KR20220044355A - Immortalized myoblast cell lines and uses thereof - Google Patents

Abstract

The present invention relates to immortalized human cells that are particularly useful for cell encapsulation therapy and methods of making and using the same.

Description

Immortalized myoblast cell lines and uses thereof

FIELD OF THE INVENTION The present invention relates generally to the field of encapsulation and particularly to the development of immortalized cell lines and methods of preparing them for use as encapsulated cell implants for the release of therapeutic proteins or adjuvants.

Cell encapsulation technology enables chronic and/or localized administration of macromolecules in multiple domains. It is based on implantation in a subject of one or several biocompatible capsules containing genetically modified cells to produce a therapeutic protein of interest. This type of capsule is usually made of a semipermeable membrane that provides mechanical protection and separates the modified cells, thereby avoiding contact between the transplanted cells and the immune cells of the host and resulting in long-term survival of the encapsulated cells. In addition, the semipermeable membrane allows for the entry of nutrients and oxygen into the transplanted cells and the outflow of the protein of interest into the host, thereby allowing for continuous and long-term production.

Ex vivo gene therapy using recoverable encapsulated cell implants has been developed as an effective strategy for local and/or chronic delivery of therapeutic proteins. In particular, modulating the activity of the patient's immune system has been considered as an innovative approach for the treatment of various disorders and, in particular, the chronic administration of monoclonal antibodies for passive immunity against neurodegenerative diseases and the use of cytokines as adjuvants for anti-cancer vaccines. Treatment regimens using genetically engineered encapsulated cells, such as local delivery, have been developed ( Lathuiliere et al., 2015, Int. J. Mol. Sci., 16, 10578-10600 ).

GM-CSF by genetically modified allogeneic cells (MVX-1 cells) with useful immunoprotective and boosting activity for tumor regression using recently encapsulated cells secreting granulocyte-macrophage colony stimulating factor (GM-CSF) An anticancer active immunization technique has been developed that allows for standardized release of Patient immunization is performed in healthy skin away from tumor deposits by combining two capsules containing irradiated autologous tumor cells and MVX-1 cells that produce more than 20 ng/24 hours of huGM-CSF. This allows for the production of GM-CSF and exposes the immune system to tumor-associated antigens (TAA) expressed by autologous tumor cells at the injection site. Local expression of GM-CSF recruits and activates antigen presenting cells (APCs), Mach et al., 2015, Annals of Oncology, 26 (suppl_8): 1-4. It induces both antibody-dependent cell-mediated cytotoxicity (ADCC) and cytotoxic T-lymphocyte responses at the site of injection and systemically as provided in 10.1093/annonc/mdv513 (WO 2017/064571).

If human primary myoblast cell lines were immortalized by retroviral transduction of CD4 and hTERT according to Stadler et al., 2011, Skelet Muscle, 1:12, 94 in terms of treatment of facial scapulohumeral muscular dystrophy (WO 2019/152820) ), the resulting immortalized cells are chosen as antibiotics, providing major inconvenience for use in therapy as a potential source of immunogenicity.

Other attempts to immortalize hTERT, the CDK4R24C mutant and primary human myoblasts overexpressing cyclin d1 failed to generate myoblasts with myogenic potential or were not scalable in terms of clinical use ( Min . -wen Jason et al., 2019, Cell proliferation, 52(3) ).

To optimize the human application of encapsulation technology, an important point is the generation of an implantable, safe and usable human cell line as a platform for the in vivo secretion of a recombinant protein of interest. Therefore, there is a need for the development of a newly developed efficient cell line that is particularly suitable for encapsulation technology in terms of safe and long-lasting effects.

The present invention relates to the preparation of immortalized human myoblasts that have exceptional survival properties in cell encapsulation devices, and in particular allow to achieve immortalized human myoblasts capable of differentiating under difficult metabolic conditions while maintaining high secretion levels of recombinant proteins. and the unexpected discovery of methods for selection.

In particular, the method for immortalization of human myoblasts according to the invention comprises at least one lentiviral vector (eg pCLX type or pRRLSIN or Giry- Laterriere) encoding the CDK4 protein of human myoblasts isolated from muscle tissue (eg healthy or autologous) from a donor. , 2011, Methods Mol Biol., 737:183-209 ) and at least one lentiviral vector encoding an hTERT protein (such as pCLX type or pRRLSIN or Giry-Laterriere, 2011 ( At least for improved in vitro proliferation and stability properties such as improved viability when encapsulated compared to parental cell lines using transduction and single cell cloning techniques with other suitable lentiviral vectors, such as those described in the same) above. It involves selection of one individual immortalized clone (no use of selective antibiotics). In particular, selected immortalized human myoblast cell lines obtained by the method of the invention, such as, for example, the cell line deposited under the number CCOS 1902, advantageously exhibit long-term viability and proliferative capacity in biocompatible capsules and long-term maintenance such as, for example, high levels of MHC It shows the characteristics of myoblasts.

In addition, another feature of the invention is that the immortalized human myoblast cell lines of the invention can be readily genetically engineered to express proteins of interest, particularly useful in the field of encapsulation therapy, and there is a method for producing the genetically modified immortalized human myoblasts. Based on the unexpected discovery that it is provided, the method comprises at least one lentiviral vector encoding a protein of interest under the control of a promoter that is overactivated under hypoxic conditions, in particular a PGK (phosphoglycerate kinase) promoter, in particular a human PGK promoter. transduction of immortalized human myoblasts according to the invention (eg pCLX or pRRLSIN type). Under the control of this promoter, the protein secretion by the genetically modified immortalized human myoblasts according to the invention can be doubled to under hypoxic conditions, which makes these cells even more interesting for use in cell encapsulation techniques, which advantageously put the cells into a state of hypoxia. increases by 3 times. In particular, the genetically modified immortalized human myoblast cell line secreting GM-CSF obtained by the method of the invention, such as, for example, the cell line deposited under the number CCOS 1901, advantageously exhibits long-term viability and proliferative capacity and cancer cells in an implantable device. It exhibits long-lasting myoblast characteristics, including secretion of high levels of GM-CSF, which is highly useful for therapy.

It is an object of the present invention to provide an immortalized human cell line useful for cell encapsulation technology.

It would be useful to provide immortalized human cell lines that do not induce tumors and exhibit extended survival even under hypoxic conditions.

It would be useful to provide an immortalized human cell line for autologous transplantation that can be used without limitation in an immunoprivileged site.

It is useful to provide immortalized human cell lines with optimized properties that do not rely on cell line selection by antibiotics.

It would be useful to provide immortalized human cell lines that can be genetically engineered to secrete high levels of a protein of interest.

It would be useful to provide genetically engineered immortalized human cells capable of maintaining high levels of expression of a protein gene of interest without silencing overtime.

It would be useful to provide genetically engineered immortalized human cells capable of maintaining high levels of secretion of a protein of interest in an encapsulation device.

It would be useful to provide genetically engineered immortalized human cells that can be frozen and thawed after being loaded into an encapsulation device and capable of maintaining high levels of secretion of a protein of interest.

The object of the present invention has been achieved by providing an immortalized human myoblast cell line according to claims 3 and 5, a method for obtaining an immortalized human myoblast cell line according to claim 1 and uses thereof.

The object of the present invention was also achieved by providing a genetically engineered immortalized human myoblast according to claim 9 and 10, a method for obtaining a genetically engineered immortalized human myoblast according to claim 7 and uses thereof .

Disclosed herein, according to a first aspect of the invention, is a method for establishing an immortalized human myoblast cell line, said method comprising:

a) providing at least one primary human myoblast expressing the surface marker CD56 and optionally at least one additional surface marker selected from CD82 and CD146;

b) transducing said at least one primary human myoblasts with a lentiviral vector encoding a cyclin-dependent kinase 4 (CDK4) gene and a lentiviral vector encoding a catalytic subunit of a human telomerase (hTERT) gene, said obtaining immortalization of primary human myoblasts;

c) Growing cells from at least one immortalized primary human myoblast obtained under step b) in a myoblast growth medium and isolating each obtained cell providing at least one myoblast phenotypic marker obtained in a separate culture medium from the growth medium to do;

d) growing each isolated cell obtained under step c) separately in separate culture and amplification media;

e) selecting from the parental cells by single cell cloning at least one cell line having improved stability or expression properties among all the individual culture and amplification media of step d);

f) controlling the myogenic potential of the selected at least one cell line;

g) selecting individual clones based on their viability in the encapsulation device;

h) optionally repeating steps d) to g) sequentially to further refine the selected line.

According to another aspect of the invention, there is provided a composition comprising an immortalized human myoblast cell line or an immortalized human myoblast derived from a primary human myoblast or a progeny thereof, the cell expressing CDK4 and hTERT and characterized by myoblast and the cells do not express an antibiotic resistance gene.

According to another aspect of the invention, there is provided an immortalized human myoblast cell line deposited with the CCOS under accession number 1902 (deposited on June 20, 2019) or a composition or progeny thereof.

According to another aspect of the invention, an immortalized human myoblast cell line derived from primary human myoblasts obtainable from the method according to the invention or a composition comprising immortalized human myoblasts derived from primary human myoblasts or progeny thereof this is provided

According to another aspect of the invention, there is provided a method for producing genetically engineered immortalized human myoblasts expressing a therapeutic protein under hypoxic conditions.

According to another aspect of the invention, there is provided a genetically engineered immortalized human myoblast cell line or a composition or progeny thereof according to the invention.

According to another aspect of the invention, there is provided a genetically immortalized human myoblast cell line secreting GM-CSF deposited with the CCOS under accession number 1901 (deposited on June 20, 2019) or a composition or progeny thereof .

According to another aspect of the invention, there is provided a genetically engineered immortalized human myoblast cell line obtainable from the method according to the invention or a composition or progeny thereof.

According to another aspect of the invention, there is provided a genetically engineered immortalized human myoblast of the invention for use in encapsulated cell therapy.

According to another aspect of the invention, there is provided a pharmaceutical composition comprising at least one genetically engineered immortalized human myoblast according to the invention and a pharmaceutically acceptable carrier, diluent or excipient thereof.

According to another aspect, the invention provides the genetically engineered immortalized human myoblasts of the invention for use in the prophylaxis and/or treatment of a disorder or disease, in particular cancer, inflammatory disorder, infectious disease, in particular viral infection or neurodegenerative disorder do.

According to another aspect, the invention provides for the manufacture of a pharmaceutical composition or implantable encapsulated cell device for the prophylaxis and/or treatment of a disorder or disease, in particular cancer, inflammatory disorder, infectious disease, in particular viral infection or neurodegenerative disorder. There is provided the use of the genetically engineered immortalized human myoblasts of the invention.

According to another aspect, the invention provides an implantable biocompatible device or kit comprising at least one immortalized human myoblast according to the invention in a cell culture medium.

According to another aspect, the invention provides a method for preventing or treating a related disorder or disease, in particular cancer, inflammatory disorder, infectious disease, in particular viral infection or neurodegenerative disorder, in a subject, said method comprising the genetically engineered immortalization of the invention and administering to a subject in need thereof a therapeutically effective amount of human myoblasts.

FIELD OF THE INVENTION The present invention relates generally to the field of encapsulation and particularly to a method for preparing it for use as an encapsulated cell implant for the development of immortalized cell lines and the release of therapeutic proteins or adjuvants, which has exceptional survival properties in cell encapsulation devices, In particular, we provide a method for the preparation and selection of immortalized human myoblasts that allows to achieve immortalized human myoblasts capable of differentiating under difficult metabolic conditions while maintaining high secretion levels of the recombinant protein.

1 is after transduction of immortalized human myoblasts of the invention (I) compared to primary myoblasts (P), measured by cell counting at each passage as described in Example 1 (I), i.e., the method of the invention; Proliferative capacity expressed as the number of months (M) versus the number of doubled cell populations (N) before step d) of step d) is shown.
Figure 2 shows the proliferation capacity expressed as the number of weeks (W) versus the number (N) of the doubled cell population after sorting of clones from the immortalized human myoblast population (I) of nine selected clones as described in Example 1; show
3 shows the maintenance of the ability to express myogenic markers over time quantified by flow cytometry compared to an immortalized cell population (I) prior to sorting, as each described in Example 1; After immortalization and sorting (after step d)) compared to the immortalized population measured by the conserved myogenic characteristics (a) of the clones obtained by the method of the invention, their conserved ability to fusion and differentiate into myotubes is Quantified by immunohistochemistry (b) compared to primary cells (P3) and immortalized cell populations (P10) and (P24) after passages 10 and 24.
4 is clone 2 versus the GM-CSF secretion rate measured by ELISA achieved by the inventive genetically modified immortalized human myoblasts (clone 2) immediately after transduction (a), as described in Example 3; The number of weeks post-transduction (W) for the various clones (c) after the sorting step (iv) of the method for (b) and for different week periods after transduction is shown.
5 shows the proliferation capacity expressed as the number of weeks (W) versus the number of doubling cell populations (N) after sorting of clones from a population of genetically modified immortalized human myoblasts of 10 selected clones as described in Example 3; show
Figure 6 shows clones obtained by the method of the invention after sorting (after step iv) as measured by retention of the ability to express myogenic markers over time quantified by flow cytometry as described in Example 2; showing the conserved myogenic characteristics (a) of fusion and their conserved ability to differentiate into myotubes were quantified by immunohistochemistry (b) compared to the population (MOI=10 and 100).
7 shows the rate of GM-CSF secretion measured by ELISA achieved by various encapsulated selected clones during different weeks after transplantation in vivo compared to control encapsulated cells (MVX-1), as described in Example 3; shows
8 is a test as non-encapsulated cells expressed as the number of doubling cell populations (N) versus the number of weeks (W) after sorting of clones from a genetically modified immortalized human myoblast population, as described in Example 3; Proliferation rates in vitro (a), in vitro secretion expressed as strains (W) versus non-encapsulated cells after sorting (b) and in vitro secretion expressed as strains versus encapsulated cells after encapsulation (c) and control encapsulated cells (C) Rate of ex vivo secretion in mice as encapsulated cells as measured by quantification of GM-CSF in serum (d) and in tissues surrounding the capsule (e) compared to pre-transplantation compared to cells (MVX-1) Stability over time of two selected clones 61.27 and 62.14 in terms of
9 depicts an implantable encapsulation device used for experiments with encapsulated cells of the invention. a: Schematic illustration of an implantable capsule according to an embodiment of the invention. b: sectional view along line II-II in FIG. 9A ; c: cross-section similar to FIG. 9b with the inner matrix of the capsule removed; d: Detailed view of circle IV in FIG. 9c of the cell receiving portion 2 inside the implantable encapsulation device containing immortalized myoblasts 24 according to the invention. e: Detailed illustration of circle V in FIG. 9B .
Figure 10 shows different times of incubation with frozen medium after thawing (hours) of the invention, as described in Example 3, compared to frozen versus formulated in 5% (a) and 10% (b and c) glycerol as freezing medium. and GM-CSF secretion measured by ELISA achieved by encapsulated genetically modified immortalized human myoblasts (M) compared to control encapsulated cells (MVX-1) are shown.
11 is a biologically active monoclonal of immortalized myoblasts obtained under Example 1 from clone 2 transduced with a lentiviral vector encoding the heavy and light chains of rituximab as described in Example 4; Supports the ability to generate antibodies. a: IgG secreted by the genetically modified cells of the invention and commercial rituximab behave identically when incubated with a fluorescently tagged anti-CD20 antibody; b & c: Myoblast-generated IgG showed a cytotoxic response (IFN-gamma (b) or CD107a (C)) following exposure of the B-cell line to either rituximab or myoblast-generated anti-CD20. overexpression) was efficient in the degranulation assay tested.
12 compares the release of huGM-CSF from two distinct capsules and two types of cells as described in Example 5. a: group A: capsules according to an embodiment of the invention (shown in FIG. 9 ) containing genetically modified immortalized human myoblasts secreting the same therapeutic protein GM-CSF, group B: identical according to embodiments of the invention A control cell line, K562 human erythroleukemia cells expressing human GM-CSF, and group C: K562 human erythroleukemia cells expressing human GM-CSF loaded into capsules (shown in FIG. 9 ). Conventional containing the same control cell line. In vitro GM-CSF release from capsule supernatant to capsules; b: GM-CSF release for 1 week from explanted capsules implanted subcutaneously in mice (same group as in FIG. a); c: GM-CSF level in the serum of mice implanted with capsules for 1 week (same group as in Fig. A); d: The amount of GM-CSF detected in the subcutaneous tissue around the implanted capsule after 1 week (same group as in Fig. A).
Figure 13 shows immortalized myoblasts according to the invention in a CTLA-4 blocking reporter gene assay (myoblasts transduced for expression of monoclonal human IgG directed against human CTLA4: C2), as described in Example 3. ) and compared to a biosimilar of ipilimumab (Yervoy ^™ , Bristol-Myers Squibb SA) as a positive control (C1) is shown.
14 depicts immunohistochemistry for Alzheimer's disease brain sections using anti-amyloid beta monoclonal antibodies produced by immortalized myoblasts, as described in Example 4.
15 shows COVID-19 in pure or diluted (1:5, 1:25) culture supernatants of transduced immortalized myoblasts using two different primary antibodies AQ806 and AI334, as described in Example 6. A dot blot detecting the -19 spike protein is shown.

As used herein, "treatment" and "treating" and the like generally mean obtaining a desired pharmacological and physiological effect. The effect may be prophylactic in terms of preventing or partially preventing a disease, a symptom or condition thereof, and/or may be therapeutic in terms of partial or complete cure of a disease, condition, symptom or side effect resulting from the disease. As used herein, the term “treatment” encompasses any treatment of a disease in a mammal, particularly a human: (a) a disease in a subject who may be predisposed to the disease but not yet diagnosed as having the disease, such as prophylactic early asymptomatic intervention. to prevent this from occurring; (b) inhibiting the disease, ie, arresting the development of the disease; or alleviating a disease, such as amelioration or restoration of damage, ie, causing regression of the disease and/or its symptoms or conditions. In particular, the methods, uses, formulations and compositions according to the invention are useful for encapsulated cell therapy.

As used herein, the term “subject” refers to a mammal. For example, mammals contemplated by the present invention include livestock animals such as humans, primates, cattle, sheep, pigs, horses, laboratory rodents, other pets, and the like.

As used herein, the term "effective amount" refers to an amount of at least one compound of the invention or a pharmaceutical formulation thereof according to the invention that elicits the desired biological or medical response in a tissue, system, animal or human. In one embodiment, an effective amount is a “therapeutically effective amount” for alleviation of the symptoms of the disease or condition being treated. In another embodiment, an effective amount is a “prophylactically effective amount” for the prevention of the symptoms of the disease or condition being prevented. The term also includes herein an amount (ie, an “effective amount”) of a compound of the invention sufficient to induce the desired response by reducing the progression of a disease, in particular reducing or inhibiting the progression of a disorder.

The term "efficacy" of a treatment according to the invention may be determined based on a change in the disease course in response to the use or method according to the invention. For example, the efficacy of cancer treatment may be improved by a reduction in tumor size or by an increase in overall survival (OS), or progression-free survival (PFS), or disease stabilization (SD), or prostate specific antigen (PSA). , reduced serum tumor markers such as cancer antigen 125 (CA125), carcinoembryonic antigen (CEA), or reduced metabolic activity, reduced genetic abnormalities such as circulating tumor desoxyribonucleic acid (ctDNA). .

The term “myogenic potential” refers to the ability of a cell to form myotubes. This ability can be tested by standard techniques such as those described herein or by flow cytometry, western blotting.

The term “human myoblast phenotypic marker” refers to a phenotypic characteristic for human myoblasts such as CD56+, CD146+, CD82+. They can be assessed by fluorescence-activated cell sorting (FACS) or by immunohistochemistry or Western blot. According to a specific aspect, said at least one myoblast phenotypic marker is selected from CD56+, CD146+ and CD82+.

The term "cell growth medium" refers to myoblasts, such as culture medium supplemented with at least one growth factor such as epidermal growth factor, creatine, uridine, dexamethasone, fetal bovine serum, fetuin, bovine serum albumin, insulin or pyruvate. A medium suitable for growth is indicated. According to a specific embodiment, the amplification medium may refer to a cell growth medium as defined above.

The term “pharmaceutical formulation” refers to a formulation that is in such a form that allows the biological activity of the active ingredient(s) to be unequivocally effective and which does not contain additional components that would be toxic to the subject to which the formulation is to be administered.

Method for producing immortalized human myoblasts according to the invention

According to one aspect, the invention provides a method for establishing an immortalized human myoblast cell line, said method comprising:

a) providing at least one primary human myoblast expressing the surface marker CD56 and optionally at least one additional surface marker selected from CD82 and CD146;

b) transducing said at least one primary human myoblasts with a lentiviral vector encoding a cyclin-dependent kinase 4 (CDK4) gene and a lentiviral vector encoding a catalytic subunit of a human telomerase (hTERT) gene, said obtaining immortalization of primary human myoblasts;

c) growing the cells from the at least one immortalized primary human myoblast obtained under step b) in a myoblast growth medium and each obtained cell providing at least one myoblast phenotypic marker in a separate culture medium from the growth medium separating;

d) growing each isolated cell obtained under step c) separately in separate culture and amplification media;

e) selecting from the parental cells by single cell cloning at least one cell line having improved stability or expression properties among all the individual culture and amplification media of step d);

f) controlling the myogenic potential of the selected at least one cell line;

g) selecting individual clones based on their viability in the encapsulation device;

h) optionally repeating steps d) to g) sequentially to further refine the selected line.

According to a particular aspect, step a) of the method of the invention is described in Reiser et al, 2000, J Virol. 2000, 74(22): 10589-10599 ; Amendola et al, 2005, Nat Biotech, 23, 108-116 can be performed using two separate lentiviral vectors or one single bicistronic vector.

According to a specific aspect, the lentiviral vector used under step b) is a vector of pCLX type as described in Salmon, 2013, Methods Mol Biol, 945, 417-448 .

According to a specific aspect, said at least one primary human myoblast provided for transduction under step b) is obtained from human myoblasts by enzyme digestion as described in Laumonier et al., 2017, J Vis Exp., 26(125). can be separated by standard methods such as

According to a further specific aspect, the growth of the cells under step c) is until the non-immortalized cells die.

According to a further specific aspect, the growth of the cells under step c) is carried out for at least 1.5 months, ie for the time necessary for the non-immortalized cells to die.

According to a specific embodiment, selection of primary human myoblasts expressing the surface marker CD56 and optionally the additional surface markers CD82 and/or CD146 can be achieved by flow cytometry.

According to a particular aspect, the myoblasts selected under step c) of the method of the invention provide myoblast phenotypic markers CD56+, CD146+ and CD82+. It is further particularly unexpected that the method of the invention allows the selection of cell subpopulations with such triple positivity, since not all CD56 positive cells were found to be CD82 positive cells. According to a further specific aspect, the method according to the invention advantageously comprises a selection/enrichment step on the basis of the surface markers described herein.

According to a specific aspect, step d) is performed until the cells show stable proliferation and viability when maintained in culture for 4 weeks.

According to another aspect of the invention, there is provided a method for producing genetically engineered immortalized human myoblasts expressing a therapeutic protein under hypoxic conditions, the method comprising:

i) providing at least one immortalized primary human myoblast;

ii) transducing said at least one immortalized primary human myoblasts with a lentiviral vector for expression of a target protein under the control of a phosphoglycerate kinase (PGK) promoter (eg human PGK);

iii) separately growing each isolated cell obtained under step ii) in separate culture and amplification media;

iv) selecting at least one cell line showing the highest level of secretion for the target protein, such as by ELISA or Western blotting, from among all the individual culture and amplification media of step iii);

v) controlling the myogenic potential of the selected at least one cell line.

According to a specific aspect, the at least one cell line selected under step iv) is a cell line that provides a secretion level of the target protein of at least 1 pg/cell/day.

According to certain aspects, the target protein is a human glycoprotein.

According to a specific aspect, the target protein is human GM-CSF.

According to certain aspects, the target protein is a human monoclonal antibody.

According to a specific aspect, the target protein is selected from rituximab, ipilimumab, and gantenerumab.

According to certain aspects, the target protein is an antigen.

According to certain aspects, the target protein is a viral antigen.

According to a specific aspect, the target protein is a COVID-19 spike protein or antigenic fragment thereof.

According to a particular aspect, the method according to the invention uses at least one growth factor selected from fetuin, epidermal growth factor or insulin under the growth phase.

According to a particular aspect, the method according to the invention allows the cells to grow without the need to coat the culture plate.

According to another aspect, the invention provides a method of treatment by immunotherapy in a subject, said method comprising administering to said subject in need thereof at least one genetically engineered immortalized human myoblast according to the invention do.

According to another aspect, the invention provides a method of treating cancer in a subject, said method comprising administering to said subject at least one genetically engineered immortalized human myoblast according to the invention.

According to another aspect, the invention provides a method of vaccinating a subject against a viral infection, said method comprising administering to a subject in need thereof a therapeutically effective amount of a genetically engineered immortalized human myoblast of the invention. and wherein said cell expresses a viral antigen.

cell according to the invention

According to a specific aspect of the invention, there is provided a composition comprising an immortalized human myoblast cell line derived from a primary human myoblast or an immortalized human myoblast or a progeny thereof, wherein the cell expresses CDK4 and hTERT and an antibiotic resistance gene retains myoblast characteristics, such as the ability to differentiate into myotubes in the absence of expression of

According to another aspect of the invention, the immortalized human myoblast cell line according to the invention exhibits a proliferation rate corresponding to a doubling time of from about 24 to about 72 hours for at least 6 months.

According to another aspect of the invention, the immortalized human myoblast cell line according to the invention exhibits a survival period of at least about 48 hours under hypoxic conditions in standard myoblast culture medium.

According to a specific aspect of the invention, there is provided an immortalized human myoblast according to the invention, which can continue to grow stably for up to at least 6 months in a myoblast culture medium.

The immortalized human myoblasts according to the invention have demonstrated long-term survival in encapsulation devices while maintaining high levels of secretion of the protein of interest and are therefore unique and for further development of novel cell lines genetically engineered to secrete the protein of interest in various areas of application. It provides a very advantageous platform.

For example, genetically engineered immortalized human myoblasts are typically capable of secreting protein at a rate of about 1 to about 15 pg/cell/day under standard myoblast culture conditions.

According to another aspect of the invention, there is provided a composition comprising a genetically engineered immortalized human myoblast cell line or genetically engineered immortalized human myoblast or progeny thereof, wherein the cell expresses CDK4, hTERT and at least one It is capable of expressing a Therapeutic protein or antigen, maintaining myoblast characteristics and secreting the Therapeutic protein or antigen.

For example, genetically engineered immortalized human myoblasts according to the invention may express GM-CSF and secrete GM-CSF. Typically, according to certain aspects, the genetically engineered immortalized human myoblasts are capable of secreting GM-CSF at a rate of about 1 to about 5 pg/cell/day for about 6 months under standard myoblast culture conditions.

According to another aspect of the invention, human, humanized or chimeric monoclonal antibodies (eg anti-CD20 monoclonal antibodies rituximab, ipilimumab, gantenerumab) or recombinant proteins (eg mouse or human hormones or growth factors) ) or a genetically engineered immortalized human myoblast cell line expressing an antigen (eg, a viral antigen such as a COVID-19 pike protein antigen).

composition according to the invention

The invention provides cells and pharmaceutical compositions and methods thereof for treating a subject suffering from a medical disorder, preferably a mammalian subject, most preferably a human patient.

In another embodiment, the invention provides a pharmaceutical composition containing at least one cell of the invention and a pharmaceutically acceptable carrier, diluent or excipient thereof.

The immortalized cells of the invention or formulations thereof may be administered as pharmaceutical formulations which may contain one or more agents according to the invention in any form described herein. For use as encapsulated cells, the cells may be prepared as various types of suspensions or other fluid formulations in cell growth media, preferably animal-free media.

In one embodiment, the cells may be suspended in a suitable fluid medium, such as a growth or differentiation medium. The fluid medium may include a physiologically acceptable aqueous solution for growth or maintenance of living cells. For example, the fluid medium may contain glucose, salts, minerals, buffers, amino acids, hormones and growth factors that the cells need and use in vitro and/or in vivo. Suitable fluidic media for encapsulated cells are described, for example, in PBS, HBSS, MyoCult or cell growth media described herein.

In one embodiment, the cells are encapsulated in a hydrogel such as polyethylene glycol (PEG), alginate or chitosan hydrogel. PEG-based encapsulation is described in more detail in Lathuillere et al., 2014, Biomaterials 35 780-790 . Cells are described in Li, 2000, Tissue Eng., 6(2):151-63 ; Li, 1999, Tissue Eng., 5(5):453-66 ; Uludag, 2000, Adv Drug Deliv Rev., 42(1-2):29-64 , can be grown on a support matrix such as polyvinyl alcohol (PVA), PEG, polyethylene, polyester.

In one embodiment, cells encapsulated in a device that need to be cryopreserved are described in Elliott et al., 2017, Cryobiology; 76:74-91 as described in formulations containing cryoprotectants.

An implantable device or kit comprising a cell of the invention

The immortalized myoblasts of the invention can be used for ECT and therefore cells as in flat sheets as described in Lathuillere et al., 2014 (same above) or WO 2014/173441 depending on the site of implantation of the secreted protein and device. It may be encapsulated in an implant or in a hollow fiber device such as that described in Lathuillere et al., 2015 (same above). Alternative devices such as those described in Orive et al., 2019, Prog Retin Eye Res, 68:67-82 may also be used.

According to certain aspects, an implantable device containing an effective amount of immortalized human myoblasts of the invention is provided.

According to another specific aspect, there is provided a kit for cell-based therapy in a mammal comprising an effective amount of the invention of immortalized human myoblasts and instructions for use thereof for preparing a cell encapsulating implant.

According to another specific aspect, there is provided a kit for cell-based therapy in a mammal comprising an implantable device comprising an effective amount of said immortalized human myoblasts and instructions for use thereof.

According to a further embodiment, the kit of the invention may further comprise an antigenic substance useful for anti-cancer or anti-infective vaccination (eg one or more antigen(s)).

According to a specific embodiment, the cell chamber of the implantable device contains between 1.0 x 10 ⁴ cells and 8 x 10 ⁵ immortalized human myoblasts according to the invention (eg 1.0 x 10 ⁴ , 5.0 x depending on application and secreted protein). 10 ⁴ , 1.0 x 10 ⁵ , 3.0 x 10 ⁵ , 5.0 x 10 ⁵ or 8 x 10 ⁵ or 10 ⁶ cells). One of ordinary skill in the art will recognize that the exact number of cells in each chamber may vary depending on both the growth rate of the encapsulated cell/cell line and/or the volume of the individual chamber used to construct the device.

According to a specific embodiment, immortalized human myoblasts secreting GM-CSF can be modulated in an implantable capsule in view of use in personalized anti-tumor cell immunotherapy as described in WO 2017/064571. .

According to a specific embodiment, an implantable device containing at least one immortalized human myoblast according to the invention can be cryopreserved and the cryopreserved device can be stored in vapor phase using any method(s) known in the art. may be transported under liquid nitrogen (eg, -190°C) conditions and/or under dry ice (eg -70°C) conditions.

Prior to implantation, cryopreserved devices can be thawed prior to implantation using any method(s) known in the art, typically in a 37° C. water bath or in a dry bath.

According to certain aspects, viability and/or functionality of cells prior to transplantation before encapsulation and/or after thawing can be performed, such as to confirm suitability for use in transplantation. This can be done using a variety of methods known in the art. For example, cells can be stained using vital stains such as trypan blue or ethidium bromide or acridine orange or live/dead assay kits (Molecular Probes; Thermo Fisher Scientific, Waltham, MA). In a preferred embodiment, the cell population suitable for transplantation is at least about 50%, at least about 75%, at least about 95%, or at least about 99% viable. In other embodiments, a morphological characteristic of a cell can be measured as a measure of a cell's suitability for use in transplantation.

dosing mode

Cells according to the invention and formulations thereof can be administered by implantation of a biocompatible implantable device containing an effective amount of the immortalized human myoblasts of the invention allowing for the slow release of proteins secreted by living cells inside the implant. there is.

According to another aspect, the cells and formulations thereof according to the present invention are prepared as microcapsules or microspheres as described in Acarregui et al., 2013 Biomacromolecules, 14(2), 322-330 or as a hydrophobic matrix or a hydrophilic matrix, It may be administered as a biodegradable matrix or a mineral matrix.

According to another aspect, the cells according to the invention and formulations thereof can be directly injected as cell suspensions.

According to certain aspects, an implantable device suitable for a cell of the invention may be:

Disclosed herein is an implantable capsule comprising a cell receiving portion comprising a porous membrane surrounding a cell receiving chamber for receiving immortalized cells in a liquid medium therein for secretion of a therapeutic agent, the capsule further comprising a cell receiving chamber and a cell support matrix inserted within a cell receiving chamber configured for arrangement of immortalized cells therein.

In an embodiment, the cell support matrix comprises at least one yarn.

In an advantageous embodiment, said at least one yarn consists of or comprises a polyester material.

In an advantageous embodiment, the cell support matrix comprises a plurality of said yarns.

In an advantageous embodiment, the plurality of yarns is in the range of 5 to 20 yarns, preferably in the range of 5 to 15 yarns, for example about 10 yarns.

In an advantageous embodiment, the yarn extends within the cell receiving chamber over substantially the entire length of the chamber or at least 80 percent of the length of the cell receiving chamber.

In an advantageous embodiment, the cell receiving chamber comprises a polyester yarn.

In an advantageous embodiment, the cell receiving portion further comprises a membrane support mounted to a cell receiving chamber configured to provide a structural support to the porous membrane, the membrane support being made of a coil made of a biocompatible material, for example a stainless steel coil. made up of or includes

In an advantageous embodiment, the capsule further comprises an extractor portion coupled to the extractor end of the cell receiving portion configured to allow a surgical instrument to pull the implantable capsule away from the implantation site, the extractor portion comprising a retrieval thread. do.

In an advantageous embodiment, the recovery yarn is made of a yarn of polypropylene.

In an advantageous embodiment, the extractor part comprises an anchor tube 8 having a cavity therein into which the anchor part 15 of the recovery thread 9 is inserted and engaged.

In an advantageous embodiment, the anchor tube consists of or comprises a polyurethane material.

In an advantageous embodiment, the extractor portion is coupled to the cell receiving portion via a bond comprising a connector, the connector comprising a portion inserted into the extractor end of the porous membrane and a second portion inserted into the engaging end of the anchor tube.

In an advantageous embodiment, the linker is joined to the anchor tube and the cell receiving part by means of an adhesive, in particular a photocurable adhesive, for example of the photocurable urethane methacrylate type.

In an advantageous embodiment, the outer diameter of the capsules is in the range from 0.5 to 3 millimeters, preferably in the range from 0.8 to 1.5 millimeters and has a length in the range from 5 to 25 millimeters, preferably in the range from 8 to 20 millimeters.

In an advantageous embodiment, the length to diameter ratio of the capsules is in the range from 5 to 20.

Referring to FIG. 9 , an implantable capsule 1 according to an embodiment of the invention comprises a cell receiving portion 2 and an extractor portion 3 connected together by a bond 4 . The cell receiving portion 2 typically comprises a substantially cylindrical outer shape having a diameter that can range from 0.5 to 3 millimeters and a length that can typically range from 5 to 20 millimeters, for example about 10 millimeters. do. The ratio L/D of the length L to the diameter D is preferably in the range from 5 to 20, preferably in the range from 5 to 15. The capsule may be implanted in a patient's tissue by an implantation device which is itself well known in the art of implantation and need not be further described herein.

The cell receiving portion 2 allows the therapeutic agent produced by the cells 24 contained in the capsule to pass through the membrane to the surrounding tissues and fluids and electrolytes and nutrients for the cells 24 pass from the surrounding tissues through the membrane to the capsule. and a porous membrane 5 configured to allow Therefore, the porosity and type of membrane may vary depending on the particular application and type of cells contained within the capsule. In an example, the membrane is in the form of, for example, a polyether-sulfone (PES) membrane having a porosity of about 0.65 μm configured to allow passage of target molecules through the membrane. Examples of membranes that can be used in the present invention are detailed below:

Exemplary embodiments of membranes include polyethersulfones based on their biocompatible chemical composition, structural properties, as well as inherent membrane performance such as superior flow rate, downstream cleanliness and low protein binding affinity. It can be extruded into tubes of different shapes and small diameters.

The cell receiving portion (2) may be in the form of a flat sheet as described in Lathuillere et al., 2014, Biomaterials, 35 780-790 or WO 2014/173441 or Lathuillere et al., 2015 ( It may have a hollow fiber as described in the same) above.

The cell receiving portion 2 may contain an effective amount of cells (eg, 1.0×10 ⁴ , 5.0×10 ), such as about 1.0×10 ⁴ cells to 8×10 ⁵ cells, depending on the application and secreted protein, eg, depending on the interest. ⁴ , 1.0 x 10 ⁵ , 3.0 x 10 ⁵ , 5.0 x 10 ⁵ or 8 x 10 ⁵ or 10 ⁶ cells). Those skilled in the art will appreciate that the exact number of cells in the cell receiving moiety may vary depending on both the growth rate and/or the volume of the encapsulated cells/cell line of the cell receiving moiety.

The porous membrane 5 surrounds the cell receiving chamber 13 and the membrane support 6 in the cell receiving chamber 13 . The membrane support serves to mechanically support the porous membrane in order to maintain the stability of the volume in the cell receiving chamber 13 and to prevent rupture of the membrane. In the illustrated embodiment, the membrane support is in the form of a coil, in particular a stainless steel coil, which is known per se as described, for example, in WO 2017/0645701. The membrane support 6 also serves to fix the extractor part 3 via a coupling 4 .

In the illustrated embodiment, the coupling 4 comprises a connector 10 having a part 10a inserted into the membrane support 6 , in particular in this embodiment in a cylinder surrounded by a stainless steel coil. The diameter of the connector insert portion 10a may be configured to securely fit and engage the extractor end of the coil for a secure connection therebetween. The coupling 4 further comprises a fastening part 10b which engages with the anchor 8 of the extractor part 3 , whereby in the presently shown embodiment the anchor 8 is a tube, preferably of a connector 10 . It is in the form of a polyurethane (PU) tube fitted over the second end 10b. Adhesive 18a may be deposited on the connector prior to insertion of the extractor end 12b of the cell receiving portion respectively joining the ends 8a of the anchors to the anchors 8 on the connector 10 . The adhesive may advantageously be in the form of, for example, a photocurable adhesive of the type of photocurable urethane methacrylate (eg dymax 1187 M SV).

The extractor portion 3 serves to provide a means for withdrawing the implant from the patient's tissue when use of the implant is complete. In the illustrated embodiment, the extractor portion comprises a retrieval thread 9 comprising an anchor portion 15 secured to an anchor tube 8 and an anchor configured to allow the surgical device to grip the thread to withdraw the implantable capsule. It further includes a seal portion 16 extending over the tube. In the illustrated embodiment, the recovery thread 9 is made of a biocompatible yarn or yarn, for example a polypropylene type (eg Prolene ^™ suture). In an embodiment, the length of the thread extends within the hollow anchor tube 8 and comprises a knot 15a, wherein the anchor portion 15 is held in the tube by an adhesive, such as the photocurable adhesive described above, The knot increases the attachment strength of the recovery thread to the anchor tube. The recovery thread is therefore flexible and very thin, reducing patient discomfort and allowing for easy removal of the implant.

It may be noted that the extractor portion 3 may have different shapes and configurations, the purpose of which is to allow the surgical device to hold the implant and withdraw it from the patient's tissue.

As a variant, the recovery thread may be fixed directly to the connector 10 without the presence of an anchor tube, or may be formed integrally with the connector 10 . In such variations the connector may include, for example, an orifice that allows a thread to be fed through the orifice and draws the implanted capsule out of the patient tissue. A polyurethane tube, or any other material of suitable mechanical and biological properties, advantageously provides a structure to support the bonding of the recovery seal. It can also be used as a support for the tweezers during manipulation, whether it is being assembled or implanted.

The cell receiving portion (2) further comprises a cell supporting matrix (7) inserted into the cell receiving chamber. In a preferred embodiment, the cell support matrix 7 comprises one or more yarns 14 of biocompatible material, preferably a plurality of yarns extending longitudinally within the cell receiving chamber 13 . The yarn, in a preferred embodiment, extends from a location at or proximate to the extractor end 12b to a location at or proximate to the cell loading end 12a of the membrane 5 . The yarn preferably extends over the entire length or most of the length of the cell receiving chamber 13 . In a preferred embodiment, the yarn may advantageously be made of clinical grade polyester (PE), which is well known per se and already approved for surgical implantation use. Such polyester yarns are typically used to suture tissue within the patient's body. An example of a polyester yarn that can be used in an advantageous embodiment of the invention is, for example, 44/27-PET-5540-FTT-SS (Textile Development Associates, Inc). The material is a 40 denier 27 filament yarn made of textured polyester.

Cell support matrix 7 has been shown to significantly improve the performance of immortalized cells contained in cell receiving chambers, increasing both the activity and durability of release of therapeutic agents over time, particularly for adherent cells. Such adherent cells are, for example, genetically engineered cells useful in cell therapy such as genetically engineered immortalized human myoblasts, mouse myoblasts, human retinal pigment epithelial cells, stem cells, stem cell derived cell lines. As such, it has been shown that these cells 24 tend to align with the fibers of the yarn 14 , improving cell density and spacing optimized for release of therapeutic agents and uptake of nutrients. The yarn also advantageously provides a large overall surface area for attachment of cells to it.

In an exemplary embodiment, immortalized human myoblasts secreting GM-CSF are loaded into the cell receiving portion (2) of the capsule of the invention. Such capsules are useful for personalized anti-tumor cell immunotherapy.

Cells are loaded into the cell receiving portion in a cell growth medium suitable for the cell type, such as Ham's F12 or DMEM supplemented with growth factors or fetal bovine serum. Additionally, for cells to be frozen, a freezing medium/cryopreservative is also added to the cell growth medium, such as glycerol.

In an exemplary embodiment, the cell receiving cavity 13 can receive therein, for example 5 to 20 yarns 14 arranged in parallel within a cavity extending substantially the entire length of the cavity. The yarn can be inserted into the cell receiving cavity 13 by pulling one end of it through the cavity, and the bond 4 attaches the membrane support 6 and the cell support matrix 14 to the porous membrane 5 . It is mounted on the extractor end (12b) of the cell receiving portion (2) after being finished.

It can be noted that the cell support matrix 7 can be preassembled to the membrane support 6 by inserting it into the tubular porous membrane 5, for example through the inside of the coil, prior to its insertion into the tubular porous membrane 5 of the pre-assembled coils and cell support matrix. there is.

The cell support matrix 7 therefore, in particular in the form of the yarn 14 , has a very advantageous effect of optimizing the distribution of cells in an orderly manner within the cell receiving chamber, thereby improving the secretion yield and rate for a given volume. . Moreover, this configuration allows the length of the cell receiving portion to be easily modified by simply changing the cut length of the yarn to the corresponding length of the coil of the porous membrane tube and the membrane support 6 . Moreover, the use of well-characterized biocompatible implantable polyesters does not adversely affect the safety of the device.

It was also observed that the presence of a cell support matrix 7 allowed for freezing and thawing of the contained cells without affecting the viability of the cells. The presence of the matrix 7 improves the freezing and thawing properties of the capsules, which are particularly advantageous as they allow the capsules to be stored for an extended period of time in the frozen state and ready for use in the treatment of a patient when needed. In particular, it will be shown that improved distribution of cells, particularly adherent cells, along the yarn contributes to maintaining high viability during freezing and thawing processes.

The cells in the liquid medium are transferred to the cell receiving chamber by means of a cell loading device 20 (shown only partially and schematically in the examples) comprising an outlet nozzle 22 inserted into the cell loading end 12a of the porous membrane 5 . (13) can be inserted.

The implantable capsule 1 may be supplied in a pre-assembled arrangement with a cell loading device. In this embodiment, the nozzle 22 of the cell loading device may be attached to the cell loading end 12a of the membrane by, for example, an adhesive 18c, such as the photocurable adhesive already described above. The cell loading device may comprise a catheter tube allowing the cells of the liquid medium to be injected through the catheter tube into the cell receiving chamber of the capsule, and the air contained within the cell receiving capsule may be pushed through the porous membrane 5 . there is.

However, as noted above, the capsule may be filled with ready-to-use immortalized cells and medium and the cell receiving end 12 hermetically sealed by a plug (not shown) and then frozen until needed for patient treatment. .

The implantable devices of the invention may be implanted in a living subject at a variety of sites, including under the skin (eg subcutaneously). Alternatively, the device may be implanted at an intrathecal, intracerebral, intraosseous, intratumoral, intrapleural, intraocular, or intraperitoneal site.

The dosage administered to a subject, either as single or multiple doses, will depend on a variety of factors, including pharmacokinetics, patient condition and characteristics (gender, age, weight, health, size), severity of symptoms, concomitant treatments, number of treatments, and desired effect. will depend on

Combination

According to the invention, the cells and pharmaceutical formulations thereof are used alone or as co-agents useful for preventing and/or treating cancer, in particular cancer cell antigens and/or immune checkpoints such as PD-1, PD-L1 or CTLA4 inhibitors. inhibitors or co-agents useful for preventing and/or treating autoimmune disorders.

The invention encompasses administration of the cells of the invention or formulations thereof, which are administered to a subject prior to, concurrently or sequentially with other therapeutic regimens or co-agents.

A cell of the invention or a formulation thereof according to the invention administered concurrently with said co-agent may be administered in the same or different composition(s) and by the same or different route(s) of administration.

According to one embodiment, there is provided a pharmaceutical formulation comprising at least one cell of the invention in combination with at least one co-agent useful for preventing and/or treating cancer and at least one pharmaceutically acceptable carrier.

object

According to another aspect, the cells, devices, kits and methods of the invention are useful for the treatment of a subject in need of treatment with a therapeutic protein.

According to certain aspects, the cells, devices, kits and methods of the invention provided are useful for the treatment of cancer.

According to certain aspects, the cancer is selected from non-Hodgkin's lymphoma, head and neck cancer, melanoma, lung cancer, bladder cancer, kidney cancer, triple negative breast cancer, colorectal cancer, stomach cancer, pancreatic cancer, ovarian cancer, prostate cancer, sarcoma and chordoma.

According to another specific aspect, the provided cells, devices, kits and methods are useful for treatment by immunotherapy.

According to another specific aspect, the cells, devices, kits and methods of the invention provided are useful for the treatment of inflammatory disorders.

According to another specific aspect, the provided cells, devices, kits and methods are useful for the treatment of neurodegenerative disorders.

According to a particular aspect, the neurodegenerative disorder is selected from Alzheimer's disease and Parkinson's disease.

According to another specific aspect, the provided cells, devices, kits and methods are useful for the prevention and/or treatment of infectious diseases, particularly viral infections.

According to certain aspects, the viral infection is a COVID-19 viral infection.

According to another specific aspect, the immortalized cells and methods according to the invention provide for vaccination with a tumor antigen (such as a tumor or viral antigen) or the patient's own immunity to increase the efficacy of an immune response against neoplastic cells or viral particles. Can be used to increase system capabilities.

For example, cells that secrete GM-CSF immunostimulatory cytokines are described in Gupta & al., 2010, Moving Forward. Discov Med., 50:52-60 may be usefully used as part of personalized anti-tumor cell immunotherapy.

According to a specific aspect, the immortalized cells and methods according to the invention comprise other proteins (such as antibodies or antibody fragments).

For applications in the field of oncology, it may be useful in the context of the invention for the following proteins to be secreted by encapsulated cells:

Trastuzumab (Herceptin®), Pertuzumab (Perjeta®) for breast cancer (HER2+), Rituximab (Rituxan®) for lymphoma and CML (chronic myelogenous leukemia), Bli for acute lymphocytic leukemia (ALL) Natumomab (Biincyto®), obinutuzumab (Gazyva®) for chronic lymphocytic leukemia (CLL), ofatumumab (Arzerra®), cetuximab (Erbitux®) for colon and head and neck cancer, colon cancer Panitumumab (Vectibix®) for lung cancer, nesitumumab (Portrazza®) for lung cancer, bevacizumab (Avastin®) for colon or recurrent brain tumors, ramucirumab (Cyramza®) for gastric cancer, melanoma, lung cancer , nivolumab (Opdivo®), pembrolizumab (Keytruda®), atezolizumab (Tecentriqu®), durvalumab (lmfizi®), avelumab (Bavencio®) for advanced cancers such as head and neck, bladder and kidney cancers ), ipilimumab (Yervoy®) for melanoma and kidney cancer, daratumumab (Darzalex®) or elotuzumab (empliciti®) for multiple myeloma, dinutuximab (Unitixin®) for neuroblastoma, Olaratumab (Lartuvo®) for soft tissue sarcoma and Catumaxomab (Removab®) for refractory ovarian cancer.

For applications in the field of inflammatory disorders, it may be useful for the following proteins to be secreted by encapsulated cells in the context of the invention:

For adalimumab (Humira®), infliximab (Remicade®), golimumab (Simponi®), systemic lupus erythematosus for colon inflammatory disorder, polyarthritis rheumatoid arthritis, ankylosing spondyloarthritis polyarthritis rheumatism, and psoriasis belimumab (Benlysta®), tocilizumab (Actemra®), sarilumab (Kevzara®) for polyarthritis rheumatoid arthritis or juvenile polyarthritis, brodalumab (Siliq®), ixekizumab (Taltz®) for psoriasis ), secukinumab (Cosentyx®), guselkumab (Tremfya®) for psoriasis, ustekinumab (Stelara®) for psoriasis and Crohn's disease, vedolizumab (Entyvio®) for ulcerative colitis and Crohn's disease , canakinumab (Ilaris®) for cryopyrin-associated periodic syndrome, daclizumab (Zinbryta®) or natalizumab (Tysabri®) for multiple sclerosis, ocrelizumab (Ocrevus®), dupilumab for atopic dermatitis (Dupixent®), mepolizumab (Nucala®), reslizumab (Cinqai®) and benralizumab (Fasenra®) for asthma, ranibizumab (Lucentis®) for macular degeneration.

For applications in other therapeutic fields, therapeutic proteins, in particular insulin or antibodies as described in Kaplon et al, 2019, Mabs, 11(2):219-238 .

For applications in the field of neurodegenerative disorders, it may be useful for the following proteins to be secreted by encapsulated cells in the context of the invention: Gantenerumab, aducanumab for Alzheimer's disease, progressive nuclear palsy or frontotemporal dementia , PRX002/RG7935 (pracinezumab), BIIB-054 (cinpanemab) or MEDI1341/TAK-341 (Astra Zeneca, Takeda Pharmaceutical Company).

According to a specific embodiment, in the field of vaccines, it may be useful for the following proteins to be secreted by encapsulated cells in the context of the invention.

According to a specific embodiment, antigen(s) and vaccine adjuvant(s) may be secreted by genetically engineered immortalized human myoblasts according to the invention, wherein said cells secreting antigen(s) such as GM-CSF and cells that secrete the vaccine adjuvant(s) are placed in separate implantable biocompatible devices (administered in proximity to each other) or such different secreting cells are loaded into the same implantable biocompatible device.

According to another specific embodiment, the immortalized human myoblasts according to the invention may be transduced for expression of both at least one antigen and at least one vaccine adjuvant.

According to another specific embodiment, the immortalized human myoblasts according to the invention can be transduced for the expression of several antigens (such as spike protein and E protein from COVID-19) against the same pathological agent or with the same pathology. The genetically engineered immortalized human myoblasts according to the invention that secrete several antigens against an antagonistic agent can be used simultaneously (eg in the same implantable device).

Methods and uses according to the invention

The invention provides a genetically engineered immortalized human myoblast according to the invention for use in the prophylaxis and/or treatment of a disorder or disease, in particular cancer, an inflammatory disorder or a neurodegenerative disorder.

The invention further relates to the genetically engineered immortalized human myoblasts according to the invention for the manufacture of a pharmaceutical agent (such as an encapsulated cell preparation) useful for the prophylaxis and/or treatment of a disorder or disease, in particular cancer, an inflammatory disorder or a neurodegenerative disorder. provides the use of

The invention further provides a method for preventing or treating a related disorder or disease, in particular cancer, inflammatory disorder or neurodegenerative disorder in a subject, said method comprising a therapeutically effective amount of the genetically engineered immortalized human myoblasts of the invention in need thereof and administering to a subject with

According to one aspect, the genetically engineered immortalized human myoblasts according to the invention are useful for the treatment of cancer (eg ). For example, genetically engineered immortalized human myoblasts according to the invention secrete GM-CSF.

In particular, the genetically engineered immortalized human myoblasts according to the invention are useful for the treatment of cancer.

According to another aspect, the genetically engineered immortalized human myoblasts according to the invention are useful for the treatment of inflammatory disorders (eg rheumatoid arthritis). For example, genetically engineered immortalized human myoblasts according to the invention secrete an anti-TNF alpha antibody.

The references cited herein are incorporated herein by reference in their entirety. Having described the invention, the following examples are provided by way of illustration and not limitation.

Example

The following studies are performed to support the effectiveness of the inventive cells and methods according to the invention.

The following abbreviations each represent the following definitions:

DAPI (4,6 diamidino-2-phenylindole); DMEM (Dulbecco's Modified Eagle's Medium); DPBS (Dulbecco's Phosphate Buffered Saline); EDTA (ethylenediamine tetraacetic acid); FBS (fetal bovine serum); HBSS (Hank's Buffered Salt Solution); MEF (myocyte enhancer factor); PFA (paraformaldehyde).

Example 1: Preparation of Immortalized Human Myoblast Cell Line

An immortalized human myoblast cell line was prepared according to the method according to the invention as detailed below:

The following reagents were used:

Myoblast Growth Medium (GM):

- 15% FBS (GIBCO 10101145)

- bovine serum albumin (Sigma-Aldrich A4503; 0.5 mg/ml)

- Fetuin (Desert Biological 302070; 0.5 mg/ml)

- Epidermal growth factor (R&D Systems 236-GMP-200; 10 ng/ml)

- Dexamethasone (PharmaServ 8016; 0.39 μg/ml)

- Insulin (Sigma-Aldrich I9278; 0.04 mg/ml)

- Creatine monohydrate (ParmaServ 8114; 149 μg/ml)

- Pyruvate (Gibco 11360039; 100 μg/ml)

- uridine (U3003; 50 μg/ml)

- Hams F10 (GIBCO 41550021) supplemented with gentamicin (Gibco 15710049; 5 μg/ml)

Myoblast differentiation medium (DM):

- bovine serum albumin (Sigma-Aldrich A4503; 0.5 mg/ml)

- Epidermal growth factor (R&D Systems 236-GMP-200; 10 ng/ml)

- Insulin (Sigma-Aldrich I9278; 10 μg/ml)

- Creatine monohydrate (ParmaServ 8114; 149 μg/ml)

- Pyruvate (Gibco 11360039; 100 μg/ml)

- uridine (U3003; 50 μg/ml)

- DMEM (GIBCO 61965026) supplemented with gentamicin (Gibco 15710049; 10 μg/ml)

Blocking solution:

- Goat serum (Sigma G9023, 2%)

- Tween 20 (AppliChem A1389, 0.2%)

HBSS (GIBCO 14175053)

PFA 4% (Santa Cruz sc-281692)

Triton X-100 (AppliChem A1388)

Liquid Blockers (Arcus Biologicals NAN-012)

Ab mouse anti-MF20 (Hybridoma Bank)

Ab rabbit anti-MEF2 (Santa Cruz sc-313)

Ab goat anti-mouse Alexa 488 (Life A11029)

Ab goat anti-rabbit Alexa 546 (Life A11035)

DPBS (Sigma D8537) with DAPI Fluoromount-G (SouthernBiotech 0100-20).

1.1 Human Myoblast Cell Source

Human myoblasts were obtained from human muscle tissue obtained with informed consent as small muscle fragments dissected during reconstructive surgery from a non-smoking, 32-year-old female donor without significant medical history or chronic disease suffering from left knee trauma from anterior cruciate ligament injury. Eligibility criteria for tissue donation were defined in accordance with the FDA guidelines "Determining the Eligibility of Donors of Human Cells, Tissues, and Cell and Tissue-Based Products (HCT/P)". The criteria were as follows:

- Age > 18

- Healthy subjects: no identified chronic conditions including muscle disease

- Planned orthopedic surgery

- Negative screening test for the following infectious diseases: HIV type 1 & 2, HBV, HCV, Treponema pallidum, HTLV 1 & 2, West Nile virus.

And the study protocol was approved by the Ethics Committee of Geneva.

1.2 Isolation and Growth Stages of Primary Myoblasts

Under sterile conditions in a cell culture hood, human muscle tissue was washed with DMEM. Adipose and fibrous tissue was removed with tweezers and scissors. The tissue was placed in a Petri dish with 5 ml of trypsin EDTA 0.05% and cut into millimeter pieces with scissors. The muscle pieces containing the trypsin were transferred to a sterile dissociation bottle. A volume of trypsin EDTA 0.05% was completed to 90 ml for up to 3 g of tissue. Tissues were incubated at 37° C. for 60 minutes under agitation. Digestion was stopped with 10% FBS. The muscle solution was then filtered through a 70 μm cell strainer and centrifuged at 1000 rpm for 5 min at room temperature (RT) to pellet the cells. After discarding the supernatant, the pellet was dissolved in DMEM and filtered through a 40 μm cell strainer. 200,000 cells per 60 mm Petri dish were plated in 3.5 ml of growth medium (GM). Cells were incubated at 37° C. and 5% CO ₂ . After cells reached 75% confluence, GM was removed and cells were washed with HBSS. A minimum volume of trypsin EDTA 0.05% was applied to cover the surface of the cells and incubated at 37° C. for 3 minutes. The reaction was stopped with an equal volume of GM. Cells were collected and centrifuged at 1000 rpm for 5 min at room temperature. The supernatant was discarded, the cells washed with GM and centrifuged again. For cell staining, cells were resuspended in 200 μl of GM and the following antibodies were added: 3 μl anti-CD56-AlexaFluor488, 0.5 μl anti-CD82-PE, 3 μl anti-CD146-PECy7.

After incubation at 4° C. for 30 min, cells were washed and sorted by flow cytometry using a MoFlo Astrios EQ (Beckman Coulter). Myoblasts were defined as CD56+ CD146+ CD82+.

1.3 Myoblast immortalization using lentiviral vectors encoding CDK4 and hTERT (steps b) and c))

Immortalization of the myoblasts obtained above was achieved by transduction of catalytic subunits of two genes, cyclin-dependent kinase 4 (CDK4) and human telomerase (hTERT), as previously suggested ( Zhu et al., 2007, Aging Cell, 6, 515-523 ). The transgene was cloned into the 3rd generation pCLX lentiviral vector backbone under the expression of a human phosphoglycerate kinase (hPGK) promoter as described in Salmon, 2013, Methods Mol Biol., ;945:417-48 . Specific viral infectivity was titrated on HeLa target cells and expressed in units of transduction per ml (TU/ml) ( Barde et al., 2010, Curr Protoc Neurosci, Chapter 4, Unit 4 21, 10.1002/0471142301.ns0421s53).

On day 0, primary human myoblasts were seeded at 20,000 to 30,000 cells per well of a 24-well plate in 500 μl of GM. On day 1, cells were infected with lentivirus. To achieve immortalization, cells were subjected to a multiplicity of infection (MOI; number of cell copies/cell) of 3 for each vector (pCLX-PGK-hTERT and pCLX-PGK-CDK4 described herein). On day 2, 500 μl of fresh GM was added to each well. On day 3, cells were passaged into new culture dishes.

Cells were maintained in culture at 37° C. under 5% CO ₂ and proliferation was quantified using an automatic cell counter (Countess, ThermoFischer). The number of population doublings at each passage was defined as log N/log 2, where N is the number of cells obtained at confluence divided by the number of initially seeded cells. While primary myoblasts stopped proliferating after 45 days, cells transduced with lentivirus continued to grow stably for up to 6 months as can be seen under FIG. 1 .

This confirms that transduction of primary myoblasts with lentiviral vectors encoding CDK4 and hTERT can efficiently immortalize cells.

1.4 Myoblast growth and cloning (steps d) and e))

After the cells reached 75% confluence, as previously described in Laumonier et al., 2017 (same above), Cells were detached, washed and stained with anti-CD56-AlexaFluor488, anti-CD82-PE and anti-CD146-PECy7. After incubation at 4° C. for 30 min, cells were washed and sorted by flow cytometry using a MoFlo Astrios EQ (Beckman Coulter) in 96-well plates with one cell per well. Myoblasts were defined as CD56+ CD146+ CD82+. Individual clones were then cultured in growth medium, amplified and sorted by sorting 1 cell/well in 96 well plates from the immortalized myoblast population (I) using single cell cloning. A total of 33 clones were isolated, and the proliferation rate of 9 selected clones retaining qualitative morphological characteristics (1-3, 5-6, 13, 17 and 20-21) was quantified at each passage using automatic cell counting. As can be seen in FIG. 2 , it was proved that it was stably maintained over time.

1.5 Control of the differentiation potential of myoblasts into myotubes (step f))

To evaluate the myoblastic potential of myoblast clones obtained by the method of the invention after immortalization and sorting (after step d)), maintenance of their ability to express their myogenic markers over time (on CD56, CD82 and CD146) triple positive) was quantified by flow cytometry and its preserved ability to fuse and differentiate into myotubes was quantified as follows. Cells were plated in 35 mm culture dishes in GM. When cells reached 100% confluence, GM was removed, cells were washed with HBSS, and differentiation medium was added. After 72 h, cells were washed twice with DPBS and fixed with PFA 4% for 15 min at 4°C. After washing with DPBS three times, a circle was drawn around the cells with a waterproof pen and the blocking solution was applied at room temperature for 30 minutes. Primary antibodies were incubated overnight at 4°C (mouse anti-MF20 diluted 1/1000 in blocking solution and rabbit anti-MEF diluted 1/300 in blocking solution). After washing 3 times with DPBS and incubation with blocking solution for 5 min, secondary antibodies were incubated for 1 h at room temperature (goat anti-mouse Alexa 488 diluted 1/1000 in blocking solution, 1/1000 in blocking solution). goat anti-rabbit Alexa 546) diluted with . After washing 3 times with PBS, coverslips were mounted with DAPI Fluoromount-G. For quantification of percent differentiation and fusion index, 7 pictures per condition were randomly acquired at 20X on a fluorescence microscope. The number of MEF positive nuclei and DAPI nuclei was quantified.

As can be seen in FIG. 3 , the immortalized myoblasts obtained by the method of the present invention maintained myoblast phenotypic markers such as expression of myogenic markers (CD56, CD82 and CD146) and the ability to fusion and differentiate into myotubes. As can be seen, some clones demonstrated stable myogenic markers and others lost expression, suggesting low stability, so the clone showing the best stability was used for subsequent experiments. In particular, clone 61.27 deposited under number CCOS 1901 (derived from clone 2 above, deposited under number CCOS 1902) was used for encapsulation studies.

The resulting immortalized myoblast cell line was characterized as follows to examine its suitability for encapsulation techniques:

Myoblast encapsulation ability

The ability to encapsulate the resulting immortalized myoblasts was evaluated as follows: GM was removed and 75% confluent cells were washed with HBSS. A minimal volume of TrypLE (Thermo Fisher) was added to cover the cell surface and incubated at 37° C. for 3 minutes. The cells were then gently detached from the dish surface. The reaction was stopped with an equal volume of HBSS. Cells were collected and counted in duplicate using an automatic cell counter (Countess II instrument, Thermo Fisher). Cells were centrifuged at 1,000 rpm for 5 minutes at room temperature and resuspended in 25 μl GM per 800,000-1,000,000 cells. 25 μl of the cell suspension was loaded into capsules containing hollow fibers with an inner matrix as described in FIGS. 9 and 5 for immortalized myoblasts genetically engineered for GM-CSF secretion. Immortalized human cells of hematopoietic origin, genetically modified to produce GM-CSF encapsulated in the device described in WO 2017/064571 loaded into capsules containing hollow fibers as described in Lathuiliere et al., 2015 (same above) (MVX-1) is used as a control. The vasculon (the loading tube of the capsule) was cut and the capsule was sealed using a UV-sensitive adhesive (Dymax). The capsules were then placed in 2 ml of GM in a 12-well plate for 24 hours before implantation.

Based on their proliferation rate and differentiation capacity, 6 clones (#1, #2, #6, #13, #17 and #21) were used for evaluation. These clones were encapsulated and maintained in culture for up to 1 month. The capsules were then fixed and processed for histological analysis. Qualitative assessment of viability was then performed and this assay analyzed the living cell density (presence of living cells in the center of the device and It was concluded that clones #2 and #13 had excellent viability characteristics based on the way the cells spread inside).

Myoblast cell culture under hypoxic conditions

The behavior of immortalized myoblasts obtained under hypoxic conditions was tested as follows: Cells were plated and incubated for 24 h under standard conditions to allow cell adhesion. The culture dish was then placed in a hypoxic incubator chamber at 37°C with 1% oxygen for 24 hours. When the recombinant protein needed to be quantified in the culture medium, fresh medium pre-incubated for 24 h in a hypoxic chamber was added to the cells for 2 h prior to quantification.

Example 2: Alternative method for sorting immortalized human myoblasts under step d)

Alternatively, in the method for establishing an immortalized human myoblast cell line according to the invention, isolation of the immortalized human myoblast clone under steps c) and d) is performed on the encapsulated myoblast population according to steps c1) to c4) can do.

The immortalized myoblast population obtained under 1.3 was encapsulated in an implantable device with an inner matrix as described in FIG. 9 .

The device was implanted in the mouse subcutaneous tissue for 3 weeks. After 3 weeks, the device was recovered and placed in culture medium. The capsule was sectioned and its contents (cells and matrix) were replenished into the dish's culture medium. Cells were maintained in culture for several weeks for expansion. Cells were then detached and stained for FACS sorting of human myoblasts (defined as CD56+, CD146+, CD82+). Individual human myoblast clones were isolated from this myoblast population.

The myogenic potential (differentiation into root canals) of three of these clones appeared unaffected. The proliferation rate of these clones was also monitored for several weeks and had a doubling time of about 24 to about 72 hours for at least 6 months.

Example 3: Preparation of Genetically Modified Immortalized Human Myoblast Cell Line

The immortalized human myoblast cell line obtained by the method of the invention is useful for the production of genetically modified cells for the production of a protein of interest, in particular for its secretion within the capsule.

3.1 Myoblast Transduction for Secretion of Recombinant GM-CSF (Step ii))

For expression of human or murine GM-CSF, human or murine GM-CSF cDNA was cloned into the pCLX lentiviral vector under expression of the human PGK promoter, as described in Salmon, 2013 (same above).

The human PGK promoter contains a hypoxia response element, an enhancer that upregulates gene expression under hypoxic conditions ( Firth et al., 1994, Proc. Natl. Acad. Sci. USA, 91, 6496-6500 ). To identify these primary myoblasts with a lentiviral vector (MOI=5) encoding GFP under expression of a phosphoglycerate kinase (PGK) or ubiquitin (UBI) promoter and after 36 h in 1% oxygen, cells were Fixed and fluorescence quantified by flow cytometry and in myoblasts, myoblasts suppressed expression of GFP under hypoxic conditions when the PGK promoter drives more potent expression compared to UBI and is driven by the PGK promoter as opposed to the UBI promoter. Upregulation was observed.

For this reason, the PGK promoter was used for the genetic engineering of immortalized human myoblasts of the invention because secretion of the target protein will be enhanced when the myoblasts are encapsulated. Therefore, clones #2 and #13 obtained in Example 1 were transduced with different concentrations of the lentivirus and different MOIs (3-100) were applied to the cells.

The ability to secrete recombinant proteins by genetically modified immortalized human myoblasts was quantified as follows:

Cells were seeded into T75 cell culture flasks. After reaching 75% confluence, the cells were washed with HBSS and 5 ml of fresh growth medium was added at 37° C. for 2 hours. Media was then collected for GM-CSF quantification and cells were counted using an automatic cell counter (Countess II instrument, Thermo Fisher). Different ELISA kits were used depending on the protein to be quantified (GM-CSF human ELISA kit #KHC2011, GM-CSF mouse ELISA kit #BMS612, IgG (total) human ELISA kit #BMS2091, Thermo Fisher). The protocol was applied according to the manufacturer's instructions. Results were reported in pg/cell/day. As shown under Figure 4a, the expression of GM-CSF was obtained from genetically immortalized human myoblasts of the invention.

The secretion of GM-CSF from the cell population generated from the transduced immortalized clone #2 was monitored weekly for 9 weeks and the transduction with the lentiviral vector was highly stable GM-CSF-secretion as shown under Figure 4b. It was found to be efficient for generating cell lines.

3.2 Isolation of human GM-CSF-secreting clones (steps iii) and iv))

From two GM-CSF expression populations (clones #2.100 &#13.10), 125 individual clones were sorted and the expression of GM-CSF was measured for all clones. For each population, 10 clones secreting the highest levels of GM-CSF in the range of about 1-4 pg/cell/day were tested for several weeks of their secretion of GM-CSF ( FIG. 4C ) and their proliferation ( FIG. 5A ). ) was monitored. Such data support that the secretion and proliferation rates of GM-CSF secreting clones remained stable over time.

The stability of expression of myogenic markers over time (triple positive for CD56, CD82 and CD146) and their ability to fusion and differentiate into myotubes for isolated GM-CSF-secreting myoblast clones are detailed above. was evaluated and confirmed as shown in FIG. 6 .

The resulting genetically modified immortalized myoblasts were characterized as follows to examine their suitability for encapsulation techniques:

Myoblast encapsulation ability

The ability to encapsulate the resulting immortalized myoblasts was assayed as described above for 6 clones selected based on their GM-CSF secretion level, growth rate and myogenic properties, i. Differentiation capacity was encapsulated and then tested in vivo (mouse subcutaneous tissue).

Implantation of Hollow Fiber Encapsulation Device in Mice

All experiments on mice were conducted in accordance with Swiss regulations for the care and use of laboratory animals. Animals were reared and maintained in a specific pathogen-free environment and provided with ad libitum access to water and feed. Adult Rag2/I12rg double knockout mice ( Shinkai, 1992, Cell, 6;68(5):855-67 ) were anesthetized with isoflurane and the capsules were implanted subcutaneously using a trocar. The wounds were closed with surgical staples and the animals were returned to their home cages. Anesthesia was provided by subcutaneous injection of 0.1 mg/kg of buprenorphine 20 minutes prior to anesthesia and 2 mg/ml of acetaminophen in drinking water for 3 days. At the end of the experiment, mice were sacrificed with a lethal dose of sodium pentobarbital injection. Devices were dissected and directly fixed to perform histological analysis or placed back into culture medium for later quantification of recombinant protein expression. Histological treatments were performed as previously described ( Schwenter et al., 2011, Cancer Gene Ther., 18, 553-562 ).

GM-CSF secretion levels were measured from the capsules before transplantation and after explants (weeks 1 and 3). GM-CSF was also measured in mouse serum. Histological analyzes were also performed on the capsules after explantation to qualitatively measure cell viability. This experiment was performed using an encapsulation device with an inner matrix as described in Example 5 and FIG. 9 . Hematopoietic origin used in current clinical trials n° NCT02193503 (Phase 1) NCT02999646 (Phase 2 in HNSCC), where secretion levels were genetically modified to prepare GM-CSF encapsulated in devices such as those described in WO 2017/064571 compared with those obtained with immortalized human cells (MVX-1) of

As can be seen in FIG. 7 , all encapsulated clones provided much higher secretion levels than MVX-1 cells, thus confirming the beneficial effect of the immortalized cells of the invention, particularly for use in encapsulation therapy.

Clone #61.27 deposited under number CCOS1901 (derived from clone 2, deposited under number 1902) was then transferred to its high secretion rate (about 3 pg/cell/day) and the highest serum level of GM-CSF (61.27 clone). Clone #62.14 was selected because it was selected based on the high transduction of GMCSF by The proliferation rate of these two clones as the non-encapsulated and encapsulated cells described in Figure 8 was monitored in vitro for 6 hours and the GM-CSF secretion rate was also monitored in vitro for several months. FIG. 8 shows in vitro non-encapsulated cells expressed as the number of doubling cell populations (N) versus the number of weeks (W) after sorting of clones from a genetically modified immortalized human myoblast population, as described in Example 3; Proliferation rate (a), in vitro secretion expressed as line (W) versus non-encapsulated cells after sorting (b) and in vitro secretion expressed as line (W) versus encapsulated cells after encapsulation (c) and control encapsulated cells (MVX-1) and in vivo secretion rates in mice as encapsulated cells measured by quantification of GM-CSF in serum (d) and in tissue surrounding the capsule (e) compared to pre-transplantation compared to (MVX-1) Stability over time of two clones 61.27 and 62.14 in perspective is shown.

The encapsulation device described in Example 5 and shown in Figure 9 was loaded into such clones and the secretion of GM-CSF was monitored for several months in vitro as described above compared to the encapsulated cells as defined above (MVX-1). did.

Freezing and thawing of encapsulation devices preloaded with human myoblasts

The effect of different freezing conditions on GM-CSF expression levels after thawing was tested. Capsules were loaded with the described genetically modified GM-CSF secreting immortalized myoblasts (clones 61.27 and 62.14 in cryo medium containing different concentrations of glycerol used as cryopreservative). Prior to freezing, the loaded capsules were suspended and incubated in freezing medium for varying periods of time. For freezing, capsules were placed in silicone tubes pre-filled with freezing medium and transferred to freezing tubes. The freezing tubes were quickly transferred to a CoolCell freezing vessel (Biocision) and placed overnight at -80°C before being transferred to liquid nitrogen for long-term storage.

For thawing, frozen capsules in silicone tubes were transferred to pre-warmed GMs in 10-cm Petri dishes. After gentle agitation, the capsules were removed from the silicone tube and placed in a 12-well culture plate containing GM.

As can be seen from FIG. 10 , the GM-CSF-secreting myoblasts of the present invention performed much better than the control cell line (MVX1) after freezing in glycerol ( FIG. 10c ). The use of 10% glycerol as the freezing medium ( FIGS. 10b and c ) and incubation times of 0-30 min of cells with the freezing medium before freezing were well tolerated.

Example 4: Diversity of Possible Genetically Modified Immortalized Human Myoblast Cell Lines for Making Therapeutic Proteins

The ability of immortalized myoblasts according to the invention to be genetically engineered for expression of complex molecules of therapeutic interest, such as antibodies.

therapeutic macromolecule

Myoblast transduction for secretion of recombinant anti-human CD20 IgG (step ii))

For expression of anti-human CD20 IgG, the variable region of rituximab heavy chain was inserted into the human IgG1 heavy chain framework and the variable region of rituximab light chain was inserted into the human kappa light chain framework. Both sequences were synthesized and cloned into the third generation pLV-hPGK-WPRE lentiviral vector (Vectorbuilder) described in SEQ ID NOs: 6 and 7. Cells were transfected with heavy and light chain vectors using the same MOI for both transgenes as described in Lathuiliere, 2016, Methods Mol Biol., 1448:139-155 .

Immortalized myoblasts obtained from clone 2 under Example 1 were treated with different doses of lentivirus (MOI) as described in Example 2, using the method previously described ( Lathuiliere et al., 2016 (same above)) for commercialized therapeutic antibiotics. - Transduced with a lentiviral vector encoding the heavy and light chains of rituximab, a CD20 monoclonal antibody. The secretion of IgG was then quantified in the culture medium and the functionality of the secreted anti-CD20 IgG was verified by flow cytometry. In a competition assay, human PBMCs (peripheral blood mononuclear cells) were pre-incubated with different concentrations of either myoblast-generated anti-CD20 IgG or commercial rituximab followed by incubation with a fluorescently tagged anti-CD20 antibody. . Such experiments supported the resulting IgG to behave exactly like rituximab in this assay as shown in FIG. 11A . Moreover, myoblast-generated IgG was induced in the cytotoxic response (IFN-gamma or CD107a) following exposure of the B-cell line to either rituximab or myoblast-generated anti-CD20, as shown in FIGS. 11B and 11C . was efficient in a degranulation assay that tested the induction of overexpression of

The resulting anti-CD20 IgG secreting myoblasts were then loaded into an implantable device as described in Example 5 and under FIG. 9 (two cell populations CD20.30 & CD20.100 tested, 10 ⁶ cells/device) ) was transplanted into the mouse subcutaneous tissue. Prior to implantation, secretion of IgG from the capsule is quantified in the culture medium. Anti-CD20 IgG plasma levels from live animals are then quantified every two weeks.

Myoblast transduction for secretion of anti-CTLA4 IgG

For expression of anti-human CTLA4 IgG, the variable region of ipilimumab heavy chain (WO 200/1014424) was inserted into the human IgG1 heavy chain framework and the variable region of ipilimumab light chain (WO 2001/014424) was inserted into the human kappa light chain framework. inserted. Both sequences were synthesized and cloned into a third generation pLV-hPGK-WPRE lentiviral vector (Vectorbuilder) as described in SEQ ID NOs: 2 and 3. Cells were transfected with heavy and light chain vectors using the same MOI for both transgenes as described in Lathuiliere, 2016, Methods Mol Biol., 1448:139-155 .

Immortalized myoblasts obtained from clone 2 under Example 1 were commercialized using the previously described method ( Lathuiliere et al., 2016 (same above)) with different doses of lentivirus (MOI) as described in Example 2 It was transduced with a lentiviral vector encoding the heavy and light chains of ipilimumab, a therapeutic anti-CTLA4 monoclonal antibody. The secretion of IgG in the culture medium was then quantified by ELISA and the bioactivity of secreted anti-CTLA4 IgG was verified by CTLA-4 blocking bioassay as shown in FIG. 13 : aAPC/Raji cells and CTLA-4 effector cells. were antigen presenting cells and effector cells in this study, respectively. CTLA-4 effector cells were Jurkat T cells expressing human CTLA-4 and a luciferase reporter gene whose expression is regulated by NFAT-RE upstream. aAPC/Raji cells were Raji cells expressing endogenous CD80/CD86 and cell surface proteins capable of activating TCR.

When positive control or secreted anti-CTLA4 was added, they were able to block the interaction between CTLA-4 and CD80/CD86 and immunosuppression was released, thereby activating T cells and activating NFAT-induced luciferase expression. can do. The blocking activity of the anti-CTLA-4 antibody was evaluated in terms of luciferase activity. As can be seen in FIG. 13 , the myoblast-generated antibody expressed by the genetically engineered immortalized human myoblasts according to the invention was compared with the ipilimumab biosimilar as a positive control. The assay demonstrated that myoblast-generated anti-CTLA4 showed significant blocking activity on the interaction between CTLA-4 and CD80/CD86. EC ₅₀ was equivalent to the positive control (Yervoy ^™ , Bristol-Myers Squibb SA), ie 1.519 compared to 1.573 for the control group.

Myoblast transduction for secretion of anti-amyloid beta (gantenerumab)

For expression of anti-human amyloid beta IgG, the variable region of the gantenerumab heavy chain (EP 1960428) was inserted into the human IgGl heavy chain framework and the variable region of the gantenerumab light chain (EP 1960428) was inserted into the human kappa light chain framework. Both sequences were synthesized and cloned into a third generation pLV-hPGK-WPRE lentiviral vector (Vectorbuilder) as described in SEQ ID NOs: 3 and 4. Cells were transfected with heavy and light chain vectors using the same MOI for both transgenes as described in Lathuiliere, 2016 (same above).

The immortalized myoblasts obtained from clone 2 under Example 1 were then prepared as described above, and a lentiviral vector encoding the heavy and light chains of an anti-amyloid beta monoclonal antibody, gantenerumab, an anti-amyloid beta monoclonal antibody, lentiviral vector. was transduced with different doses of lentivirus (MOI) as described in Example 2 using a method previously described as ( Lathuiliere et al., 2016 (same above)). The secretion of IgG was then quantified in the culture medium by ELISA. The functionality of the antibody was tested by performing immunohistochemistry on brain sections that come in the case of human Alzheimer's disease. Briefly, sections were deparaffinized, antigen retrieval was performed in citrate buffer, and sections were incubated overnight at 4°C with supernatants of transduced human myoblasts. After washing in PBS, the secondary antibody was incubated for 2 h at room temperature. Sections were washed and images were acquired microscopically. Positive staining was observed on the sections, suggesting that the secreted antibody was functional (arrow, Figure 14).

heterologous protein

To test the ability of the immortalized human myoblasts of the invention to be genetically engineered to produce proteins from different species, the immortalized myoblast clones obtained under Example 1 were encoded with a murine GM-CSF (mu-GM-CSF) protein. were transduced with different doses (MOI) of the lentiviral vector. Individual mu-GM-CSF-secreting clones were then isolated from the transduced population and one clone selected and encapsulated in the implantable device described in Example 5 and under FIG. 9 (10 ⁶ cells/device). Delivery of muGM-CSF was quantified in vitro for several weeks.

The biological activity of secreted muGM-CSF was confirmed by an in vivo experiment in which a passive cellular immune response was detected in the vicinity of a subcutaneously implanted encapsulation device. muGM-CSF secretion levels were measured before transplantation and after explantation at different time points (days 1, 3, 5 and 7). Some capsules were maintained in vitro during the experiment as comparators. A decrease in secretion level was observed, which is consistent with previous findings and the large-volume immune infiltrates generated by GM-CSF biological activity affect encapsulated cell viability. The influx of inflammatory cells can reduce oxygen and nutrient diffusion towards the encapsulated cells.

All these data support that the immortalized human myoblasts of the invention provide exceptionally long-term viability, while retaining myoblast characteristics beyond 100 days even in an encapsulated environment. Such immortalized human myoblasts can be genetically engineered to produce high levels of a protein of interest (eg, antibodies, antibody fragments, growth factors, cytokines, etc.) in an encapsulated environment in which they can proliferate. Finally, after encapsulation, such cells can be frozen immediately after loading and thawed later, an important feature that will be very convenient for future clinical applications.

Example 5: Comparison of the behavior of immortalized cells for the invention in different devices

In the following experiment, two types of implantable capsules are compared: the capsules described in FIG. 9 for groups A and B, and the capsules described in WO 2017/064571 for contrast comparison group C (conventional capsules).

Group A: Capsules are loaded with cells of the invention (immortalized human myoblast cell line expressing human GM-CSF (cell line deposited under number CCOS1901).

Group B: Capsules are loaded with the control cell line: K562 human erythroleukemia cells expressing human GM-CSF.

Group C: Capsules are loaded with the same control cell line: K562 human erythroleukemia cells expressing human GM-CSF.

Conventional capsules do not enclose any support matrix and are therefore not suitable for loading with adherent cells such as human myoblasts. To compare the efficacy of two distinct capsules to generate huGM-CSF over time, the K562 human erythroleukemia cell line expressing human GM-CSF was used as a replacement cell line to generate the protein of interest. Groups B and C provide a direct comparison of the performance of the two capsules as the two distinct capsules contain the same genetically engineered cell line expressing the same therapeutic protein of interest according to the invention.

Under sterile culture conditions, approximately 800,000 cells were loaded into the capsule. Capsules were maintained in culture medium at 37° C. and 5% CO ₂ . Delivery of human GM-CSF was quantified in culture medium using ELISA (kit #KHC2011, Thermo Fischer) and recorded in ng/24 hours ( FIG. 12A ).

Then, the capsule was implanted in the mouse subcutaneous tissue for 1 week. After sacrifice, the capsules were recovered from the animals and placed in culture medium for quantification of human GM-CSF delivery ( FIG. 12B ). In addition, GM-CSF was quantified in mouse serum (Fig. 12c) as well as in the subcutaneous tissue surrounding the capsule (Fig. 12d).

These data show that culturing the known genetically engineered K562 human erythroleukemia cell line expressing human GM-CSF in a matrix containing macrocapsules according to an embodiment of the present invention is compared with capsules as described in WO 2017/064571 to support already showing improvement. However, the combination with the novel genetically engineered immortalized myoblasts according to the invention in a matrix containing macrocapsules according to an embodiment of the present invention is not sufficient to achieve sustained and stable GM-CSF production both in vitro and in vivo. It is by far the most efficient.

Example 6: Diversity of Possible Genetically Modified Immortalized Human Myoblast Cell Lines Producing Antigens of Interest

The ability of immortalized myoblasts according to the invention to be genetically engineered for expression and secretion of antigens of interest, such as for vaccination purposes, was assayed as follows.

For expression of the COVID-19 spike protein trimer [NC_045512.2(21563..25384)], the DNA sequence encoding residues 1-1,208 of the COVID-19 S protein (UNIPROT P0DTC2 SPIKE_SARS2) at positions 986 and 987 It was modified with a proline substitution, a GSAS substitution at furin cleavage sites 682-685, addition of the T4 fibritin trimerization domain and codon optimization for expression in human cells (SEQ ID NO: 1). The modified sequence was then synthesized and cloned into a third generation pLV-hPGK-WPRE lentiviral vector (Vectorbuilder). Myoblasts were infected at various MOIs. The secretion of the spike protein in the culture medium was assessed by dot blot. Briefly, 3 ml of pure culture or diluted supernatant was loaded onto a nitrocellulose membrane, the membrane was blocked with PBS with 3% dry milk, washed 3 times with PBS and 1 mg/ml of AI 334 (US 2010/ 0172917; Yuan et al., 2020, Science, 8;368(6491):630-633 ) or AQ 806 ( https://oap.unige.ch/journals/abrep/article/view/186 ; https:// oap.unige.ch/journals/abrep/article/view/219 ; Wrap et al., 2020, Cell, 28;181(5):1004-1015 ) Geneva Antibody Facility https://www.unige.ch (available from /medecine/antibodies/cov-resources/) was probed overnight. Membranes were revealed after incubation with HRP labeled secondary antibody. As a result of the analysis, it was verified that the spike protein was secreted into the supernatant of the transduced immortalized myoblasts (FIG. 15).

These data support that immortalized myoblasts according to the invention can be successfully modified to express a variety of therapeutic proteins. In the case of viral antigens, the immortalized myoblasts according to the invention genetically engineered to express them can be used advantageously in vaccination strategies, especially in combination with agents that increase the immune response.

sequence list

SEQ ID NO: 1 - DNA sequence for expression of spike protein by immortalized myoblasts

ATGTTCGTTTTCCTTGTTCTGTTGCCTCTCGTTAGTAGCCAATGTGTCAACCTTACTACTAGAACCCAGCTCCCTCCAGCATATACCAACAGCTTCACCCGGGGCGTATATTATCCGGACAAAGTGTTTCGCTCAAGTGTGCTGCATTCTACGCAGGACCTTTTTTTGCCCTTTTTTAGTAATGTTACTTGGTTTCATGCTATCCATGTGTCTGGAACTAACGGAACCAAACGGTTTGACAACCCCGTCCTCCCTTTCAACGATGGCGTGTATTTCGCCTCCACGGAAAAGTCGAACATCATTCGCGGCTGGATCTTTGGTACAACACTCGACTCAAAGACGCAGAGCCTGCTAATCGTCAATAACGCTACAAATGTTGTGATCAAGGTGTGTGAATTTCAGTTCTGCAATGATCCCTTCCTGGGGGTGTACTACCATAAAAATAACAAGAGCTGGATGGAGTCCGAATTTAGGGTTTACAGTTCCGCTAACAACTGCACATTCGAGTACGTAAGCCAGCCATTTCTTATGGATCTTGAGGGCAAGCAAGGAAACTTCAAGAATTTAAGGGAGTTCGTGTTCAAAAATATCGATGGCTATTTTAAAATATATAGCAAGCACACTCCAATAAACTTAGTGCGAGACCTGCCCCAGGGATTTTCGGCTCTAGAGCCCCTGGTGGATCTGCCAATTGGAATAAACATAACCCGCTTTCAAACACTGCTAGCCCTGCATAGAAGTTACCTCACCCCTGGTGATAGTAGTTCCGGATGGACAGCAGGGGCCGCCGCATACTATGTCGGCTACCTGCAGCCTAGGACCTTCTTACTGAAGTATAACGAGAACGGTACAATAACCGACGCTGTGGACTGCGCTCTGGACCCTCTGTCCGAGACGAAGTGTACCCTAAAGAGCTTTACCGTTGAAAAAGGCATTTATCAAACCAGCAATTTCCGGGTCCAGCCAACCGAGAGCATCGTCAGATTTCCCAACATTACAA ATCTGTGTCCCTTCGGCGAGGTGTTTAACGCCACACGTTTCGCCTCAGTGTACGCATGGAACCGTAAACGAATATCTAACTGTGTCGCGGATTATTCTGTCCTCTACAACTCCGCCTCTTTCTCCACCTTCAAGTGCTACGGGGTGTCACCGACTAAGCTGAACGATCTCTGCTTTACCAACGTCTACGCGGACTCCTTCGTGATCAGAGGGGATGAGGTGAGACAAATCGCCCCAGGTCAGACTGGGAAAATCGCAGATTACAACTACAAATTGCCTGATGATTTCACTGGGTGCGTCATCGCGTGGAACTCTAATAACCTCGATTCTAAGGTCGGGGGGAACTACAATTATCTGTACCGCCTATTTAGGAAGTCAAACCTGAAACCTTTCGAGCGGGATATTTCAACCGAAATCTATCAAGCGGGGTCAACACCTTGTAATGGTGTGGAAGGATTTAACTGCTACTTCCCCCTGCAGTCTTACGGATTTCAGCCAACCAATGGCGTGGGTTACCAACCTTATCGGGTGGTGGTTCTAAGTTTCGAACTGTTGCACGCTCCCGCCACGGTATGCGGGCCAAAAAAGAGCACTAACTTGGTGAAGAATAAGTGCGTGAATTTCAATTTCAATGGCCTCACTGGAACCGGAGTACTGACCGAATCCAATAAGAAGTTCTTGCCCTTTCAGCAGTTCGGAAGAGACATTGCCGACACAACCGACGCGGTGCGGGATCCTCAGACTCTGGAGATATTAGACATTACACCATGTAGCTTTGGCGGGGTGTCTGTCATTACTCCGGGCACGAATACTAGCAATCAGGTAGCCGTGCTGTACCAAGACGTGAATTGCACAGAGGTTCCCGTCGCAATTCACGCTGACCAGCTGACCCCCACGTGGAGGGTTTACAGCACTGGCAGTAATGTCTTCCAGACGAGAGCCGGTTGTTTGATCGGAGCGGAACATGTGAATAACTCCTACGAGTGCGACATCCCCATCGG AGCCGGTATATGCGCCTCTTATCAGACACAAACTAATTCACCCGGCTCCGCCTCCAGTGTAGCTTCTCAAAGCATTATAGCATATACAATGTCTCTTGGGGCCGAAAATTCCGTGGCCTATTCGAACAATTCAATCGCCATCCCAACCAACTTTACAATCAGCGTGACGACCGAAATTCTGCCTGTGAGCATGACGAAAACCAGCGTAGACTGCACTATGTATATCTGTGGGGACTCCACTGAGTGCTCCAACCTTCTCCTGCAGTACGGGAGCTTCTGTACCCAATTAAACCGTGCCCTTACAGGCATCGCTGTTGAGCAGGATAAGAATACCCAGGAAGTTTTTGCCCAGGTTAAGCAGATATACAAAACACCGCCAATTAAAGACTTCGGAGGCTTCAACTTCTCTCAGATACTGCCTGACCCTTCCAAGCCATCAAAACGGAGCTTCATTGAGGACCTCTTGTTCAACAAAGTGACTCTGGCTGATGCTGGCTTCATTAAGCAGTACGGAGATTGCCTGGGGGATATTGCTGCCAGGGATCTCATCTGTGCCCAGAAGTTTAATGGCCTGACAGTCTTGCCTCCACTTCTGACAGACGAGATGATTGCACAGTACACAAGTGCCCTCCTCGCTGGCACCATAACATCCGGATGGACATTTGGTGCAGGTGCTGCCCTCCAGATTCCCTTTGCAATGCAGATGGCGTATCGCTTTAACGGCATCGGTGTCACACAAAACGTGTTGTATGAGAACCAAAAGCTCATCGCTAACCAGTTTAATTCTGCTATTGGGAAAATTCAGGACAGCCTGTCATCGACCGCGTCTGCCCTTGGGAAGTTGCAGGACGTGGTGAATCAGAATGCTCAGGCCTTAAATACTCTGGTGAAACAACTCTCTTCAAATTTCGGCGCAATCAGCTCTGTGTTAAACGACATCCTAAGTAGGCTTGATCCGCCGGAGGCTGAAGTTCAAATTGATAGATTGATTACTGGCAGG CTCCAGTCTTTACAGACCTACGTTACACAGCAGCTGATCCGAGCGGCTGAGATTAGAGCTTCCGCCAATCTGGCCGCAACCAAGATGTCCGAATGTGTCCTGGGTCAGTCAAAGCGGGTCGACTTTTGTGGTAAAGGCTACCACCTCATGTCATTTCCCCAGAGTGCACCTCACGGAGTAGTGTTCCTCCACGTCACCTACGTTCCAGCACAGGAAAAGAATTTTACCACTGCACCGGCAATCTGTCACGACGGCAAGGCACACTTCCCCCGAGAGGGCGTATTCGTGTCGAATGGAACTCATTGGTTCGTCACACAGCGAAACTTTTATGAGCCTCAGATCATTACCACCGATAATACATTTGTGTCCGGGAACTGCGACGTTGTCATTGGAATCGTCAACAACACTGTATACGATCCACTTCAGCCAGAACTGGATAGCTTTAAGGAAGAATTGGACAAATATTTCAAAAATCACACTTCACCCGATGTGGACCTGGGGGACATTAGTGGGATCAATGCATCCGTGGTCAATATCCAAAAAGAGATTGACAGGCTCAACGAGGTGGCCAAAAATCTGAACGAAAGTCTTATCGATCTGCAAGAATTGGGAAAATATGAGCAGGGCAGCGGCTATATCCCAGAGGCCCCCCGCGACGGCCAGGCCTACGTACGCAAGGATGGCGAGTGGGTGCTGCTGAGCACCTTCCTGTGA

SEQ ID NO: 2 - Lentiviral vector construct encoding the light chain of ipilimumab (pLV-hPGK-WPRE)

AATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAA ATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTACTAGTGATTATCGGATCAACTTTGTATAGAAAAGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGA CGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAGGCAAGTTTGTACAAAAAAGCAGGCTGCCACCATGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCCGAGATCGTGCTGACCCAGAGCCCCGGCACCCTGAGCCTGAGCCCCGGCGAGAGAGCCACCCTGAGCTGCAGAGCCAGCCAGAGCGTGGGCAGCAGCTACCTGGCCTGGTACCAGCAGAAGCCCGGCCAGGCCCCCAGACTGCTGATCTACGGCGCCTTCAGCAGAGCCACCGGCATCCCCGACAGATTCAGCGGCAGCGGCAGCGGCACCGACTTCACCCTGACCATCAGCAGACTGGAGCCCGAGGACTTCGCCGTGTACTACTGCCAGCAGTACGGCAGCAGCCCCTGGACCTTCGGCCAGGGCACCAAGGTGGAGATCAAGAGAACCGTGGCCGCCCCCAGCGTGTTCATCTTCCCCCCCAGCGACGAGCAGCTGAAGAGCGGCACCGCCAGCGTGGTGTGCCTGCTGAACAACTTCTACCCCAGAGAGGCCAAGGTG CAGTGGAAGGTGGACAACGCCCTGCAGAGCGGCAACAGCCAGGAGAGCGTGACCGAGCAGGACAGCAAGGACAGCACCTACAGCCTGAGCAGCACCCTGACCCTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCACCAGGGCCTGAGCAGCCCCGTGACCAAGAGCTTCAACAGAGGCGAGTGCTGAACCCAGCTTTCTTGTACAAAGTGGTGATAATCGAATTCCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGGAATTCCCGCGGTTCGCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGA TCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCC CTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGG TTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGAGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGT TCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT

SEQ ID NO: 3 - Lentiviral vector construct encoding the heavy chain of ipilimumab (pLV-hPGK-ipi-HC-WPRE)

AATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAA ATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTACTAGTGATTATCGGATCAACTTTGTATAGAAAAGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGA CGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAGGCAAGTTTGTACAAAAAAGCAGGCTGCCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTTAGAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGAGCGGCGGCGGCGTGGTGCAGCCCGGCAGAAGCCTGAGACTGAGCTGCGCCGCCAGCGGCTTCACCTTCAGCAGCTACACCATGCACTGGGTGAGACAGGCCCCCGGCAAGGGCCTGGAGTGGGTGACCTTCATCAGCTACGACGGCAACAACAAGTACTACGCCGACAGCGTGAAGGGCAGATTCACCATCAGCAGAGACAACAGCAAGAACACCCTGTACCTGCAGATGAACAGCCTGAGAGCCGAGGACACCGCCATCTACTACTGCGCCAGAACCGGCTGGCTGGGCCCCTTCGACTACTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGCCAGCACCAAGGGCCCCAGCGTGTTCCCCCTGGCCCCCAGCAGCAAGAGCACCAGCGGCGGCACCGCCGCCCTGGGCTGCCTGGTGAAGGACTAC TTCCCCGAGCCCGTGACCGTGAGCTGGAACAGCGGCGCCCTGACCAGCGGCGTGCACACCTTCCCCGCCGTGCTGCAGAGCAGCGGCCTGTACAGCCTGAGCAGCGTGGTGACCGTGCCCAGCAGCAGCCTGGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCCAGCAACACCAAGGTGGACAAGAGAGTGGAGCCCAAGAGCTGCGACAAGACCCACACCTGCCCCCCCTGCCCCGCCCCCGAGCTGCTGGGCGGCCCCAGCGTGTTCCTGTTCCCCCCCAAGCCCAAGGACACCCTGATGATCAGCAGAACCCCCGAGGTGACCTGCGTGGTGGTGGACGTGAGCCACGAGGACCCCGAGGTGAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCACAACGCCAAGACCAAGCCCAGAGAGGAGCAGTACAACAGCACCTACAGAGTGGTGAGCGTGCTGACCGTGCTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTGAGCAACAAGGCCCTGCCCGCCCCCATCGAGAAGACCATCAGCAAGGCCAAGGGCCAGCCCAGAGAGCCCCAGGTGTACACCCTGCCCCCCAGCAGAGACGAGCTGACCAAGAACCAGGTGAGCCTGACCTGCCTGGTGAAGGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCCGTGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAAGCTGACCGTGGACAAGAGCAGATGGCAGCAGGGCAACGTGTTCAGCTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGAGCCCCGGCAAGTGAACCCAGCTTTCTTGTACAAAGTGGTGATAATCGAATTCCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTC CTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGGAATTCCCGCGGTTCGCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACT GCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAA AGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCC ACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGAGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGG ATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT

SEQ ID NO: 4 - Lentiviral vector construct encoding the heavy chain of gantenerumab ( pLV-hPGK-Gant HC-WPRE )

AATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAA ATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTACTAGTGATTATCGGATCAACTTTGTATAGAAAAGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGA CGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAGGCAAGTTTGTACAAAAAAGCAGGCTGCCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTTAGAGGTGTCCAGTGTCAGGTGGAGCTGGTGGAGAGCGGCGGCGGCCTGGTGCAGCCCGGCGGCAGCCTGAGACTGAGCTGCGCCGCCAGCGGCTTCACCTTCAGCAGCTACGCCATGAGCTGGGTGAGACAGGCCCCCGGCAAGGGCCTGGAGTGGGTGAGCGCCATCAACGCCAGCGGCACCAGAACCTACTACGCCGACAGCGTGAAGGGCAGATTCACCATCAGCAGAGACAACAGCAAGAACACCCTGTACCTGCAGATGAACAGCCTGAGAGCCGAGGACACCGCCGTGTACTACTGCGCCAGAGGCAAGGGCAACACCCACAAGCCCTACGGCTACGTGAGATACTTCGACGTGTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGCCAGCACCAAGGGCCCCAGCGTGTTCCCCCTGGCCCCCAGCAGCAAGAGCACCAGCGGCGGCACCGCCGCC CTGGGCTGCCTGGTGAAGGACTACTTCCCCGAGCCCGTGACCGTGAGCTGGAACAGCGGCGCCCTGACCAGCGGCGTGCACACCTTCCCCGCCGTGCTGCAGAGCAGCGGCCTGTACAGCCTGAGCAGCGTGGTGACCGTGCCCAGCAGCAGCCTGGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCCAGCAACACCAAGGTGGACAAGAGAGTGGAGCCCAAGAGCTGCGACAAGACCCACACCTGCCCCCCCTGCCCCGCCCCCGAGCTGCTGGGCGGCCCCAGCGTGTTCCTGTTCCCCCCCAAGCCCAAGGACACCCTGATGATCAGCAGAACCCCCGAGGTGACCTGCGTGGTGGTGGACGTGAGCCACGAGGACCCCGAGGTGAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCACAACGCCAAGACCAAGCCCAGAGAGGAGCAGTACAACAGCACCTACAGAGTGGTGAGCGTGCTGACCGTGCTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTGAGCAACAAGGCCCTGCCCGCCCCCATCGAGAAGACCATCAGCAAGGCCAAGGGCCAGCCCAGAGAGCCCCAGGTGTACACCCTGCCCCCCAGCAGAGACGAGCTGACCAAGAACCAGGTGAGCCTGACCTGCCTGGTGAAGGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCCGTGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAAGCTGACCGTGGACAAGAGCAGATGGCAGCAGGGCAACGTGTTCAGCTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGAGCCCCGGCAAGTGAACCCAGCTTTCTTGTACAAAGTGGTGATAATCGAATTCCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGA CTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGGAATTCCCGCGGTTCGCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTT CACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGA TAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAA TCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGAGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCG TATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT

SEQ ID NO: 5 - Lentiviral vector construct encoding the light chain of gantenerumab ( pLV-hPGK-Gant LC-WPRE )

AATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAA ATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTACTAGTGATTATCGGATCAACTTTGTATAGAAAAGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGA CGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAGGCAAGTTTGTACAAAAAAGCAGGCTGCCACCATGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCCGACATCGTGCTGACCCAGAGCCCCGCCACCCTGAGCCTGAGCCCCGGCGAGAGAGCCACCCTGAGCTGCAGAGCCAGCCAGAGCGTGAGCAGCAGCTACCTGGCCTGGTACCAGCAGAAGCCCGGCCAGGCCCCCAGACTGCTGATCTACGGCGCCAGCAGCAGAGCCACCGGCGTGCCCGCCAGATTCAGCGGCAGCGGCAGCGGCACCGACTTCACCCTGACCATCAGCAGCCTGGAGCCCGAGGACTTCGCCACCTACTACTGCCTGCAGATCTACAACATGCCCATCACCTTCGGCCAGGGCACCAAGGTGGAGATCAAGAGAACCGTGGCCGCCCCCAGCGTGTTCATCTTCCCCCCCAGCGACGAGCAGCTGAAGAGCGGCACCGCCAGCGTGGTGTGCCTGCTGAACAACTTCTACCCCAGAGAGGCCAAGGTG CAGTGGAAGGTGGACAACGCCCTGCAGAGCGGCAACAGCCAGGAGAGCGTGACCGAGCAGGACAGCAAGGACAGCACCTACAGCCTGAGCAGCACCCTGACCCTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGCGAGGTGACCCACCAGGGCCTGAGCAGCCCCGTGACCAAGAGCTTCAACAGAGGCGAGTGCTGAACCCAGCTTTCTTGTACAAAGTGGTGATAATCGAATTCCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGGAATTCCCGCGGTTCGCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGA TCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCC CTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGG TTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGAGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGT TCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT

SEQ ID NO: 6 - Lentiviral vector construct encoding the light chain of rituximab (pLV-hPGK-ritux-LC-WPRE)

AATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAA ATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTACTAGTGATTATCGGATCAACTTTGTATAGAAAAGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGA CGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAGGCAAGTTTGTACAAAAAAGCAGGCTGCCACCATGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCCATGGCCCAGATCGTGCTGAGCCAGTCTCCTGCCATCCTGAGTGCTAGCCCTGGCGAGAAAGTGACCATGACCTGTAGAGCCAGCAGCAGCGTGTCCTACATCCACTGGTTCCAGCAGAAGCCTGGCAGCAGCCCTAAGCCTTGGATCTACGCCACAAGCAATCTGGCCAGCGGCGTGCCAGTCAGATTTTCTGGCTCTGGCAGCGGCACCAGCTACAGCCTGACAATCTCTAGAGTGGAAGCCGAGGACGCCGCCACCTACTATTGTCAGCAGTGGACCAGCAATCCTCCTACCTTTGGCGGAGGCACCAAGCTGGAAATCAAGAGAACCGTCGCCGCTCCTAGCGTGTTCATCTTCCCACCTTCCGACGAGCAGCTGAAGTCTGGCACAGCCTCTGTCGTGTGCCTGCTGAACAACTTCTACCCCAGAGAAGCCAAGGTGCAGTGG AAGGTGGACAACGCCCTGCAGAGCGGCAATAGCCAAGAGAGCGTGACCGAGCAGGACAGCAAGGACTCTACCTACAGCCTGAGCAGCACCCTGACACTGAGCAAGGCCGACTACGAGAAGCACAAAGTGTACGCCTGCGAAGTGACCCACCAGGGCCTTTCTAGCCCTGTGACCAAGAGCTTCAACCGGGGCGAGTGTTGAACCCAGCTTTCTTGTACAAAGTGGTGATAATCGAATTCCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGGAATTCCCGCGGTTCGCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAG CCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGA CGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATT GCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGAGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTC CTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT

SEQ ID NO: 7 - Lentiviral vector construct encoding the heavy chain of rituximab (pLV-hPGK-ritux-HC-WPRE)

AATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAA ATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGCTAGCTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTACTAGTGATTATCGGATCAACTTTGTATAGAAAAGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGA CGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCTCACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCGGCTGCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAGGCAAGTTTGTACAAAAAAGCAGGCTGCCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTTAGAGGTGTCCAGTGTCAGGTTCAGCTGCAGCAGCCTGGCGCCGAACTTGTGAAACCTGGCGCCTCTGTGAAGATGAGCTGCAAGGCCAGCGGCTACACCTTCACCAGCTACAACATGCACTGGGTCAAGCAGACCCCTGGCAGAGGCCTGGAATGGATCGGAGCCATCTATCCCGGCAACGGCGACACCTCCTACAACCAGAAGTTCAAGGGCAAAGCCACACTGACCGCCGACAAGAGCAGCAGCACAGCCTACATGCAGCTGTCCAGCCTGACCAGCGAAGATAGCGCCGTGTACTACTGCGCCAGAAGCACCTATTACGGCGGCGACTGGTACTTCAACGTGTGGGGAGCTGGCACCACCGTGACAGTGTCTGCCGCCTCTACAAAGGGCCCTAGCGTTTTCCCACTGGCTCCCAGCAGCAAGAGCACATCTGGTGGAACAGCCGCTCTGGGCTGCCTGGTC AAGGATTACTTTCCCGAGCCTGTGACCGTGTCCTGGAATTCTGGCGCTCTGACAAGCGGCGTGCACACCTTTCCAGCAGTGCTGCAAAGCAGCGGCCTGTACTCTCTGAGCAGCGTGGTCACAGTGCCTAGCTCTAGCCTGGGCACCCAGACCTACATCTGCAATGTGAACCACAAGCCTAGCAACACCAAGGTGGACAAGAAGGTGGAACCCAAGAGCTGCGACAAGACCCACACCTGTCCTCCATGTCCTGCTCCAGAACTGCTCGGCGGACCTTCCGTGTTCCTGTTTCCTCCAAAGCCTAAGGACACCCTGATGATCAGCAGAACCCCTGAAGTGACCTGCGTGGTGGTGGATGTGTCCCACGAGGATCCCGAAGTGAAGTTCAATTGGTACGTGGACGGCGTGGAAGTGCACAACGCCAAGACCAAGCCTAGAGAGGAACAGTACAACAGCACCTACAGAGTGGTGTCCGTGCTGACCGTGCTGCACCAGGATTGGCTGAACGGCAAAGAGTACAAGTGCAAGGTGTCCAACAAGGCCCTGCCTGCTCCTATCGAGAAAACCATCAGCAAGGCCAAGGGCCAGCCTAGGGAACCCCAGGTTTACACACTGCCTCCAAGCAGGGACGAGCTGACCAAGAATCAGGTGTCCCTGACCTGTCTCGTGAAGGGCTTCTACCCCTCCGATATCGCCGTGGAATGGGAGAGCAATGGCCAGCCTGAGAACAACTACAAGACAACCCCTCCTGTGCTGGACTCCGACGGCTCATTCTTCCTGTACAGCAAGCTGACAGTGGACAAGTCCAGATGGCAGCAGGGCAACGTGTTCTCCTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAAAGCCTGTCTCTGAGCCCCGGCAAATAGACCCAGCTTTCTTGTACAAAGTGGTGATAATCGAATTCCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACT ATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGGAATTCCCGCGGTTCGCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATT TTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAA TATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGT TTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGAGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAAT TGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT

<110> MAXIVAX SA LES HOPITAUX UNIVERSITAIRES DE GENEVE UNIVERSITE DE GENEVE <120> IMMORTALIZED MYOBLAST CELL LINES AND USES THEREOF <150> PCT/EP <151> 2020-08-12 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 3714 <212> DNA <213> Artificial Sequence <220> <223> SEQ ID NO: 1 - DNA Sequence for the expression of Spike protein by immortalized myoblasts <400> 1 atgttcgttt tccttgttct gttgcctctc gttagtagcc aatgtacctcaa ccttactact 60 agaacccagc at agcttcaccc ggggcgtata ttatccggac 120 aaagtgtttc gctcaagtgt gctgcattct acgcaggacc tttttttgcc cttttttagt 180 aatgttactt ggtttcatgc tatccatgtg tctggaacta acggaaccaa acggtttgac 240 aaccccgtcc tccctttcaa cgatggcgtg tatttcgcct ccacggaaaa gtcgaacatc 300 attcgcggct ggatctttgg tacaacactc gactcaaaga cgcagagcct gctaatcgtc 360 aataacgcta caaatgttgt gatcaaggtg tgtgaatttc agttctgcaa tgatcccttc 420 ctgggggtgt actaccataa aaataacaag agctggatgg agtccgaatt tagggtttac 480 agttccgcta acaactgcac attcgagtac gtaagccagc catttcttat ggatcttgag 540 ggcaagcaag gaaa cttcaa gaatttaagg gagttcgtgt tcaaaaatat cgatggctat 600 tttaaaatat atagcaagca cactccaata aacttagtgc gagacctgcc ccagggattt 660 tcggctctag agcccctggt ggatctgcca attggaataa acataacccg ctttcaaaca 720 ctgctagccc tgcatagaag ttacctcacc cctggtgata gtagttccgg atggacagca 780 ggggccgccg catactatgt cggctacctg cagcctagga ccttcttact gaagtataac 840 gagaacggta caataaccga cgctgtggac tgcgctctgg accctctgtc cgagacgaag 900 tgtaccctaa agagctttac cgttgaaaaa ggcatttatc aaaccagcaa tttccgggtc 960 cagccaaccg agagcatcgt cagatttccc aacattacaa atctgtgtcc cttcggcgag 1020 gtgtttaacg ccacacgttt cgcctcagtg tacgcatgga accgtaaacg aatatctaac 1080 tgtgtcgcgg attattctgt cctctacaac tccgcctctt tctccacctt caagtgctac 1140 ggggtgtcac cgactaagct gaacgatctc tgctttacca acgtctacgc ggactccttc 1200 gtgatcagag gggatgaggt gagacaaatc gccccaggtc agactgggaa aatcgcagat 1260 tacaactaca aattgcctga tgatttcact gggtgcgtca tcgcgtggaa ctctaataac 1320 ctcgattcta aggtcggggg gaactacaat tatctgtacc gcctatttag gaagtcaaac 1380 ctgaaacctt tcgagcggga tatttc aacc gaaatctatc aagcggggtc aacaccttgt 1440 aatggtgtgg aaggatttaa ctgctacttc cccctgcagt cttacggatt tcagccaacc 1500 aatggcgtgg gttaccaacc ttatcgggtg gtggttctaa gtttcgaact gttgcacgct 1560 cccgccacgg tatgcgggcc aaaaaagagc actaacttgg tgaagaataa gtgcgtgaat 1620 ttcaatttca atggcctcac tggaaccgga gtactgaccg aatccaataa gaagttcttg 1680 ccctttcagc agttcggaag agacattgcc gacacaaccg acgcggtgcg ggatcctcag 1740 actctggaga tattagacat tacaccatgt agctttggcg gggtgtctgt cattactccg 1800 ggcacgaata ctagcaatca ggtagccgtg ctgtaccaag acgtgaattg cacagaggtt 1860 cccgtcgcaa ttcacgctga ccagctgacc cccacgtgga gggtttacag cactggcagt 1920 aatgtcttcc agacgagagc cggttgtttg atcggagcgg aacatgtgaa taactcctac 1980 gagtgcgaca tccccatcgg agccggtata tgcgcctctt atcagacaca aactaattca 2040 cccggctccg cctccagtgt agcttctcaa agcattatag catatacaat gtctcttggg 2100 gccgaaaatt ccgtggccta ttcgaacaat tcaatcgcca tcccaaccaa ctttacaatc 2160 agcgtgacga ccgaaattct gcctgtgagc atgacgaaaa ccagcgtaga ctgcactatg 2220 tatatctgtg gggactccac tgagtgctcc a accttctcc tgcagtacgg gagcttctgt 2280 acccaattaa accgtgccct tacaggcatc gctgttgagc aggataagaa tacccaggaa 2340 gtttttgccc aggttaagca gatatacaaa acaccgccaa ttaaagactt cggaggcttc 2400 aacttctctc agatactgcc tgacccttcc aagccatcaa aacggagctt cattgaggac 2460 ctcttgttca acaaagtgac tctggctgat gctggcttca ttaagcagta cggagattgc 2520 ctgggggata ttgctgccag ggatctcatc tgtgcccaga agtttaatgg cctgacagtc 2580 ttgcctccac ttctgacaga cgagatgatt gcacagtaca caagtgccct cctcgctggc 2640 accataacat ccggatggac atttggtgca ggtgctgccc tccagattcc ctttgcaatg 2700 cagatggcgt atcgctttaa cggcatcggt gtcacacaaa acgtgttgta tgagaaccaa 2760 aagctcatcg ctaaccagtt taattctgct attgggaaaa ttcaggacag cctgtcatcg 2820 accgcgtctg cccttgggaa gttgcaggac gtggtgaatc agaatgctca ggccttaaat 2880 actctggtga aacaactctc ttcaaatttc ggcgcaatca gctctgtgtt aaacgacatc 2940 ctaagtaggc ttgatccgcc ggaggctgaa gttcaaattg atagattgat tactggcagg 3000 ctccagtctt tacagaccta cgttacacag cagctgatcc gagcggctga gattagagct 3060 tccgccaatc tggccgcaac caagatgtcc gaatgtg tcc tgggtcagtc aaagcgggtc 3120 gacttttgtg gtaaaggcta ccacctcatg tcatttcccc agagtgcacc tcacggagta 3180 gtgttcctcc acgtcaccta cgttccagca caggaaaaga attttaccac tgcaccggca 3240 atctgtcacg acggcaaggc acacttcccc cgagagggcg tattcgtgtc gaatggaact 3300 cattggttcg tcacacagcg aaacttttat gagcctcaga tcattaccac cgataataca 3360 tttgtgtccg ggaactgcga cgttgtcatt ggaatcgtca acaacactgt atacgatcca 3420 cttcagccag aactggatag ctttaaggaa gaattggaca aatatttcaa aaatcacact 3480 tcacccgatg tggacctggg ggacattagt gggatcaatg catccgtggt caatatccaa 3540 aaagagattg acaggctcaa cgaggtggcc aaaaatctga acgaaagtct tatcgatctg 3600 caagaattgg gaaaatatga gcagggcagc ggctatatcc cagaggcccc ccgcgacggc 3660 caggcctacg tacgcaagga tggcgagtgg gtgctgctga gcaccttcct gtga 3714 <210> 2 <211> 7405 <212> DNA <213> Artificial Sequence <220> <223> SEQ ID NO : 2 - lentiviral vector construct encoding for the light chain of ipilimumab (pLV-hPGK-WPRE) <400> 2 aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca 60 tgccttacaa ggagagaa aa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga 120 tcgtgcctta ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt 180 gccgcattgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg 240 gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 300 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg 420 aacagggact tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt 480 gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga 600 attagatcgc gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataaatta 660 aaacatatag tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta 720 gaaacatcag aaggctgtag acaaatactg ggacagctac aaccatccct tcagacagga 780 tcagaagaac ttagatcatt atataataca gtagcaaccc tctattgtgt gcatcaaagg 840 atagagataa aagacaccaa ggaagcttta gacaagatag aggaagagca aaacaaaagt 900 aagaccaccg cacagcaagc ggccgctgat cttcag acct ggaggaggag atatgaggga 960 caattggaga agtgaattat ataaatataa agtagtaaaa attgaaccat taggagtagc 1020 acccaccaag gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc 1080 tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 1200 ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440 ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560 ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680 tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740 tggagagaga gacagagaca gatccattcg attagtgaac gg atctcgac ggtatcgcta 1800 gcttttaaaa gaaaaggggg gattgggggg tacagtgcag gggaaagaat agtagacata 1860 atagcaacag acatacaaac taaagaatta caaaaacaaa ttacaaaaat tcaaaatttt 1920 actagtgatt atcggatcaa ctttgtatag aaaagttggg gttgcgcctt ttccaaggca 1980 gccctgggtt tgcgcaggga cgcggctgct ctgggcgtgg ttccgggaaa cgcagcggcg 2040 ccgaccctgg gtctcgcaca ttcttcacgt ccgttcgcag cgtcacccgg atcttcgccg 2100 ctacccttgt gggccccccg gcgacgcttc ctgctccgcc cctaagtcgg gaaggttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata 2280 gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatgaaat acctattgcc tacggcagcc 2520 gctggattgt tattactcgc ggcccagccg gccatggccg agatcgtgct gacccagagc 2580 cccggcaccc tgagcctgag ccccggcgag agagccaccc tgagctgc ag agccagccag 2640 agcgtgggca gcagctacct ggcctggtac cagcagaagc ccggccaggc ccccagactg 2700 ctgatctacg gcgccttcag cagagccacc ggcatccccg acagattcag cggcagcggc 2760 agcggcaccg acttcaccct gaccatcagc agactggagc ccgaggactt cgccgtgtac 2820 tactgccagc agtacggcag cagcccctgg accttcggcc agggcaccaa ggtggagatc 2880 aagagaaccg tggccgcccc cagcgtgttc atcttccccc ccagcgacga gcagctgaag 2940 agcggcaccg ccagcgtggt gtgcctgctg aacaacttct accccagaga ggccaaggtg 3000 cagtggaagg tggacaacgc cctgcagagc ggcaacagcc aggagagcgt gaccgagcag 3060 gacagcaagg acagcaccta cagcctgagc agcaccctga ccctgagcaa ggccgactac 3120 gagaagcaca aggtgtacgc ctgcgaggtg acccaccagg gcctgagcag ccccgtgacc 3180 aagagcttca acagaggcga gtgctgaacc cagctttctt gtacaaagtg gtgataatcg 3240 aattccgata atcaacctct ggattacaaa atttgtgaaa gattgactgg tattcttaac 3300 tatgttgctc cttttacgct atgtggatac gctgctttaa tgcctttgta tcatgctatt 3360 gcttcccgta tggctttcat tttctcctcc ttgtataaat cctggttgct gtctctttat 3420 gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt tgc tgacgca 3480 acccccactg gttggggcat tgccaccacc tgtcagctcc tttccgggac tttcgctttc 3540 cccctcccta ttgccacggc ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg 3600 gctcggctgt tgggcactga caattccgtg gtgttgtcgg ggaagctgac gtcctttcca 3660 tggctgctcg cctgtgttgc cacctggatt ctgcgcggga cgtccttctg ctacgtccct 3720 tcggccctca atccagcgga ccttccttcc cgcggcctgc tgccggctct gcggcctctt 3780 ccgcgtcttc gccttcgccc tcagacgagt cggatctccc tttgggccgc ctccccgcat 3840 cgggaattcc cgcggttcgc tttaagacca atgacttaca aggcagctgt agatcttagc 3900 cactttttaa aagaaaaggg gggactggaa gggctaattc actcccaacg aagacaagat 3960 ctgctttttg cttgtactgg gtctctctgg ttagaccaga tctgagcctg ggagctctct 4020 ggctaactag ggaacccact gcttaagcct caataaagct tgccttgagt gcttcaagta 4080 gtgtgtgccc gtctgttgtg tgactctggt aactagagat ccctcagacc cttttagtca 4140 gtgtggaaaa tctctagcag tagtagttca tgtcatctta ttattcagta tttataactt 4200 gcaaagaaat gaatatcaga gagtgagagg aacttgttta ttgcagctta taatggttac 4260 aaataaagca atagcatcac aaatttcaca aataaagcat ttttttcact gcattctag t 4320 tgtggtttgt ccaaactcat caatgtatct tatcatgtct ggctctagct atcccgcccc 4380 taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct 4440 gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga 4500 agtagtgagg aggctttttt ggaggcctag ggacgtaccc aattcgccct atagtgagtc 4560 gtattacgcg cgctcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt 4620 tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga 4680 ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat gggacgcgcc 4740 ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga ccgctacact 4800 tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg ccacgttcgc 4860 cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat ttagtgcttt 4920 acggcacctc gaccccaaaa aacttgatta gggtgatggt tcacgtagtg ggccatcgcc 4980 ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata gtggactctt 5040 gttccaaact ggaacaacac tcaaccctat ctcggtctat tcttttgatt tataagggat 5100 tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa 5160 ttttaacaaa atattaacgc ttacaattta ggtggcactt ttcggggaaa tgtgcgcgga 5220 acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa 5280 ccctgataaa tgcttcaata atattgaaaa aggaagagta tgagtattca acatttccgt 5340 gtcgccctta ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg 5400 ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg 5460 gatctcaaca gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg 5520 agcactttta aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag 5580 caactcggtc gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca 5640 gaaaagcatc ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg 5700 agtgataaca ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc 5760 gcttttttgc acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg 5820 aatgaagcca taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg 5880 ttgcgcaaac tattaactgg cgaactactt actctagctt cccggcaaca attaatagac 5940 tggatggagg cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg 6000 tttat tgctg ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg 6060 gggccagatg gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact 6120 atggatgaac gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa 6180 ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt 6240 aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag 6300 ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct 6360 ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt 6420 tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg 6480 cagataccaa atactgttct tctagtgtag ccgtagttag gccaccactt caagaactct 6540 gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc 6600 gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg 6660 tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa 6720 ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaaga gagaaaggcg 6780 gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg 6840 ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga 6900 tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt 6960 ttacggttcc tggccttttg ctggcctttt gctcacatgt tctttcctgc gttatcccct 7020 gattctgtgg ataaccgtat taccgccttt gagtgagctg ataccgctcg ccgcagccga 7080 acgaccgagc gcagcgagtc agtgagcgag gaagcggaag agcgcccaat acgcaaaccg 7140 cctctccccg cgcgttggcc gattcattaa tgcagctggc acgacaggtt tcccgactgg 7200 aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc tcactcatta ggcaccccag 7260 gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt 7320 cacacaggaa acagctatga ccatgattac gccaagcgcg caattaaccc tcactaaagg 7380 gaacaaaagc tggagctgca DNA encoding 223 construct i the heavy chain of ipilimumab (pLV-hPGK-ipi-HC-WPRE) <400> 3 aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca 60 tgccttacaa ggagatggaaa agcaccgtgc gtg ttagagtagtg cc ttagagtagtg aaggc aacagacggg tctgacatgg attggacgaa ccactgaatt 180 gccgcattgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg 240 gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 300 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg 420 aacagggact tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt 480 gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga 600 attagatcgc gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataaatta 660 aaacatatag tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta 720 gaaacatcag aaggctgtag acaaatactg ggacagctac aaccatccct tcagacagga 780 tcagaagaac ttagatcatt atataataca gtagcaaccc tctattgtgt gcatcaaagg 840 atagagataa aagacaccaa ggaagcttta gacaagatag aggaagagca aaacaaaagt 900 aagaccaccg cacagcaagc ggccgctgat cttcagacct ggaggaggag atatgaggga 960 caattggaga agtgaattat ataaatataa agt agtaaaa attgaaccat taggagtagc 1020 acccaccaag gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc 1080 tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 1200 ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440 ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560 ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680 tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740 tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcgcta 1800 gcttttaaaa gaaaaggggg gattgggggg tacagtgca g gggaaagaat agtagacata 1860 atagcaacag acatacaaac taaagaatta caaaaacaaa ttacaaaaat tcaaaatttt 1920 actagtgatt atcggatcaa ctttgtatag aaaagttggg gttgcgcctgc ggc gttgcgcctgg c ccgaccctgg gtctcgcaca ttcttcacgt ccgttcgcag cgtcacccgg atcttcgccg 2100 ctacccttgt gggccccccg gcgacgcttc ctgctccgcc cctaagtcgg gaaggttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata 2280 gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatggagt ttgggctgag ctgggttttc 2520 ctcgttgctc tttttagagg tgtccagtgt caggtgcagc tggtggagag cggcggcggc 2580 gtggtgcagc ccggcagaag cctgagactg agctgcgccg ccagcggctt caccttcagc 2640 agctacacca tgcactgggt gagacaggcc cccggcaagg gcctggagtg ggtgaccttc 2700 atcagctacg acggcaacaa caagtactac gccgacagcg tgaagggcag attcaccatc 2760 agcagagaca acagcaagaa caccctgtac ctgcagatga acagcctgag agccgaggac 2820 accgccatct actactgcgc cagaaccggc tggctgggcc ccttcgacta ctggggccag 2880 ggcacc ctgg tgaccgtgag cagcgccagc accaagggcc ccagcgtgtt ccccctggcc 2940 cccagcagca agagcaccag cggcggcacc gccgccctgg gctgcctggt gaaggactac 3000 ttccccgagc ccgtgaccgt gagctggaac agcggcgccc tgaccagcgg cgtgcacacc 3060 ttccccgccg tgctgcagag cagcggcctg tacagcctga gcagcgtggt gaccgtgccc 3120 agcagcagcc tgggcaccca gacctacatc tgcaacgtga accacaagcc cagcaacacc 3180 aaggtggaca agagagtgga gcccaagagc tgcgacaaga cccacacctg ccccccctgc 3240 cccgcccccg agctgctggg cggccccagc gtgttcctgt tcccccccaa gcccaaggac 3300 accctgatga tcagcagaac ccccgaggtg acctgcgtgg tggtggacgt gagccacgag 3360 gaccccgagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 3420 aagcccagag aggagcagta caacagcacc tacagagtgg tgagcgtgct gaccgtgctg 3480 caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgccc 3540 gcccccatcg agaagaccat cagcaaggcc aagggccagc ccagagagcc ccaggtgtac 3600 accctgcccc ccagcagaga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 3660 aagggcttct accccagcga catcgccgtg gagtgggaga gcaacggcca gcccgagaac 3720 aactacaaga c caccccccc cgtgctggac agcgacggca gcttcttcct gtacagcaag 3780 ctgaccgtgg acaagagcag atggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 3840 gaggccctgc acaaccacta cacccagaag agcctgagcc tgagccccgg caagtgaacc 3900 cagctttctt gtacaaagtg gtgataatcg aattccgata atcaacctct ggattacaaa 3960 atttgtgaaa gattgactgg tattcttaac tatgttgctc cttttacgct atgtggatac 4020 gctgctttaa tgcctttgta tcatgctatt gcttcccgta tggctttcat tttctcctcc 4080 ttgtataaat cctggttgct gtctctttat gaggagttgt ggcccgttgt caggcaacgt 4140 ggcgtggtgt gcactgtgtt tgctgacgca acccccactg gttggggcat tgccaccacc 4200 tgtcagctcc tttccgggac tttcgctttc cccctcccta ttgccacggc ggaactcatc 4260 gccgcctgcc ttgcccgctg ctggacaggg gctcggctgt tgggcactga caattccgtg 4320 gtgttgtcgg ggaagctgac gtcctttcca tggctgctcg cctgtgttgc cacctggatt 4380 ctgcgcggga cgtccttctg ctacgtccct tcggccctca atccagcgga ccttccttcc 4440 cgcggcctgc tgccggctct gcggcctctt ccgcgtcttc gccttcgccc tcagacgagt 4500 cggatctccc tttgggccgc ctccccgcat cgggaattcc cgcggttcgc tttaagacca 4560 atgacttaca aggcagc tgt agatcttagc cactttttaa aagaaaaggg gggactggaa 4620 gggctaattc actcccaacg aagacaagat ctgctttttg cttgtactgg gtctctctgg 4680 ttagaccaga tctgagcctg ggagctctct ggctaactag ggaacccact gcttaagcct 4740 caataaagct tgccttgagt gcttcaagta gtgtgtgccc gtctgttgtg tgactctggt 4800 aactagagat ccctcagacc cttttagtca gtgtggaaaa tctctagcag tagtagttca 4860 tgtcatctta ttattcagta tttataactt gcaaagaaat gaatatcaga gagtgagagg 4920 aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 4980 aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 5040 tatcatgtct ggctctagct atcccgcccc taactccgcc catcccgccc ctaactccgc 5100 ccagttccgc ccattctccg ccccatggct gactaatttt ttttatttat gcagaggccg 5160 aggccgcctc ggcctctgag ctattccaga agtagtgagg aggctttttt ggaggcctag 5220 ggacgtaccc aattcgccct atagtgagtc gtattacgcg cgctcactgg ccgtcgtttt 5280 acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc 5340 ccctttcgcc agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt 5400 gcgcagcctg aatggcgaat gg gacgcgcc ctgtagcggc gcattaagcg cggcgggtgt 5460 ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc 5520 tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg 5580 gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta 5640 gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt 5700 ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat 5760 ctcggtctat tcttttgatt tataagggat tttgccgatt tcggcctatt ggttaaaaaa 5820 tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgc ttacaattta 5880 ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat 5940 tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa 6000 aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt 6060 tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag 6120 ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt 6180 tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg 6240 gtattatccc gtattgacgc cgggcaag ag caactcggtc gccgcataca ctattctcag 6300 aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta 6360 agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg 6420 acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta 6480 actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac 6540 accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt 6600 actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca 6660 cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag 6720 cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta 6780 gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag 6840 ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt 6900 tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat 6960 aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta 7020 gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa 7080 acaaaaaaac caccgctacc agcggtggtt tgt ttgccgg atcaagagct accaactctt 7140 tttccgaagg taactggctt cagcagagcg cagataccaa atactgttct tctagtgtag 7200 ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta 7260 atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 7320 agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag 7380 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa 7440 agcgccacgc ttcccgaaga gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga 7500 acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc 7560 gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc 7620 ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt 7680 gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt 7740 gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag 7800 gaagcggaag agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa 7860 tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat 7920 gtgagttagc tcactcatta ggcaccccag gctttacac t ttatgcttcc ggctcgtatg 7980 ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac 8040 gccaagcgcg caattaaccc tcactaaagg SEQ ID NO: 4 lenti 213 8119 210 ID> DNA aagg 213 123 119 210 ID> agc tggagctgca < DNA agct> encoding for the heavy chain of gantenerumab (pLV-hPGK-Gant HC-WPRE) <400> 4 aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca 60 tgccttacaa ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga 120 tcgtgcctta ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt 180 gccgcattgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg 240 gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 300 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg 420 aacagggact tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt 480 gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaa gga gagagatggg tgcgagagcg tcagtattaa gcgggggaga 600 attagatcgc gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataaatta 660 aaacatatag tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta 720 gaaacatcag aaggctgtag acaaatactg ggacagctac aaccatccct tcagacagga 780 tcagaagaac ttagatcatt atataataca gtagcaaccc tctattgtgt gcatcaaagg 840 atagagataa aagacaccaa ggaagcttta gacaagatag aggaagagca aaacaaaagt 900 aagaccaccg cacagcaagc ggccgctgat cttcagacct ggaggaggag atatgaggga 960 caattggaga agtgaattat ataaatataa agtagtaaaa attgaaccat taggagtagc 1020 acccaccaag gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc 1080 tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 1200 ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacga c ctggatggag tgggacagag aaattaacaa 1440 ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560 ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680 tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740 tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcgcta 1800 gcttttaaaa gaaaaggggg gattgggggg tacagtgcag gggaaagaat agtagacata 1860 atagcaacag acatacaaac taaagaatta caaaaacaaa ttacaaaaat tcaaaatttt 1920 actagtgatt atcggatcaa ctttgtatag aaaagttggg gttgcgcctt ttccaaggca 1980 gccctgggtt tgcgcaggga cgcggctgct ctgggcgtgg ttccgggaaa cgcagcggcg 2040 ccgaccctgg gtctcgcaca ttcttcacgt ccgttcgcag cgtcacccgg atcttcgccg 2100 ctacccttgt gggccccccg gcgacgcttc ctgctccgcc cctaagtcgg gaaggttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcg ccgacc gcgatgggct gtggccaata 2280 gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatggagt ttgggctgag ctgggttttc 2520 ctcgttgctc tttttagagg tgtccagtgt caggtggagc tggtggagag cggcggcggc 2580 ctggtgcagc ccggcggcag cctgagactg agctgcgccg ccagcggctt caccttcagc 2640 agctacgcca tgagctgggt gagacaggcc cccggcaagg gcctggagtg ggtgagcgcc 2700 atcaacgcca gcggcaccag aacctactac gccgacagcg tgaagggcag attcaccatc 2760 agcagagaca acagcaagaa caccctgtac ctgcagatga acagcctgag agccgaggac 2820 accgccgtgt actactgcgc cagaggcaag ggcaacaccc acaagcccta cggctacgtg 2880 agatacttcg acgtgtgggg ccagggcacc ctggtgaccg tgagcagcgc cagcaccaag 2940 ggccccagcg tgttccccct ggcccccagc agcaagagca ccagcggcgg caccgccgcc 3000 ctgggctgcc tggtgaagga ctacttcccc gagcccgtga ccgtgagctg gaacagcggc 3060 gccctgacca gcggcgtgca caccttcccc gccgtgctgc agagcagcgg cctgtacagc 3120 ctgagcagcg tggtgaccgt gcccagcagc agcctgggca cccagaccta catctgcaac 3180 gtgaaccaca agcccagcaa caccaaggtg gacaagagag tggagcccaa gagctgcgac 3240 aagacccaca cctgcccccc ctgccccgcc cccgagctgc tgggcggccc cagcgtgttc 3300 ctgttccccc ccaagcccaa ggacaccctg atgatcagca gaacccccga ggtgacctgc 3360 gtggtggtgg acgtgagcca cgaggacccc gaggtgaagt tcaactggta cgtggacggc 3420 gtggaggtgc acaacgccaa gaccaagccc agagaggagc agtacaacag cacctacaga 3480 gtggtgagcg tgctgaccgt gctgcaccag gactggctga acggcaagga gtacaagtgc 3540 aaggtgagca acaaggccct gcccgccccc atcgagaaga ccatcagcaa ggccaagggc 3600 cagcccagag agccccaggt gtacaccctg ccccccagca gagacgagct gaccaagaac 3660 caggtgagcc tgacctgcct ggtgaagggc ttctacccca gcgacatcgc cgtggagtgg 3720 gagagcaacg gccagcccga gaacaactac aagaccaccc cccccgtgct ggacagcgac 3780 ggcagcttct tcctgtacag caagctgacc gtggacaaga gcagatggca gcagggcaac 3840 gtgttcagct gcagcgtgat gcacgaggcc ctgcacaacc actacaccca gaagagcctg 3900 agcctgagcc ccggcaagtg aacccagctt tcttgtacaa agtgg tgata atcgaattcc 3960 gataatcaac ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt 4020 gctcctttta cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc 4080 cgtatggctt tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag 4140 ttgtggcccg ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc 4200 actggttggg gcattgccac cacctgtcag ctcctttccg ggactttcgc tttccccctc 4260 cctattgcca cggcggaact catcgccgcc tgccttgccc gctgctggac aggggctcgg 4320 ctgttgggca ctgacaattc cgtggtgttg tcggggaagc tgacgtcctt tccatggctg 4380 ctcgcctgtg ttgccacctg gattctgcgc gggacgtcct tctgctacgt cccttcggcc 4440 ctcaatccag cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcgt 4500 cttcgccttc gccctcagac gagtcggatc tccctttggg ccgcctcccc gcatcgggaa 4560 ttcccgcggt tcgctttaag accaatgact tacaaggcag ctgtagatct tagccacttt 4620 ttaaaagaaa aggggggact ggaagggcta attcactccc aacgaagaca agatctgctt 4680 tttgcttgta ctgggtctct ctggttagac cagatctgag cctgggagct ctctggctaa 4740 ctagggaacc cactgcttaa gcctcaataa agcttgcctt gagtgcttca agtagtgtgt 4800 gcccgtctgt tgtgtgactc tggtaactag agatccctca gaccctttta gtcagtgtgg 4860 aaaatctcta gcagtagtag ttcatgtcat cttattattc agtatttata acttgcaaag 4920 aaatgaatat cagagagtga gaggaacttg tttattgcag cttataatgg ttacaaataa 4980 agcaatagca tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt 5040 ttgtccaaac tcatcaatgt atcttatcat gtctggctct agctatcccg cccctaactc 5100 cgcccatccc gcccctaact ccgcccagtt ccgcccattc tccgccccat ggctgactaa 5160 ttttttttat ttatgcagag gccgaggccg cctcggcctc tgagctattc cagaagtagt 5220 gaggaggctt ttttggaggc ctagggacgt acccaattcg ccctatagtg agtcgtatta 5280 cgcgcgctca ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca 5340 acttaatcgc cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg 5400 caccgatcgc ccttcccaac agttgcgcag cctgaatggc gaatgggacg cgccctgtag 5460 cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag 5520 cgccctagcg cccgctcctt tcgctttctt cccttccttt ctcgccacgt tcgccggctt 5580 tccccgtcaa gctctaaatc gggggctccc tttagggttc cgatttagtg ctttac ggca 5640 cctcgacccc aaaaaacttg attagggtga tggttcacgt agtgggccat cgccctgata 5700 gacggttttt cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca 5760 aactggaaca acactcaacc ctatctcggt ctattctttt gatttataag ggattttgcc 5820 gatttcggcc tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattttaa 5880 caaaatatta acgcttacaa tttaggtggc acttttcggg gaaatgtgcg cggaacccct 5940 atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 6000 taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 6060 cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 6120 aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 6180 aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 6240 tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc 6300 ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag 6360 catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat 6420 aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt 6 480 ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa 6540 gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc 6600 aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg 6660 gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt 6720 gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca 6780 gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat 6840 gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca 6900 gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg 6960 atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg 7020 ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 7080 ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 7140 ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 7200 ccaaatactg ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 7260 ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 7320 tc gtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc 7380 tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 7440 tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagagagaaa ggcggacagg 7500 tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac 7560 gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 7620 tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 7680 ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct 7740 gtggataacc gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc 7800 gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc caatacgcaa accgcctctc 7860 cccgcgcgtt ggccgattca ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg 7920 ggcagtgagc gcaacgcaat taatgtgagt tagctcactc attaggcacc ccaggcttta 7980 cactttatgc ttccggctcg tatgttgtgt ggaattgtga gcggataaca atttcacaca 8040 ggaaacagct atgaccatga ttacgccaag cgcgcaatta accctcacta aagggaacaa 8100 aagctggagc tgcaagctt 8119 <210> <212> DNA <211> Artificial Sequence NO encoding vector encoding> <210> <223 - DNA <211> 7405 the light chain of gantenerumab (pLV-hPGK-Gant LC-WPRE) <400> 5 aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca 60 tgccttacaa ggagatggaaa agcaccgtgc gtg tagtcgt g gtg tagtg gtg a ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt 180 gccgcattgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg 240 gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 300 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg 420 aacagggact tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt 480 gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga 600 attagatcgc gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataaatta 660 aaacatatag tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta 720 gaaacatcag aaggctgtag acaaatactg ggacagctac aaccatccct tcagacagga 780 tcagaagaac ttagatcatt atataataca gtagcaaccc tctattgtgt gcatcaaagg 840 atagagataa aagacaccaa ggaagcttta gacaagatag aggaagagca aaacaaaagt 900 aagaccaccg cacagcaagc ggccgctgat cttcagacct ggaggaggag atatgaggga 960 caattggaga agtgaattat ataa taa agtagtaaaa attgaaccat taggagtagc 1020 acccaccaag gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc 1080 tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 1200 ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440 ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560 ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680 tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740 tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcgcta 1800 gcttttaaaa gaaaaggggg gattgggggg ta cagtgcag gggaaagaat agtagacata 1860 atagcaacag acatacaaac taaagaatta caaaaacaaa ttacaaaaat tcaaaatttt 1920 actagtgatt atcggatcaa ctttgtatag aaaagttggg gttgcgcctt ttccaaggca 1980 gccctgggtt tgcgcaggga cgcggctgct ctgggcgtgg ttccgggaaa cgcagcggcg 2040 ccgaccctgg gtctcgcaca ttcttcacgt ccgttcgcag cgtcacccgg atcttcgccg 2100 ctacccttgt gggccccccg gcgacgcttc ctgctccgcc cctaagtcgg gaaggttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata 2280 gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatgaaat acctattgcc tacggcagcc 2520 gctggattgt tattactcgc ggcccagccg gccatggccg acatcgtgct gacccagagc 2580 cccgccaccc tgagcctgag ccccggcgag agagccaccc tgagctgcag agccagccag 2640 agcgtgagca gcagctacct ggcctggtac cagcagaa gc ccggccaggc ccccagactg 2700 ctgatctacg gcgccagcag cagagccacc ggcgtgcccg ccagattcag cggcagcggc 2760 agcggcaccg acttcaccct gaccatcagc agcctggagc ccgaggactt cgccacctac 2820 tactgcctgc agatctacaa catgcccatc accttcggcc agggcaccaa ggtggagatc 2880 aagagaaccg tggccgcccc cagcgtgttc atcttccccc ccagcgacga gcagctgaag 2940 agcggcaccg ccagcgtggt gtgcctgctg aacaacttct accccagaga ggccaaggtg 3000 cagtggaagg tggacaacgc cctgcagagc ggcaacagcc aggagagcgt gaccgagcag 3060 gacagcaagg acagcaccta cagcctgagc agcaccctga ccctgagcaa ggccgactac 3120 gagaagcaca aggtgtacgc ctgcgaggtg acccaccagg gcctgagcag ccccgtgacc 3180 aagagcttca acagaggcga gtgctgaacc cagctttctt gtacaaagtg gtgataatcg 3240 aattccgata atcaacctct ggattacaaa atttgtgaaa gattgactgg tattcttaac 3300 tatgttgctc cttttacgct atgtggatac gctgctttaa tgcctttgta tcatgctatt 3360 gcttcccgta tggctttcat tttctcctcc ttgtataaat cctggttgct gtctctttat 3420 gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca 3480 acccccactg gttggggcat tgccaccacc tgtcagctcc ttt ccgggac tttcgctttc 3540 cccctcccta ttgccacggc ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg 3600 gctcggctgt tgggcactga caattccgtg gtgttgtcgg ggaagctgac gtcctttcca 3660 tggctgctcg cctgtgttgc cacctggatt ctgcgcggga cgtccttctg ctacgtccct 3720 tcggccctca atccagcgga ccttccttcc cgcggcctgc tgccggctct gcggcctctt 3780 ccgcgtcttc gccttcgccc tcagacgagt cggatctccc tttgggccgc ctccccgcat 3840 cgggaattcc cgcggttcgc tttaagacca atgacttaca aggcagctgt agatcttagc 3900 cactttttaa aagaaaaggg gggactggaa gggctaattc actcccaacg aagacaagat 3960 ctgctttttg cttgtactgg gtctctctgg ttagaccaga tctgagcctg ggagctctct 4020 ggctaactag ggaacccact gcttaagcct caataaagct tgccttgagt gcttcaagta 4080 gtgtgtgccc gtctgttgtg tgactctggt aactagagat ccctcagacc cttttagtca 4140 gtgtggaaaa tctctagcag tagtagttca tgtcatctta ttattcagta tttataactt 4200 gcaaagaaat gaatatcaga gagtgagagg aacttgttta ttgcagctta taatggttac 4260 aaataaagca atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt 4320 tgtggtttgt ccaaactcat caatgtatct tatcatgtct ggctctagc t atcccgcccc 4380 taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct 4440 gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga 4500 agtagtgagg aggctttttt ggaggcctag ggacgtaccc aattcgccct atagtgagtc 4560 gtattacgcg cgctcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt 4620 tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga 4680 ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat gggacgcgcc 4740 ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga ccgctacact 4800 tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg ccacgttcgc 4860 cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat ttagtgcttt 4920 acggcacctc gaccccaaaa aacttgatta gggtgatggt tcacgtagtg ggccatcgcc 4980 ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata gtggactctt 5040 gttccaaact ggaacaacac tcaaccctat ctcggtctat tcttttgatt tataagggat 5100 tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa 5160 ttttaacaaa atattaacgc ttacaattta ggtggcactt ttcggggaaa tgtg cgcgga 5220 acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa 5280 ccctgataaa tgcttcaata atattgaaaa aggaagagta tgagtattca acatttccgt 5340 gtcgccctta ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg 5400 ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg 5460 gatctcaaca gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg 5520 agcactttta aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag 5580 caactcggtc gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca 5640 gaaaagcatc ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg 5700 agtgataaca ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc 5760 gcttttttgc acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg 5820 aatgaagcca taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg 5880 ttgcgcaaac tattaactgg cgaactactt actctagctt cccggcaaca attaatagac 5940 tggatggagg cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg 6000 tttattgctg ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg 6060 gggccagatg gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact 6120 atggatgaac gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa 6180 ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt 6240 aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag 6300 ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct 6360 ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt 6420 tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg 6480 cagataccaa atactgttct tctagtgtag ccgtagttag gccaccactt caagaactct 6540 gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc 6600 gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg 6660 tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa 6720 ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaaga gagaaaggcg 6780 gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg 6840 ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga 6900 tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt 6960 ttacggttcc tggccttttg ctggcctttt gctcacatgt tctttcctgc gttatcccct 7020 gattctgtgg ataaccgtat taccgccttt gagtgagctg ataccgctcg ccgcagccga 7080 acgaccgagc gcagcgagtc agtgagcgag gaagcggaag agcgcccaat acgcaaaccg 7140 cctctccccg cgcgttggcc gattcattaa tgcagctggc acgacaggtt tcccgactgg 7200 aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc tcactcatta ggcaccccag 7260 gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt 7320 cacacaggaa acagctatga ccatgattac gccaagcgcg caattaaccc tcactaaagg 7380 gaacaaaagc tggagctgca agctt 7405 <210> 6 <211> 7399 <212> DNA <213> Artificial Sequence <220> <223> SEQ ID NO: 6 - lentiviral vector construct encoding for the light chain of Rituximab ( pLV-hPGK-ritux-LC-WPRE) <400> 6 aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca 60 tgccttacaa ggagagaaaa agcaccgtgc cctgc atgccgattg cc cc cc ggtagtg t g cc cc cc ggtagattg gtg cc tagagattg ttggaagtaa ttg attgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg 240 gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 300 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg 420 aacagggact tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt 480 gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga 600 attagatcgc gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataaatta 660 aaacatatag tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta 720 gaaacatcag aaggctgtag acaaatactg ggacagctac aaccatccct tcagacagga 780 tcagaagaac ttagatcatt atataataca gtagcaaccc tctattgtgt gcatcaaagg 840 atagagataa aagacaccaa ggaagcttta gacaagatag aggaagagca aaacaaaagt 900 aagaccaccg cacagcaagc ggccgctgat cttcagacct ggaggaggag atatgaggga 960 caattggaga agtgaattat ataaatataa agtagtaaaa attgaaccat taggagtagc 1020 acccaccaag gcaaagagaa ga gtggtgca gagagaaaaa agagcagtgg gaataggagc 1080 tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 1200 ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440 ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560 ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680 tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740 tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcgcta 1800 gcttttaaaa gaaaaggggg gattgggggg tacagtgcag gggaaagaat agtagacata 1860 atagcaacag acatacaaac taaagaat ta caaaaacaaa ttacaaaaat tcaaaatttt 1920 actagtgatt atcggatcaa ctttgtatag aaaagttggg gttgcgcctt ttccaaggca 1980 gccctgggtt tgcgcaggga cgcggctgct ctgggcgtgg ttccgggaaa cgcagcggcg 2040 ccgaccctgg gtctcgcaca ttcttcacgt ccgttcgcag cgtcacccgg atcttcgccg 2100 ctacccttgt gggccccccg gcgacgcttc ctgctccgcc cctaagtcgg gaaggttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata 2280 gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatgaaat acctattgcc tacggcagcc 2520 gctggattgt tattactcgc ggcccagccg gccatggccc agatcgtgct gagccagtct 2580 cctgccatcc tgagtgctag ccctggcgag aaagtgacca tgacctgtag agccagcagc 2640 agcgtgtcct acatccactg gttccagcag aagcctggca gcagccctaa gccttggatc 2700 tacgccacaa gcaatctggc cagcggcgtg cca gtcagat tttctggctc tggcagcggc 2760 accagctaca gcctgacaat ctctagagtg gaagccgagg acgccgccac ctactattgt 2820 cagcagtgga ccagcaatcc tcctaccttt ggcggaggca ccaagctgga aatcaagaga 2880 accgtcgccg ctcctagcgt gttcatcttc ccaccttccg acgagcagct gaagtctggc 2940 acagcctctg tcgtgtgcct gctgaacaac ttctacccca gagaagccaa ggtgcagtgg 3000 aaggtggaca acgccctgca gagcggcaat agccaagaga gcgtgaccga gcaggacagc 3060 aaggactcta cctacagcct gagcagcacc ctgacactga gcaaggccga ctacgagaag 3120 cacaaagtgt acgcctgcga agtgacccac cagggccttt ctagccctgt gaccaagagc 3180 ttcaaccggg gcgagtgttg aacccagctt tcttgtacaa agtggtgata atcgaattcc 3240 gataatcaac ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt 3300 gctcctttta cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc 3360 cgtatggctt tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag 3420 ttgtggcccg ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc 3480 actggttggg gcattgccac cacctgtcag ctcctttccg ggactttcgc tttccccctc 3540 cctattgcca cggcggaact catcgccgcc tgccttgcc c gctgctggac aggggctcgg 3600 ctgttgggca ctgacaattc cgtggtgttg tcggggaagc tgacgtcctt tccatggctg 3660 ctcgcctgtg ttgccacctg gattctgcgc gggacgtcct tctgctacgt cccttcggcc 3720 ctcaatccag cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcgt 3780 cttcgccttc gccctcagac gagtcggatc tccctttggg ccgcctcccc gcatcgggaa 3840 ttcccgcggt tcgctttaag accaatgact tacaaggcag ctgtagatct tagccacttt 3900 ttaaaagaaa aggggggact ggaagggcta attcactccc aacgaagaca agatctgctt 3960 tttgcttgta ctgggtctct ctggttagac cagatctgag cctgggagct ctctggctaa 4020 ctagggaacc cactgcttaa gcctcaataa agcttgcctt gagtgcttca agtagtgtgt 4080 gcccgtctgt tgtgtgactc tggtaactag agatccctca gaccctttta gtcagtgtgg 4140 aaaatctcta gcagtagtag ttcatgtcat cttattattc agtatttata acttgcaaag 4200 aaatgaatat cagagagtga gaggaacttg tttattgcag cttataatgg ttacaaataa 4260 agcaatagca tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt 4320 ttgtccaaac tcatcaatgt atcttatcat gtctggctct agctatcccg cccctaactc 4380 cgcccatccc gcccctaact ccgcccagtt ccgcccattc tccg ccccat ggctgactaa 4440 ttttttttat ttatgcagag gccgaggccg cctcggcctc tgagctattc cagaagtagt 4500 gaggaggctt ttttggaggc ctagggacgt acccaattcg ccctatagtg agtcgtatta 4560 cgcgcgctca ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca 4620 acttaatcgc cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg 4680 caccgatcgc ccttcccaac agttgcgcag cctgaatggc gaatgggacg cgccctgtag 4740 cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag 4800 cgccctagcg cccgctcctt tcgctttctt cccttccttt ctcgccacgt tcgccggctt 4860 tccccgtcaa gctctaaatc gggggctccc tttagggttc cgatttagtg ctttacggca 4920 cctcgacccc aaaaaacttg attagggtga tggttcacgt agtgggccat cgccctgata 4980 gacggttttt cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca 5040 aactggaaca acactcaacc ctatctcggt ctattctttt gatttataag ggattttgcc 5100 gatttcggcc tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattttaa 5160 caaaatatta acgcttacaa tttaggtggc acttttcggg gaaatgtgcg cggaacccct 5220 atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 5280 taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 5340 cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 5400 aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 5460 aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 5520 tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc 5580 ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag 5640 catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat 5700 aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt 5760 ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa 5820 gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc 5880 aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg 5940 gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt 6000 gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca 6060 gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat 6120 gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca 6180 gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg 6240 atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg 6300 ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 6360 ctgcgc gtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 6420 ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 6480 ccaaatactg ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 6540 ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 6600 tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc 6660 tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 6720 tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagagagaaa ggcggacagg 6780 tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac 6840 gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 6900 tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 6960 ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct 7020 gtggataacc gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc 7080 gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc caatacgcaa accgcctctc 7140 cccgcgcgtt ggccgattca ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg 7200 ggcagtgagc g caacgcaat taatgtgagt tagctcactc attaggcacc ccaggcttta 7260 cactttatgc ttccggctcg tatgttgtgt ggaattgtga gcggataaca atttcacaca 7320 ggaaacagct atgaccatga ttacgccaag cgcgcaatta accctcacta aagggaacaa 7380 aagctggagc tgcaagctt 7399 <210> 7 <211> 8104 <212> DNA <213> Artificial Sequence <220> <223> SEQ ID NO: 7 - lentiviral vector construct encoding for the heavy chain of Rituximab (pLV-hPGK-ritux-HC-WPRE) <400> 7 aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca 60 tgccttacaa ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga 120 tcgtgcctta ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt 180 gccgcattgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg 240 gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 300 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg 420 aacagggact tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt 480 gctgaagcgc gcacggcaag aggcgag ggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga 600 attagatcgc gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataaatta 660 aaacatatag tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta 720 gaaacatcag aaggctgtag acaaatactg ggacagctac aaccatccct tcagacagga 780 tcagaagaac ttagatcatt atataataca gtagcaaccc tctattgtgt gcatcaaagg 840 atagagataa aagacaccaa ggaagcttta gacaagatag aggaagagca aaacaaaagt 900 aagaccaccg cacagcaagc ggccgctgat cttcagacct ggaggaggag atatgaggga 960 caattggaga agtgaattat ataaatataa agtagtaaaa attgaaccat taggagtagc 1020 acccaccaag gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc 1080 tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 1200 ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440 ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560 ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680 tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740 tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggtatcgcta 1800 gcttttaaaa gaaaaggggg gattgggggg tacagtgcag gggaaagaat agtagacata 1860 atagcaacag acatacaaac taaagaatta caaaaacaaa ttacaaaaat tcaaaatttt 1920 actagtgatt atcggatcaa ctttgtatag aaaagttggg gttgcgcctt ttccaaggca 1980 gccctgggtt tgcgcaggga cgcggctgct ctgggcgtgg ttccgggaaa cgcagcggcg 2040 ccgaccctgg gtctcgcaca ttcttcacgt ccgttcgcag cgtcacccgg atcttcgccg 2100 ctacccttgt gggccccccg gcgacgcttc ctgctccgcc cctaagtcgg gaaggttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtc tcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata 2280 gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatggagt ttgggctgag ctgggttttc 2520 ctcgttgctc tttttagagg tgtccagtgt caggttcagc tgcagcagcc tggcgccgaa 2580 cttgtgaaac ctggcgcctc tgtgaagatg agctgcaagg ccagcggcta caccttcacc 2640 agctacaaca tgcactgggt caagcagacc cctggcagag gcctggaatg gatcggagcc 2700 atctatcccg gcaacggcga cacctcctac aaccagaagt tcaagggcaa agccacactg 2760 accgccgaca agagcagcag cacagcctac atgcagctgt ccagcctgac cagcgaagat 2820 agcgccgtgt actactgcgc cagaagcacc tattacggcg gcgactggta cttcaacgtg 2880 tggggagctg gcaccaccgt gacagtgtct gccgcctcta caaagggccc tagcgttttc 2940 ccactggctc ccagcagcaa gagcacatct ggtggaacag ccgctctggg ctgcctggtc 3000 aaggattact ttcccgagcc tgtgaccgtg tcctggaatt ctggcgctct gacaagcggc 3060 gtgcacacct ttccagcagt gctgcaaagc agcggcctgt actctctgag cagcgtggtc 3120 acagtgccta gctctagcct gggcacccag acctacatct gcaatgtgaa ccacaagcct 3180 agcaacacca aggtggacaa gaaggtggaa cccaagagct gcgacaagac ccacacctgt 3240 cctccatgtc ctgctccaga actgctcggc ggaccttccg tgttcctgtt tcctccaaag 3300 cctaaggaca ccctgatgat cagcagaacc cctgaagtga cctgcgtggt ggtggatgtg 3360 tcccacgagg atcccgaagt gaagttcaat tggtacgtgg acggcgtgga agtgcacaac 3420 gccaagacca agcctagaga ggaacagtac aacagcacct acagagtggt gtccgtgctg 3480 accgtgctgc accaggattg gctgaacggc aaagagtaca agtgcaaggt gtccaacaag 3540 gccctgcctg ctcctatcga gaaaaccatc agcaaggcca agggccagcc tagggaaccc 3600 caggtttaca cactgcctcc aagcagggac gagctgacca agaatcaggt gtccctgacc 3660 tgtctcgtga agggcttcta cccctccgat atcgccgtgg aatgggagag caatggccag 3720 cctgagaaca actacaagac aacccctcct gtgctggact ccgacggctc attcttcctg 3780 tacagcaagc tgacagtgga caagtccaga tggcagcagg gcaacgtgtt ctcctgcagc 3840 gtgatgcacg aggccctgca caaccactac acccagaaaa gcctgtctct gagccc cggc 3900 aaatagaccc agctttcttg tacaaagtgg tgataatcga attccgataa tcaacctctg 3960 gattacaaaa tttgtgaaag attgactggt attcttaact atgttgctcc ttttacgcta 4020 tgtggatacg ctgctttaat gcctttgtat catgctattg cttcccgtat ggctttcatt 4080 ttctcctcct tgtataaatc ctggttgctg tctctttatg aggagttgtg gcccgttgtc 4140 aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg ttggggcatt 4200 gccaccacct gtcagctcct ttccgggact ttcgctttcc ccctccctat tgccacggcg 4260 gaactcatcg ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt gggcactgac 4320 aattccgtgg tgttgtcggg gaagctgacg tcctttccat ggctgctcgc ctgtgttgcc 4380 acctggattc tgcgcgggac gtccttctgc tacgtccctt cggccctcaa tccagcggac 4440 cttccttccc gcggcctgct gccggctctg cggcctcttc cgcgtcttcg ccttcgccct 4500 cagacgagtc ggatctccct ttgggccgcc tccccgcatc gggaattccc gcggttcgct 4560 ttaagaccaa tgacttacaa ggcagctgta gatcttagcc actttttaaa agaaaagggg 4620 ggactggaag ggctaattca ctcccaacga agacaagatc tgctttttgc ttgtactggg 4680 tctctctggt tagaccagat ctgagcctgg gagctctctg gctaactagg gaacccactg 4 740 cttaagcctc aataaagctt gccttgagtg cttcaagtag tgtgtgcccg tctgttgtgt 4800 gactctggta actagagatc cctcagaccc ttttagtcag tgtggaaaat ctctagcagt 4860 agtagttcat gtcatcttat tattcagtat ttataacttg caaagaaatg aatatcagag 4920 agtgagagga acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca 4980 aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc 5040 aatgtatctt atcatgtctg gctctagcta tcccgcccct aactccgccc atcccgcccc 5100 taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt tttatttatg 5160 cagaggccga ggccgcctcg gcctctgagc tattccagaa gtagtgagga ggcttttttg 5220 gaggcctagg gacgtaccca attcgcccta tagtgagtcg tattacgcgc gctcactggc 5280 cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta atcgccttgc 5340 agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg atcgcccttc 5400 ccaacagttg cgcagcctga atggcgaatg ggacgcgccc tgtagcggcg cattaagcgc 5460 ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc tagcgcccgc 5520 tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc gtcaagctct 5580 aa atcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg accccaaaaa 5640 acttgattag ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg tttttcgccc 5700 tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg gaacaacact 5760 caaccctatc tcggtctatt cttttgattt ataagggatt ttgccgattt cggcctattg 5820 gttaaaaaat gagctgattt aacaaaaatt taacgcgaat tttaacaaaa tattaacgct 5880 tacaatttag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc 5940 taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa 6000 tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt 6060 gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct 6120 gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc 6180 cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta 6240 tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac 6300 tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc 6360 atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac 6420 ttacttct ga caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg 6480 gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac 6540 gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc 6600 gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt 6660 gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga 6720 gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc 6780 cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag 6840 atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca 6900 tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc 6960 ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca 7020 gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 7080 tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 7140 ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgttctt 7200 ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 7260 gctctgctaa tcc tgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 7320 ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 7380 tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 7440 ctatgagaaa gcgccacgct tcccgaagag agaaaggcgg acaggtatcc ggtaagcggc 7500 agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 7560 agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 7620 gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 7680 tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt 7740 accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca 7800 gtgagcgagg aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg 7860 attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac 7920 gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg 7980 gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac 8040 catgattacg ccaagcgcgc aattaaccct cactaaaggg aacaaaagct ggagctgcaa 8100gctt 8104

Claims (26)

A method for establishing an immortalized human myoblast cell line, said method comprising:
a) providing at least one primary human myoblast expressing the surface marker CD56 and optionally the further surface markers CD82 and/or CD146;
b) transducing said at least one primary human myoblasts with a lentiviral vector encoding a cyclin-dependent kinase 4 (CDK4) gene and a lentiviral vector encoding a catalytic subunit of a human telomerase (hTERT) gene, said obtaining immortalization of primary human myoblasts;
c) growing the cells from the at least one immortalized primary human myoblast obtained under step b) in a myoblast growth medium and each cell providing the at least one myoblast phenotypic marker obtained in a separate culture medium in a growth medium separating from;
d) growing each isolated cell obtained under step c) separately in separate culture and amplification media;
e) selecting from the parental cells by single cell cloning at least one cell line having improved stability or expression properties among all the individual culture and amplification media of step d);
f) controlling the myogenic potential of the selected at least one cell line;
g) selecting individual clones based on their viability in the encapsulation device;
h) optionally repeating steps d) to g) sequentially to further refine the selected line. In claim 1,
wherein step b) is performed using two separate lentiviral vectors, such as pCLX type or one single bicistronic vector. A composition comprising an immortalized human myoblast cell line or an immortalized human myoblast derived from a primary human myoblast or a progeny thereof, wherein the cell expresses CDK4 and hTERT in the absence of expression of an antibiotic resistance gene and exhibits myoblast characteristics maintaining an immortalized human myoblast cell line or composition. The immortalized myoblast cell line according to claim 3 , which gives triple positivity for CD56, CD82 and CD146. An immortalized human myoblast cell line or a composition or progeny thereof deposited with the CCOS under accession number 1902. A composition comprising an immortalized human myoblast cell line or an immortalized human myoblast derived from a primary human myoblast or progeny thereof obtainable from the method according to claim 1 or 2 . A method for producing genetically engineered immortalized human myoblasts expressing a therapeutic protein under hypoxic conditions, the method comprising:
i) providing at least one immortalized primary human myoblast;
ii) transducing said at least one immortalized primary human myoblasts with a lentiviral vector for expression of a target protein under the control of a phosphoglycerate kinase (PGK) promoter;
iii) separately growing each isolated cell obtained under step ii) in separate culture and amplification media;
iv) selecting at least one cell line showing the highest level of secretion for the target protein from among all the individual culture and amplification media of step iii);
v) controlling the myogenic potential of the selected at least one cell line. In claim 7,
The method wherein the phosphoglycerate kinase (PGK) promoter is a human PGK promoter. In claim 7,
The method wherein the target protein is human GM-CSF. In claim 7,
The method of claim 1, wherein the target protein is a human monoclonal antibody. In claim 7,
The method wherein the target protein is selected from rituximab, ipilimumab and gantenerumab. In claim 7,
wherein the target protein is an antigen, in particular a viral antigen. In claim 12,
The method of claim 1, wherein the target protein is a COVID-19 spike protein or antigenic fragment thereof. A composition comprising a genetically engineered immortalized human myoblast cell line or genetically engineered immortalized human myoblast or progeny thereof, wherein the cell expresses CDK4, hTERT in the absence of expression of an antibiotic resistance gene and at least one therapeutic protein or a genetically engineered immortalized human myoblast cell line or composition that expresses an antigen, maintains myoblast characteristics and is capable of secreting said therapeutic protein or antigen. A genetically immortalized human myoblast cell line or a composition or progeny thereof secreting GM-CSF deposited with the CCOS under accession number 1901. A genetically engineered immortalized human myoblast cell line obtainable from the method according to any one of claims 7 to 13 or a composition or progeny thereof. The genetically engineered immortalized human myoblast according to any one of claims 14 to 15 for use in encapsulated cell therapy. 16. A pharmaceutical composition comprising at least one immortalized human myoblast according to any one of claims 2 to 6 or 14 to 15 and a pharmaceutically acceptable carrier, diluent or excipient thereof. The genetically engineered immortalized immortalized product according to any one of claims 14 to 15 for use in the prophylaxis and/or treatment of disorders or diseases, in particular cancer, inflammatory disorders, infectious diseases, in particular viral infections or neurodegenerative disorders. human myoblasts. A genetically engineered immortalized human myoblast for use according to claim 19 for the prevention and/or treatment of cancer, wherein said cancer is non-Hodgkin's lymphoma, head and neck cancer, melanoma, lung cancer, bladder cancer, kidney cancer, triple Genetically engineered immortalized human myoblasts selected from negative breast cancer, colorectal cancer, gastric cancer, pancreatic cancer, ovarian cancer, prostate cancer, sarcoma and chordoma. Genetically engineered immortalized human myoblasts for use according to claim 19 for the prevention and/or treatment of viral infections. A genetically engineered immortalized human myoblast according to claim 21 for use in the prophylaxis of a viral infection, wherein said prophylaxis is vaccination with a viral antigen. A genetically engineered immortalized human myoblast for use according to claim 19 for the prevention and/or treatment of a viral infection, wherein the virus is coronavirus 19 (COVID-19). . An implantable biocompatible device or kit comprising at least one immortalized human myoblast according to claim 14 , optionally further comprising one or more antigen(s) in a cell culture medium. 16. A method for preventing or treating a disorder or disease associated with a subject, in particular cancer, an inflammatory disorder, an infectious disease, in particular a viral infection or a neurodegenerative disorder, said method comprising the genetically engineered method according to any one of claims 14 to 15 A method comprising administering to a subject in need thereof a therapeutically effective amount of immortalized human myoblasts. 16. A method of vaccinating a subject against a viral infection, said method comprising administering to a subject in need thereof a therapeutically effective amount of genetically engineered immortalized human myoblasts according to any one of claims 14 to 15. A method comprising a, wherein the cell expresses a viral antigen.

Images