KR20220040975A - Detection set for canine babesia using real-time pcr and detection method thereof - Google Patents

Detection set for canine babesia using real-time pcr and detection method thereof Download PDF

Info

Publication number
KR20220040975A
KR20220040975A KR1020210038461A KR20210038461A KR20220040975A KR 20220040975 A KR20220040975 A KR 20220040975A KR 1020210038461 A KR1020210038461 A KR 1020210038461A KR 20210038461 A KR20210038461 A KR 20210038461A KR 20220040975 A KR20220040975 A KR 20220040975A
Authority
KR
South Korea
Prior art keywords
babesia
detection
heat shock
hsp70
shock protein
Prior art date
Application number
KR1020210038461A
Other languages
Korean (ko)
Other versions
KR102482020B1 (en
Inventor
문명진
최지영
김민선
윤영민
Original Assignee
주식회사 케어벳
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 케어벳 filed Critical 주식회사 케어벳
Publication of KR20220040975A publication Critical patent/KR20220040975A/en
Application granted granted Critical
Publication of KR102482020B1 publication Critical patent/KR102482020B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a detection set and detection method capable of detecting Babesia gibsoni and Babesia canis, which are the main causes of canine Babesia infection, by using a real-time polymerase chain reaction (real-time PCR).

Description

실시간 중합효소 연쇄반응을 이용한 개 바베시아 검출세트 및 검출방법{DETECTION SET FOR CANINE BABESIA USING REAL-TIME PCR AND DETECTION METHOD THEREOF} Detection set and detection method of dog babesia using real-time polymerase chain reaction {DETECTION SET FOR CANINE BABESIA USING REAL-TIME PCR AND DETECTION METHOD THEREOF}

본 발명은 실시간 중합효소 연쇄반응으로, 개 바베시아 감염증의 주원인인 바베시아 깁소니(Babesia gibsoni), 바베시아 캐니스(Babesia canis)를 검출할 수 있는 검출세트 및 검출방법에 관한 것이다.The present invention is a real-time polymerase chain reaction, Babesia gibsoni ), and to a detection set capable of detecting Babesia canis and a detection method.

바베시아 감염증(Babesiosis)는 진드기 매개로 인한 원생동물 기생충인 바베시아(Babesia) 종에 의해 발생한다. 숙주는 설치류, 사람, 개, 고양이, 말과 소 등이다. 바베시아는 포유류의 적혈구를 침범하여 빈혈을 유발한다. 개 바베시아는 혈액도말 김자(Giemsa) 염색상에서 적혈구 내 원충의 형태에 따라 대형과 소형으로 나눌 수 있는데, B. canis vogeli, B. canis canis, B. canis rossi, B.coco는 대형, Babesia gibsoni, B. conrada, B. microti, B. annae 는 소형에 속한다. 일반적으로 바베시아 깁소니(Babesia gibsoni)의 병원성이 바베시아 캐니스(Babesia canis)보다 심하다.Babesiosis is caused by a tick-borne protozoan parasite, Babesia spp. Hosts include rodents, humans, dogs, cats, horses and cattle. Babesia invades mammalian red blood cells and causes anemia. Dog Babesia can be divided into large and small according to the shape of the protozoa in the red blood cells on the blood smear Giemsa staining . gibsoni, B. conrada, B. microti, and B. annae belong to the subspecies. In general, the pathogenicity of Babesia gibsoni is more severe than that of Babesia canis .

개 바베시아 감염증은 전 세계적으로 발생하며, 지역별로 감염원이 되는 바베시아 종 또한 차이가 있다. 개 바베시아 감염증을 일으키는 대표적인 종은 바베시아 깁소니(Babesia gibsoni), 바베시아 캐니스(B. canis) 하위 3종(Babesia canis canis, canis rossi, canis vogeli)이 있으며 아시아 지역에서는 바베시아 깁소니(Babesia gibsoni)에 의한 감염이 많다(Irwin, P. J. (2010). Canine Babesiosis. Veterinary Clinics of North America: Small Animal Practice, 40(6), 1141-1156.) 특히 우리나라를 비롯한 아시아 지역은 대부분 소형인 바베시아 깁소니(Babesia gibsoni) 감염이 주로 발병하는 것으로 보고되었다.Babesia infection in dogs occurs worldwide, and there are also differences in the Babesia species that are the source of infection by region. The most common cause of canine Babesia infection is Babesia . gibsoni ), Babesia canis ( B. canis ) There are three subspecies ( Babesia canis canis, canis rossi, canis vogeli ), and there are many infections caused by Babesia gibsoni in Asia (Irwin, PJ (2010) ).Canine Babesiosis. Veterinary Clinics of North America: Small Animal Practice, 40(6), 1141-1156.) In particular, in Asia including Korea, it is reported that most small-sized Babesia gibsoni infections occur mainly. became

개 바베시아증의 주된 임상증상은 용혈성 빈혈에 따른 점막창백, 혈색소뇨, 빈맥, 빈호흡, 발열, 식욕저하, 침울, 황달, 비장종대, 림프절 종대, 혈소판감소 등이다. 만성 혹은 저감염된 경우 무증상으로 진행되나, 스트레스나 부신피질호르몬제 투여와 같은 면역억제 상황에서 다시 증상을 발현될 수 있다.The main clinical symptoms of canine babesiosis are mucosal pallor, hemoglobinuria, tachycardia, tachypnea, fever, loss of appetite, depression, jaundice, enlarged spleen, enlarged lymph nodes, and thrombocytopenia due to hemolytic anemia. Chronic or low infection progresses asymptomatically, but symptoms may reappear under immunosuppressive situations such as stress or administration of corticosteroids.

개 바베시아 감염증을 진단하는 방법은 혈액도말, 효소 면역 측정법(Enzyme-linked immunosorbent assay, ELISA), 중합효소 연쇄반응(Polymerase chain reaction, PCR) 등이 있으며, 현재 국내 동물병원의 경우 면역진단 기반의 항체가 검사 키트를 이용하거나 PCR 검사 위탁을 통해 개 바베시아 감염증을 진단하고 있다. 일반적으로 PCR 방법은 민감도가 높아 조기 진단에 유리하기 때문에 병원 현장에서 개 바베시아 감염증의 정확한 진단을 위해 항체가 검사 키트와 함께 이용될 필요가 있다.Methods for diagnosing canine Babesia infection include blood smear, enzyme-linked immunosorbent assay (ELISA), and polymerase chain reaction (PCR). of canine Babesia infection by using an antibody test kit or outsourcing a PCR test. In general, since the PCR method has high sensitivity and is advantageous for early diagnosis, it is necessary to use an antibody together with a test kit for accurate diagnosis of canine Babesia infection in the hospital.

대한민국 특허등록 제10-1419717호: 주혈원충, 바베스열원충, 범안열원충을 진단할 수 있는 프라이머 세트, 상기 프라이머 세트를 포함하는 중합효소 연쇄반응 키트, 상기 키트를 이용한 주혈원충, 바베스열원충, 범안열원충 진단 방법Republic of Korea Patent Registration No. 10-1419717: A primer set capable of diagnosing schistosoma, Barbes fever, and Panocular fever, a polymerase chain reaction kit comprising the primer set, Schistosoma using the kit, and Barbes fever How to diagnose protozoa, panocular fever parasite

본 발명의 과제는 개 바베시아 감염증을 일으키는 바베시아(바베스 열원충)인 바베시아 깁소니(Babesia gibsoni), 바베시아 캐니스(Babesia canis)에 특이적인 프라이머와 프로브 세트를 이용하여 정확하게 확인할 수 있는 검출세트 및 검출방법을 제공하는 것이다.The subject of the present invention is Babesia ( Babesia ), a Babesia (Babes fever parasite) that causes a dog Babesia infection Gibsoni ), Babesia canis ( Babesia canis ) It is to provide a detection set and a detection method that can be accurately identified using a specific primer and probe set.

상기한 과제를 달성하기 위해 본 발명은,In order to achieve the above object, the present invention

서열번호 1의 정방향 프라이머 및 서열번호 2의 역방향 프라이머로 이루어진 바베시아 검출용 프라이머쌍과,A pair of primers for detecting Babesia consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2;

서열번호 3의 염기서열로 이루어진 베바시아 검출용 프로브Bevacia detection probe consisting of the nucleotide sequence of SEQ ID NO: 3

를 포함하는, 바베시아 검출세트를 제공한다.It provides a Babesia detection set comprising a.

또한 본 발명은Also, the present invention

시료로부터 추출한 DNA를 제1항의 검출세트를 이용하여 실시간 중합효소연쇄반응으로 증폭하는 단계; 및Amplifying the DNA extracted from the sample by a real-time polymerase chain reaction using the detection set of claim 1; and

상기 증폭 산물을 분석하는 단계analyzing the amplification product

를 포함하는, 실시간 중합효소연쇄반응으로 바베시아를 검출하는 방법을 제공한다.It provides a method for detecting Babesia in a real-time polymerase chain reaction comprising a.

또한 본 발명은Also, the present invention

상기한 검출세트, 반응완충액 및 데옥시뉴클레오티드(dNTP)를 포함하는 바베시아 검출키트를 제공한다.Provided is a Babesia detection kit comprising the above detection set, reaction buffer, and deoxynucleotide (dNTP).

본 발명은 실시간 중합효소 연쇄반응을 이용하여 개 바베시아 감염증을 일으키는 바베시아 깁소니(Babesia gibsoni), 바베시아 캐니스(Babesia canis)를 신속하게 검출할 수 있다. 기존 바베시아 감염증 검출 방법 경우 일반적인 중합효소 연쇄반응을 이용한 것으로 전기영동이 필수로 과정에 포함되어 분석시간이 크게 소모되고 오염의 위험이 있다. 본 발명은 실시간 중합효소 연쇄반응을 이용한 것으로 기존 방법 대비 시간 소모와 오염의 위험이 적기 때문에 병원 현장에서 진단용으로 쓰이기에 유용하다.The present invention can rapidly detect Babesia gibsoni and Babesia canis that cause canine Babesia infection by using a real-time polymerase chain reaction. In the case of the existing Babesia infection detection method, a general polymerase chain reaction is used, and since electrophoresis is essential in the process, analysis time is greatly consumed and there is a risk of contamination. The present invention uses a real-time polymerase chain reaction, and since it consumes less time and reduces the risk of contamination compared to the existing method, it is useful for diagnosis in the hospital field.

도 1은 본 발명의 일 실시예에 따른 실시예 1의 프라이머/프로브를 이용하여 실시간 중합효소연쇄반응을 진행하여 바베시아 이외의 타 미생물에 대한
특이도를 확인한 결과를 나타낸 것이다.
도 2는 본 발명의 일 실시예에 따른 실시예 1의 프라이머/프로브를 이용하여 최소검출 한계 민감도를 확인한 실험 결과를 나타낸 것이다(R2: 0.99995, eff %: 102.14399).
도 3은 본 발명의 일 실시예에 따른 실시예 1의 프라이머/프로브를 이용하여 판정기준치 (Cut-off)를 확인한 실험 결과를 나타낸 것이다.1 is a real-time polymerase chain reaction using the primer/probe of Example 1 according to an embodiment of the present invention for other microorganisms other than Babesia.
Shows the results of confirming specificity.
2 shows the experimental results confirming the minimum detection limit sensitivity using the primer/probe of Example 1 according to an embodiment of the present invention (R 2 : 0.99995, eff %: 102.14399).
3 shows the experimental results of confirming the cut-off value using the primer/probe of Example 1 according to an embodiment of the present invention.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 바베시아 hsp 70 유전자를 표적 유전자로 하여 PCR을 통해 증폭시키고, 동시에 증폭 산물에 혼성가능하며 검출가능한 수단으로 표지된 프로브를 반응시킴으로써, 실시간 PCR 방법을 통해 개 바베시아 감염증을 일으키는 바베시아 깁소니(Babesia gibsoni), 바베시아 캐니스(Babesia canis)를 검출하는 방법에 관한 것이다.The present invention amplifies the Babesia hsp 70 gene as a target gene through PCR and simultaneously reacts the amplification product with a probe labeled with a hybrid and detectable means, thereby causing a canine Babesia infection through real-time PCR. Gibsoni ( Babesia gibsoni ), and relates to a method for detecting Babesia canis ( Babesia canis ).

본 발명에서 언급한 실시간 PCR 방법은 thermal cycler와 분광 형광광도계가 일체화된 장치를 이용하여, 실시간으로 PCR 증폭산물의 생성과정을 모니터링하여 얻고자하는 DNA의 양을 분석하는 방법을 의미한다. 실시간 PCR방법은 PCR 증폭산물의 확인을 위한 전기영동이 필요 없으며, 증폭이 지수 함수적으로 일어나는 영역에서 증폭산물량을 비교하여 더욱 정확한 정량이 가능한, 신속성과 정량성이 뛰어난 방법이다.The real-time PCR method mentioned in the present invention refers to a method of analyzing the amount of DNA to be obtained by monitoring the production process of the PCR amplification product in real time using a device in which a thermal cycler and a spectrofluorophotometer are integrated. The real-time PCR method does not require electrophoresis to confirm the PCR amplification product, and it is a method with excellent rapidity and quantification that enables more accurate quantification by comparing the amount of amplification products in the region where amplification occurs exponentially.

이러한 과정으로 제작한, 본 발명의 바베시아 검출 세트의 상세한 사항은 하기 표 1과 같다.The details of the Babesia detection set of the present invention prepared by this process are shown in Table 1 below.

구분 division 염기서열 (5'->3') base sequence (5'->3') 타겟 유전자 target gene 비고note Babesia F1Babesia F1 CAACACYACCATCAGCCGTGCCAACACYACCATCAGCCGTGC hsp70hsp70 서열번호 1SEQ ID NO: 1 Babesia R1Babesia R1 TCGTGGATCTTCCTCTTGTCMAGTCGTGGATCTTCCTCTTGTCMAG 서열번호 2SEQ ID NO: 2 Babesia FAM BHQ1Babesia FAM BHQ1 CGTTTCGAGGAGATGTGTGGTGAGAAGTTCCGTTTCGAGGAGATGTGTGGTGAGAAGTTC 서열번호 3SEQ ID NO: 3

본 발명의 바베시아 검출용 세트 중 프로브의 3' 및 5' 말단에 검출 가능한 수단을 포함하거나, 예컨대 표지되어 있을 수 있다. 상기 검출가능한 수단은 프로브에 연결, 결합, 또는 부착시켜 통상적인 방식으로 밀도, 농도, 양 등을 확인할 수 있는 화합물, 생체 분자 또는 생체 분자 모방체 등을 의미한다. 그 예로, 통상적으로 사용되는 형광 표지인자, 발광물질, 생발광물질, 동위원소 등이 있으나, 이로 한정되는 것은 아니다.In the set for detecting Babesia of the present invention, a detectable means may be included at the 3' and 5' ends of the probe, or may be labeled, for example. The detectable means refers to a compound, biomolecule or biomolecular mimic, etc. that can be linked to, bound to, or attached to a probe to check density, concentration, amount, etc. in a conventional manner. Examples include, but are not limited to, commonly used fluorescent labeling factors, luminescent materials, bioluminescent materials, isotopes, and the like.

다른 예로, 형광 표지 인자가 가장 바람직하다. 형광 표지 인자는 현재 시중에 다수 종이 시판되고 있으므로, 용이하게 입수가능하다. 형광 표지 인자의 예로는, FAM, VIC, TAMRA, JOE, ROX, NED, HEX, TET, SYBR Green, Cy3, Texas Red, RED610, RED670, Cy5™ 등이 있으나, 이로 한정되는 것은 아니다. 형광 표지 인자는 종류에 따라 여기 및 방사 파장이 다르면 사용방법 또한 상이하므로, 이를 고려하여 하나의 PCR 반응물에 함께 사용하는 형광 표지 인자는 별개로 검출가능한지 여부를 판단하여 선택 사용하여야 하며, 서로 다른 색상을 사용할 수 있다. 상기 형광 표지 인자에 대한 구체적인 사항 및 선택은 본원 발명에 속하는 기술분야의 당업자들에게 자명한 것이다.In another example, a fluorescent labeling factor is most preferred. Fluorescent labeling factors are readily available, as many species are currently commercially available on the market. Examples of fluorescent labeling factors include, but are not limited to, FAM, VIC, TAMRA, JOE, ROX, NED, HEX, TET, SYBR Green, Cy3, Texas Red, RED610, RED670, Cy5™. If the excitation and radiation wavelengths of the fluorescent labeling factor are different depending on the type, the method of use is also different. Considering this, the fluorescent labeling factor used together in one PCR reaction should be selected and used by determining whether it is detectable separately, and different colors are used. can be used Specific details and selection of the fluorescent labeling factor will be apparent to those skilled in the art to which the present invention pertains.

일 예로, 형광 표지 인자는 통상의 방법으로 본 발명에 따른 바베시아 검출세트에 포함된 프라이머, 또는 프로브에 표지된다. 표지 방법은 인터칼레이팅(intercalating) 방법, TaqMan™ 프로브법 및 분자비콘(Molecualr beacon) 방법들이 있다. 인터칼레이팅 방법은 이중가닥 DNA에 결합하여 형광을 나타내는 시약(inter-calator: SYBR Green I, EtBr 등)을 PCR 반응에 첨가하여 증폭과 함께 발색하는 형광을 검출하는 방법으로, 인터컬레이터가 PCR 반응으로 합성된 이중가닥 DNA에 결합하여 형광을 발하며 이 형광강도를 검출하여 증폭산물의 생성량을 측정할 수 있다. TaqMan™ 프로브법은 5'말단을 형광 표지인자(FAM 등)로 3'말단을 quencher물질(TAMRA 등)로 수식한 올리고뉴클레오티드(TaqManTM probe)를 PCR 반응액에 첨가하는 방법으로, TaqManTM 프로브가 어닐링 단계에서 주형 DNA에 특이적으로 혼성화하지만, 프로브상의 형광 억제 물질(quencher)에 의해 형광 발생이 억제되고, 연장 단계에서 Taq DNA 중합효소가 갖는 5'→ 3' 엑소뉴클레아제 활성으로주형에 혼성화한 TaqMan™ 프로브만 분해되어 형광색소가 프로브에서 유리되므로서 형광 억제 물질(quencher)에 의한 억제가 해제되어 형광을 발하게 된다. 분자 비콘방법은 양 말단을 형광 표지인자(FAM, TAMRA 등)과 형광 억제 물질(quencher)(DABCYL 등)로 수식한 헤어핀형 이차구조를 만드는 올리고뉴클레오티드 프로브(Molecular Beacon probe)를 PCR 반응계에 첨가하는 방법이다. 분자 비콘 프로브는 유리 상태에서 헤어핀 구조를 취하며 형광 표지인자와 quencher 물질에 근접해 있어 형광발생이 억제되지만, 어닐링 단계에서 주형 DNA와 상보적인 영역에서 특이적으로 혼성화할때 형광 표지인자와 quencher 물질과의 거리가 멀어져 quencher 물질에 의한 억제가 해소됨으로써 프로브상의 형광색소가 형광을 나타내게 된다. 그러나, 혼성화되지 않은 분자 비콘 프로브는 헤어핀 구조를 유지하고 있어 형광을 나타내지 않게 된다.For example, the fluorescent labeling factor is labeled with a primer or a probe included in the Babesia detection set according to the present invention by a conventional method. The labeling method includes an intercalating method, a TaqMan™ probe method, and a molecular beacon method. The intercalating method is a method of detecting fluorescence that develops with amplification by adding a reagent (inter-calator: SYBR Green I, EtBr, etc.) that binds to double-stranded DNA and exhibits fluorescence to the PCR reaction. It binds to the double-stranded DNA synthesized by the reaction to emit fluorescence, and by detecting the fluorescence intensity, the amount of amplified product can be measured. The TaqMan ™ probe method is a method in which an oligonucleotide (TaqMan ™ probe) modified with a fluorescent labeling factor (FAM, etc.) at the 5’ end and a quencher material (TAMRA, etc.) at the 3’ end is added to the PCR reaction solution. hybridizes specifically to the template DNA in the annealing step, but the fluorescence generation is suppressed by the fluorescence suppressing substance (quencher) on the probe, and the 5' → 3' exonuclease activity of Taq DNA polymerase in the extension step. As only the TaqMan™ probe hybridized with the fluorescence dye is decomposed and the fluorochrome is released from the probe, the suppression by the fluorescence quencher is released and fluorescence is emitted. In the molecular beacon method, both ends of an oligonucleotide probe (Molecular Beacon probe) are added to the PCR reaction system to create a hairpin-type secondary structure modified with a fluorescent labeling factor (FAM, TAMRA, etc.) and a fluorescence suppressing material (DABCYL, etc.). way. Molecular beacon probes have a hairpin structure in the free state and are close to the fluorescent labeling factor and quencher material, so fluorescence is suppressed. As the distance between the probes increases, the suppression by the quencher substance is eliminated, so that the fluorescent dye on the probe shows fluorescence. However, the non-hybridized molecular beacon probe maintains a hairpin structure and thus does not exhibit fluorescence.

이러한 방법을 본 발명의 바베시아를 검출하기 위한 실시간 PCR 방법에 적용할 수 있다. 상기한 방법들은 당업계에 공지된 것이므로, 반응 효율, 시간, 형광 표지인자 타입 등을 적절히 고려하여, 특정 방법을 선택할 수 있을 것이다. 본 발명에서는 일 예로, TaqMan™ 프로브 방법을 사용할 수 있다. 이때 상기 프로브는 5'말단이 JOE, VIC, 헥사클로로-6-카르복시플루오레세인(Hexachloro-6-carboxyfluorescein, HEX), 6-카르복시플루오레세인(6-carboxyfluorescein, FAM), 시아닌-5(Cyanine-5, Cy5) 및 ROX로 이루어진 군으로부터 선택되는 1종의 형광물질로 표지되며, 상기 프로브의 3'-말단은 BHQ(Black hole Quencher)-1, BHQ-2, BHQ-3, TAO 및 MGB로 이루어진 군으로부터 선택된 1종의 형광 억제 물질(Quencher)로 표지된다.This method can be applied to the real-time PCR method for detecting Babesia of the present invention. Since the above methods are known in the art, a specific method may be selected by appropriately considering reaction efficiency, time, type of fluorescent label, and the like. In the present invention, as an example, the TaqMan™ probe method may be used. At this time, the 5' end of the probe is JOE, VIC, hexachloro-6-carboxyfluorescein (HEX), 6-carboxyfluorescein (FAM), cyanine-5 (Cyanine) -5, Cy5) and one type of fluorescent substance selected from the group consisting of ROX, and the 3'-end of the probe is BHQ (Black Hole Quencher)-1, BHQ-2, BHQ-3, TAO and MGB It is labeled with one kind of fluorescence suppressing substance (Quencher) selected from the group consisting of.

본 발명의 바베시아를 검출하는 방법에 있어, 실시간 PCR 반응 조건은 통상적인 조건을 취할 수 있다.In the method for detecting Babesia of the present invention, real-time PCR reaction conditions may be conventional conditions.

또한, 본 발명의 바베시아 검출세트는 통상적인 실시간 PCR 방법 및 장치를 사용하여, 실시할 수 있다. 상기 실시간 PCR 방법은 DNA 중합효소와 형광공명 에너지이동(Fluorescence Resonance Energy Transfer, FRET)의 원리에 의해 PCR의 매 주기마다 실시간으로 시행되는 형광을 검출하고 정량하는 방법이다.In addition, the Babesia detection set of the present invention can be performed using a conventional real-time PCR method and apparatus. The real-time PCR method is a method for detecting and quantifying fluorescence performed in real time every cycle of PCR by the principle of DNA polymerase and fluorescence resonance energy transfer (FRET).

이러한 방법은 특이적인 증폭산물을 비 특이적인 증폭산물로부터 구별하여 확인할 수 있으며, 자동화된 양상으로 분석 결과를 쉽게 입수할 수 있다.In this method, specific amplification products can be identified by distinguishing them from non-specific amplification products, and analysis results can be easily obtained in an automated manner.

본 발명의 바베시아 검출세트 및 이를 이용한 바베시아 검출 방법에 의해, 기존의 바베시아를 검출하기 위한 PCR 과정을 현저하게 단축시킬 수 있을 뿐만 아니라, 그 결과를 실시간으로 신속하게 확인할 수 있다.By the Babesia detection set of the present invention and the Babesia detection method using the same, the PCR process for detecting Babesia can be significantly shortened, and the result can be quickly confirmed in real time.

또한, 본 발명은 상기한 검출 세트를 포함하는, 바베시아 검출용 키트를 제공한다. 상기 프라이머 쌍 및 프로브는 하나의 반응 용기, 스트립 또는 마이크로플레이트에 패키징될 수 있으며, 당업계에 공지된 방법으로 패키징된다.In addition, the present invention provides a kit for detecting Babesia, including the detection set described above. The primer pair and probe may be packaged in one reaction vessel, strip or microplate, and packaged by methods known in the art.

또한, 본 발명의 키트는 택 중합효소(Taq. polymerase), MgCl2를 포함한 반응 완충액, dNTP 및 안정화제(stabilizer)로 이루어진 군으로부터 선택된 1종 이상을 더 포함할 수 있으며, 그 외에도 당업계에 공지된 다른 시약, 예컨대 실시간 PCR용 마스터 믹스를 추가적으로 포함할 수 있다.In addition, the kit of the present invention may further include one or more selected from the group consisting of a tag polymerase ( Taq. polymerase), a reaction buffer containing MgCl 2 , dNTP and a stabilizer, and in addition to those in the art Other known reagents, such as master mix for real-time PCR, may be additionally included.

이하 본 발명의 내용을 실시예 및 시험예를 통하여 구체적으로 설명한다. 그러나, 이들은 본 발명을 보다 상세하게 설명하기 위한 것으로 본 발명의 권리범위가 이들에 의해 한정되는 것은 아니다.Hereinafter, the contents of the present invention will be described in detail through Examples and Test Examples. However, these are for describing the present invention in more detail, and the scope of the present invention is not limited thereto.

실시예 1: 프라이머 및 프로브 구성Example 1: Primer and Probe Construction

바베시아 검출을 위한 표적 유전자를 hsp 70 유전자로 선정하였다. Reference 서열을 기준으로 NCBI DB에서 nucleotide blast를 진행하여 529개의 유사 서열을 수집하였고 수집된 서열을 비교하여 바베시아 깁소니(Babesia gibsoni), 바베시아 캐니스(B. canis)를 특이적으로 검출할 수 있는 프라이머와 프로브를 디자인 하였다.The target gene for the detection of Babesia was selected as the hsp 70 gene. Based on the reference sequence, nucleotide blast was performed in the NCBI DB to collect 529 similar sequences. Primers and probes that can be used were designed.

사용한 reference sequence는 다음과 같다: Accession No. AB083515(Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea4)The reference sequence used is as follows: Accession No. AB083515 (Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea4)

서열 수집을 위한 nucleotide blast의 조건은 아래와 같다:The nucleotide blast conditions for sequence collection are as follows:

- Max target sequences : 1,000- Max target sequences : 1,000

- Optimize for Highly similar sequences (Megablast)- Optimize for Highly similar sequences (Megablast)

- Database : Standard database_nucleotide collection (nr/nt)- Database: Standard database_nucleotide collection (nr/nt)

디자인된 프라이머와 프로브의 서열은 표 2와 같다.The sequences of the designed primers and probes are shown in Table 2.

구분 division 염기서열 (5'->3') base sequence (5'->3') 타겟 유전자 target gene 비고note Babesia F1Babesia F1 CAACACYACCATCAGCCGTGCCAACACYACCATCAGCCGTGC hsp70hsp70 서열번호 1SEQ ID NO: 1 Babesia R1Babesia R1 TCGTGGATCTTCCTCTTGTCMAGTCGTGGATCTTCCTCTTGTCMAG 서열번호 2SEQ ID NO: 2 Babesia FAM BHQ1Babesia FAM BHQ1 CGTTTCGAGGAGATGTGTGGTGAGAAGTTCCGTTTCGAGGAGATGTGTGGTGAGAAGTTC 서열번호 3SEQ ID NO: 3

실험예Experimental example 1: One: 바베시아Babesia 깁소니Gibbsoni , , 바베시아Babesia 캐니스canis 검출용 for detection 프라이머primer , , 프로브의of the probe 이론적 특이도 확인 Confirmation of theoretical specificity

타 균주, 기생충, 바이러스에 대한 교차반응 여부를 확인하기 위해 디자인 된 프라이머와 프로브를 각각 NCBI nucleotide blast를 이용하여 검증하였다.The primers and probes designed to check for cross-reactivity with other strains, parasites and viruses were each verified using NCBI nucleotide blast.

이론적 특이도 확인을 위한 nucleotide blast의 조건은 아래와 같다:The conditions for nucleotide blast to confirm theoretical specificity are as follows:

- Max target sequences : 1,000- Max target sequences : 1,000

- Optimize for Highly similar sequences (Megablast)- Optimize for Highly similar sequences (Megablast)

- Database : Standard database_nucleotide collection (nr/nt)- Database: Standard database_nucleotide collection (nr/nt)

서열번호 1의 정방향 프라이머(Babesia F1)에 대한 blast 결과를 아래 표 3에 나타내었다.The blast results for the forward primer (Babesia F1) of SEQ ID NO: 1 are shown in Table 3 below.

No.No. DescriptionDescription Max ScoreMax Score E valueE value Per.
Ident*Per.
Ident* AccessionAccession 검출여부detection 1One Babesia canis vogeli isolate Bengaluru-490 heat shock protein 70 (hsp70) gene, partial cdsBabesia canis vogeli isolate Bengaluru-490 heat shock protein 70 (hsp70) gene, partial cds 39.439.4 0.90.9 95.2495.24 MK947103.1MK947103.1 OO 22 Babesia canis vogeli isolate Bengaluru-401 heat shock protein 70 (hsp70) gene, partial cdsBabesia canis vogeli isolate Bengaluru-401 heat shock protein 70 (hsp70) gene, partial cds 39.439.4 0.90.9 95.2495.24 MK947102.1MK947102.1 OO 33 Babesia canis vogeli isolate Bengaluru-102 heat shock protein 70 (hsp70) gene, partial cdsBabesia canis vogeli isolate Bengaluru-102 heat shock protein 70 (hsp70) gene, partial cds 39.439.4 0.90.9 95.2495.24 MK947101.1MK947101.1 OO 44 Babesia ovata heat shock 70 (BOVATA_024020), partial mRNABabesia ovata heat shock 70 (BOVATA_024020), partial mRNA 39.439.4 0.90.9 95.2495.24 XM_029011319.1XM_029011319.1 OO 55 Babesia bigemina dnaK protein, putative partial mRNABabesia bigemina dnaK protein, putative partial mRNA 39.439.4 0.90.9 95.2495.24 XM_012910642.1XM_012910642.1 OO 66 Babesia bigemina genome assembly Bbig001, chromosome : IBabesia bigemina genome assembly Bbig001, chromosome : I 39.439.4 0.90.9 95.2495.24 LK391707.1LK391707.1 OO 77 Babesia bovis BBOV_III010010 mRNA for dnaK protein, complete cds,
clone: XBBk017269, strain: TexasBabesia bovis BBOV_III010010 mRNA for dnaK protein, complete cds,
clone: XBBk017269, strain: Texas 39.439.4 0.90.9 95.2495.24 AK441590.1AK441590.1 OO 88 Babesia bovis BBOV_III010010 mRNA for dnaK protein, complete cds,
clone: XBBk005181, strain: TexasBabesia bovis BBOV_III010010 mRNA for dnaK protein, complete cds,
clone: XBBk005181, strain: Texas 39.439.4 0.90.9 95.2495.24 AK440760.1AK440760.1 OO 99 Babesia bovis BBOV_III010010 mRNA for dnaK protein, complete cds,
clone: XBBk004153, strain: TexasBabesia bovis BBOV_III010010 mRNA for dnaK protein, complete cds,
clone: XBBk004153, strain: Texas 39.439.4 0.90.9 95.2495.24 AK440686.1AK440686.1 OO 1010 Babesia gibsoni strain TWN2 heat shock protein 70 (hsp70) gene, partial cdsBabesia gibsoni strain TWN2 heat shock protein 70 (hsp70) gene, partial cds 39.439.4 0.90.9 95.2495.24 FJ763842.1FJ763842.1 OO 1111 Babesia gibsoni strain TWN5 heat shock protein 70 (hsp70) gene, partial cdsBabesia gibsoni strain TWN5 heat shock protein 70 (hsp70) gene, partial cds 39.439.4 0.90.9 95.2495.24 FJ763841.1FJ763841.1 OO 1212 Babesia gibsoni strain TWN3 heat shock protein 70 (hsp70) gene, partial cdsBabesia gibsoni strain TWN3 heat shock protein 70 (hsp70) gene, partial cds 39.439.4 0.90.9 95.2495.24 FJ763839.1FJ763839.1 OO 1313 Babesia bigemina HSP70 mRNA for heat shock protein 70, complete cdsBabesia bigemina HSP70 mRNA for heat shock protein 70, complete cds 39.439.4 0.90.9 95.2495.24 AB482178.1AB482178.1 OO 1414 Babesia gibsoni strain TWN1 heat shock protein 70 (hsp70) gene, partial cdsBabesia gibsoni strain TWN1 heat shock protein 70 (hsp70) gene, partial cds 39.439.4 0.90.9 95.2495.24 EF584826.1EF584826.1 OO 1515 Babesia bovis dnaK protein (BBOV_III010010) mRNA, complete cdsBabesia bovis dnaK protein (BBOV_III010010) mRNA, complete cds 39.439.4 0.90.9 95.2495.24 XM_001612075.1XM_001612075.1 OO 1616 Babesia canis vogeli heat shock protein 70 (hsp70) gene, complete cdsBabesia canis vogeli heat shock protein 70 (hsp70) gene, complete cds 39.439.4 0.90.9 95.2495.24 EF527401.1EF527401.1 OO 1717 Babesia orientalis heat shock protein 70 mRNA, complete cdsBabesia orientalis heat shock protein 70 mRNA, complete cds 39.439.4 0.90.9 95.2495.24 EF512547.1EF512547.1 OO 1818 Babesia caballi hsp70 gene for heat shock protein 70, partial cds, isolate: BcabUSDABabesia caballi hsp70 gene for heat shock protein 70, partial cds, isolate: BcabUSDA 39.439.4 0.90.9 95.2495.24 AB248742.1AB248742.1 OO 1919 Babesia odocoilei hsp70 gene for heat shock protein 70, partial cds, isolate: Bodo625-3Babesia odocoilei hsp70 gene for heat shock protein 70, partial cds, isolate: Bodo625-3 39.439.4 0.90.9 95.2495.24 AB248740.1AB248740.1 OO 2020 Babesia canis rossi hsp70 gene for heat shock protein 70, partial cds, isolate: Bcr69Babesia canis rossi hsp70 gene for heat shock protein 70, partial cds, isolate: Bcr69 39.439.4 0.90.9 95.2495.24 AB248737.1AB248737.1 OO 2121 Babesia canis rossi hsp70 gene for heat shock protein 70, partial cds, isolate: Bcr44Babesia canis rossi hsp70 gene for heat shock protein 70, partial cds, isolate: Bcr44 39.439.4 0.90.9 95.2495.24 AB248736.1AB248736.1 OO 2222 Babesia canis canis hsp70 gene for heat shock protein 70, complete cds, isolate: Bcc450Babesia canis canis hsp70 gene for heat shock protein 70, complete cds, isolate: Bcc450 39.439.4 0.90.9 95.2495.24 AB248735.1AB248735.1 OO 2323 Babesia canis canis hsp70 gene for heat shock protein 70, complete cds, isolate: Bcc295Babesia canis canis hsp70 gene for heat shock protein 70, complete cds, isolate: Bcc295 39.439.4 0.90.9 95.2495.24 AB248734.1AB248734.1 OO 2424 Babesia vogeli hsp70 gene for heat shock protein 70, complete cds, isolate: BcvOki76Babesia vogeli hsp70 gene for heat shock protein 70, complete cds, isolate: BcvOki76 39.439.4 0.90.9 95.2495.24 AB248733.1AB248733.1 OO 2525 Babesia vogeli hsp70 gene for heat shock protein 70, partial cds, isolate: BcvOki64Babesia vogeli hsp70 gene for heat shock protein 70, partial cds, isolate: BcvOki64 39.439.4 0.90.9 95.2495.24 AB248732.1AB248732.1 OO 2626 Babesia gibsoni hsp70 gene for heat shock protein 70, complete cds, isolate: BgOki61Babesia gibsoni hsp70 gene for heat shock protein 70, complete cds, isolate: BgOki61 39.439.4 0.90.9 95.2495.24 AB248730.1AB248730.1 OO 2727 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea4Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea4 39.439.4 0.90.9 95.2495.24 AB083515.1AB083515.1 OO 2828 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea3Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea3 39.439.4 0.90.9 95.2495.24 AB083514.1AB083514.1 OO 2929 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea2Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea2 39.439.4 0.90.9 95.2495.24 AB083513.1AB083513.1 OO 3030 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea1Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea1 39.439.4 0.90.9 95.2495.24 AB083512.1AB083512.1 OO 3131 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Japan2Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Japan2 39.439.4 0.90.9 95.2495.24 AB083511.1AB083511.1 OO 3232 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Japan1Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Japan1 39.439.4 0.90.9 95.2495.24 AB083510.1AB083510.1 OO 3333 Babesia bovis heat shock protein 70 (HSP70) mRNA, complete cdsBabesia bovis heat shock protein 70 (HSP70) mRNA, complete cds 39.439.4 0.90.9 95.2495.24 AF107118.1AF107118.1 OO 3434 Babesia ovata NAD-specific glutamate dehydrogenase (BOVATA_024010), partial mRNABabesia ovata NAD-specific glutamate dehydrogenase (BOVATA_024010), partial mRNA 39.439.4 0.90.9 95.2495.24 XM_029011318.1XM_029011318.1 OO 3535 [Mycobacterium] chelonae subsp. chelonae strain DSM 43804 chromosome, complete genome[Mycobacterium] chelonae subsp. chelonae strain DSM 43804 chromosome, complete genome 39.439.4 0.90.9 95.2495.24 CP034383.1CP034383.1 OO 3636 Mycobacterium phlei strain NCTC8151 genome assembly, chromosome: 1Mycobacterium phlei strain NCTC8151 genome assembly, chromosome: 1 39.439.4 0.90.9 95.2495.24 LR134347.1LR134347.1 OO 3737 Mycobacterium chelonae CCUG 47445, complete genomeMycobacterium chelonae CCUG 47445, complete genome 39.439.4 0.90.9 95.2495.24 CP007220.1CP007220.1 OO 3838 Mycobacterium chelonae genomeMycobacterium chelonae genome 39.439.4 0.90.9 95.2495.24 CP010946.1CP010946.1 OO 3939 Parambassis ranga genome assembly, chromosome: 16Parambassis ranga genome assembly, chromosome: 16 37.337.3 3.73.7 9595 LR131966.1LR131966.1 XX 4040 Anabaena cylindrica PCC 7122 chromosome, complete genomeAnabaena cylindrica PCC 7122 chromosome, complete genome 37.337.3 3.73.7 9595 CP003659.1CP003659.1 XX 4141 Babesia divergens hsp70 gene for heat shock protein 70, complete cds, isolate: BdivUKBabesia divergens hsp70 gene for heat shock protein 70, complete cds, isolate: BdivUK 37.337.3 3.73.7 9595 AB248739.1AB248739.1 XX 4242 Chitinophaga sp. 1303 chromosome, complete genomeChitinophaga sp. 1303 chromosome, complete genome 37.337.3 3.73.7 9595 CP051204.1CP051204.1 XX 4343 Chitinophaga sp. 1310 chromosome, complete genomeChitinophaga sp. 1310 chromosome, complete genome 37.337.3 3.73.7 9595 CP051205.1CP051205.1 XX 4444 Sphaerospermopsis kisseleviana NIES-73 DNA, nearly complete genomeSphaerospermopsis kisseleviana NIES-73 DNA, nearly complete genome 37.337.3 3.73.7 9595 AP018314.1AP018314.1 XX 4545 Anabaena cylindrica PCC 7122 DNA, nearly complete genomeAnabaena cylindrica PCC 7122 DNA, nearly complete genome 37.337.3 3.73.7 9595 AP018166.1AP018166.1 XX 4646 Mycobacterium sp. EPM10906, complete genomeMycobacterium sp. EPM10906, complete genome 37.337.3 3.73.7 9595 CP010271.1CP010271.1 XX 4747 Calothrix sp. PCC 7507 chromosome, complete genomeCalothrix sp. PCC 7507 chromosome, complete genome 37.337.3 3.73.7 9595 CP003943.1CP003943.1 XX 4848 Spirosoma sp. I-24 chromosomeSpirosoma sp. I-24 chromosome 35.335.3 1515 94.7494.74 CP045997.1CP045997.1 XX 4949 PREDICTED: Contarinia nasturtii protein kinase C-binding protein 1-like
(LOC116342390), transcript variant X2, mRNAPREDICTED: Contarinia nasturtii protein kinase C-binding protein 1-like
(LOC116342390), transcript variant X2, mRNA 35.335.3 1515 94.7494.74 XM_031769982.1XM_031769982.1 XX 5050 PREDICTED: Contarinia nasturtii protein kinase C-binding protein 1-like
(LOC116342390), transcript variant X1, mRNAPREDICTED: Contarinia nasturtii protein kinase C-binding protein 1-like
(LOC116342390), transcript variant X1, mRNA 35.335.3 1515 94.7494.74 XM_031769981.1XM_031769981.1 XX *per. Ident: Primer sequence에 mixed base code (Y)가 포함되어 프로그램에서 1 base pair 불일치 값인 95.24% 일치로 표시됨.*per. Ident: Primer sequence contains mixed base code (Y), which is displayed as 95.24% match, which is 1 base pair mismatch value in the program.

서열번호 2의 역방향 프라이머(Babesia R1)에 대한 blast 결과는 아래 표 4에 나타내었다.The blast results for the reverse primer (Babesia R1) of SEQ ID NO: 2 are shown in Table 4 below.

No.No. DescriptionDescription Max ScoreMax Score E valueE value Per. identPer. ident AccessionAccession 검출여부detection 1One Babesia canis vogeli isolate Bengaluru-490 heat shock protein 70 (hsp70) gene, partial cdsBabesia canis vogeli isolate Bengaluru-490 heat shock protein 70 (hsp70) gene, partial cds 43.343.3 0.110.11 95.6595.65 MK947103.1MK947103.1 OO 22 Babesia canis vogeli isolate Bengaluru-401 heat shock protein 70 (hsp70) gene, partial cdsBabesia canis vogeli isolate Bengaluru-401 heat shock protein 70 (hsp70) gene, partial cds 43.343.3 0.110.11 95.6595.65 MK947102.1MK947102.1 OO 33 Babesia canis vogeli isolate Bengaluru-102 heat shock protein 70 (hsp70) gene, partial cdsBabesia canis vogeli isolate Bengaluru-102 heat shock protein 70 (hsp70) gene, partial cds 43.343.3 0.110.11 95.6595.65 MK947101.1MK947101.1 OO 44 Babesia bigemina dnaK protein, putative partial mRNABabesia bigemina dnaK protein, putative partial mRNA 43.343.3 0.110.11 95.6595.65 XM_012910642.1XM_012910642.1 OO 55 Babesia bigemina genome assembly Bbig001, chromosome : IBabesia bigemina genome assembly Bbig001, chromosome : I 43.343.3 0.110.11 95.6595.65 LK391707.1LK391707.1 OO 66 Babesia gibsoni strain TWN2 heat shock protein 70 (hsp70) gene, partial cdsBabesia gibsoni strain TWN2 heat shock protein 70 (hsp70) gene, partial cds 43.343.3 0.110.11 95.6595.65 FJ763842.1FJ763842.1 OO 77 Babesia gibsoni strain TWN5 heat shock protein 70 (hsp70) gene, partial cdsBabesia gibsoni strain TWN5 heat shock protein 70 (hsp70) gene, partial cds 43.343.3 0.110.11 95.6595.65 FJ763841.1FJ763841.1 OO 88 Babesia gibsoni strain TWN3 heat shock protein 70 (hsp70) gene, partial cdsBabesia gibsoni strain TWN3 heat shock protein 70 (hsp70) gene, partial cds 43.343.3 0.110.11 95.6595.65 FJ763839.1FJ763839.1 OO 99 Babesia bigemina HSP70 mRNA for heat shock protein 70, complete cdsBabesia bigemina HSP70 mRNA for heat shock protein 70, complete cds 43.343.3 0.110.11 95.6595.65 AB482178.1AB482178.1 OO 1010 Babesia gibsoni strain TWN1 heat shock protein 70 (hsp70) gene, partial cdsBabesia gibsoni strain TWN1 heat shock protein 70 (hsp70) gene, partial cds 43.343.3 0.110.11 95.6595.65 EF584826.1EF584826.1 OO 1111 Babesia canis vogeli heat shock protein 70 (hsp70) gene, complete cdsBabesia canis vogeli heat shock protein 70 (hsp70) gene, complete cds 43.343.3 0.110.11 95.6595.65 EF527401.1EF527401.1 OO 1212 Babesia orientalis heat shock protein 70 mRNA, complete cdsBabesia orientalis heat shock protein 70 mRNA, complete cds 43.343.3 0.110.11 95.6595.65 EF512547.1EF512547.1 OO 1313 Babesia caballi hsp70 gene for heat shock protein 70, partial cds, isolate: BcabUSDABabesia caballi hsp70 gene for heat shock protein 70, partial cds, isolate: BcabUSDA 43.343.3 0.110.11 95.6595.65 AB248742.1AB248742.1 OO 1414 Babesia ovis hsp70 gene for heat shock protein 70, partial cds, isolate: BovTurBabesia ovis hsp70 gene for heat shock protein 70, partial cds, isolate: BovTur 43.343.3 0.110.11 95.6595.65 AB248741.1AB248741.1 OO 1515 Babesia canis rossi hsp70 gene for heat shock protein 70, partial cds, isolate: Bcr69Babesia canis rossi hsp70 gene for heat shock protein 70, partial cds, isolate: Bcr69 43.343.3 0.110.11 95.6595.65 AB248737.1AB248737.1 OO 1616 Babesia canis rossi hsp70 gene for heat shock protein 70, partial cds, isolate: Bcr44Babesia canis rossi hsp70 gene for heat shock protein 70, partial cds, isolate: Bcr44 43.343.3 0.110.11 95.6595.65 AB248736.1AB248736.1 OO 1717 Babesia canis canis hsp70 gene for heat shock protein 70, complete cds, isolate: Bcc450Babesia canis canis hsp70 gene for heat shock protein 70, complete cds, isolate: Bcc450 43.343.3 0.110.11 95.6595.65 AB248735.1AB248735.1 OO 1818 Babesia canis canis hsp70 gene for heat shock protein 70, complete cds, isolate: Bcc295Babesia canis canis hsp70 gene for heat shock protein 70, complete cds, isolate: Bcc295 43.343.3 0.110.11 95.6595.65 AB248734.1AB248734.1 OO 1919 Babesia vogeli hsp70 gene for heat shock protein 70, complete cds, isolate: BcvOki76Babesia vogeli hsp70 gene for heat shock protein 70, complete cds, isolate: BcvOki76 43.343.3 0.110.11 95.6595.65 AB248733.1AB248733.1 OO 2020 Babesia vogeli hsp70 gene for heat shock protein 70, partial cds, isolate: BcvOki64Babesia vogeli hsp70 gene for heat shock protein 70, partial cds, isolate: BcvOki64 43.343.3 0.110.11 95.6595.65 AB248732.1AB248732.1 OO 2121 Babesia gibsoni hsp70 gene for heat shock protein 70, complete cds, isolate: BgOki61Babesia gibsoni hsp70 gene for heat shock protein 70, complete cds, isolate: BgOki61 43.343.3 0.110.11 95.6595.65 AB248730.1AB248730.1 OO 2222 Babesia gibsoni hsp70 gene for heat shock protein 70, partial cds, strain: Aomori 2Babesia gibsoni hsp70 gene for heat shock protein 70, partial cds, strain: Aomori 2 43.343.3 0.110.11 95.6595.65 AB118031.1AB118031.1 OO 2323 Babesia gibsoni hsp70 gene for heat shock protein 70, partial cds, strain: Okinawa 1Babesia gibsoni hsp70 gene for heat shock protein 70, partial cds, strain: Okinawa 1 43.343.3 0.110.11 95.6595.65 AB118030.1AB118030.1 OO 2424 Babesia gibsoni hsp70 gene for heat shock protein 70, partial cds, strain: Aomori 1Babesia gibsoni hsp70 gene for heat shock protein 70, partial cds, strain: Aomori 1 43.343.3 0.110.11 95.6595.65 AB118028.1AB118028.1 OO 2525 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea4Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea4 43.343.3 0.110.11 95.6595.65 AB083515.1AB083515.1 OO 2626 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea3Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea3 43.343.3 0.110.11 95.6595.65 AB083514.1AB083514.1 OO 2727 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea2Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea2 43.343.3 0.110.11 95.6595.65 AB083513.1AB083513.1 OO 2828 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea1Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Korea1 43.343.3 0.110.11 95.6595.65 AB083512.1AB083512.1 OO 2929 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Japan2Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Japan2 43.343.3 0.110.11 95.6595.65 AB083511.1AB083511.1 OO 3030 Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Japan1Babesia gibsoni hsp70 mRNA for heat shock protein 70, complete cds, strain: Japan1 43.343.3 0.110.11 95.6595.65 AB083510.1AB083510.1 OO 3131 Babesia cf. odocoilei Fukui-766 hsp70 mRNA for heat shock protein 70, complete cdsBabesia cf. odocoilei Fukui-766 hsp70 mRNA for heat shock protein 70, complete cds 41.341.3 0.440.44 100100 LC430611.1LC430611.1 XX 3232 Babesia cf. odocoilei Akita-615 hsp70 mRNA for heat shock protein 70, complete cdsBabesia cf. odocoilei Akita-615 hsp70 mRNA for heat shock protein 70, complete cds 41.341.3 0.440.44 100100 LC430610.1LC430610.1 XX 3333 Babesia cf. odocoilei Akita-610 hsp70 mRNA for heat shock protein 70, complete cdsBabesia cf. odocoilei Akita-610 hsp70 mRNA for heat shock protein 70, complete cds 41.341.3 0.440.44 100100 LC430609.1LC430609.1 XX 3434 Babesia odocoilei hsp70 gene for heat shock protein 70, partial cds, isolate: Bodo625-3Babesia odocoilei hsp70 gene for heat shock protein 70, partial cds, isolate: Bodo625-3 41.341.3 0.440.44 100100 AB248740.1AB248740.1 XX 3535 PREDICTED: Stomoxys calcitrans eukaryotic translation initiation factor 2 subunit 3 (LOC106088297), transcript variant X1, mRNAPREDICTED: Stomoxys calcitrans eukaryotic translation initiation factor 2 subunit 3 (LOC106088297), transcript variant X1, mRNA 39.339.3 1.81.8 100100 XM_013253735.1XM_013253735.1 XX 3636 Aspergillus flavus strain AF36 chromosome 2Aspergillus flavus strain AF36 chromosome 2 37.237.2 7.47.4 100100 CP051020.1CP051020.1 XX 3737 Mytilinidion resinicola vacuolar membrane PQ loop repeat protein (BDZ99DRAFT_444186), mRNAMytilinidion resinicola vacuolar membrane PQ loop repeat protein (BDZ99DRAFT_444186), mRNA 37.237.2 7.47.4 100100 XM_033717882.1XM_033717882.1 XX 3838 Lotus japonicus B-129 DNA, chromosome 3, complete sequenceLotus japonicus B-129 DNA, chromosome 3, complete sequence 37.237.2 7.47.4 100100 AP022631.1AP022631.1 XX 3939 Ensifer adhaerens strain Corn53 plasmid AA, complete sequenceEnsifer adhaerens strain Corn53 plasmid AA, complete sequence 37.237.2 7.47.4 100100 CP030263.1CP030263.1 XX 4040 Gadus morhua genome assembly, chromosome: 7Gadus morhua genome assembly, chromosome: 7 37.237.2 7.47.4 100100 LR633949.1LR633949.1 XX 4141 PREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113065579), transcript variant X5, mRNAPREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113065579), transcript variant X5, mRNA 37.237.2 7.47.4 100100 XM_026236973.1XM_026236973.1 XX 4242 PREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113065579), transcript variant X4, mRNAPREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113065579), transcript variant X4, mRNA 37.237.2 7.47.4 100100 XM_026236962.1XM_026236962.1 XX 4343 PREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113065579), transcript variant X3, mRNAPREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113065579), transcript variant X3, mRNA 37.237.2 7.47.4 100100 XM_026236952.1XM_026236952.1 XX 4444 PREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113065579), transcript variant X2, mRNAPREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113065579), transcript variant X2, mRNA 37.237.2 7.47.4 100100 XM_026236942.1XM_026236942.1 XX 4545 PREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113065579), transcript variant X1, mRNAPREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113065579), transcript variant X1, mRNA 37.237.2 7.47.4 100100 XM_026236933.1XM_026236933.1 XX 4646 PREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113056736), mRNAPREDICTED: Carassius auratus collagen alpha-1(VII) chain-like (LOC113056736), mRNA 37.237.2 7.47.4 100100 XM_026223566.1XM_026223566.1 XX 4747 Oryzias latipes strain HSOK chromosome 13Oryzias latipes strain HSOK chromosome 13 37.237.2 7.47.4 100100 CP020633.1CP020633.1 XX 4848 Oryzias latipes strain HNI chromosome 13Oryzias latipes strain HNI chromosome 13 37.237.2 7.47.4 100100 CP020791.1CP020791.1 XX 4949 Oryzias latipes strain Hd-rR chromosome 13 sequenceOryzias latipes strain Hd-rR chromosome 13 sequence 37.237.2 7.47.4 100100 CP020677.1CP020677.1 XX 5050 TPA: Oryzias latipes strain Hd-rR, complete genome assembly, chromosome 13TPA: Oryzias latipes strain Hd-rR, complete genome assembly, chromosome 13 37.237.2 7.47.4 100100 HF933219.1HF933219.1 XX *per. Ident: Primer sequence에 mixed base code (M)가 포함되어 프로그램에서 1 base pair 불일치 값인 95.45% 일치로 표시됨.
**No. 31~50의 per. Ident값이 100%인 이유는 R1 염기서열 23개 중 20개 이하로 100% 일치하는 결과임.*per. Ident: Primer sequence contains mixed base code (M), so it is displayed as 1 base pair mismatch value of 95.45% match in the program.
**No. 31-50 per. The reason that the Ident value is 100% is the result of 100% agreement with less than 20 out of 23 R1 nucleotide sequences.

각 프라이머와 프로브 세트에 대하여 NCBI nucleotide blast를 통해 이론적 특이도를 확인한 결과, 서열번호 2 내지 3의 역방향 프라이머와 프로브 서열은 바베시아 깁소니(Babesia gibsoni), 바베시아 캐니스(Babesia canis) 이외의 타 미생물에 불일치 하는 것을 확인하였다. 서열번호 1의 정방향 프라이머 서열의 경우, 바베시아 이외에 Mycobacterium 일부의 서열에 일치하는 것으로 확인되었다. 그러나 중합효소 연쇄반응의 특성상 정방향 프라이머 서열과 역방향 프라이머 서열이 미생물에 동시에 일치하지 않는 경우 검출되지 않으므로 Mycobacterium에 대한 잘못된 검출은 없을 것으로 판단된다.As a result of confirming the theoretical specificity through NCBI nucleotide blast for each primer and probe set, the reverse primer and probe sequences of SEQ ID NOs: 2 to 3 are Babesia gibsoni , Babesia canis , other than It was confirmed that it was inconsistent with other microorganisms. In the case of the forward primer sequence of SEQ ID NO: 1, it was confirmed to match the sequence of a part of Mycobacterium other than Babesia. However, due to the nature of the polymerase chain reaction, if the forward primer sequence and the reverse primer sequence do not match at the same time in the microorganism, it is not detected, so it is considered that there will be no erroneous detection of Mycobacterium.

실험예Experimental example 2: 2: 바베시아Babesia 깁소니Gibbsoni , , 바베시아Babesia 캐니스canis 검출용 for detection 프라이머primer , , 프로브세트를a set of probes 이용한 검출 방법 detection method using

상기 표 2의 실시간 중합효소 연쇄반응에서 디자인된 프라이머와 프로브의 사용농도는 표 6과 같다.Table 6 shows the concentrations of primers and probes designed in the real-time polymerase chain reaction of Table 2 above.

타겟target 이름name 프라이머/ 프로브
사용농도 (nM)Primer/Probe
Concentration (nM) 초고속 Real-time PCR 10ul 반응 시Ultra-fast Real-time PCR 10ul reaction Real-time PCR
20ul 반응 시Real-time PCR
20ul reaction 바베시아 깁소니(Babesia gibsoni),
바베시아 캐니스(Babesia canis) Babesia gibsoni ,
Babesia canis Babesia F1
(서열번호 1)Babesia F1
(SEQ ID NO: 1) 15001500 750750 Babesia R1
(서열번호 2)Babesia R1
(SEQ ID NO: 2) 15001500 750750 Babesia FAM BHQ1
(서열번호 3)Babesia FAM BHQ1
(SEQ ID NO: 3) 200200 100100

바베시아 깁소니(Babesia gibsoni), 바베시아 캐니스(Babesia canis) 검출용 프라이머와 프로브를 이용한 실시간 중합효소 연쇄반응의 반응 조건은 표 7과 같다.Table 7 shows the reaction conditions of a real-time polymerase chain reaction using a primer and a probe for detecting Babesia gibsoni and Babesia canis .

본 발명 과정에 사용한 실시간 중합효소 연쇄반응 기기는 (주)진시스템의 UF-150 (초고속 실시간중합효소 연쇄반응)과 BIO-RAD사의 CFX connect이다. 그러나 본 발명의 프라이머와 프로브 세트는 위 2개 장비에 국한되지 않고 이용할 수 있다.The real-time polymerase chain reaction equipment used in the process of the present invention is a UF-150 (ultra-fast real-time polymerase chain reaction) of Jin Systems Co., Ltd. and a CFX connect of BIO-RAD. However, the primer and probe set of the present invention can be used without being limited to the above two devices.

고속 실시간 PCR 장비 (UF-150)High-speed real-time PCR equipment (UF-150) 실시간 PCR 장비Real-time PCR equipment 단계step 온도 (℃)Temperature (℃) 시간 (초)time (seconds) 반복repeat 단계step 온도 (℃)Temperature (℃) 시간 (초)time (seconds) 반복repeat Pre-denaturationPre-denaturation 5050 300300 1One Pre-denaturationPre-denaturation 9595 600600 1One DenaturationDenaturation 9595 55 4545 DenaturationDenaturation 9595 1515 4545 Annealing Annealing 6060 1515 Annealing/
extensionAnnealing/
extension 6060 6060 ExtensionExtension 7272 55

실험예 3: 바베시아 깁소니, 바베시아 캐니스 검출용 프라이머, 프로브에 대한 특이도 실험Experimental Example 3: Babesia gibsoni, primers for detecting Babesia canis, specificity tests for probes

본 발명의 프라이머, 프로브 세트를 이용한 실시간 중합효소 연쇄반응의 특이도를 바베시아 깁소니 DNA 시료, 12종의 진드기 매개 감염성 박테리아 시료에 대한 검출여부로 확인하였다.The specificity of the real-time polymerase chain reaction using the primer and probe set of the present invention was confirmed by detection of Babesia gibsoni DNA samples and 12 tick-borne infectious bacterial samples.

특이도 실험에 이용한 교차반응 리스트는 표 8과 같다.Table 8 shows a list of cross-reactions used in the specificity experiment.

No.No. TargetTarget SampleSample Ref.Ref. 1One Babesia Babesia 임상검체
clinical specimen
 -- 22 기타Other Bartonella jaculi Bartonella jaculi KCTC 23655KCTC 23655 33 Bartonella pachyuromydis Bartonella pachyuromydis KCTC 23657KCTC 23657 44 Bartonella acomydis Bartonella acomydis KCTC 23908KCTC 23908 55 Bartonella callosciuri Bartonella callosciuri KCTC 23909KCTC 23909 66 Bartonella pachyuromys Bartonella pachyuromys KCTC 23911KCTC 23911 77 Leptospira interrogans(canicola)Leptospira interrogans (canicola) ATCC 23470ATCC 23470 88 AnaplasmaAnaplasma ovisovis ATCC VR-1437 ATCC VR-1437 99 FrancisellaFrancisella philomiragiaphilomiragia ATCC 25017D-5ATCC 25017D-5 1010 BartonellaBartonella quintanaquintana Vircell MBC006Vircell MBC006 1111 BorreliaBorrelia gariniigarinii Vircell MBC077Vircell MBC077 1212 BorreliaBorrelia afzeliiafzelii Vircell MBC078Vircell MBC078

바베시아 깁소니 시료의 경우 표준균주를 분양받을 수 없어 병원 진단 양성으로 판정된 바베시아 시료를 기준으로 시험하였다. 그 결과는 도 1에 나타내었다.In the case of Babesia Gibsoni samples, standard strains could not be distributed, so the test was performed based on the Babesia samples that were determined to be positive for hospital diagnosis. The results are shown in FIG. 1 .

도 1을 참조하면, 본 발명에서 디자인된 프라이머, 프라이머 세트는 바베시아 이외의 타 미생물에 대해 반응하지 않는 것으로 확인되었다.Referring to FIG. 1 , it was confirmed that the primers and primer sets designed in the present invention did not react against microorganisms other than Babesia.

실험예 4: 바베시아 깁소니, 바베시아 캐니스 검출용 프라이머, 프로브에 대한 민감도 실험Experimental Example 4: Sensitivity test for Babesia gibsoni, Babesia canis detection primer, and probe

4-1. 최소검출한계 (Limit of detection, 4-1. Limit of detection, LODLOD ))

실시간 중합효소연쇄반응 기술을 이용한 바베시아 깁소니, 바베시아 캐니스 프라이머, 프로브 세트의 민감도를 확인하였다. 0.91 x 105 copy/㎕로 정량한 plasmid DNA를 10배식 단계 희석하여 3반복으로 테스트 진행하였다. 실험결과 0.91 x 101 copy/㎕까지 100% 검출 가능한 것을 확인하였다.The sensitivity of Babesia gibsoni, Babesia canis primers and probe sets using real-time polymerase chain reaction technology was confirmed. The plasmid DNA quantified at 0.91 x 10 5 copy/μl was diluted 10-fold and the test was performed in 3 repetitions. As a result of the experiment, it was confirmed that 100% detection was possible up to 0.91 x 10 1 copy/μl.

4-2. 판정기준치 (Cut-off)4-2. Judgment Criteria (Cut-off)

판정기준치를 확인하기 위해서 최소검출한계 시험에서 100% 검출된 0.91 x 101 copy/㎕ 농도와 66.7%로 검출된 0.91 x 100 copy/㎕를 5구간으로 세분화하여 각 20반복으로 테스트를 진행하였다.In order to confirm the criterion value, in the minimum detection limit test, the concentration of 0.91 x 10 1 copy/μl detected at 100% and 0.91 x 10 0 copy/μl detected at 66.7% were subdivided into 5 sections, and the test was performed with 20 repetitions each. .

도 3에 나타낸 결과에서 보듯이, 95% 이상 검출되는 판정기준치는 0.47 x 101 copies/㎕ (95% CI: 0.36 x 101 copies/㎕ - 0.74 x 101 copies/㎕) 로 확인되었다. As can be seen from the results shown in Figure 3, it was confirmed that the criterion for detection of 95% or more was 0.47 x 10 1 copies/μl (95% CI: 0.36 x 10 1 copies/μl - 0.74 x 10 1 copies/μl).

4-3. 정밀도- 반복성 실험4-3. Precision-Repeatability Experiments

반복성을 평가하기 위해, 민감도 시험에서 100% 검출된 0.91 x 101 copy/㎕를 저농도로 선정하고, 각각 10배 농도인 0.91 x 102 copy/㎕를 중간 농도, 0.91 x 103 copy/㎕를 고농도로 선정하였다. 해당하는 세 가지 농도에 대해서 검사 내, 검사 간, 날짜 간, 검사실 내, 로트 간 반복성 실험을 진행하였고, 결과의 평균(mean), 표준편차(standard deviation, SD), 변동계수(coefficient of variation, CV)는 아래 표 9에 나타내었다. To evaluate the repeatability, 0.91 x 10 1 copy/μl, which was 100% detected in the sensitivity test, was selected as a low concentration, and 0.91 x 10 2 copy/μl, which is a 10-fold concentration, respectively, was selected as a medium concentration and 0.91 x 10 3 copy/μl was used. High concentration was selected. Repeatability tests were conducted for the three concentrations within the test, between tests, between days, in the lab, and between lots, and the mean, standard deviation (SD), coefficient of variation, and CV) is shown in Table 9 below.

검사 내 반복성 (각 농도당 10일간 반복)Repeatability within the test (repeat for 10 days for each concentration) TargetTarget Concentration (copies/㎕)Concentration (copies/μl) HighHigh MiddleMiddle LowLow BabesiaBabesia 0.91 x 103 0.91 x 10 3 0.91 x 102 0.91 x 10 2 0.91 x 101 0.91 x 10 1 Ct Mean± SDCt Mean± SD 30.31±0.3930.31±0.39 33.47±0.5533.47±0.55 36.84±0.9536.84±0.95 CV (%)CV (%) 1.291.29 1.631.63 2.572.57 검사 간 반복성 (각 농도당 10일간 반복)Repeatability between tests (10 days for each concentration) BabesiaBabesia 0.91 x 103 0.91 x 10 3 0.91 x 102 0.91 x 10 2 0.91 x 101 0.91 x 10 1 Ct Mean± SDCt Mean± SD 30.22±0.3630.22±0.36 33.49±0.5033.49±0.50 37.06±0.8137.06±0.81 CV (%)CV (%) 1.181.18 1.501.50 2.202.20 날짜 간 반복성 (각 농도당 10일간 반복)Repeatability between days (repeat for 10 days for each concentration) BabesiaBabesia 0.91 x 103 0.91 x 10 3 0.91 x 102 0.91 x 10 2 0.91 x 101 0.91 x 10 1 Ct Mean± SDCt Mean± SD 30.51±0.4230.51±0.42 33.69±0.4733.69±0.47 37.04±0.8237.04±0.82 CV (%)CV (%) 1.391.39 1.411.41 2.222.22 검사실 내 반복성 (각 농도당 10일간 반복)Intra-Laboratory Repeatability (Repeat 10 days for each concentration) BabesiaBabesia 0.91 x 103 0.91 x 10 3 0.91 x 102 0.91 x 10 2 0.91 x 101 0.91 x 10 1 Ct Mean± SDCt Mean± SD 30.28±0.3930.28±0.39 33.61±0.5033.61±0.50 36.84±0.6636.84±0.66 CV (%)CV (%) 1.291.29 1.501.50 1.781.78 로트lot 간 반복성 (각 농도당 10일간 반복) Hepatic repeatability (repeat for 10 days for each concentration) BabesiaBabesia 0.91 x 103 0.91 x 10 3 0.91 x 102 0.91 x 10 2 0.91 x 101 0.91 x 10 1 Ct Mean± SDCt Mean± SD 30.16±0.4530.16±0.45 33.61±0.5233.61±0.52 36.81±0.7336.81±0.73 CV (%)CV (%) 1.501.50 1.541.54 1.991.99

4-4. 재현성 실험4-4. reproducibility experiment

정밀도를 평가하기 위해, 민감도 시험에서 100% 검출된 0.91 x 101 copy/㎕를 저농도로 선정하고, 각각 10배 농도인 0.91 x 102 copy/㎕를 중간 농도, 0.91 x 103 copy/㎕를 고농도로 선정하였다. 해당하는 세 가지 농도에 대해서 검사 장소(기관)간, 장비 간, 검사자 간, 로트 간 재현성 실험을 진행하였고, 결과의 평균(mean), 표준편차(standard deviation, SD), 변동계수(coefficient of variation, CV)는 아래 표 10에 나타내었다. In order to evaluate the precision, 0.91 x 10 1 copy/μl, which was 100% detected in the sensitivity test, was selected as a low concentration, and 0.91 x 10 2 copy/μl, which is a 10-fold concentration, respectively, was selected as a medium concentration and 0.91 x 10 3 copy/μl was used. High concentration was selected. Reproducibility tests were conducted between test sites (institutions), between equipment, between inspectors, and between lots for the three concentrations, and the mean, standard deviation (SD), and coefficient of variation of the results were conducted. , CV) are shown in Table 10 below.

장소 간 재현성 (각 농도당 Reproducibility between sites (for each concentration 5일간반복Repeat for 5 days )) TargetTarget Concentration (copies/㎕)Concentration (copies/μl) HighHigh MiddleMiddle LowLow BabesiaBabesia 0.91 x 103 0.91 x 10 3 0.91 x 102 0.91 x 10 2 0.91 x 101 0.91 x 10 1 Ct Mean± SDCt Mean± SD 30.14±0.3430.14±0.34 33.24±0.4033.24±0.40 36.74±0.8036.74±0.80 CV (%)CV (%) 1.131.13 1.221.22 2.172.17 장비 간 재현성 (각 농도당 5일간 반복)Instrument-to-instrument reproducibility (repeat 5 days for each concentration) BabesiaBabesia 0.91 x 103 0.91 x 10 3 0.91 x 102 0.91 x 10 2 0.91 x 101 0.91 x 10 1 Ct Mean± SDCt Mean± SD 30.59±0.7330.59±0.73 33.88±0.9533.88±0.95 37.18±1.2637.18±1.26 CV (%)CV (%) 2.42.4 2.812.81 3.383.38 검사자 간 재현성 (각 농도당 5일간 반복)Inter-examiner reproducibility (repeat 5 days for each concentration) BabesiaBabesia 0.91 x 103 0.91 x 10 3 0.91 x 102 0.91 x 10 2 0.91 x 101 0.91 x 10 1 Ct Mean± SDCt Mean± SD 30.24±0.3230.24±0.32 33.63±0.4833.63±0.48 36.86±0.7236.86±0.72 CV (%)CV (%) 1.071.07 1.421.42 1.961.96 로트lot 간 재현성 (각 농도당 5일간 반복) Liver reproducibility (repeat 5 days for each concentration) BabesiaBabesia 0.91 x 103 0.91 x 10 3 0.91 x 102 0.91 x 10 2 0.91 x 101 0.91 x 10 1 Ct Mean± SDCt Mean± SD 30.13±0.3130.13±0.31 33.33±0.4633.33±0.46 36.65±0.7136.65±0.71 CV (%)CV (%) 1.021.02 1.391.39 1.951.95

실험예Experimental example 4: 4: 바베시아Babesia 깁소니Gibbsoni , , 바베시아Babesia 캐니스canis 검출용 for detection 프라이머primer , , 프로브에on the probe 대한 임상 실험 clinical trials for

병원현장에서 양성 49개, 음성 49개로 진단된 98개의 표 11의 임상시료를 이용하여 실험예 2와 동일하게 수행하여 임상 평가를 진행하였으며, 그에 따른 결과 총 일치율은 98.98% (95% CI: 94.45% - 99.97%)로 확인하였다.Clinical evaluation was conducted in the same manner as in Experimental Example 2 using 98 clinical samples in Table 11 diagnosed as 49 positive and 49 negative at the hospital site, and as a result, the total agreement rate was 98.98% (95% CI: 94.45). % - 99.97%).

No.No. BreedBreed Age (Y, M)Age (Y, M) Gender (F/M)Gender (F/M) Weight (Kg)Weight (Kg) Animal hospital results Animal hospital results 1One PomeranianPomeranian 14y14y FF 3.563.56 -- 22 Shih-tzuShih-tzu 10y10y FF 4.974.97 -- 33 Shih-tzuShih-tzu 10y10y FF 6.16.1 -- 44 BichonfriseBichonfrise 3y3y FF 2.962.96 -- 55 PomeranianPomeranian 11y11y FF 2.422.42 -- 66 MalteseMaltese 8m8m FF 2.082.08 -- 77 MalteseMaltese 12y12y FF 3.23.2 -- 88 C. SpanielC. Spaniel 7y7y FF 11.911.9 -- 99 Golden RetrieverGolden Retriever 4y4m4y4m MM 3434 ++ 1010 Yorkshire TerrierYorkshire Terrier 7y7y MM 4.554.55 ++ 1111 Cocker SpanielCocker Spaniel 7y7y FF 9.469.46 ++ 1212 Shetland SheepdogShetland Sheepdog 2y2y MM 12.512.5 ++ 1313 Welsh corgiWelsh corgi 4y4y MM 12.912.9 ++ 1414 PomeranianPomeranian 13y13y MM 2.62.6 ++ 1515 MixedMixed 3y5m3y5m MM 6.386.38 ++ 1616 MixedMixed 1y1y MM 11.211.2 ++ 1717 Golden RetrieverGolden Retriever 5y5y FF 3333 ++ 1818 MalteseMaltese 7y7y FF 3.43.4 ++ 1919 Golden RetrieverGolden Retriever 1y1y MM 3535 ++ 2020 MalteseMaltese 14y14y FF 22 ++ 2121 PoodlePoodle 3y3y MM 44 ++ 2222 PoodlePoodle 6y6y MM 10.910.9 ++ 2323 MixedMixed 7y7y MM 55 ++ 2424 Shih-tzuShih-tzu 4y4y FF 4.14.1 ++ 2525 PoodlePoodle 12y12y FF 3.83.8 ++ 2626 Bedlington TerrierBedlington Terrier 1y1y FF 9.359.35 ++ 2727 Spitz Spitz 2y2y FF 7.47.4 ++ 2828 PomeranianPomeranian 2y2y FF 2.92.9 ++ 2929 Bichon FriseBichon Prize 5y5y MM 8.28.2 ++ 3030 PoodlePoodle 1y1y FF 3.43.4 ++ 3131 MalteseMaltese 10y10y MM 6.36.3 ++ 3232 Welsh corgiWelsh corgi 3y3y FF 8.48.4 ++ 3333 MalteseMaltese 7y7y FF 3.143.14 -- 3434 Shih-tzuShih-tzu 14y14y FF 3.53.5 -- 3535 M. schnauzerM. schnauzer 16y16y FF 5.35.3 -- 3636 M. schnauzerM. schnauzer 17y17y MM 6.26.2 -- 3737 MalteseMaltese 10y10y FF 4.884.88 -- 3838 PoodlePoodle 5y5y MM 2.882.88 -- 3939 MalteseMaltese 12y12y MM 2.72.7 -- 4040 MixedMixed 3y3y MM 9.79.7 -- 4141 Y.T.Y.T. 9y9y MM 2.382.38 -- 4242 PomeranianPomeranian 1y1y MM 2.12.1 -- 4343 MixedMixed 7y7y FF 9.469.46 -- 4444 MixedMixed 13y13y FF 5.985.98 -- 4545 MalteseMaltese 7y7y MM 3.63.6 -- 4646 PoodlePoodle 5y5y FF 5.645.64 -- 4747 Labrador RetrieverLabrador Retriever 4y4y FF 3232 -- 4848 BichonfriseBichonfrise 15y15y MM 13.613.6 -- 4949 MalteseMaltese 5y5y FF 6.166.16 -- 5050 MalteseMaltese 9y9y MM 2.612.61 -- 5151 PoodlePoodle 10y10y MM 5.45.4 -- 5252 PomeranianPomeranian 7y7y MM 5.425.42 -- 5353 MixedMixed 3y3y FF 5.75.7 -- 5454 Shih-tzuShih-tzu 3y3y FF 4.54.5 ++ 5555 DachshundDachshund 8y8y MM 9.159.15 ++ 5656 PoodlePoodle 6y6y MM 3.83.8 ++ 5757 Kerry Blue TerrierKerry Blue Terrier 5y5y FF 12.112.1 ++ 5858 PomeranianPomeranian 5y5y FF 5.15.1 ++ 5959 MalteseMaltese 1y1y FF 3.763.76 ++ 6060 Border CollieBorder Collie 4y4y FF 13.513.5 ++ 6161 MixedMixed 7y7y MM 10.9810.98 ++ 6262 Cocker SpanielCocker Spaniel 1y1y FF 8.68.6 ++ 6363 GoldendoodleGoldendoodle 4y4y MM 27.527.5 ++ 6464 Shih-tzuShih-tzu 8y8y FF 2.52.5 ++ 6565 SchnauzerSchnauzer 10y10y FF 3.83.8 ++ 6666 PomeranianPomeranian 9y9y MM 3.73.7 ++ 6767 Shih-tzuShih-tzu 4y4y MM 6.456.45 -- 6868 C. SpanielC. Spaniel 8y8y MM 18.518.5 -- 6969 MalteseMaltese 11y11y MM 6.966.96 -- 7070 MalteseMaltese 4y4y FF 3.73.7 -- 7171 MalteseMaltese 5y5y FF 3.633.63 -- 7272 MalteseMaltese 11y11y MM 3.23.2 -- 7373 MalteseMaltese 7y7y MM 4.34.3 -- 7474 M. schnauzerM. schnauzer 9y9y FF 5.885.88 -- 7575 Y.T.Y.T. 17y17y FF 1.681.68 -- 7676 white terrierwhite terrier 6y6y FF 6.66.6 -- 7777 MalteseMaltese 8y8y FF 2.242.24 -- 7878 PomeranianPomeranian 8y8y MM 5.585.58 -- 7979 PoodlePoodle 7y7y MM 4.164.16 -- 8080 Shih-tzuShih-tzu 8y8y MM 3.83.8 -- 8181 MalteseMaltese 4y4y MM 5.85.8 -- 8282 MalteseMaltese 8y8y MM 2.572.57 -- 8383 PoodlePoodle 9y9y MM 3.73.7 -- 8484 Shih-tzuShih-tzu 11y11y FF 77 -- 8585 PoodlePoodle 18y18y MM 4.84.8 -- 8686 PomeranianPomeranian 1y1y MM 3.453.45 ++ 8787 Shih-tzuShih-tzu 12y12y FF 4.74.7 ++ 8888 Border CollieBorder Collie 2y2y MM 1515 ++ 8989 MalteseMaltese 3y3y MM 3.83.8 ++ 9090 MalteseMaltese 6y6y MM 4.64.6 ++ 9191 PomeranianPomeranian 3y3y MM 5.15.1 ++ 9292 PoodlePoodle 4y4y MM 88 ++ 9393 MalteseMaltese 3y3y FF 3.83.8 ++ 9494 Jindo Jindo 1Y1Y FF 17.517.5 ++ 9595 PoodlePoodle 1Y11M1Y11M FF 6.426.42 ++ 9696 PomeranianPomeranian 8Y8Y FF 3.163.16 ++ 9797 MalteseMaltese 11M11M MM 3.23.2 ++ 9898 MalteseMaltese 11y11y MM 3.663.66 --

상관성 평가Correlation evaluation 병원 진단 결과hospital diagnosis 합계Sum 양성positivity 음성voice 검출세트detection set 양성positivity 4848 00 4848 음성voice 1One 4949 5050 합계Sum 4949 4949 9898 양성 일치율 = 97.96% (95% CI: 89.15% - 99.95%)Positive concordance rate = 97.96% (95% CI: 89.15% - 99.95%) 음성 일치율 = 100.00% (95% CI: 92.75% - 100.00%)Negative concordance rate = 100.00% (95% CI: 92.75% - 100.00%) 총 일치율 = 98.98% (95% CI: 94.45% - 99.97%)Total concordance = 98.98% (95% CI: 94.45% - 99.97%)

<110> CAREVET Co., Ltd. <120> DETECTION SET FOR CANINE BABESIA USING REAL-TIME PCR AND DETECTION METHOD THEREOF <130> DP200047 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Babesia specific forward primer Babesia F1 <400> 1 caacacyacc atcagccgtg c 21 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Babesia specific reverse primer Babesia R1 <400> 2 tcgtggatct tcctcttgtc mag 23 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Babesia specific probe Babesia FAM BHQ1 <400> 3 cgtttcgagg agatgtgtgg tgagaagttc 30 <110> CAREVET Co., Ltd. <120> DETECTION SET FOR CANINE BABESIA USING REAL-TIME PCR AND DETECTION METHOD THEREOF <130> DP200047 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Babesia specific forward primer Babesia F1 <400> 1 caacacyacc atcagccgtg c 21 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Babesia specific reverse primer Babesia R1 <400> 2 tcgtggatct tcctcttgtc mag 23 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Babesia specific probe Babesia FAM BHQ1 <400> 3 cgtttcgagg agatgtgtgg tgagaagttc 30

Claims (5)

서열번호 1의 정방향 프라이머 및 서열번호 2의 역방향 프라이머로 이루어진 바베시아 검출용 프라이머쌍과,
서열번호 3의 염기서열로 이루어진 베바시아 검출용 프로브
를 포함하는, 바베시아 검출세트.A pair of primers for detecting Babesia consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2;
Bevacia detection probe consisting of the nucleotide sequence of SEQ ID NO: 3
Containing, Babesia detection set. 제1항에 있어서, 상기 프로브의 5'말단과 3'말단은 형광물질로 표지된 것을 특징으로 하는 바베시아 검출세트.The Babesia detection set according to claim 1, wherein the 5' and 3' ends of the probe are labeled with a fluorescent material. 분리된 시료로부터 추출한 DNA를 제1항의 검출세트를 이용하여 실시간
중합효소연쇄반응으로 증폭하는 단계; 및
상기 증폭 산물을 분석하는 단계
를 포함하는, 바베시아 검출방법.DNA extracted from the separated sample in real time using the detection set of claim 1
amplifying by polymerase chain reaction; and
analyzing the amplification product
Including, Babesia detection method. 제1항의 검출세트, 반응완충액 및 데옥시뉴클레오티드(dNTP)를 포함하는 바베시아 검출키트.A Babesia detection kit comprising the detection set of claim 1, a reaction buffer, and deoxynucleotides (dNTPs). 제4항에 있어서, 상기 검출키트는 하나의 반응 용기, 스트립(strip) 또는 마이크로플레이트에 패키징 되는 것을 특징으로 하는 바베시아 검출키트.[Claim 5] The Babesia detection kit according to claim 4, wherein the detection kit is packaged in one reaction vessel, a strip, or a microplate.
KR1020210038461A 2020-09-24 2021-03-25 Detection set for canine babesia using real-time pcr and detection method thereof KR102482020B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200124131 2020-09-24
KR1020200124131 2020-09-24

Publications (2)

Publication Number Publication Date
KR20220040975A true KR20220040975A (en) 2022-03-31
KR102482020B1 KR102482020B1 (en) 2022-12-27

Family

ID=80935033

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020210038461A KR102482020B1 (en) 2020-09-24 2021-03-25 Detection set for canine babesia using real-time pcr and detection method thereof

Country Status (1)

Country Link
KR (1) KR102482020B1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103103286A (en) * 2013-03-05 2013-05-15 扬州大学 Primer, probe and kit for fluorescence quantitative PCR (Polymerase Chain Reaction) detecting and typing of babesia
KR101419717B1 (en) 2012-06-29 2014-07-23 (주)바이오니아 PCR diagnostic kits including primers for the simultaneous detection for Piroplasms and genus-specific detection for Babesia or Theileria
CN107779519A (en) * 2016-08-25 2018-03-09 台达电子国际（新加坡）私人有限公司 Detect primer pair, kit and the method for Babesia canis
US20190055611A1 (en) * 2017-08-15 2019-02-21 Delta Electronics Int'l (Singapore) Pte Ltd Primer pair, kit and method for detecting babesia gibsoni
JP2020524495A (en) * 2017-06-07 2020-08-20 ジーイーエヌ−プローブ・インコーポレーテッド Detection of Babesia sp. nucleic acids in samples

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101419717B1 (en) 2012-06-29 2014-07-23 (주)바이오니아 PCR diagnostic kits including primers for the simultaneous detection for Piroplasms and genus-specific detection for Babesia or Theileria
CN103103286A (en) * 2013-03-05 2013-05-15 扬州大学 Primer, probe and kit for fluorescence quantitative PCR (Polymerase Chain Reaction) detecting and typing of babesia
CN107779519A (en) * 2016-08-25 2018-03-09 台达电子国际（新加坡）私人有限公司 Detect primer pair, kit and the method for Babesia canis
JP2020524495A (en) * 2017-06-07 2020-08-20 ジーイーエヌ−プローブ・インコーポレーテッド Detection of Babesia sp. nucleic acids in samples
US20190055611A1 (en) * 2017-08-15 2019-02-21 Delta Electronics Int'l (Singapore) Pte Ltd Primer pair, kit and method for detecting babesia gibsoni

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Ofer Peleg 등, Veterinary Parasitology, 173, p.292-299, 2010.* *

Also Published As

Publication number Publication date
KR102482020B1 (en) 2022-12-27

Similar Documents

Publication Publication Date Title
CN111235232B (en) Visual rapid nucleic acid detection method based on CRISPR-Cas12a system and application
van der Meide et al. Comparison between quantitative nucleic acid sequence-based amplification, real-time reverse transcriptase PCR, and real-time PCR for quantification of Leishmania parasites
Helps et al. Detection of Chlamydophila felis and feline herpesvirus by multiplex real-time PCR analysis
Bott et al. A combined microscopic-molecular method for the diagnosis of strongylid infections in sheep
Loeffler et al. Quantification of fungal DNA by using fluorescence resonance energy transfer and the light cycler system
Hussy et al. Quantitative fluorogenic PCR assay for measuring ovine herpesvirus 2 replication in sheep
Taniuchi et al. High throughput multiplex PCR and probe-based detection with Luminex beads for seven intestinal parasites
Salant et al. The development of a loop-mediated isothermal amplification method (LAMP) for Echinococcus granulosis coprodetection
EP1229128A1 (en) New method for genotype determination
Bass et al. Development of a multiplex real-time PCR assay for identification of members of the Anopheles gambiae species complex
AU2020100696A4 (en) LAMP-TaqMan ASSAY KIT FOR PIGEON NEWCASTLE DISEASE VIRUS
CN113637798A (en) Primer and probe for detecting delta 69/70HV deletion mutation site of S gene of new coronavirus Alpha strain and application of primer and probe
Yu et al. A simple and rapid diagnostic method to detect new goose astrovirus using reverse-transcription loop-mediated isothermal amplification
Abendaño et al. Quantification of Mycobacterium avium subsp. paratuberculosis strains representing distinct genotypes and isolated from domestic and wildlife animal species by use of an automatic liquid culture system
KR102128651B1 (en) Detection set for dengue virus serotypes using multiplex real-time pcr and detection method thereof
Chen et al. Development of a duplex real‐time PCR assay for simultaneous detection and differentiation of Theileria equi and Babesia caballi
KR102482020B1 (en) Detection set for canine babesia using real-time pcr and detection method thereof
Koekemoer Serotype-specific detection of African horsesickness virus by real-time PCR and the influence of genetic variations
CN113528686B (en) Reagent and kit for detecting nucleic acid of brucella
Wang et al. Development of a cleaved probe-based loop-mediated isothermal amplification assay for rapid detection of African swine fever virus
KR20160065233A (en) Primer set for genotyping of horse
Cano et al. Non‐lethal loop‐mediated isothermal amplification assay as a point‐of‐care diagnostics tool for Neoparamoeba perurans, the causative agent of amoebic gill disease
KR102278402B1 (en) Primers and probes for Measles virus and Measles virus vaccine strain and detection method using them
Morero et al. Taguchi method for the optimization of three loop mediated isothermal amplification procedures for Tritrichomonas foetus detection
KR20210097242A (en) Primer set for high sensitive multiplex loop-mediated isothermal amplification reaction for detection and identification of Mycobacterium tuberculosis and Nontuberculous mycobacteria

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant