KR20220048385A - Reverse transcriptase nested polymerase chain reaction for the detection of Aichivirus-A from water environment and positive control for confirmation of the false positive reaction - Google Patents

Abstract

The present invention provides a primer set for detecting Aichivirus-A (AiV-A), which can rapidly confirm AiV-A causing acute gastroenteritis in humans with high specificity and detection sensitivity, a detection kit, a detection method, a positive control group capable of distinguishing a false positive reaction, and uses thereof.

Description

A primer set for reverse transcriptase nested polymerase chain reaction for detection of Aichivirus-A in an aqueous environment and a positive control group capable of testing false-positive reactions {Reverse transcriptase nested polymerase chain reaction for the detection of Aichivirus-A from water environment and positive control for confirmation of the false positive reaction}

The present invention relates to a primer set for detecting Aichivirus-A and a detection kit comprising the same, and more particularly, to Aichivirus-A ( Aichivirus -A; AiV) that causes acute gastroenteritis in aquatic environments such as groundwater, drinking water, and non-sterile water. -A) relates to a primer set for a reverse-transcriptase nested polymerase chain reaction capable of rapidly detecting with high specificity and sensitivity, and a detection kit comprising the same.

In addition, the present invention relates to a PCR positive control group for detecting Aichi virus-A and a method for preparing the same, and more specifically, a PCR positive control group for detecting Aichi virus-A capable of distinguishing a false positive reaction due to PCR contamination. and to a method for manufacturing the same.

Water-borne foodborne diseases refer to all diseases caused by ingestion of water or food contaminated with pathogenic microorganisms (including viruses) or toxic substances. Waterborne food-borne diseases are known to be caused by inflammatory pathogens introduced through the oral cavity of the human body and multiply in the gastrointestinal tract, and mainly exhibit symptoms related to the gastrointestinal tract, such as abdominal pain, diarrhea, nausea, and vomiting. Norovirus, rotavirus, coxsackie virus, adenovirus, and Aichi virus-A have been reported as causative viruses of waterborne foodborne diseases prevalent in Korea.

Aichivirus-A is known as a virus first reported in 1989 in Aichi Prefecture, Japan. It is mainly related to infectious enteritis in children and shows symptoms of gastroenteritis such as diarrhea and abdominal pain. It is known that mixed infections with other waterborne viruses occur well, and cases of infection have been reported all over the world regardless of developed and underdeveloped countries.

Conventional Aichi virus-A diagnostic methods include reverse transcription polymerase chain reaction (RT-PCR), real-time quantitative polymerase chain reaction (RT-qPCR), and isothermal amplification ( Loop-mediated isothermal amplification (LAMP) is mainly used. In the case of RT-qPCR, the test takes a relatively short time compared to normal PCR, but the test cost is high and there is a technical limitation of amplifying a very short region for nucleotide sequence analysis. has difficulties In the case of LAMP, it has the advantage of being able to proceed at a single temperature and having a high possibility of field application, but there is a disadvantage that it is difficult to determine a positive sample because a false positive reaction appears well.

In addition, in the case of the examination method using an electron microscope, the presence of the virus can be confirmed, but there is a disadvantage in that the morphological analysis is difficult. In the case of enzyme immunoassay, it has the advantage of being able to distinguish viruses with similar clinical features, but it has disadvantages in that it is difficult to evaluate the proliferation and infectivity of the virus, and the accuracy is poor because false-negative results are reported.

Therefore, in the technical field to which the present invention pertains, there is a need to develop a technology capable of detecting Aichi virus-A with high specificity and sensitivity without the aforementioned problems.

On the other hand, it should be understood that the matters described as the above background art are only for improving understanding of the background of the present invention, and are not cited as an admission that they can be used as "prior art" of the present invention.

Saikruang et al., (2014). Molecular detection and characterization of Aichivirus A in adult patients with diarrhea in Thailand. J. Virol. Methods. 86; 983-987 Lodder et al., (2013). Aichi Virus in Sewage and Surface Water, the Netherlands. Emerging Infectious Diseases. 19; 1222-1230

An object of the present invention is to provide a reverse transcription nested PCR primer set that has high species specificity so as not to react with other viruses other than Aichi virus-A, and can detect Aichi virus-A with high detection sensitivity.

Another object of the present invention is an Aichi virus-A detection kit capable of rapidly and accurately detecting Aichi virus-A infection with high specificity and sensitivity using a reverse transcription nested PCR primer set capable of detecting Aichi virus-A and a detection method.

Another object of the present invention is to prepare a chimeric plasmid by cloning the Aichi virus-A gene substitution into pUC19 vector DNA comprising an ampicillin resistance gene and an ORI region gene (ori gene), , to provide a PCR-positive control group for detecting Aichi virus-A, which is capable of accurately detecting Aichi virus-A, and excellent in preventing false-positive reactions, by distinguishing false-positive reactions caused by PCR contamination, and a method for manufacturing the same.

However, the problems of the present invention as described above are exemplary, and the scope of the present invention is not limited thereby. Further, other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

As a result of repeated research to solve the technical problem of the invention and meet the object of the invention, the present inventors have high species specificity so as not to react with viruses other than Aichi virus-A, and have high detection sensitivity. The reverse transcription nested PCR primer set capable of detecting Aichi virus-A, and the Aichi virus- A detection kit and detection method have been devised.

As used herein, the term "specimen" refers to water-based environmental samples such as groundwater, drinking water, and non-sterilized water, contaminated food, feces of suspected infection patients, various secretions, and the like. However, the sample of the present invention is not limited thereto, and any sample in which RNA of Aichi virus-A can be detected as a variety of samples collected from an aquatic environment or food may be used in the present invention, of course.

As used herein, the term "gene sample" is used as a broad concept including RNA, DNA, cDNA generated from RNA by reverse transcriptase, DNA or cDNA amplified through pre-PCR (pre-PCR). . In addition, as used herein, "synthetic gene sequence" may consist of a cDNA sequence generated from an RNA gene as well as an RNA gene sequence of Aichivirus-A. Thus, the positive control of Ichivirus-A may consist of a cDNA sequence generated from RNA as well as an RNA sequence.

As used herein, the term "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a complementary template and base pair, and is a nucleic acid template strand refers to a short nucleic acid sequence that serves as a starting point for copying. The primer is capable of initiating DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature.

A technical feature of the present invention is to provide a PCR-positive control group for distinguishing between a false positive reaction and an RT-PCR primer set having a rapid and high detection sensitivity of Aichi virus-A, which can cause acute gastroenteritis, and a use thereof.

In the primer set for Aichi virus-A detection of the present invention, the forward primer is selected from the nucleotide sequences of SEQ ID NOs: 1 to 5, and the reverse primer is selected from the nucleotide sequences of SEQ ID NOs: 6 to SEQ ID NO: 11. However, in the primer combination of the present invention, the forward primer should be located on the 5' side rather than the reverse primer.

The present invention provides a reverse transcription nested PCR primer set for detecting Aichi virus-A.

The primer set for detecting Aichi virus-A of the present invention includes a primer set for reverse-transcriptase PCR (RT-PCR) consisting of a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 10, and a forward primer and sequence of SEQ ID NO: 2 A primer set for nested PCR consisting of the reverse primer of No. 7 is included.

The Aichi virus-A detection kit of one embodiment of the present invention includes the above-mentioned Aichi virus-A detection primer set.

Aichi virus-A detection kit of one embodiment of the present invention further includes a reverse transcription polymerase, a polymerase, dNTPs, and a PCR buffer.

In addition, the present invention provides a PCR positive control group for detecting Aichi virus-A.

In the PCR positive control for detecting Aichi virus-A in which the Aichi virus-A gene is inserted into a vector comprising an ampicillin resistance gene and an ORI region gene (ori gene), the Aichi virus-A gene is the The Aichi virus-A gene and the nucleotide sequence are partially different and the PCR amplification product is substituted with a large gene, but the Aichi virus-A gene and the nucleotide sequence are partially different from the nucleotide sequence and the PCR product size is large in the restriction enzyme recognition site. contains a nucleotide sequence.

In the positive control group for detecting Aichi virus-A of one embodiment of the present invention, the Aichi virus-A gene and the gene having a large nucleotide sequence and a large PCR product size further include the nucleotide sequence of GATATCGGCCTGCATGCGCA recognized by the restriction enzyme. include

In the positive control group for detecting Aichi virus-A of one embodiment of the present invention, the restriction enzyme may be at least one selected from the group consisting of EcoRV, HaeIII, HpyCH4V and FspI.

In the PCR positive control for Aichi virus-A detection of one embodiment of the present invention, the nucleotide sequence recognized by EcoRV is GATATC, the nucleotide sequence recognized by HaeIII is GGCC, the nucleotide sequence recognized by HpyCH4V is TGCA, and FspI is The recognized nucleotide sequence is TGCGCA.

In the positive control group for detecting Aichi virus-A of one embodiment of the present invention, the gene having a partially different nucleotide sequence from the Aichi virus-A gene and having a large PCR product is the forward primer of SEQ ID NO: 2 and SEQ ID NO: 10 The size of the RT-PCR amplification product by the RT-PCR primer set consisting of the reverse primers is 1,000 nt. Here, "nt" is a unit indicating the size of an oligonucleotide or polynucleotide, and corresponds to the number of bases constituting the oligonucleotide or polynucleotide.

In the positive control group for detecting Aichi virus-A of one embodiment of the present invention, the gene having a nucleotide sequence partially different from the Aichi virus-A gene and having a large PCR product is the forward primer of SEQ ID NO: 2 and SEQ ID NO: 7 The size of the nested PCR amplification product by the primer set for nested PCR consisting of reverse primers is 950 nt.

In the positive control group for detecting Aichi virus-A of one embodiment of the present invention, when the nested PCR amplification product is digested with EcoRV, it is divided into a 588 nt treated product and a 362 nt treated product.

In the positive control group for detecting Aichi virus-A of one embodiment of the present invention, the gene having a nucleotide sequence partially different from the Aichi virus-A gene and having a large PCR product size is a gene having the nucleotide sequence of SEQ ID NO: 20.

Aichi virus-A detection method of one embodiment of the present invention comprises the steps of (a) preparing a gene sample from a specimen, and (b) using a pair of a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 10. Performing RT-PCR (Reverse-transcriptase PCR) on the sample, (c) using a pair of the forward primer of SEQ ID NO: 2 and the reverse primer of SEQ ID NO: 7 to the RT-PCR product of step (b) It comprises the steps of amplifying the target sequence by performing nested PCR, (d) detecting the amplification product of step (c).

The method for detecting Aichi virus-A according to an embodiment of the present invention further includes (e) confirming whether or not false positives are caused by contamination of the PCR positive control for detecting Aichi virus-A.

In the Aichi virus-A detection method of one embodiment of the present invention, when the size of the amplification product of the nested PCR is 950 nt, it can be determined as false positive due to contamination of the Aichi virus-A detection PCR positive control group.

In the Aichi virus-A detection method of one embodiment of the present invention, when the nested PCR amplification product is digested with EcoRV, it is divided into a 588 nt processed product and a 362 nt processed product. PCR for detecting the Aichi virus-A It can be determined as a false positive due to contamination of the positive control group.

In the Aichi virus-A detection method of one embodiment of the present invention, the detection of the amplification product in step (d) is selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement and phosphorescence measurement. One or more methods may be used.

In the Aichi virus-A detection method of one embodiment of the present invention, the sample may be at least one type of aquatic environment sample selected from the group consisting of groundwater, drinking water, and non-sterilized water.

The primer set and detection kit for detecting Aichi virus-A of the present invention has high species specificity that does not react with other species other than Aichi virus-A, and has a high detection intensity. Aichi virus-A can also be detected in the sample. Accordingly, the primer set and detection kit for detecting Aichi virus-A of the present invention can rapidly and accurately detect Aichi virus-A infection with high specificity and sensitivity.

In addition, the Aichi virus-A detection method of the present invention enables accurate detection of Aichi virus-A by distinguishing false-positive reactions due to PCR contamination when using a PCR-positive control group, and minimizes the occurrence of false-positive reactions. accurate diagnosis is possible.

In addition, according to the detection kit and detection method comprising a primer set capable of detecting Aichi virus-A of the present invention, it is possible to accurately determine whether or not Aichi virus-A has been infected while having a high detection intensity, so that drinking water, sterilized water And it is possible to quickly and accurately monitor and treat in various aquatic environments such as non-sterile water.

On the other hand, these technical effects of the present invention are not limited only to the above-mentioned range, and even if not explicitly mentioned, it is the invention that can be recognized by those of ordinary skill in the art from the description of the specific content for the implementation of the invention to be described later. Effects are also included, of course.

1 is a result confirming the amplification of the Aichi virus-A gene using primer sets 1 to 28 for detecting Aichi virus-A.
2 is a result confirming the detection sensitivity for a primer set selected from among RT-PCR primers for detecting Aichi virus-A.
3 is a result confirming a non-specific reaction to set 20 among RT-PCR primers for detecting Aichi virus-A.
4 is a result of confirming the detection sensitivity for a primer set selected among nested PCR primers for detecting Aichi virus-A.
5 shows the result of performing RT-PCR using the RT-PCR primer pair of SEQ ID NOs: 2 and 10 for environmental samples (top), and additionally the nested PCR primer pairs of SEQ ID NOs: 2 and 7 Results (bottom) of performing nested PCR using
6 shows the results (detection sensitivity) of RT-PCR and nested PCR on an environmental sample using the primer set for detecting Aichi virus-A of the present invention, and the primer sets of Ref.2 and Ref.5 of the prior art. The results (detection sensitivity) of RT-PCR and nested PCR on environmental samples are compared and shown.
7 is a schematic diagram showing the total nucleotide sequence, restriction enzyme recognition site, and primer-specific sequence of the PCR positive control for Aichi virus-A detection of the present invention.
8 shows the results of RT-PCR of the PCR positive control for detecting Aichi virus-A of the present invention, the results of nested PCR, and the results of treatment with restriction enzymes for the nested PCR amplification products.

Hereinafter, with reference to the accompanying drawings and terms, preferred embodiments will be described in detail so that those of ordinary skill in the art to which the present invention pertains can easily practice the present invention. In consideration of the functions in the present invention, general terms currently widely used as possible have been selected, but this may vary depending on the intention or precedent of a person skilled in the art, the emergence of new technology, and the like. Also, in a specific case, there is a term arbitrarily selected by the applicant, and in this case, the meaning will be described in detail in the description of the corresponding invention.

However, the following examples are merely illustrative of the content of the present invention and do not limit or limit the scope of the present invention. What a person skilled in the art can easily infer from the detailed description and examples of the present invention is construed as belonging to the scope of the present invention. The references cited herein are incorporated herein by reference.

On the other hand, when 'including', 'having', 'consisting', etc. mentioned in the present invention are used, other parts may be added unless 'only' is used. When a component is expressed in the singular, cases including the plural are included unless otherwise explicitly stated. In interpreting the components, it is interpreted as including an error range even if there is no separate explicit description.

Example

Example 1: Collection of viral nucleic acids and construction of primers

1. Collection of viral nucleic acids

In order to confirm the specificity of the reverse transcription-polymerase chain reaction, the 3CD gene of Aichi virus-A (NCBI accession number NC_001918, 6,038-8,011) was synthesized, and 7 types of reference viruses [Astrovirus (AstV), Hepatitis A virus (HAV) were synthesized. , Hepatitis E virus (HEV), Norovirus GI (NoV GI), Novorius GII (NoV GII), Rotavirus (RV), Sapovirus (SV)] were collected.

2. Construction of Aichi virus-A specific primer

In order to diagnose Aichi virus-A through RT-PCR, primers were designed using Primer 3 and Oligocalc programs. A nucleotide letter code was used to prepare a primer with a wide range capable of detecting Aichi virus-A of various strains. In order for RT-PCR to react, two types of primers (forward primer and reverse primer) must be configured as one set. Aichi virus-A-specific primer sets (sets 1 to 28) were prepared by comparing the nucleotide sequences of the genes of 7 types of Aichi virus-A and reference virus collected as above.

Table 1 below shows the nucleotide sequences of primers for RT-PCR reaction (RT-PCR primers) designed according to an embodiment of the present invention. In addition, Tables 2 and 3 below show the nucleotide sequences of sets 1 to 28 of primers for RT-PCR reaction (RT-PCR primers) designed according to an embodiment of the present invention.

Aichi Virus-A Diagnostic Primer primer RT-PCR primer sequence
(5'→3') SEQ ID NO: Length position ^a division name forward NL_6261-F ACACYYCMACYTCMCGYCARTA One 22 6,261-6,282 NL_Sense2-F RTACAAGGAYATGCGGCG 2 18 6,280-6,297 NL_AiV-A_3CD-NF20 ACTGGNMTACTGGTYTCT 3 18 6,323-6,340 NL_C94b-NF GACTTCCCCGGAGTYGTCGTCT 4 22 6,398-6,419 NL_AiV-FY GACTTYCCMGGCTTNGTCGTBTG 5 23 6,398-6,420 reverse NL-Antisense2-R CCTTCGAAGGTCGCKGCRCGGTA 6 23 6,437-6,459 NL-Antisense1-R AGGATRGKRTGGAKRGGRGCRGAR 7 24 6,550-6,573 NL-AiV-RNKm-R GCRGAGAANCCACTCGARCCWGC 8 23 6,533-6,555 NL-AiV-RRY-R CGGTTSAYGTTSACGCCRGG 9 20 6,638-6,657 NL-246k-NR GACATCCGGTTGAYGTTGAC 10 20 6,644-6,663 NL-6779-R RGAARAGYTGGGTRTCMARA 11 20 6,760-6,779

^a The location was created based on Genebank accession number NC_001918.1.

RT-PCR and nested PCR primer sets for Aichivirus-A diagnostics primer location product (nt) note Combination division name set 1 forward NL_6261-F (SEQ ID NO: 1) 6,261-6,282 199 reverse NL-Antisense2-R (SEQ ID NO: 6) 6,437-6,459 set 2 forward NL_Sense2-F (SEQ ID NO: 2) 6,280-6,297 180 reverse NL-Antisense2-R (SEQ ID NO: 6) 6,437-6,459 set 3 forward NL_AiV-A_3CD-NF20 (SEQ ID NO: 3) 6,323-6,340 137 reverse NL-Antisense2-R (SEQ ID NO: 6) 6,437-6,459 set 4 forward NL_6261-F (SEQ ID NO: 1) 6,261-6,282 313 reverse NL-Antisense1-R (SEQ ID NO: 7) 6,550-6,573 set 5 forward NL_Sense2-F (SEQ ID NO: 2) 6,280-6,297 294 nested PCR
Primer Combination reverse NL-Antisense1-R (SEQ ID NO: 7) 6,550-6,573 set 6 forward NL_AiV-A_3CD-NF20 (SEQ ID NO: 3) 6,323-6,340 251 reverse NL-Antisense1-R (SEQ ID NO: 7) 6,550-6,573 set 7 forward NL_C94b-NF (SEQ ID NO: 4) 6,398-6,419 176 reverse NL-Antisense1-R (SEQ ID NO: 7) 6,550-6,573 set 8 forward NL_AiV-FY (SEQ ID NO: 5) 6,398-6,420 176 reverse NL-Antisense1-R (SEQ ID NO: 7) 6,550-6,573 set 9 forward NL_6261-F (SEQ ID NO: 1) 6,261-6,282 295 reverse NL-AiV-RNKm-R (SEQ ID NO: 8) 6,533-6,555 set 10 forward NL_Sense2-F (SEQ ID NO: 2) 6,280-6,297 276 reverse NL-AiV-RNKm-R (SEQ ID NO: 8) 6,533-6,555 set 11 forward NL_AiV-A_3CD-NF20 (SEQ ID NO: 3) 6,323-6,340 233 reverse NL-AiV-RNKm-R (SEQ ID NO: 8) 6,533-6,555 set 12 forward NL_C94b-NF (SEQ ID NO: 4) 6,398-6,419 158 reverse NL-AiV-RNKm-R (SEQ ID NO: 8) 6,533-6,555 set 13 forward NL_AiV-FY (SEQ ID NO: 5) 6,398-6,420 158 reverse NL-AiV-RNKm-R (SEQ ID NO: 8) 6,533-6,555

RT-PCR and nested PCR primer sets for Aichivirus-A diagnostics primer location product (nt) note Combination division name set 14 forward NL_6261-F (SEQ ID NO: 1) 6,261-6,282 397 reverse NL-AiV-RRY-R (SEQ ID NO: 9) 6,638-6,657 set 15 forward NL_Sense2-F (SEQ ID NO: 2) 6,280-6,297 178 reverse NL-AiV-RRY-R (SEQ ID NO: 9) 6,638-6,657 set 16 forward NL_AiV-A_3CD-NF20 (SEQ ID NO: 3) 6,323-6,340 335 reverse NL-AiV-RRY-R (SEQ ID NO: 9) 6,638-6,657 set 17 forward NL_C94b-NF (SEQ ID NO: 4) 6,398-6,419 260 reverse NL-AiV-RRY-R (SEQ ID NO: 9) 6,638-6,657 set 18 forward NL_AiV-FY (SEQ ID NO: 5) 6,398-6,420 260 reverse NL-AiV-RRY-R (SEQ ID NO: 9) 6,638-6,657 set 19 forward NL_6261-F (SEQ ID NO: 1) 6,261-6,282 403 reverse NL-246k-NR (SEQ ID NO: 10) 6,644-6,663 set 20 forward NL_Sense2-F (SEQ ID NO: 2) 6,280-6,297 384 RT-PCR
Primer Combination reverse NL-246k-NR (SEQ ID NO: 10) 6,644-6,663 set 21 forward NL_AiV-A_3CD-NF20 (SEQ ID NO: 3) 6,323-6,340 341 reverse NL-246k-NR (SEQ ID NO: 10) 6,644-6,663 set 22 forward NL_C94b-NF (SEQ ID NO: 4) 6,398-6,419 266 reverse NL-246k-NR (SEQ ID NO: 10) 6,644-6,663 set 23 forward NL_AiV-FY (SEQ ID NO: 5) 6,398-6,420 266 reverse NL-246k-NR (SEQ ID NO: 10) 6,644-6,663 set 24 forward NL_6261-F (SEQ ID NO: 1) 6,261-6,282 519 reverse NL-6779-R (SEQ ID NO: 11) 6,760-6,779 set 25 forward NL_Sense2-F (SEQ ID NO: 2) 6,280-6,297 500 reverse NL-6779-R (SEQ ID NO: 11) 6,760-6,779 set 26 forward NL_AiV-A_3CD-NF20 (SEQ ID NO: 3) 6,323-6,340 457 reverse NL-6779-R (SEQ ID NO: 11) 6,760-6,779 set 27 forward NL_C94b-NF (SEQ ID NO: 4) 6,398-6,419 382 reverse NL-6779-R (SEQ ID NO: 11) 6,760-6,779 set 28 forward NL_AiV-FY (SEQ ID NO: 5) 6,398-6,420 382 reverse NL-6779-R (SEQ ID NO: 11) 6,760-6,779

Example 2: Ichivirus-A diagnostic primer combination construction and optimal primer combination selection

By combining the Aichi virus-A primers designed in Example 1 in 28 sets (Table 2 and Table 3), the most effective primer combination for diagnosis was obtained through RT-PCR assay with Aichi virus-A and various related viruses. was selected. The selection of the optimal diagnostic primer combination consisted of the following three steps: i) selection through PCR with artificially synthesized Ichivirus-A template nucleic acid; ii) analysis of nonspecific reactions with taxonomically similar viruses; iii) Detection limit analysis through detection sensitivity analysis.

In order to confirm that the primer set (set 1) prepared in Example 1 can be used to detect Aichi virus-A, a primer composition for RT-PCR reaction was prepared as follows.

For the nucleic acid of Aichi virus-A, the nucleotide sequence of the 3CD gene position (6,038-8,011) known from Genebank accession number NC_001918.1 was requested by Macrogen, and gene synthesis was performed. After synthesizing the corresponding nucleotide sequence, the synthesized gene was inserted into the pTOP Blunt V2 vector and provided in the form of a plasmid.

For PCR, 17 µL of sterile distilled water, forward and reverse primers (forward primer of SEQ ID NO: 1 and reverse primer of SEQ ID NO: 6; set 1) in ^AccuPower® HotStart PCR premix (Bioneer), and 1 µL of plasmid synthesized as template nucleic acid (1 pg/μL) was added to perform PCR. PCR is pre-denatured at 95°C for 10 minutes, followed by 45 seconds at 95°C (denaturation), 45 seconds at 55°C (annealing), and 60 seconds at 72°C (extension) repeated 30 times. An amplification product of about 199 nt was confirmed.

(1) Experimental Example 1

Using the primer set prepared in Example 1 in the same manner as in Example 1, primer composition 2 (forward primer of SEQ ID NO: 2 and reverse primer of SEQ ID NO: 6; set 2) was prepared, and Example 2 and A PCR reaction was performed under the same temperature conditions to confirm an amplification product of about 180 nt.

(2) Experimental Example 2

It was carried out in the same manner as in Example 2, but instead of the primer set (set 1 and set 2) used in the reaction in Example 1 and Experimental Example 1, primer composition 3 (set 3) to composition 28 (set 28) for PCR reaction ) was prepared, and PCR reaction was performed under the same temperature conditions as in Example 2 to confirm an amplification product of about 500 to 137 nt.

Electrophoresis of 4 μL of the 20 μL of the amplification product in which the reactions of Experimental Examples 1 and 2 is completed on a 1.2% agarose gel containing a UV color reagent was performed to confirm whether the gene was amplified by a color reaction under UV light, and the result is shown in FIG. 1 shown in

(3) Experimental Example 3

Among the primer sets 1 to 28 prepared in Example 1 in which the PCR reaction was confirmed, a combination of five primer compositions for a PCR reaction with high amplification intensity and a large size (sets 5, 9, 20, 22, 23) In order to confirm whether these primers specifically amplify Aichi virus-A and the detection sensitivity to Aichi virus-A, the synthesized plasmid, the template nucleic acid of Aichi virus-A, was diluted 10-fold by step dilution method, followed by PCR reaction. was performed. The primer composition for the PCR reaction was the same composition as in Example 2, Experimental Examples 1 to 2, and the reaction temperature was the same as in Example 2. 4 μL of the 20 μL of the amplified product after the reaction was completed was electrophoresed on a 1.2% agarose gel containing a UV color reagent to confirm whether the gene was amplified by a color reaction under UV light, and the result is shown in FIG. 2 .

Figure 2 is a result of confirming the detection sensitivity that the primer composition for PCR reaction of the present invention can diagnose Aichi virus-A. Here, "10 ^-5 to 10 ^-8 " indicates the dilution factor of the synthesized plasmid as a template nucleic acid, and "N" is a sample using sterile distilled water as a template nucleic acid as a negative control. According to FIG. 2, it was confirmed that primer set 5 could detect Aichi virus-A up to a dilution factor of 10 ^-5 (10 fg/μL) or less, and primer set 9 and sets 20, 23 and 22 were 10 ^-6 It was confirmed that Aichi virus-A could be detected up to a dilution factor of (1 fg/μL). In particular, primer set 20 showed higher amplification intensity than other primer sets at a dilution factor of 10 ^-6 (1 fg/μL), and was selected as a primer combination for RT-PCR.

(4) Experimental Example 4

In order to confirm that the primer set 20 selected as a primer combination for RT-PCR specifically amplifies Aichi virus-A, a PCR reaction was performed to confirm a non-specific reaction including the 7 reference viruses collected in Example 1. carried out. The reaction temperature was the same as in Example 2. 4 μL of the 20 μL of the amplified product after the reaction was completed was electrophoresed on a 1.2% agarose gel containing a UV color reagent, respectively, to confirm whether the gene was amplified by a color reaction under UV light, and the results are shown in FIG. 3 .

FIG. 3 shows the confirmation of the Aichi virus-A specific reaction of primer set 20 through PCR reaction using the Aichi virus-A template nucleic acid and nucleic acids of 7 types of reference viruses as templates. Here, "P, AstV, HAV, HEV, No, RV and SV" represents the abbreviation of Aichi virus-A ("P") and the reference virus described in Example 1, and "N" is a negative control. This is a sample using sterile distilled water as a template nucleic acid.

As shown in FIG. 3 , the PCR reaction was confirmed only with the target virus, Aichivirus-A, for primer set 20, confirming that it was possible to specifically amplify Aichivirus-A.

Therefore, it can be seen that the primer set 20 prepared in Example 1 is a primer set suitable for amplifying the Aichi virus-A template nucleic acid.

(5) Experimental Example 5

In order to detect Aichivirus-A with high detection sensitivity, nested polymerase chain reaction (nested-PCR) was performed. More specifically, nested PCR was performed by designing a primer combination (a combination of a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 7) existing within the amplification range of primer set 20 confirmed with high detection sensitivity in Experimental Example 3 (Table 1). The reaction temperature was the same as in Example 2. 4 μL of the 20 μL of the amplified product after the reaction was completed was electrophoresed on a 1.2% agarose gel containing a UV color reagent to confirm whether the gene was amplified by a color reaction under UV light, and the results are shown in FIG. 4 .

4 is a result confirming whether the nested PCR composition 1 (N-set 1) of the primer composition 20 (set 20) for a PCR reaction of the present invention can diagnose Aichi virus-A with higher detection sensitivity. Here, "10 ^-5 to 10 ^-8 " indicates the dilution factor of the synthesized plasmid as a template nucleic acid, and "PN" is a PCR-negative control. sample was performed. In addition, "N" is a sample using sterile distilled water as a template nucleic acid as a negative control. According to FIG. 4, the detection sensitivity of nested PCR composition 1 was confirmed up to a 10 ^-7 (100 ag/μL) dilution factor, and higher detection sensitivity than the RT-PCR combination was confirmed.

Example 3: Aqueous environment sample empirical experiment

A demonstration experiment was conducted using a groundwater sample that is expected to be contaminated with a trace or trace amount of virus. Experimental materials and methods required for collection, desorption and concentration of groundwater samples are described in 「Norovirus Management Manual in Groundwater (Ministry of Environment, 2014)」 and US-EPA (814-B-95-002; Virus Monitoring Protocol for the Information Collection Requirements Rule) ) was performed in the same way. The area around the faucet was disinfected, and after flowing about 10 L of water, pH, temperature, turbidity, residual chlorine, etc. were measured, and additional devices were connected and reagents were processed. When the pH is 8.0 or higher, a 0.1 M hydrochloric acid cylinder is connected to the module, and when residual chlorine is measured, 10 mL of 2% sodium thiosulfate per 1 gal (about 3.8 L) of water is injected. was connected to collect samples. A sample of groundwater was collected by adjusting the water pressure to 30 psi by attaching a manometer, and after flowing more than 500 L, it was placed in an icebox and moved to the laboratory. In the desorption and concentration process, 20 mL of each sample was prepared by desorption and centrifugation using a 1.5% beef extract solution, and then stored in a cryogenic freezer.

Then, RNA nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (Qiagen). RT-nested PCR was performed in the same manner as in Experimental Examples 4 and 5 using the extracted RNA. 4 µL of the 20 µL of the amplified product after the reaction was completed was electrophoresed on a 1.2% agarose gel containing a UV color reagent to confirm whether the gene was amplified by a color reaction under UV light, and the result is shown in FIG. 5 . According to FIG. 5 , as a result of the environmental sample validation test, negative reactions were found in all samples except for the positive control group using Aichi virus-A as a template nucleic acid.

In order to investigate the decrease in detection sensitivity due to the PCR inhibitor contained in the environmental sample, the Aichi virus-A template nucleic acid was added to the aqueous environment sample RNA, which was confirmed as negative as a result of the empirical test, and serially diluted, and an artificial infection experiment was carried out. The PCR reaction was performed in the same manner as in Experimental Examples 4 and 5, but the primer set 20 of the present invention and the comparison primer combination having the same amplification gene and similar nucleotide sequence position Ref. 2 (Non-Patent Document 1) and Ref. 5 (Non-Patent Document 2) was used to compare artificial infection experiments.

Table 4 below shows the comparative primer combinations Ref. 2 and Ref. The nucleotide sequence of 5 is shown.

Comparative primer combinations Ref. 2 and Ref. 5 nucleotide sequence information comparative primer base sequence
(5'→3') SEQ ID NO: location product (nt) Combination division name Ref. 2 RT-PCR forward 6261 ACACTCCCACCTCCCGCCAGTA 12 6,261-6,282 519 reverse 6779 GGAAGAGCTGGGTGTCAAGA 13 6,760-6,779 nested PCR forward C94b GACTTCCCCGGAGTCGTCGTCT 14 6,398-6,419 266 reverse 246k GACATCCGGTTGACGTTGAC 15 6,644-6,663 Ref. 5 RT-PCR forward Sense1 ACACTCCCACCTCCCGCCAGTA 16 6,261-6284 313 reverse Antisense1 AGGATGGGGTGGATRGGGGCAGAG 17 6,550-6,573 nested PCR forward Sense2 GTACAAGGACATGCGGCG 18 6,280-6,297 180 reverse Antisense2 CCTTCGAAGGTCGCGGCRCGGTA 19 6,437-6,459

For artificial infection PCR of the primer set and comparison primer combination of the present invention, 14 μL of sterile distilled water, 3 μL of non-specific inhibitor, a pair of forward and reverse primers, and an environmental sample diluted in AccuPower ^® HotStart PCR premix (Bioneer) A plasmid nucleic acid (1 ng/μL) was added as a template nucleic acid to perform PCR. The template nucleic acid was serially diluted 10-fold and used in the artificial infection detection sensitivity experiment.

Ref. The RT-PCR condition of 2 was followed by RT reaction at 42° C. for 1 hour, followed by pre-denaturation at 95° C. for 10 minutes. After that, the process was repeated 40 times at 94°C for 30 seconds (denaturation), at 55°C for 30 seconds (annealing), and at 72°C for 60 seconds (extension), and finally amplified at 72°C for 7 minutes to amplify about 519 nt. The product was confirmed. In the case of nested PCR, after pre-denaturation at 95°C for 10 minutes, 40 repetitions at 95°C for 30 seconds (denaturation), 55°C for 30 seconds (annealing), 72°C for 60 seconds (extension) After carrying out the process, it was finally amplified at 72° C. for 7 minutes to confirm an amplification product of about 223 nt.

Ref. The RT-PCR conditions of 5 were pre-denatured at 42°C for 1 hour, followed by RT reaction at 94°C for 5 minutes. After that, the amplification product of about 313 nt was confirmed by repeating 35 times at 94°C for 45 seconds (denaturation), at 42°C for 15 seconds (annealing), and at 72°C for 60 seconds (extension). In the case of nested PCR, after pre-denaturation at 95°C for 10 minutes, 35 repetitions at 94°C for 30 seconds (denaturation), 42°C for 30 seconds (annealing), 72°C for 45 seconds (extension) The process was carried out to confirm the amplification product of about 180 nt.

4 μL of the 20 μL of the amplified product after the reaction was completed was electrophoresed on a 1.2% agarose gel containing a UV color reagent to confirm whether the gene was amplified by a color reaction under UV light, and the result is shown in FIG. 6 . According to FIG. 6 , as a result of the artificial infection test, the sensitivity of the RT-PCR artificial infection detection of the primer set of the present invention was 10 ^-4 , which was decreased by 100 times compared to when the plasmid was amplified with the template nucleic acid, but nested The PCR artificial infection detection sensitivity was confirmed as 10 ^-7 , and the detection sensitivity equivalent to that of the plasmid was confirmed. On the other hand, comparative primer combinations Ref. 2 and Ref. In case of 5, lower detection sensitivity than plasmid amplification was confirmed, and nested PCR artificial infection detection sensitivity lower than that of the primer set of the present invention was confirmed.

Summarizing the above results, the primer set and detection kit for detecting Aichi virus-A of the present invention has high species specificity that does not react with other species other than Aichi virus-A, and has high detection intensity. It can be seen that the detection of Aichi virus-A is possible even in samples contaminated with trace or trace traces. Accordingly, the primer set and detection kit for detecting Aichi virus-A of the present invention can rapidly and accurately detect Aichi virus-A infection with high specificity and sensitivity.

Example 4: Preparation of a positive control group for verification of false positive reactions

In order to confirm the contamination of the positive control group in the laboratory, a positive control group for verification of false positive reactions was prepared. The positive control group was prepared to include the nucleotide sequence of the primer set of the present invention, and 4 types of restriction enzyme nucleotide sequences were added to confirm whether or not false positive was obtained through restriction enzyme treatment. Information on the nucleotide sequence of the positive control group (SEQ ID NO: 20) is shown in FIG. 7 .

Molecular biological methods such as RT-PCR require a positive control for analysis reliability. there is also One of the methods of securing the reliability of this test method is securing a standard positive control group, and in the case of the positive control group of the present invention, i) it has an amplification product of a size different from that of Aichi virus-A amplified in an actual environmental sample, ii) a non-specific reaction Even if an amplification product of the same size as that of the positive control group is confirmed by using the It has the advantage of being able to check quickly and quickly.

For comparison of the positive control group and the existing plasmid template nucleic acid, RT-nested PCR was performed in the same manner as in Experimental Examples 4 and 5, and 4 μL of the 20 μL of the reaction product was added to 1.2% UV color reagent containing Whether the gene was amplified by electrophoresis on an agarose gel was confirmed by a color reaction under ultraviolet light. In addition, by treating the nested PCR amplification product with restriction enzyme EcoRV (GAT/ATC), it was confirmed that the amplification product of the positive control group was divided into 588 nt and 362 nt, and the results are shown in FIG. 8 .

Figure 8 (A) shows the RT-PCR results of the 3CD gene plasmid of Aichi virus-A (NC_001918, 6,038-8,011) and the positive control group of the present invention. In the case of the plasmid, an amplification product of 384 nt was confirmed, and in the case of a positive control, an amplification product of 1,000 nt was confirmed.

Figure 8 (B) shows the nested-PCR results of the 3CD gene plasmid of Aichi virus-A (NC_001918, 6,038-8,011) and the positive control group of the present invention. In the case of the plasmid, an amplification product of 294 nt was confirmed, and in the case of a positive control, an amplification product of 950 nt was confirmed.

8C shows the results of EcoRV (GAT/ATC) restriction enzyme treatment of nested PCR products. In the case of the plasmid, since there is no nucleotide sequence to which the restriction enzyme works, the amplification product of 294 nt is confirmed as it is, but in the case of a positive control, there is a nucleotide sequence to which the restriction enzyme works, so the processed products of 588 nt and 362 nt are confirmed. .

Summarizing the above results, the Aichi virus-A detection method of the present invention can accurately detect Aichi virus-A by distinguishing false-positive reactions due to PCR contamination when using a PCR-positive control group, and minimize the occurrence of false-positive reactions. It can be seen that an accurate diagnosis of Aichi virus-A is possible.

The present invention has been described above with reference to the above examples, but the present invention is not limited thereto. Those skilled in the art can make modifications and changes without departing from the spirit and scope of the present invention, and it will be appreciated that such modifications and changes also belong to the present invention.

<110> National Institute of Environmental Research <120> Reverse transcriptase nested polymerase chain reaction for the detection of Aichivirus-A from water environment and positive control for confirmation of the false positive reaction <130> P20-0111KR <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NL_6261-F <400> 1 acacyycmac ytcmcgycar ta 22 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NL_Sense2-F <400> 2 rtacaaggay atgcggcg 18 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NL_AiV-A_3CD-NF20 <400> 3 actggnmtac tggtytct 18 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NL_C94b-NF <400> 4 gacttccccg gagtygtcgt ct 22 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NL_AiV-FY <400> 5 gacttyccmg gcttngtcgt btg 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NL-Antisense2-R <400> 6 ccttcgaagg tcgckgcrcg gta 23 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NL-Antisense1-R <400> 7 aggatrgkrt ggakrggrgc rgar 24 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NL-AiV-RNKm-R <400> 8 gcrgagaanc cactcgarcc wgc 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NL-AiV-RRY-R <400> 9 cggttsaygt tsacgccrgg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NL-246k-NR <400> 10 gacatccggt tgaygttgac 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NL-6779-R <400> 11 rgaaragytg ggtrtcmara 20 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 6261 <400> 12 acactcccac ctcccgccag ta 22 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6779 <400> 13 ggaagagctg ggtgtcaaga 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> C94b <400> 14 gacttccccg gagtcgtcgt ct 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 246k <400> 15 gacatccggt tgacgttgac 20 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Sense1 <400> 16 acactcccac ctcccgccag ta 22 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Antisense1 <400> 17 aggatggggt ggatrggggc agag 24 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Sense2 <400> 18 gtacaaggac atgcggcg 18 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Antisense2 <400> 19 ccttcgaagg tcgcggcrcg gta 23 <210> 20 <211> 1012 <212> DNA <213> Artificial Sequence <220> <223> AiV-A positive control <400> 20 tcgcgagtac aaggacatgc ggcggataat gccatctaca ccatatgtga tattggatct 60 gacaatagtt ttgagattac tatcccttat tcattttcca cttggatgag gaagacacat 120 ggtaaaccta ttggcctatt ccagatgaa gtcctaaata ggttaacata caattactcc 180 agtccaaatg aggtatactg catagtgcaa ggtaaaatgg gacaagacgc caaatttttc 240 tgccccactg ggtctttagt aactttccag aattcatggg gttcccaaat ggacttgact 300 gacccgcttt gcatagaaga ttcagtagaa gattgtaagc aaaccattac accaacagaa 360 ttgggactaa cctcagcaca agatgatggc cctttaggaa atgacaaacc aaattatttt 420 cttaacttta agtctatgaa tgttgggccc tttactgtca gtcacaccaa agtagacaat 480 atttttggac gtgcttggtt tgcccatgtt catgacttca ctaatgatgg cctatggaga 540 cagggattgg aatttccaaa ggaagggcac ggtgccctat cacttctgtt tgatatcggc 600 ctgcatgcgc agcctacttt actggtgaat taaacatcca tgttctattt cttagtgata 660 ggggttttct cagagttgga catacatatg acactgagac aaacagaacc aattttttat 720 catccagtgg cataattaca gtaccagcag gagaacagat gacactatct gtcccctctt 780 attccaacaa gccattacgg acagttagat catccaatgc tttaggttat ttactgtgta 840 aaccattgct aactggtacc agctctggta gaatagagat attccttagc ttgagatgtc 900 caaatttctt ctttccctta ccagcaccaa aactctgccc ccatccaccc catcctccag 960 caacacgtaa atatagagga gatttggtca acgtcaaccg gatgtcaagc tt 1012

Claims (17)

A primer set for RT-PCR (Reverse-transcriptase PCR) consisting of a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 10;
A primer set for detecting Aichi virus-A, comprising a primer set for nested PCR consisting of a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 7. A primer set for RT-PCR (Reverse-transcriptase PCR) consisting of a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 10;
Aichi virus-A detection kit comprising a primer set for nested PCR consisting of a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 7. 3. The method of claim 2,
Reverse transcription polymerase, polymerase, dNTPs, and further comprising a PCR buffer, Aichi virus-A detection kit. In the positive control group for detecting Aichi virus-A in which the Aichi virus-A gene is inserted into a vector containing an ampicillin resistance gene and an ORI region gene (ori gene),
The Aichi virus-A gene is partially different from the Aichi virus-A gene and substituted with a gene having a large size of the PCR amplification product, but the Aichi virus-A gene and the Aichi virus-A gene are partially different from the Aichi virus-A gene and the size of the PCR product A large gene is a PCR positive control for Aichi virus-A detection, including the nucleotide sequence of the restriction enzyme recognition site. 5. The method of claim 4,
The Aichi virus-A gene and the gene having a large nucleotide sequence and a large PCR product size further include a nucleotide sequence of GATATCGGCCTGCATGCGCA recognized by a restriction enzyme, a positive control group for detecting Aichi virus-A. 6. The method of claim 5,
The restriction enzyme is at least one selected from the group consisting of EcoRV, HaeIII, HpyCH4V and FspI, Aichi virus-A detection PCR positive control group. 7. The method of claim 6,
The nucleotide sequence recognized by EcoRV is GATATC, the nucleotide sequence recognized by HaeIII is GGCC, the nucleotide sequence recognized by HpyCH4V is TGCA, and the nucleotide sequence recognized by FspI is TGCGCA, A positive control group for detecting Aichi virus-A. 8. The method of claim 7,
RT-PCR amplification product by a primer set for RT-PCR consisting of a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 10 for a gene having a partially different nucleotide sequence from the Aichi virus-A gene and a large PCR product The size of 1,000 nt, Aichi virus-A PCR positive control for detection. 9. The method of claim 8,
A gene having a partially different nucleotide sequence from the Aichi virus-A gene and having a large PCR product size is a nested PCR amplification product by a nested PCR primer set consisting of a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 7 The size of the 950 nt, Aichi virus-A PCR positive control for detection. 10. The method of claim 9,
When the nested PCR amplification product is digested with EcoRV, it is characterized in that it is divided into a 588 nt processed product and a 362 nt processed product, a positive control group for Aichi virus-A detection. 11. The method of claim 10,
A PCR positive control for detecting Aichi virus-A, wherein the Aichi virus-A gene and the nucleotide sequence are partially different and the large PCR product size is a gene having the nucleotide sequence of SEQ ID NO: 20. (a) preparing a genetic sample from the specimen;
(b) performing RT-PCR (Reverse-transcriptase PCR) on the gene sample using a pair of the forward primer of SEQ ID NO: 2 and the reverse primer of SEQ ID NO: 10;
(c) amplifying the target sequence by performing nested PCR on the RT-PCR product of step (b) using a pair of the forward primer of SEQ ID NO: 2 and the reverse primer of SEQ ID NO: 7; ,
(d) Aichi virus-A detection method comprising the step of detecting the amplification product of step (c). 13. The method of claim 12,
(E) Aichi virus-A detection method, further comprising the step of confirming whether or not false-positive due to contamination of the PCR-positive control group for detecting Aichi virus-A according to any one of claims 4 to 11. 14. The method of claim 13,
When the size of the amplification product of the nested PCR is 950 nt, it is determined as a false positive due to contamination of the Aichi virus-A detection PCR positive control group. 14. The method of claim 13,
When the nested PCR amplification product is digested with EcoRV, when it is divided into a 588 nt processed product and a 362 nt processed product, it is determined as a false positive due to contamination of the Aichi virus-A detection PCR positive control, Aichi virus-A detection method. 13. The method of claim 12,
The detection of the amplification product of step (d) uses at least one method selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement and phosphorescence measurement, Aichi virus-A detection method. 13. The method of claim 12,
Wherein the sample is at least one type of aquatic environment sample selected from the group consisting of groundwater, drinking water and non-sterilized water, the Aichi virus-A detection method.

Images