and miR-93-5p is low compared to the control group, the subject is stressed It may further include the step of determining the state.

본 발명에서 상기 엑소좀 miRNA의 발현 수준을 언급하면서 사용되는 용어 "저발현"은 바이오 마커(본 발명에서는 엑소좀 유래 miRNA)가 비정상 프로세스, 질환 혹은 개체 내 기타 병태를 나타내거나 이의 징후인 경우, 건강하거나 정상인 개체 또는 비교 대상인 개체로부터 획득된 생물학적 시료에서 검출되는 바이오 마커의 값 혹은 수준 범위 보다 낮은 생물학적 시료 내의 바이오 마커의 값 혹은 수준을 지칭한다.In the present invention, the term "low expression" used while referring to the expression level of the exosome miRNA is a biomarker (exosome-derived miRNA in the present invention) indicating an abnormal process, disease, or other condition in an individual or a symptom thereof. Refers to a value or level of a biomarker in a biological sample that is lower than a value or level range of a biomarker detected in a biological sample obtained from a healthy or normal individual or a subject to be compared.

본 명세서에서 상기 엑소좀 miRNA의 발현 수준을 언급하면서 사용되는 용어 "고발현"은 바이오 마커가 비정상 프로세스, 질환 혹은 개체 내 기타 병태를 나타내거나 이의 징후인 경우, 건강하거나 정상인 개체 또는 비교 대상인 개체로부터 획득된 생물학적 시료에서 검출되는 바이오 마커의 값 혹은 수준 범위 보다 높은 생물학적 시료 내의 바이오 마커의 값 혹은 수준을 지칭한다.The term "high expression" used while referring to the expression level of the exosomal miRNA in the present specification is when the biomarker indicates or is a symptom of an abnormal process, disease, or other condition within the subject, from a healthy or normal subject or a subject for comparison Refers to a value or level of a biomarker in a biological sample that is higher than a value or level range of a biomarker detected in the obtained biological sample.

본 명세서에서 사용되는 용어 "생물학적 시료"란 본 발명의 miRNA 발현이 검출될 수 있는 개체로부터 얻어지는 모든 시료를 의미한다.As used herein, the term “biological sample” refers to any sample obtained from an individual in which the expression of miRNA of the present invention can be detected.

본 발명의 바람직한 구현예에 따르면, 상기 생물학적 시료는 혈액, 타액(saliva), 생검(biopsy), 피부 조직, 액체 배양물, 분변 및 소변으로 이루어진 군에서 선택된 어느 하나이며, 특별히 이에 제한되지 않으나 바람직하게는 혈액이며, 본 발명의 기술분야에서 통상적으로 사용되는 방법으로 처리하여 준비될 수 있다.According to a preferred embodiment of the present invention, the biological sample is any one selected from the group consisting of blood, saliva, biopsy, skin tissue, liquid culture, feces and urine, but is not particularly limited thereto. Preferably, it is blood, and it can be prepared by processing by a method commonly used in the art.

본 발명에서 상기 엑소좀은 신경 유래 엑소좀 일 수 있다.In the present invention, the exosome may be a nerve-derived exosome.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

<실시예: 1 재료 및 준비><Example: 1 Materials and Preparation>

실시예 1-1. 실험동물Example 1-1. laboratory animal

8 주령 수컷 Sprague-Dawley 래트에 온도, 습도 및 빛을 조절 하였다 (24 ± 2 °C, 50 ± 20 % 상대 습도, 12시간 명주기 / 12시간 암주기 (07:00에 불이 켜짐)). 동물들은 음식과 물에 자유롭게 접근할 수 있도록 하였으며, 모든 동물 실험 프로토콜은 한국 경기도 (KPC)의 기관 동물 관리 및 사용위원회 (KPC-IACUC; 승인 번호 P181112)에 의해 검토되고 승인되었으며, 지침에 따랐다.8-week-old male Sprague-Dawley rats were controlled for temperature, humidity and light (24 ± 2 °C, 50 ± 20 % relative humidity, 12 h light cycle / 12 h dark cycle (lights on at 07:00)). Animals had free access to food and water, and all animal testing protocols were reviewed and approved by the Institutional Animal Care and Use Committee (KPC-IACUC; Approval No. P181112) of Gyeonggi-do, Korea (KPC), and followed the guidelines.

실시예 1-2. 급성 고강도 스트레스 모델 프로토콜Example 1-2. Acute High Intensity Stress Model Protocol

전자 발충격을 사용하여 급성 고강도 스트레스를 유발시켰다. 스트레스 그룹을 20 분 동안 발충격 테스트에 노출시켰으며(8 초 지속; 5 분 간격, 총 4 회), 스트레스 유발로 부터 1 일, 3 일, 7 일에 동물을 희생시켰다(도 1). 이때, 동물을 3 % 이소플루란으로 마취하여 통증을 최소화하고 혈액을 복부 정맥에서 채취하였다.Electromagnetic shock was used to induce acute high intensity stress. The stress group was exposed to the paw shock test for 20 min (8 sec duration; 5 min interval, 4 total times), and the animals were sacrificed on days 1, 3, and 7 from stress induction (Fig. 1). At this time, the animal was anesthetized with 3% isoflurane to minimize pain and blood was collected from the abdominal vein.

실시예 1-3. ELISA 분석Examples 1-3. ELISA analysis

혈액은 스트레스 유도로부터 0 시간, 2 시간, 4 시간, 6 시간, 9 시간, 18 시간, 20 시간, 1 일(24 시간), 3 일, 7 일에 수집되었다. 혈액으로부터 분리된 혈청은 ELISA를 이용하여 스트레스 관련 호르몬 수준을 측정하는데 사용되었다. 코티솔 및 코르티코스테론은 제조사의 지시에 따라 코티콜 ELISA 키트 및 코르티 코스테론 ELISA 키트 (Enzo Life Sciences, Ann Arbor, USA)를 사용하여 측정되었다.Blood was collected at 0 hours, 2 hours, 4 hours, 6 hours, 9 hours, 18 hours, 20 hours, 1 day (24 hours), 3 days, 7 days from stress induction. Serum isolated from blood was used to measure stress-related hormone levels using ELISA. Cortisol and corticosterone were measured using a corticosterone ELISA kit and a corticosterone ELISA kit (Enzo Life Sciences, Ann Arbor, USA) according to the manufacturer's instructions.

실시예 1-4. 조직병리학Examples 1-4. histopathology

뇌 샘플을 10 % 중성 완충 포르말린에 고정시켰다. 고정 후, 조직을 탈수시키고, 제거하고, 파라핀에 포매시켰다. 뇌 파라핀 블록으로부터 섹션을 4 ㎛의 두께로 절단하였다. 그리고 헤마톡실린 및 에오신(H&E) 염색은 DAKO CoverStainer (Agilent, 미국 캘리포니아 산타 클라라 소재)를 사용하여 수행하였다. Brain samples were fixed in 10% neutral buffered formalin. After fixation, the tissue was dehydrated, removed and embedded in paraffin. Sections were cut from brain paraffin blocks to a thickness of 4 μm. And hematoxylin and eosin (H&E) staining was performed using a DAKO CoverStainer (Agilent, Santa Clara, CA, USA).

신경 염증 마커 단백질의 발현을 확인하기 위해, 면역 조직 화학 (immunohistochemistry, IHC)을 수행하였다. 뇌 절편을 항-BDNF (Abcam, Cambridge, UK), COX-2 (Abcam, Cambridge, UK), GFAP (Abcam, Cambridge, UK), TNF-α (Abcam, Cambridge, UK) 1차 항체로 염색하고 제조자의 지시에 따라 라벨링된 중합체 DAKO EnVisionTM + System-HRP를 사용하였다. 염색 후, 뇌절편을 Pannoramic SCAN II로 스캔 하였다. 해마에서 신경염증 마커를 Imaged J 소프트웨어를 사용하여 정량화 하였다.To confirm the expression of neuroinflammatory marker protein, immunohistochemistry (IHC) was performed. Brain sections were stained with anti-BDNF (Abcam, Cambridge, UK), COX-2 (Abcam, Cambridge, UK), GFAP (Abcam, Cambridge, UK), TNF-α (Abcam, Cambridge, UK) primary antibodies. The labeled polymer DAKO EnVision™ + System-HRP was used according to the manufacturer's instructions. After staining, the brain sections were scanned with Pannoramic SCAN II. Neuroinflammatory markers in the hippocampus were quantified using Imaged J software.

실시예 1-5. 엑소좀 및 신경 유래 엑소좀의 분리Examples 1-5. Isolation of exosomes and nerve-derived exosomes

엑소좀은 제조사의 지침을 수정하여 엑소-퀵솔루션을 사용하여 혈청으로부터 분리되었다. 세포 파편 제거를 위해 원심 분리한 후, 2 ml 혈청 및 500 μl 용액을 혼합하였다. 혼합물을 원심 분리한 후, 펠렛을 200 ㎕ PBS로 재현탁 시켰다. Exosomes were isolated from serum using the exo-quick solution by modifying the manufacturer's instructions. After centrifugation to remove cell debris, 2 ml serum and 500 μl solution were mixed. After centrifugation of the mixture, the pellet was resuspended in 200 μl PBS.

신경 유래 엑소좀의 분리는 종래 언급된 방법(Mustapic, Maja, and et al)에 수정을 가하여 수행하였다. 혈청 200 ㎕로부터 분리된 엑소좀을 회전 혼합기에서 4 ℃에서 1시간 동안 anti-CD171 2㎕와 함께 인큐베이션 하였다. 15 μl PierceTM streptavidin plus UltralinkTM 수지 및 28μl PBS를 첨가한 후, 샘플을 회전 믹서에서 4 ℃로 1 시간 동안 배양하였다. 샘플을 4 ℃에서 10 분 동안 200 x g에서 원심 분리하여 펠렛화한 다음, 상청액을 샘플로부터 제거하고 상기 펠렛을 200 μl 0.1M 글리신-HCl에 재현탁 시켰다. 그 다음, 10초 동안 혼합하고 30초 동안 볼텍싱 한 후, 4 ℃에서 10 분 동안 4500 x g에서 원심 분리하여 샘플을 펠렛화 하였다. 상청액을 새로운 튜브로 옮기고 15 μl Tris-HCl을 첨가하였다. 이어서, 25 μl PBS를 첨가하였다.Isolation of nerve-derived exosomes was performed with modifications to the previously mentioned method (Mustapic, Maja, and et al). Exosomes isolated from 200 μl of serum were incubated with 2 μl of anti-CD171 for 1 hour at 4° C. in a rotary mixer. After addition of 15 μl Pierce™ streptavidin plus Ultralink™ resin and 28 μl PBS, the samples were incubated in a rotary mixer at 4° C. for 1 hour. Samples were pelleted by centrifugation at 200 x g for 10 min at 4 °C, then the supernatant was removed from the samples and the pellet resuspended in 200 μl 0.1M glycine-HCl. Samples were then pelleted by mixing for 10 s and vortexing for 30 s, followed by centrifugation at 4500 x g for 10 min at 4 °C. The supernatant was transferred to a new tube and 15 μl Tris-HCl was added. Then 25 μl PBS was added.

실시예 1-6. 유세포 분석Example 1-6. flow cytometry

혈청으로부터 분리된 50 ㎕ 엑소좀을 10 ㎕의 알데히드 / 설페이트 라텍스 비드와 함께 실온에서 15 분 동안 배양하였다. 3 % BSA 보충된 500 ㎕ PBS를 첨가한 다음, 샘플을 회전 혼합기에서 밤새 인큐베이션 하였다. 비드 결합 엑소좀을 3000 x g에서 10분 동안 원심 분리하여 펠렛화하고, 500 μl PBS로 세척하였다. 이어서, 3000 x g에서 10분 동안 원심 분리하여 샘플을 펠릿화 하였다. 상청액을 샘플로부터 제거하고, 펠렛을 anti-CD9, CD63 항체 (BioLegend, San Diego, CA, USA)를 함유하는 50 μl의 PBS로 1 시간 동안 실온에서 재현탁시켰다. 그 다음 3000 x g에서 10분 동안 원심 분리하여 샘플을 펠렛화 하였으며, 펠렛을 200 μl의 PBS로 재현탁 시켰다. 엑소좀 마커의 검출은 유세포 분석기 Galios를 사용하여 수행되었다.50 μl exosomes isolated from serum were incubated with 10 μl of aldehyde/sulfate latex beads at room temperature for 15 minutes. 500 μl PBS supplemented with 3% BSA was added, then samples were incubated overnight on a rotary mixer. Bead-bound exosomes were pelleted by centrifugation at 3000 x g for 10 min, and washed with 500 μl PBS. The sample was then pelleted by centrifugation at 3000 x g for 10 min. The supernatant was removed from the sample, and the pellet was resuspended in 50 μl of PBS containing anti-CD9, CD63 antibody (BioLegend, San Diego, CA, USA) for 1 h at room temperature. Then, the sample was pelleted by centrifugation at 3000 x g for 10 minutes, and the pellet was resuspended in 200 μl of PBS. Detection of exosome markers was performed using a flow cytometer Galios.

실시예 1-7. 투과 전자 현미경 관찰Example 1-7. Transmission electron microscopy

혈청으로부터 분리된 엑소좀을 차가운 증류수에 재현탁 시켰다. 엑소좀 현탁액을 포름바 탄소 코팅 그리드에 로딩하고 2% 파라 포름알데히드에 10분 동안 고정시킨 다음, 용액을 제거하고 샘플을 건조시켰다. 그리드는 bioTEM에 의해 관찰되었다.Exosomes isolated from serum were resuspended in cold distilled water. The exosome suspension was loaded onto a Formbar carbon coated grid and fixed in 2% para-formaldehyde for 10 min, then the solution was removed and the sample dried. The grid was observed by bioTEM.

실시예 1-8. 동적 광산란 관찰Examples 1-8. Dynamic light scattering observation

Zeta Sizer Nano S를 사용하여 분리된 엑소좀의 크기를 측정하였다.The size of the isolated exosomes was measured using a Zeta Sizer Nano S.

실시예 1-9. 웨스턴 블롯Examples 1-9. western blot

웨스턴 블롯을 사용하여 엑소좀 마커 (CD9, CD81 및 TSG101), 신경 유래 엑소좀 마커 (CD171) 및 신경 마커 (TUJ1, NSE)를 확인하였다. M-PER 및 HaltTM 프로테아제 및 포스파타제 인히비터 칵테일 (Thermo Scientific)을 용해를 위해 혈청으로부터 분리된 각각의 총 엑소좀 (tEV) 및 신경 유래 엑소좀 (nEV)에 첨가하였다. 샘플 농도는 제조사의 지시에 따라 PierceTM BCA 단백질 분석 키트를 사용하여 측정하였다. 20 μg의 엑소좀 용해물을 BoltTM 4-12 % Bis-Tris Plus 겔에 로딩하고 polyvinylidene fluoride(PVDF) 막으로 옮겼다. 이어서, 막을 실온에서 1.5 시간 동안 5 % skim milk로 보충된 TBS-T로 차단하였다. 그 다음, 상기 막을 anti-CD9 (1:1000; NovusBio, USA), CD81 (1:1000; NovusBio, USA), TSG101 (1:1000; NovusBio, USA), CD171(1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA), TUJ1 (1:1000; Abcam, Cambridge, UK), NSE (1:1000; Abcam, Cambridge, UK) 일차 항체와 함께 4 ℃에서 밤새 인큐베이션 하였다. 그 다음, 막을 TBS-T로 세척한 후, horseradish peroxidase (HRP)-접합된 이차 항체 (1 : 2000 희석)와 함께 실온에서 1 시간 동안 배양하였다. 반응 후, 막을 TBS-T로 세척하였다. 밴드는 Image QuantTM LAS 4000 (GE Healthcare, UK)을 사용하여 EzWestLumi plus로 확인하였다.Western blot was used to identify exosomal markers (CD9, CD81 and TSG101), neuronal exosomal markers (CD171) and neuronal markers (TUJ1, NSE). M-PER and Halt™ protease and phosphatase inhibitor cocktails (Thermo Scientific) were added to each total exosomes (tEV) and neuronal derived exosomes (nEV) isolated from serum for lysis. Sample concentrations were determined using the Pierce BCA Protein Assay Kit according to the manufacturer's instructions. 20 μg of exosome lysate was loaded onto a Bolt TM 4-12 % Bis-Tris Plus gel and transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was then blocked with TBS-T supplemented with 5% skim milk for 1.5 h at room temperature. The membrane was then anti-CD9 (1:1000; NovusBio, USA), CD81 (1:1000; NovusBio, USA), TSG101 (1:1000; NovusBio, USA), CD171 (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA), TUJ1 (1:1000; Abcam, Cambridge, UK), and NSE (1:1000; Abcam, Cambridge, UK) were incubated with primary antibodies overnight at 4 °C. Then, the membrane was washed with TBS-T and incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (1:2000 dilution) at room temperature for 1 hour. After the reaction, the membrane was washed with TBS-T. Bands were identified with EzWestLumi plus using Image Quant™ LAS 4000 (GE Healthcare, UK).

실시예 1-10. 엑소좀의 miRNA 분석을 위한 차세대 시퀀싱(Next generation sequencing (NGS))Examples 1-10. Next generation sequencing (NGS) for miRNA analysis of exosomes

혈청으로부터 분리된 신경 유래 엑소좀을 풀링하여 샘플 900 ㎕를 제조하였다. 제조업체의 지침에 따라 PierceTM BCA 단백질 분석 키트 (Thermo Fisher Scientific)를 사용하여 농도를 측정하였다. BCA 분석에 의해 측정된 바와 같이, 각 샘플의 농도는 2.25 mg / ml (control), 1.66 mg / ml (severe)이다. 900 μl of sample was prepared by pooling neuronal-derived exosomes isolated from serum. Concentrations were determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. As determined by BCA analysis, the concentrations of each sample were 2.25 mg/ml (control), 1.66 mg/ml (severe).

엑소좀 mRNA 분리 및 라이브러리 준비는 제조사의 지시에 따라 SMARTer smRNA-Seq 키트를 사용하였으며 마크로젠에 의해 수행되었다. 그 다음 HiSeq 2500 시스템 사용 설명서에 따라 miRNA 시퀀싱을 수행하였다.Exosome mRNA isolation and library preparation were performed by Macrogen using the SMARTer smRNA-Seq kit according to the manufacturer's instructions. Then, miRNA sequencing was performed according to the HiSeq 2500 system instruction manual.

실시예 1-11. 통계 분석Examples 1-11. statistical analysis

모든 통계 분석은 Student 's t test를 사용하여 수행되었다. 통계적 유의성 값은 p <0.05로 설정되었다.All statistical analyzes were performed using Student's t test. Statistical significance values were set at p <0.05.

<실시예 2: 급성 고강도 스트레스 그룹에서 스트레스 호르몬 수치 확인><Example 2: Confirmation of stress hormone levels in acute high-intensity stress group>

급성 고강도 스트레스 유발 여부를 확인하기 위해 ELISA를 사용하여 혈청에서 코티솔 및 코르티코스테론 수준을 측정하였다. 혈액은 스트레스로 유도로부터 0 시간, 2 시간, 4 시간, 6 시간, 9 시간, 18 시간, 20 시간, 1 일 (24 시간), 3 일, 7 일에 수집되었다.To determine whether acute high-intensity stress was induced, cortisol and corticosterone levels were measured in serum using ELISA. Blood was collected at 0 hr, 2 hr, 4 hr, 6 hr, 9 hr, 18 hr, 20 hr, 1 day (24 hr), 3 hr, 7 hr from induction to stress.

그 결과, 대조군과 비교하여 급성 고강도 스트레스 군에서, 코티솔 수준이 상당한 증가하였음을 확인하였다(표 2 및 도 2a).As a result, it was confirmed that the level of cortisol was significantly increased in the acute high-intensity stress group compared to the control group (Table 2 and FIG. 2a).

시간time 실험군experimental group 대조군control P 값P value 0 h0 h 13.45±4.9113.45±4.91 4.21±0.414.21±0.41 p=0.00099p=0.00099 2 h2 h 8.82±2.458.82±2.45 4.36±0.854.36±0.85 p=0.0018p=0.0018 4 h4 h 9.77±2.699.77±2.69 4.56±0.924.56±0.92 p=0.0012p=0.0012 6 h6 h 7.36±1.837.36±1.83 4.99±0.854.99±0.85 p=0.016p=0.016 9 h9 h 9.67±2.259.67±2.25 5.4±1.335.4±1.33 p=0.0025p=0.0025 18 h18 h 6.37±2.666.37±2.66 2.51±0.572.51±0.57 p=0.0060p=0.0060 20 h20 h 11.24±4.3911.24±4.39 4.71±1.294.71 ± 1.29 p=0.0058p=0.0058 Day 1Day 1 10.08±4.4210.08±4.42 3.37±0.653.37±0.65 p=0.0043p=0.0043 Day 3Day 3 5.91±1.455.91±1.45 3.9±1.273.9±1.27 p=0.029p=0.029 Day 7Day 7 5.58±1.35.58±1.3 3.35±0.813.35±0.81 p=0.0051p=0.0051

코르티코스테론의 경우, 스트레스 노출로부터 0 시간 및 1 일째에 상당한 증가가 관찰되었고, 스트레스 유도로부터 6 시간에 현저한 감소가 확인되었다(표 3 및 도 2b).For corticosterone, a significant increase was observed at 0 h and 1 day from stress exposure, and a significant decrease was confirmed at 6 h from stress induction (Table 3 and Figure 2b).

시간time 실험군experimental group 대조군control P 값P value 0 h0 h 224.31±93.41224.31±93.41 82.88±62.3282.88±62.32 p=0.012p=0.012 2 h2 h 45.66±31.5845.66±31.58 75.28±38.1575.28±38.15 p=0.174p=0.174 4 h4 h 106.94±45.64106.94±45.64 94.71±68.7794.71±68.77 p=0.726p=0.726 6 h6 h 34.24±17.2234.24±17.22 105.91±68.10105.91±68.10 p=0.031p=0.031 9 h9 h 100.79±72.11100.79±72.11 94.66±60.0694.66±60.06 p=0.876p=0.876 18 h18 h 36.08±32.3836.08±32.38 20.84±19.6520.84±19.65 p=0.348p=0.348 20 h20 h 134.43±75.67134.43±75.67 87.40±76.7787.40±76.77 p=0.310p=0.310 Day 1Day 1 119.58±80.09119.58±80.09 19.73±13.3819.73±13.38 p=0.013p=0.013 Day 3Day 3 22.51±22.1722.51±22.17 68.79±73.1068.79±73.10 p=0.169p=0.169 Day 7Day 7 85.69±76.3585.69±76.35 65.22±35.1465.22±35.14 p=0.564p=0.564

상기 결과는 급성 고강도 스트레스 처리에 의해 마우스에 스트레스가 유발되었음을 의미한다.These results mean that stress was induced in mice by acute high-intensity stress treatment.

<실시예 3: 급성 고강도 스트레스 그룹 해마에서 신경 염증 마커 수준의 병리학적 분석><Example 3: Pathological analysis of neuroinflammation marker levels in the hippocampus of the acute high-intensity stress group>

급성 고강도 스트레스에 의한 신경 염증 마커 단백질 발현 수준 변화를 분석하기 위해, H&E 염색 및 IHC를 수행하였다. H&E 염색 결과, 스트레스 처리 1일, 3일 및 7일에 대조군과 고강도 스트레스를 처리한 그룹 비교시 해마에서 유의미한 차이는 없었다(도 3a).H&E staining and IHC were performed to analyze the change in the expression level of neuroinflammatory marker protein due to acute high-intensity stress. As a result of H&E staining, there was no significant difference in the hippocampus when comparing the control group and the group treated with high intensity stress on days 1, 3, and 7 of the stress treatment (FIG. 3a).

BDNF, COX-2, GFAP 및 TNF-α와 같은 신경 관련 염증 마커의 발현 수준을 확인하기 위해, IHC 염색을 수행한 후 정량화 하였다(도 3b). 그 결과 해마에서 BDNF 발현의 현저한 변화는 관찰되지 않았다(대조군 = 10.92 ± 2.21 %, 제 1 일 = 13.54 ± 4.59 %, p = 0.212; 제 3 일 = 6.60 ± 4.87 %, p = 0.117; 제 7 일 = 12.46 ± 1.43 %, p = 0.185). COX-2 발현 관련 유의미한 결과는 3 일 또는 7 일에 관찰되었다 (대조군 = 7.62 ± 0.71 %, 1 일 = 8.33 ± 1.34 %, p = 0.232; 3 일 = 10.75 ± 1.59 %, p = 0.018; 7 일 = 11.34 ± 1.51 %, p = 0.009). GFAP 발현 수준은 스트레스 노출로부터 1 일, 3 일, 7 일차에 크게 변화되었다 (대조군 = 14.66 ± 4.2 %, 1 일 = 22.43 ± 1.18 %, p = 0.018; 3 일 = 24.77 ± 1.82 %, p = 0.009; 7 일 = 26.36 ± 1.06 %, p = 0.005). 마지막으로, TNF-α 발현 수준은 7 일에 유의미하게 변화하였다 (대조군 = 0 %, 1 일 = 0 %; 3 일 = 0 %; 7 일 = 0.60 ± 0.47 %, p = 0.0003).To determine the expression levels of neuronal-related inflammatory markers such as BDNF, COX-2, GFAP and TNF-α, IHC staining was performed and then quantified ( FIG. 3b ). As a result, no significant change in BDNF expression was observed in the hippocampus (control = 10.92 ± 2.21%, day 1 = 13.54 ± 4.59%, p = 0.212; day 3 = 6.60 ± 4.87%, p = 0.117; day 7) = 12.46 ± 1.43%, p = 0.185). Significant results related to COX-2 expression were observed at day 3 or 7 (control = 7.62 ± 0.71%, day 1 = 8.33 ± 1.34%, p = 0.232; day 3 = 10.75 ± 1.59%, p = 0.018; day 7) = 11.34 ± 1.51%, p = 0.009). GFAP expression levels changed significantly on days 1, 3, and 7 from stress exposure (control = 14.66 ± 4.2%, day 1 = 22.43 ± 1.18%, p = 0.018; day 3 = 24.77 ± 1.82%, p = 0.009) ; 7 days = 26.36 ± 1.06%, p = 0.005). Finally, TNF-α expression levels were significantly changed at 7 days (control = 0%, day 1 = 0%; day 3 = 0%; day 7 = 0.60 ± 0.47%, p = 0.0003).

상기 결과는 고강도 스트레스가 해마에 손상을 유발할 수 있음을 의미한다.These results suggest that high-intensity stress can cause damage to the hippocampus.

<실시예 4: 혈청에서 분리한 엑소좀의 특성 확인><Example 4: Confirmation of characteristics of exosomes isolated from serum>

신경 유래 엑소좀이 분리되기 전에 혈청으로부터 분리된 총 엑소좀의 특성을 확인하였다. 먼저, 엑소좀 마커인 CD9, CD63 및 TSG101의 존재를 확인하기 위해 형광 활성화 세포 분류 (fluorescence-activated cell sorting, FACS) 및 웨스턴 블로팅을 수행하였다. FACS 결과 CD9, CD63과 같은 테트라스파닌이 엑소좀에 존재함을 보여주었다(도 4a). 또한, 웨스턴 블롯팅 결과 테트라스파닌 뿐만 아니라 TSG101의 존재를 확인하였다(도 4b). Before the nerve-derived exosomes were separated, the characteristics of total exosomes isolated from serum were confirmed. First, to confirm the presence of exosome markers CD9, CD63 and TSG101, fluorescence-activated cell sorting (FACS) and Western blotting were performed. FACS results showed that tetraspanins such as CD9 and CD63 were present in exosomes (FIG. 4a). In addition, as a result of western blotting, the presence of TSG101 as well as tetraspanin was confirmed (FIG. 4b).

또한, 투과형 전자 현미경(transmission electron microscope, TEM)을 사용하여 엑소좀의 모양과 크기를 확인했다. TEM 이미지는 혈청으로부터 분리된 엑소좀이 구형 이중층 막이고 직경이 30-150nm 범위임을 보여주었다 (도 4c).In addition, the shape and size of the exosomes were confirmed using a transmission electron microscope (TEM). TEM images showed that exosomes isolated from serum were spherical bilayer membranes and ranged in diameter from 30-150 nm (Fig. 4c).

마지막으로, 엑소좀의 크기를 확인하기 위해 동적 광산란 (dynamic light scattering, DLS)을 수행한 결과 엑소좀의 크기가 30-150 nm 범위에 있음을 확인하였다(도 4d).Finally, as a result of performing dynamic light scattering (DLS) to confirm the size of the exosome, it was confirmed that the size of the exosome was in the range of 30-150 nm (Fig. 4d).

<실시예 5: 신경 세포 유래 엑소좀의 특성 확인><Example 5: Confirmation of characteristics of nerve cell-derived exosomes>

총 엑소좀의 분리 후, 면역 침전을 위해 anti-L1 세포 부착 분자 (L1CAM, CD171) 비오티닐화된 항체(biotinylated antibody)를 사용하여 신경 유래 엑소좀의 분리를 수행하였다. 그 다음 웨스턴 블롯팅을 통해 신경 유래 엑소좀의 특성을 분석하였다(도 5a). After isolation of total exosomes, isolation of neuronal-derived exosomes was performed using an anti-L1 cell adhesion molecule (L1CAM, CD171) biotinylated antibody for immunoprecipitation. Then, the characteristics of the nerve-derived exosomes were analyzed by Western blotting (FIG. 5a).

웨스턴 블롯 결과 신경 유래 엑소좀에 존재하는 TUJ1, NSE 같은 신경 마커는 혈청으로부터 분리된 신경 유래 엑소좀 (nEV)에 있고 총 엑소좀 (tEV)에서는 거의 확인되지 않았다(도 5b).As a result of Western blot, neural markers such as TUJ1 and NSE present in the neuronal exosomes were found in the neuronal exosomes (nEV) isolated from the serum, but were hardly identified in the total exosomes (tEV) (Fig. 5b).

<실시예 6: 스트레스에 의해 유도된 엑소좀 내 miRNA 발현 변화><Example 6: Changes in miRNA expression in exosomes induced by stress>

스트레스에 의해 변화된 miRNA 발현 패턴을 확인하기 위해 차세대 시퀀싱 (NGS)을 수행하였다. 그 결과, 대조군과 비교해 13 개의 상향 조절된 miRNA 및 11 개의 하향 조절된 miRNA를 확인하였다(도 6, 표 4 및 표 5).Next-generation sequencing (NGS) was performed to confirm the miRNA expression pattern changed by stress. As a result, compared with the control group, 13 up-regulated miRNAs and 11 down-regulated miRNAs were identified ( FIG. 6 , Tables 4 and 5).

Figure pat00001
Figure pat00001

Figure pat00002
Figure pat00002

상기 결과는, 급성 고강도 스트레스하에 발현된 신경 유래 엑소좀으로부터 유래된 특정 miRNA의 엑소좀은 스트레스 관련 바이오 마커로서 사용될 수 있음을 의미한다.These results suggest that exosomes of specific miRNAs derived from nerve-derived exosomes expressed under acute high-intensity stress can be used as stress-related biomarkers.

<110> Daegu-Gyeongbuk Medical Innovation Foundation Kyungpook National University Industry-Academic Cooperation Foundation <120> Stress diagnosis technology using exosome-derived miRNA <130> P200257 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> let-7a-1-3p <400> 1 cuauacaauc uacugucuuu cc 22 <210> 2 <211> 22 <212> RNA <213> let-7a-5p <400> 2 ugagguagua gguuguauag uu 22 <210> 3 <211> 22 <212> RNA <213> let-7b-3p <400> 3 cuauacaacc uacugccuuc cc 22 <210> 4 <211> 22 <212> RNA <213> let-7b-5p <400> 4 ugagguagua gguugugugg uu 22 <210> 5 <211> 22 <212> RNA <213> let-7c-2-3p <400> 5 cuauacaauc uacugucuuu cc 22 <210> 6 <211> 22 <212> RNA <213> let-7c-5p <400> 6 ugagguagua gguuguaugg uu 22 <210> 7 <211> 22 <212> RNA <213> let-7d-3p <400> 7 cuauacgacc ugcugccuuu cu 22 <210> 8 <211> 21 <212> RNA <213> let-7f-1-3p <400> 8 cuauacaauc uauugccuuc c 21 <210> 9 <211> 22 <212> RNA <213> let-7f-5p <400> 9 ugagguagua gauuguauag uu 22 <210> 10 <211> 21 <212> RNA <213> miR-126a-5p <400> 10 cauuauuacu uuugguacgc g 21 <210> 11 <211> 22 <212> RNA <213> miR-3473 <400> 11 ucuagggcug gagagauggc ua 22 <210> 12 <211> 22 <212> RNA <213> miR-466b-3p <400> 12 auacauacac acacacauac ac 22 <210> 13 <211> 21 <212> RNA <213> miR-98-3p <400> 13 cuauacaacu uacuacuuuc c 21 <210> 14 <211> 22 <212> RNA <213> let-7d-5p <400> 14 agagguagua gguugcauag uu 22 <210> 15 <211> 22 <212> RNA <213> let-7g-5p <400> 15 ugagguagua guuuguacag uu 22 <210> 16 <211> 22 <212> RNA <213> let-7i-5p <400> 16 ugagguagua guuugugcug uu 22 <210> 17 <211> 21 <212> RNA <213> miR-140-3p <400> 17 uaccacaggg uagaaccacg g 21 <210> 18 <211> 23 <212> RNA <213> miR-17-5p <400> 18 caaagugcuu acagugcagg uag 23 <210> 19 <211> 23 <212> RNA <213> miR-191a-5p <400> 19 caacggaauc ccaaaagcag cug 23 <210> 20 <211> 23 <212> RNA <213> miR-19b-3p <400> 20 ugugcaaauc caugcaaaac uga 23 <210> 21 <211> 22 <212> RNA <213> miR-24-3p <400> 21 uggcucaguu cagcaggaac ag 22 <210> 22 <211> 23 <212> RNA <213> miR-30c-5p <400> 22 uguaaacauc cuacacucuc agc 23 <210> 23 <211> 23 <212> RNA <213> miR-425-5p <400> 23 aaugacacga ucacucccgu uga 23 <210> 24 <211> 22 <212> RNA <213> miR-93-5p <400> 24 ugagguagua gguugugugg uu 22 <110> Daegu-Gyeongbuk Medical Innovation Foundation Kyungpook National University Industry-Academic Cooperation Foundation <120> Stress diagnosis technology using exosome-derived miRNA <130> P200257 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> let-7a-1-3p <400> 1 cuauacaauc uacugucuuu cc 22 <210> 2 <211> 22 <212> RNA <213> let-7a-5p <400> 2 ugagguagua gguuguauag uu 22 <210> 3 <211> 22 <212> RNA <213> let-7b-3p <400> 3 cuauacaacc uacugccuuc cc 22 <210> 4 <211> 22 <212> RNA <213> let-7b-5p <400> 4 ugagguagua gguugugugg uu 22 <210> 5 <211> 22 <212> RNA <213> let-7c-2-3p <400> 5 cuauacaauc uacugucuuu cc 22 <210> 6 <211> 22 <212> RNA <213> let-7c-5p <400> 6 ugagguagua gguuguaugg uu 22 <210> 7 <211> 22 <212> RNA <213> let-7d-3p <400> 7 cuauacgacc ugcugccuuu cu 22 <210> 8 <211> 21 <212> RNA <213> let-7f-1-3p <400> 8 cuauacaauc uauugccuuc c 21 <210> 9 <211> 22 <212> RNA <213> let-7f-5p <400> 9 ugagguagua gauuguauag uu 22 <210> 10 <211> 21 <212> RNA <213> miR-126a-5p <400> 10 cauuauuacu uuugguacgc g 21 <210> 11 <211> 22 <212> RNA <213> miR-3473 <400> 11 ucuagggcug gagagauggc ua 22 <210> 12 <211> 22 <212> RNA <213> miR-466b-3p <400> 12 auacauacac acacacauac ac 22 <210> 13 <211> 21 <212> RNA <213> miR-98-3p <400> 13 cuauacaacu uacuacuuuc c 21 <210> 14 <211> 22 <212> RNA <213> let-7d-5p <400> 14 agagguagua gguugcauag uu 22 <210> 15 <211> 22 <212> RNA <213> let-7g-5p <400> 15 ugagguagua guuuguacag uu 22 <210> 16 <211> 22 <212> RNA <213> let-7i-5p <400> 16 ugagguagua guuugugcug uu 22 <210> 17 <211> 21 <212> RNA <213> miR-140-3p <400> 17 uaccacaggg uagaaccacg g 21 <210> 18 <211> 23 <212> RNA <213> miR-17-5p <400> 18 caaagugcuu acagugcagg uag 23 <210> 19 <211> 23 <212> RNA <213> miR-191a-5p <400> 19 caacggaauc ccaaaagcag cug 23 <210> 20 <211> 23 <212> RNA <213> miR-19b-3p <400> 20 ugugcaaauc caugcaaaac uga 23 <210> 21 <211> 22 <212> RNA <213> miR-24-3p <400> 21 uggcucaguu cagcaggaac ag 22 <210> 22 <211> 23 <212> RNA <213> miR-30c-5p <400> 22 uguaaacauc cuacacucuc agc 23 <210> 23 <211> 23 <212> RNA <213> miR-425-5p <400> 23 augacacga ucacucccgu uga 23 <210> 24 <211> 22 <212> RNA <213> miR-93-5p <400> 24 ugagguagua gguugugugg uu 22

Claims (7)

let-7a-1-3p(서열번호 1), let-7a-5p(서열번호 2), let-7b-5p(서열번호 4), let-7c-2-3p(서열번호 5), let-7c-5p(서열번호 6), let-7d-3p(서열번호 7), let-7f-1-3p(서열번호 8), let-7f-5p(서열번호 9), miR-126a-5p(서열번호 10), miR-3473(서열번호 11) 및 miR-466b-3p(서열번호 12)로 이루어진 군으로부터 선택되는 어느 하나 이상의 엑소좀 유래 miRNA의 발현 수준을 측정하는 제제를 포함하는, 스트레스 진단용 조성물.let-7a-1-3p (SEQ ID NO: 1), let-7a-5p (SEQ ID NO: 2), let-7b-5p (SEQ ID NO: 4), let-7c-2-3p (SEQ ID NO: 5), let- 7c-5p (SEQ ID NO: 6), let-7d-3p (SEQ ID NO: 7), let-7f-1-3p (SEQ ID NO: 8), let-7f-5p (SEQ ID NO: 9), miR-126a-5p ( SEQ ID NO: 10), miR-3473 (SEQ ID NO: 11) and miR-466b-3p (SEQ ID NO: 12) comprising an agent for measuring the expression level of any one or more exosome-derived miRNAs selected from the group consisting of, for stress diagnosis composition. 제1항에 있어서, 상기 엑소좀은 신경 유래 엑소좀인 것인, 스트레스 진단용 조성물.The composition for diagnosing stress according to claim 1, wherein the exosome is a nerve-derived exosome. 제1항에 있어서, 상기 제제는 상기 하나 이상의 엑소좀 유래 miRNA에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 것인, 스트레스 진단용 조성물.The composition for diagnosing stress according to claim 1, wherein the agent comprises a primer or probe that specifically binds to the one or more exosome-derived miRNAs. (a) 개체의 생물학적 시료로부터 엑소좀을 분리하는 단계; 및
(b) 상기 (a)단계에서 분리된 엑소좀에서 유래한 let-7a-1-3p(서열번호 1), let-7a-5p(서열번호 2), let-7b-5p(서열번호 4), let-7c-2-3p(서열번호 5), let-7c-5p(서열번호 6), let-7d-3p(서열번호 7), let-7f-1-3p(서열번호 8), let-7f-5p(서열번호 9), miR-126a-5p(서열번호 10), miR-3473(서열번호 11) 및 miR-466b-3p(서열번호 12)로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA의 발현 수준을 대조군 시료의 해당 엑소좀 유래 miRNA의 발현 수준과 비교하는 단계를 포함하는, 스트레스 진단을 위한 정보제공 방법.
(a) isolating the exosomes from the biological sample of the subject; and
(b) let-7a-1-3p (SEQ ID NO: 1), let-7a-5p (SEQ ID NO: 2), let-7b-5p (SEQ ID NO: 4) derived from the exosome isolated in step (a) , let-7c-2-3p (SEQ ID NO: 5), let-7c-5p (SEQ ID NO: 6), let-7d-3p (SEQ ID NO: 7), let-7f-1-3p (SEQ ID NO: 8), let Any one or more miRNAs selected from the group consisting of -7f-5p (SEQ ID NO: 9), miR-126a-5p (SEQ ID NO: 10), miR-3473 (SEQ ID NO: 11) and miR-466b-3p (SEQ ID NO: 12) A method for providing information for diagnosing stress, comprising comparing the expression level of the control sample with the expression level of the corresponding exosome-derived miRNA of the control sample.
제4항에 있어서, 상기 생물학적 시료는 혈액, 타액(saliva), 생검(biopsy), 피부 조직, 액체 배양물, 분변 및 소변으로 이루어진 군에서 선택된 어느 하나인 것인, 스트레스 진단을 위한 정보제공 방법.The method of claim 4, wherein the biological sample is any one selected from the group consisting of blood, saliva, biopsy, skin tissue, liquid culture, feces, and urine. . 제4항에 있어서, 상기 엑소좀은 신경 유래 엑소좀인 것인, 스트레스 진단을 위한 정보제공 방법.The method of claim 4, wherein the exosome is a nerve-derived exosome. 제4항에 있어서, 상기 (b)단계에서 측정되는 개체의 let-7a-1-3p(서열번호 1), let-7a-5p(서열번호 2), let-7b-5p(서열번호 4), let-7c-2-3p(서열번호 5), let-7c-5p(서열번호 6), let-7d-3p(서열번호 7), let-7f-1-3p(서열번호 8), let-7f-5p(서열번호 9), miR-126a-5p(서열번호 10), miR-3473(서열번호 11), 및 miR-466b-3p(서열번호 12)로 이루어진 군으로부터 선택되는 어느 하나 이상의 miRNA의 발현 수준이 대조군 시료의 해당 엑소좀 유래 miRNA의 발현 수준에 비해 고발현인 경우 상기 개체는 스트레스 상태인 것으로 판정하는 단계를 더 포함하는, 스트레스 진단을 위한 정보제공 방법.The method according to claim 4, wherein let-7a-1-3p (SEQ ID NO: 1), let-7a-5p (SEQ ID NO: 2), let-7b-5p (SEQ ID NO: 4) of the individual measured in step (b) , let-7c-2-3p (SEQ ID NO: 5), let-7c-5p (SEQ ID NO: 6), let-7d-3p (SEQ ID NO: 7), let-7f-1-3p (SEQ ID NO: 8), let Any one or more selected from the group consisting of -7f-5p (SEQ ID NO: 9), miR-126a-5p (SEQ ID NO: 10), miR-3473 (SEQ ID NO: 11), and miR-466b-3p (SEQ ID NO: 12) When the expression level of miRNA is high compared to the expression level of the corresponding exosome-derived miRNA of the control sample, the method further comprising the step of determining that the subject is in a stress state, information providing method for diagnosing stress.
KR1020220044688A 2020-06-11 2022-04-11 Stress diagnosis technology using exosome-derived miRNA KR20220049503A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020220044688A KR20220049503A (en) 2020-06-11 2022-04-11 Stress diagnosis technology using exosome-derived miRNA

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
KR1020200070904A KR102348806B1 (en) 2020-06-11 2020-06-11 Stress diagnosis technology using exosome-derived miRNA
KR1020220000299A KR102389340B1 (en) 2020-06-11 2022-01-03 Stress diagnosis technology using exosome-derived miRNA
KR1020220044688A KR20220049503A (en) 2020-06-11 2022-04-11 Stress diagnosis technology using exosome-derived miRNA

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020220000299A Division KR102389340B1 (en) 2020-06-11 2022-01-03 Stress diagnosis technology using exosome-derived miRNA

Publications (1)

Publication Number Publication Date
KR20220049503A true KR20220049503A (en) 2022-04-21

Family

ID=78846302

Family Applications (3)

Application Number Title Priority Date Filing Date
KR1020200070904A KR102348806B1 (en) 2020-06-11 2020-06-11 Stress diagnosis technology using exosome-derived miRNA
KR1020220000299A KR102389340B1 (en) 2020-06-11 2022-01-03 Stress diagnosis technology using exosome-derived miRNA
KR1020220044688A KR20220049503A (en) 2020-06-11 2022-04-11 Stress diagnosis technology using exosome-derived miRNA

Family Applications Before (2)

Application Number Title Priority Date Filing Date
KR1020200070904A KR102348806B1 (en) 2020-06-11 2020-06-11 Stress diagnosis technology using exosome-derived miRNA
KR1020220000299A KR102389340B1 (en) 2020-06-11 2022-01-03 Stress diagnosis technology using exosome-derived miRNA

Country Status (2)

Country Link
KR (3) KR102348806B1 (en)
WO (1) WO2021251656A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7406059B1 (en) 2022-10-20 2023-12-27 防衛装備庁長官 How to generate data for acute stress assessment

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160042703A (en) 2014-10-10 2016-04-20 서울대학교산학협력단 Composition for diagnosis of excercise stress and use thereof

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201302468D0 (en) * 2013-02-12 2013-03-27 Reneuron Ltd Stem cell product
CA2946720A1 (en) * 2014-04-22 2015-10-29 The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. Methods, processes, devices and kits for the measurement of post traumatic stress disorder microrna markers
CN104975093B (en) * 2015-07-10 2017-12-12 浙江省农业科学院 Applications of the serum ssc miR 215 as detection intestine of young pigs stress damage molecular marked compound
US9933440B2 (en) * 2016-05-31 2018-04-03 Edward J. Goetzl Drug efficacy test method for dementias utilizing astrocyte-derived exosomes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160042703A (en) 2014-10-10 2016-04-20 서울대학교산학협력단 Composition for diagnosis of excercise stress and use thereof

Also Published As

Publication number Publication date
KR102389340B1 (en) 2022-04-21
KR20220008929A (en) 2022-01-21
KR20210153942A (en) 2021-12-20
WO2021251656A1 (en) 2021-12-16
KR102348806B1 (en) 2022-01-07

Similar Documents

Publication Publication Date Title
US20220098678A1 (en) Biomarkers of Cancer
JP5934726B2 (en) Method for analyzing the presence of disease markers in a blood sample of a subject
KR20080016789A (en) Identification of molecular diagnostic markers for endometriosis in blood lymphocytes
CN102105585A (en) Method for detecting or quantifying DNA
WO2017136508A1 (en) Dissociation of human tumor to single cell suspension followed by biological analysis
KR102389340B1 (en) Stress diagnosis technology using exosome-derived miRNA
CN107937512A (en) For diagnosing serum microRNA markers, primer sets and application and the kit of recurrent miscarriage
JP2002505118A (en) Novel method for detection and monitoring of endometrial and uterine cancer
KR102531451B1 (en) Atopic dermatitis-associated stress diagnosis technology using exosome-derived miRNA
KR102328932B1 (en) Urinary exosome-derived biomarkers for diagnosis or prognosis of antibody-mediated rejection in kidney allografts
KR102592433B1 (en) Marker for prognosing extranodal nk/t-cell lymphoma, extranodal nk/t-cell lymphoma prognostic kit comprising the same and method for prognosing extranodal nk/t-cell lymphoma
KR101704828B1 (en) Method for diagnosing inflammatory diseases through analysis of protein or gene of extracellular vesicle in a body fluid
CN108034707B (en) SPAG7 gene is preparing the application in diagnosis of dementia preparation
JP2013535688A (en) Methods and kits for tolerance diagnosis and / or prognosis in liver transplantation
TWI598444B (en) Method and gene marker for assessing risk of suffering breast cancer
WO2012162049A2 (en) Methods and compositions for measuring radiation exposure in a subject
JP2010502179A (en) Prognosis method
KR102347899B1 (en) Urinary exosome-derived biomarkers for diagnosis or prognosis of BK virus-associated nephropathy in kidney allografts
CN111518897A (en) Molecular marker and application thereof
US20120004122A1 (en) Diagnostic Marker for Migraine and Use Thereof
KR20180099123A (en) Biomarker for predicting resistance to anticancer agent
KR20230020820A (en) Biomarkers for diagnosing breast cancer and uses thereof
US20230045066A1 (en) Biomarkers for diagnosing breast cancer and uses thereof
JP2005102694A (en) Group of genes differentially expressed in peripheral blood cells and diagnostic method and assay method using the same
CN117778558A (en) Application of IGFBP3 gene in preparation of related products for screening intrauterine adhesion

Legal Events

Date Code Title Description
A107 Divisional application of patent