KR20220024022A - Improved method for preparing mRNA-loaded lipid nanoparticles - Google Patents

Abstract

The present invention provides improved methods for formulating lipid nanoparticles and encapsulating mRNA. In some embodiments, the present invention provides an improved method for encapsulating messenger RNA (mRNA) in lipid nanoparticles, the method comprising heating the mRNA-encapsulated lipid nanoparticles in a drug product formulation solution.

Description

Improved method for preparing mRNA-loaded lipid nanoparticles

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Patent Application No. 62/847,837, filed on May 14, 2019, which is incorporated herein by reference in its entirety for all purposes.

Messenger RNA therapy (MRT) is becoming an increasingly important approach in the treatment of a variety of diseases. MRT involves administering messenger RNA (mRNA) to a patient in need of therapy to produce a protein encoded by mRNA within the patient's body. Lipid nanoparticles are commonly used to encapsulate mRNA for efficient in vivo delivery of mRNA.

To improve lipid nanoparticle delivery, for example, novel novel methods capable of affecting intracellular delivery and/or expression of mRNA in various types of mammalian tissues, organs and/or cells (eg, mammalian liver cells). Much effort has been devoted to identifying one lipid or specific lipid composition. However, these existing approaches are expensive, time consuming and unpredictable.

The present invention provides, among other things, a further improved method for preparing mRNA-loaded lipid nanoparticles (mRNA-LNPs). The present invention comprises the steps of mixing one or more lipids in a lipid solution with one or more mRNAs in an mRNA solution to form mRNA encapsulated in LNP (mRNA-LNP) in an LNP forming solution (e.g., Method A as described below) After the method of encapsulating messenger RNA (mRNA) comprising and heating the mRNA-LNP in the drug formulation solution unexpectedly significantly increases the encapsulation efficiency of mRNA-LNP, ie the amount or percentage of mRNA encapsulated in the LNP (ie, encapsulation rate or encapsulation efficiency). It is based on the surprising discovery that it provides benefits. The present invention is particularly useful for preparing mRNA-LNPs with a higher encapsulation rate or encapsulation efficiency compared to conventional approaches.

Compared to the prior approaches, the method of the present invention described herein provides higher encapsulation efficiency, and thus higher efficacy and better efficacy of mRNA delivery by lipid nanoparticles, thereby improving the therapeutic index in a positive direction. and can provide additional benefits such as cost savings, good patient compliance, and a more patient friendly dosing regimen. The mRNA-loaded lipid nanoparticle formulations provided by the present invention can be formulated in different ways, such as intravenous, intramuscular, intra-articular, intrathecal, inhalation (respiratory), subcutaneous, intravitreal, and ophthalmic administration for more potent and efficient protein expression. It can be successfully delivered in vivo via the route of administration.

This method of the present invention is scalable as it can be performed using a pump system, thereby allowing improved particle formation/formulation in quantities sufficient for the conduct of clinical trials and/or commercial sale. A variety of pump systems can be used in the practice of the present invention, including, but not limited to, pulseless flow pumps, gear pumps, peristaltic pumps, and centrifugal pumps.

This method of the present invention improves encapsulation efficiency and produces a homogeneous particle size.

Accordingly, in one aspect, the present invention provides a method of encapsulating messenger RNA (mRNA) within a lipid nanoparticle (LNP), said method comprising (a) mixing one or more lipids in a lipid solution with one or more mRNAs in an mRNA solution to form mRNA (mRNA-LNP) encapsulated in LNP in the LNP forming solution; (b) exchanging the LNP-forming solution for the drug product formulation solution to provide mRNA-LNP in the drug product formulation solution; and (c) heating the mRNA-LNP in the drug product formulation solution, wherein the encapsulation efficiency of the mRNA-LNP produced from step (c) is greater than the encapsulation efficiency of the mRNA-LNP produced from step (b). big

In some embodiments, in step (c), the drug product formulation solution is heated by applying heat to the solution from a heat source.

In some embodiments, in step (c), the drug product formulation solution is heated by applying heat to the solution from a heat source, and the solution is brought to a temperature above ambient temperature for at least 5 seconds, at least 10 seconds, at least 20 seconds. or more, 30 seconds or more, 40 seconds or more, 50 seconds or more, 1 minute or more, 2 minutes or more, 3 minutes or more, 4 minutes or more, 5 minutes or more, 10 minutes or more, 15 minutes or more, 20 minutes or more, 25 minutes or more, at least 30 minutes, at least 35 minutes, at least 40 minutes, at least 45 minutes, at least 50 minutes, at least 60 minutes, at least 70 minutes, at least 80 minutes, at least 90 minutes, at least 100 minutes, or at least 120 minutes. In some embodiments, in step (c), the drug product formulation solution is heated by applying heat to the solution from a heat source, and the solution is heated to a temperature above ambient temperature for 120 minutes or less, 100 minutes or less, 90 minutes or less, 60 minutes or less, 45 minutes or less, 30 minutes or less, 25 minutes or less, 20 minutes or less, 15 minutes or less, 10 minutes or less, 5 minutes or less, 4 minutes or less, 3 minutes or less, 2 minutes or less, 1 minute or less, 50 seconds or less or less, 40 seconds or less, 30 seconds or less, 20 seconds or less, 10 seconds or less, or 5 seconds or less. In some embodiments, in step (c), the drug product formulation solution is heated by applying heat to the solution from a heat source, and the solution is held at a temperature above ambient temperature for 10-20 minutes. In some embodiments, in step (c), the drug product formulation solution is heated by applying heat to the solution from a heat source, and the solution is held at a temperature above ambient temperature for 20 to 90 minutes. In some embodiments, in step (c), the drug product formulation solution is heated by applying heat to the solution from a heat source, and the solution is held at a temperature above ambient temperature for 30 to 60 minutes. In some embodiments, in step (c), the drug product formulation solution is heated by applying heat to the solution from a heat source, and the solution is held at a temperature above ambient temperature for about 15 minutes. In some embodiments, the temperature to which the drug product formulation solution is heated (or to which the drug product formulation solution is maintained) is about 30° C., 37° C., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C. , or 70°C or higher. In some embodiments, the temperature to which the drug product formulation solution is heated is about 25-70°C, about 30-70°C, about 35-70°C, about 40-70°C, about 45-70°C, about 50-70°C , or in the range of about 60 to 70 °C. In some embodiments, the above ambient temperature to which the drug product formulation solution is heated is about 65°C.

In some embodiments, in step (a), lipid nanoparticles are formed by mixing lipids dissolved in a lipid solution comprising ethanol with mRNA dissolved in an aqueous solution of sexual mRNA. In some embodiments, in step (a), the one or more lipids comprise one or more cationic lipids, one or more helper lipids, and one or more PEG-modified lipids (also referred to as PEG lipids). In some embodiments, the lipid also contains one or more cholesterol lipids. mRNA-LNP is formed by mixing a lipid solution and an mRNA solution. Thus, in some embodiments, the LNP comprises one or more cationic lipids, one or more helper lipids, and one or more PEG lipids. In some embodiments, the LNP also contains one or more cholesterol lipids.

In some embodiments, the one or more cationic lipids are cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis( 2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5- Dione (target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyunde) syl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (target 24), N1GL, N2GL, V1GL, and combinations thereof.

In some embodiments, the one or more cationic lipids comprise amino lipids. Amino lipids suitable for use in the present invention include those described in WO2017180917, which is incorporated herein by reference. Exemplary aminolipids in WO2017180917 include those described in paragraph [0744], such as DLin-MC3-DMA (MC3), (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-diene -1-amine (L608), and compound 18. Other amino lipids include compound 2, compound 23, compound 27, compound 10, and compound 20. Additionally, amino lipids suitable for use in the present invention include those described in WO2017112865, which is incorporated herein by reference. Exemplary amino lipids in WO2017112865 include formulas (I), (Ial)-(Ia6), (lb), (II), (IIa), (III), (Illa), (IV), (17-1) , the compound according to any one of (19-1), (19-11), and (20-1), and the compounds of paragraphs [00185], [00201], [0276]. In some embodiments, cationic lipids suitable for use in the present invention include those described in WO2016118725, which is incorporated herein by reference. Exemplary cationic lipids in WO2016118725 include such as KL22 and KL25. In some embodiments, cationic lipids suitable for use in the present invention include those described in WO2016118724, which is incorporated herein by reference. Exemplary cationic lipids in WO2016118725 include those such as KL10, 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), and KL25.

In some embodiments, the one or more non-cationic lipids are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3- Phosphocholine (DPPC), 1,2-dioleyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dioleyl-sn-glycero-3-phosphotidylcholine (DOPC) , 1,2-Dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1, 2-dioleyl-sn-glycero-3-phospho-(1′- rac -glycerol) (DOPG).

In some embodiments, the one or more PEG-modified lipids comprise poly(ethylene) glycol chains up to 5 kDa in length covalently linked to a lipid having a C ₆ -C ₂₀ alkyl chain in length.

In some embodiments, after step (a), the mRNA-LNP is purified by Tangential Flow Filtration. In some embodiments, about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% of purified mRNA-LNP , or greater than 99% are less than about 150 nm (eg, about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm , less than about 100 nm, about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm). have In some embodiments, substantially all of the purified mRNA-LNP is less than 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm , about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or less than about 50 nm). In some embodiments, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the purified mRNA-LNP has a size in the range of 50-150 nm. has In some embodiments, substantially all of the purified mRNA-LNP has a size in the range of 50-150 nm. In some embodiments, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the purified mRNA-LNP has a size in the range of 80-150 nm. has In some embodiments, substantially all of the purified nanoparticles have a size in the range of 80-150 nm.

In some embodiments, the method according to the invention improves the encapsulation efficiency after step (c) by at least 5% compared to the encapsulation efficiency after step (b). In some embodiments, the method according to the invention improves the encapsulation efficiency after step (c) by at least 10% or more compared to the encapsulation efficiency after step (b). In some embodiments, the method according to the invention improves the encapsulation efficiency after step (c) by at least 15% compared to the encapsulation efficiency after step (b). In some embodiments, the method according to the invention improves the encapsulation efficiency after step (c) by at least 20% compared to the encapsulation efficiency after step (b). In some embodiments, the method according to the present invention improves the encapsulation efficiency after step (c) by at least 25% or more compared to the encapsulation efficiency after step (b).

In some embodiments, the method according to the invention improves the amount of encapsulation after step (c) compared to encapsulation after step (b) by 5% encapsulation. In some embodiments, the method according to the invention improves the amount of encapsulation after step (c) compared to encapsulation after step (b) by 10% encapsulation. In some embodiments, the method according to the invention improves the amount of encapsulation after step (c) compared to encapsulation after step (b) by 15% encapsulation. In some embodiments, the method according to the invention improves the amount of encapsulation after step (c) compared to encapsulation after step (b) by 20% encapsulation. In some embodiments, the method according to the invention improves the amount of encapsulation after step (c) compared to encapsulation after step (b) by 25% encapsulation.

In some embodiments, according to the method according to the present invention, after step (c) about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 %, or greater than 99% of the mRNA is recovered.

In some embodiments, according to the method according to the present invention, the encapsulation rate after step (c) is greater than about 90%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, according to the method according to the present invention, after step (c) about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 %, or greater than 99% of the mRNA is recovered.

In some embodiments, the lipid solution and the mRNA solution are mixed using a pump system. In some embodiments, the pump system includes a pulse-less flow pump. In some embodiments, the pump system is a gear pump. In some embodiments, a suitable pump is a peristaltic pump. In some embodiments, a suitable pump is a centrifugal pump. In some embodiments, the method using the pump system is performed on a large scale. For example, in some embodiments, the method comprises administering a solution of at least about 1 mg, 5 mg, 10 mg, 50 mg, 100 mg, 500 mg, or 1000 mg of mRNA to one or more cations using a pump as described above. admixing with a lipid solution comprising sex lipids, one or more helper lipids, and one or more PEG-modified lipids. In some embodiments, the method of mixing the lipid solution with the mRNA solution contains at least about 1 mg, 5 mg, 10 mg, 50 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA after step (c). It provides a composition according to the present invention.

In some embodiments, the lipid solution is about 25-75 ml/min, about 75-200 ml/min, about 200-350 ml/min, about 350-500 ml/min, about 500-650 ml/min, about 650 850 ml/min, or at a flow rate in the range of about 850-1000 ml/min. In some embodiments, the lipid solution is about 50 ml/min, about 100 ml/min, about 150 ml/min, about 200 ml/min, about 250 ml/min, about 300 ml/min, about 350 ml/min, about 400 ml/min, about 450 ml/min, about 500 ml/min, about 550 ml/min, about 600 ml/min, about 650 ml/min, about 700 ml/min, about 750 ml/min, about 800 ml/min, about 850 ml/min, about 900 ml/min, about 950 ml/min, or about 1000 ml/min.

In some embodiments, the mRNA solution is about 25-75 ml/min, about 75-200 ml/min, about 200-350 ml/min, about 350-500 ml/min, about 500-650 ml/min, about 650 850 ml/min, or at a flow rate in the range of about 850-1000 ml/min. In some embodiments, the mRNA solution is about 50 ml/min, about 100 ml/min, about 150 ml/min, about 200 ml/min, about 250 ml/min, about 300 ml/min, about 350 ml/min, about 400 ml/min, about 450 ml/min, about 500 ml/min, about 550 ml/min, about 600 ml/min, about 650 ml/min, about 700 ml/min, about 750 ml/min, about 800 ml/min, about 850 ml/min, about 900 ml/min, about 950 ml/min, or about 1000 ml/min.

In some embodiments, the lipid solution comprises a non-aqueous solvent such as an organic solvent. In some embodiments, the lipid solution comprises an alcohol. In some embodiments, the lipid solution comprises ethanol. In some embodiments, a method according to the invention comprises first dissolving the lipid(s) in a lipid solution. In some embodiments, a method according to the invention comprises first dissolving the lipid(s) in a lipid solution comprising ethanol.

In some embodiments, the mRNA solution is an aqueous solution. In some embodiments, the mRNA solution comprises citrate. In some embodiments, the mRNA solution is a citrate buffer. In some embodiments, the method according to the invention comprises first dissolving the mRNA in an aqueous solution. In some embodiments, the method according to the present invention comprises first dissolving the mRNA in an aqueous solution comprising citrate.

In some embodiments, a method according to the invention comprises mixing a lipid solution comprising lipids in ethanol with an mRNA buffer comprising mRNA dissolved in a citrate buffer. In some embodiments, the LNP forming solution comprises ethanol and citrate.

In some embodiments, a method according to the present invention comprises first generating an mRNA solution by mixing a citrate buffer with a mother mRNA solution. In certain embodiments, a suitable citrate buffer contains about 10 mM citrate, about 150 mM NaCl, having a pH of about 4.5. In some embodiments, a suitable mRNA stock solution contains mRNA at a concentration of at least about 1 mg/ml, about 10 mg/ml, about 50 mg/ml, or about 100 mg/ml.

In some embodiments, the citrate buffer is about 100-300 ml/min, 300-600 ml/min, 600-1200 ml/min, 1200-2400 ml/min, 2400-3600 ml/min, 3600-4800 ml/min , or at a flow rate ranging from 4800 to 6000 ml/min. In some embodiments, the citrate buffer is about 220 ml/min, about 600 ml/min, about 1200 ml/min, about 2400 ml/min, about 3600 ml/min, about 4800 ml/min, or about 6000 ml/min mixed at a flow rate of

In some embodiments, the mRNA mother liquor is about 10-30 ml/min, about 30-60 ml/min, about 60-120 ml/min, about 120-240 ml/min, about 240-360 ml/min, about 360 Mix at a flow rate in the range of -480 ml/min, or about 480-600 ml/min. In some embodiments, the mRNA stock solution is about 20 ml/min, about 40 ml/min, about 60 ml/min, about 80 ml/min, about 100 ml/min, about 200 ml/min, about 300 ml/min, Mix at a flow rate of about 400 ml/min, about 500 ml/min, or about 600 ml/min.

In some embodiments, in step (b), the drug product formulation solution is an aqueous solution containing pharmaceutically acceptable excipients including, but not limited to, cryoprotectants. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution containing pharmaceutically acceptable excipients including, but not limited to, sugars. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution containing pharmaceutically acceptable excipients including, but not limited to, trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, in step (b), the drug product formulation solution comprises trehalose. In some embodiments, in step (b), the drug product formulation solution comprises sucrose. In some embodiments, in step (b), the drug product formulation solution comprises mannose. In some embodiments, in step (b), the drug product formulation solution comprises lactose. In some embodiments, in step (b), the drug product formulation solution comprises mannitol. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising 5 to 20% (w/v) of saccharides such as trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising 5 to 20% (w/v) trehalose. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising 5 to 20% (w/v) sucrose. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising 5 to 20% (w/v) mannose. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising 5 to 20% (w/v) lactose. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising 5 to 20% (w/v) mannitol. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising about 10% (w/v) saccharides such as trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising about 10% (w/v) trehalose. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising about 10% (w/v) sucrose. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising about 10% (w/v) mannose. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising about 10% (w/v) lactose. In some embodiments, in step (b), the drug product formulation solution is an aqueous solution comprising about 10% (w/v) mannitol.

In some embodiments, the drug product formulation solution is free of (ie, below detectable levels) one or both of a non-aqueous solvent such as ethanol and citrate. In some embodiments, the drug product formulation solution is free of citrate (ie, below detectable levels). In some embodiments, the drug product formulation solution is free of ethanol (ie, below detectable levels). In some embodiments, the drug product formulation solution comprises ethanol but no citrate (ie, below detectable levels). In some embodiments, the drug product formulation solution comprises citrate but no ethanol (ie, below detectable levels). In some embodiments, the drug product formulation solution comprises only residual citrate. In some embodiments, the drug product formulation solution comprises only residual non-aqueous solvents, such as ethanol. In some embodiments, the drug product formulation solution contains less than about 10 mM (e.g., less than about 9 mM, about 8 mM, about 7 mM, about 6 mM, about 5 mM, about 4 mM, about 3 mM, less than about 2 mM, or about 1 mW) citrate. In some embodiments, the drug product formulation solution contains less than about 25% (e.g., about 20%, about 15%, about 10%, about 5%, about 4%, about 3%, about 2%, or less than about 1%) of a non-aqueous solvent such as ethanol. In some embodiments, the drug product formulation solution does not require any additional downstream processing (eg, buffer exchange and/or additional purification steps) prior to lyophilization. In some embodiments, the drug product formulation solution does not require any additional downstream processing (eg, buffer exchange and/or additional purification steps) prior to administration to a subject.

In some embodiments, the drug product formulation solution has a pH of between pH 4.5 and pH 7.5. In some embodiments, the drug product formulation solution has a pH of between pH 5.0 and pH 7.0. In some embodiments, the drug product formulation solution has a pH of between pH 5.5 and pH 7.0. In some embodiments, the drug product formulation solution has a pH greater than pH 4.5. In some embodiments, the drug product formulation solution has a pH greater than pH 5.0. In some embodiments, the drug product formulation solution has a pH greater than pH 5.5. In some embodiments, the drug product formulation solution has a pH greater than pH 6.0. In some embodiments, the drug product formulation solution has a pH greater than pH 6.5.

In some embodiments, the present invention is used to encapsulate mRNA containing one or more modified nucleotides. In some embodiments, one or more nucleotides are modified with pseudouridine. In some embodiments, one or more nucleotides are modified with 5-methylcytidine. In some embodiments, the present invention is used to encapsulate unmodified mRNA.

In another aspect, the present invention provides a method of delivering mRNA to produce a protein in vivo, the method comprising administering to a subject a composition of lipid nanoparticles encapsulating the mRNA produced by the method described herein wherein the mRNA encodes one or more protein(s) or peptide(s) of interest.

As used herein, unless otherwise specified, "or" means "and/or". As used in this disclosure, the term “comprise” and various forms of the term, such as “comprising and comprising” and the like, are intended to exclude other additives, components, integers, or steps. not intended As used herein, the terms “about” and “approximately” are used equivalently. Both terms are intended to encompass any standard range understood by one of ordinary skill in the art.

Other features, objects and advantages of the present invention will become apparent from the following detailed description, drawings and claims for carrying out the invention. It should be understood, however, that while the detailed description, drawings, and claims for carrying out the invention represent embodiments of the invention, they are given for purposes of illustration only and not limitation. It will be apparent to those skilled in the art that various changes and modifications can be made within the scope of the present invention.

The drawings are for illustrative purposes only and not limiting.
1 shows a schematic diagram of a conventional LNP-mRNA encapsulation method (Method A), wherein mRNA dissolved in an aqueous mRNA solution is mixed with lipid dissolved in a lipid solution using a pump system to form mRNA-LNP in LNP solution. and then exchanging the LNP-forming solution for the drug product formulation solution.
2 shows a schematic diagram of an exemplary LNP-mRNA encapsulation method of the present invention, wherein mRNA dissolved in an aqueous mRNA solution is mixed with lipid dissolved in a lipid solution using a pump system to form mRNA-LNP in an LNP-forming solution. and then exchanging the LNP forming solution with the drug product formulation solution, and then heating the drug product formulation solution to increase encapsulation of mRNA in the LNP.
3 shows the differences in encapsulation before and after the final step of heating the mRNA-LNP in the drug formulation solution for 12 different mRNA-LNPs tested.
Figure 4 shows the differences in encapsulation before and after the final step of heating the mRNA-LNP in the drug formulation solution for 13 different mRNA-LNPs tested.
5 shows an exemplary graph of protein expression after pulmonary administration of mRNA encapsulated in lipid nanoparticles prepared by method A after a heating step.

Justice

In order to more easily understand the present invention, first, specific terms are defined as follows. Additional definitions for the following terms and other terms are set forth throughout this specification.

Alkyl : As used herein, “alkyl” refers to a radical of a straight-chain or branched saturated hydrocarbon group having from 1 to 20 carbon atoms (“C _1-20 alkyl”). In some embodiments, an alkyl group has 1 to 3 carbon atoms (“C _1-3 alkyl”). Examples of C _1-3 alkyl groups include methyl (C ₁ ), ethyl (C ₂ ), n-propyl (C ₃ ), and isopropyl (C ₃ ). In some embodiments, an alkyl group has 8 to 12 carbon atoms (“C _8-12 alkyl”). Examples of the C _8-12 alkyl group include n -octyl (C ₈ ), n -nonyl (C ₉ ), n -decyl (C ₁₀ ), n -undecyl (C ₁₁ ), n -dodecyl (C ₁₂ ), and the like. including, but not limited to. The prefix " n -" (normal) refers to an unbranched alkyl group. For example, n -C ₈ alkyl refers to -(CH ₂ ) ₇ CH ₃ , n -C ₁₀ alkyl refers to -(CH ₂ ) ₉ CH ₃ , and so on.

Amino Acid : As used herein, the term “amino acid”, in its broadest sense, refers to any compound and/or substance that can be included in a polypeptide chain. In some embodiments, the amino acid has the general structure H ₂ NC(H)(R)-COOH. In some embodiments, the amino acid is a naturally occurring amino acid. In some embodiments, the amino acid is a synthetic amino acid, and in some embodiments, the amino acid is a D-amino acid; In some embodiments, the amino acid is an L-amino acid. “Standard amino acid” refers to any of the standard 1-amino acids found primarily in naturally occurring peptides. "Non-standard amino acid" refers to any amino acid other than a standard amino acid, whether prepared synthetically or obtained from a natural source. As used herein, “synthetic amino acid” encompasses, but is not limited to, chemically modified amino acids, including salts, amino acid derivatives (eg, amides), and/or substitutions. Amino acids, including carboxy-terminal amino acids and/or amino-terminal amino acids of peptides, are modified by methylation, amidation, acetylation, protecting groups and/or altering the circulating half-life of the peptide without adversely affecting the activity of the peptide. It can be modified by substitution with other chemical functional groups that can Amino acids can participate in disulfide bonds. Amino acids can be, for example, in one or more chemical entities ( eg , a methyl group, an acetate group, an acetyl group, a phosphate group, a formyl moieties, an isoprenoid group, a sulfate group, a polyethylene glycol moiety, a lipid moiety) , carbohydrate moieties, biotin moieties, etc. ). The term “amino acid” is used interchangeably with “amino acid residue” and may refer to a free amino acid and/or an amino acid residue of a peptide. Whether referring to free amino acids or residues of peptides will become clear from the context in which the term is used.

Animal : As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (eg, rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate and/or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and/or worms. In some embodiments, the animal can be a transgenic animal, a genetically engineered animal, and/or a clone.

Approximately or about : As used herein, the term “approximately” or “about,” when applied to one or more values of interest, refers to a value that is similar to a specified reference value. In certain embodiments, the terms "approximately" or "about", unless stated otherwise or otherwise clear from the context (except when such numbers exceed 100% of the possible numerical values), are of the stated reference numerical value. 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8% in either direction (greater than or less than) , 7%, 6%, 5%, 4%, 3%, 2%, or 1% or less.

Delivery : As used herein, the term “delivery” includes both local and systemic delivery. For example, delivery of mRNA may be: a situation in which the mRNA is delivered to a target tissue, the encoded protein or peptide is expressed, and is maintained within the target tissue (also referred to as "localized distribution" or "localized delivery"); and situations in which mRNA is delivered to a target tissue, the encoded protein or peptide is expressed, secreted into the patient's circulatory system (eg, serum), distributed throughout the body, and absorbed by other tissues ("systemic distribution" or "systemic delivery") also referred to as ").

Efficacy : As used herein, the term "potency" or grammatical equivalent refers to an improvement in a biologically relevant endpoint with respect to delivery of an mRNA encoding a related protein or peptide. In some embodiments, the biological endpoint is protection against ammonium chloride challenge at a specific time point after administration.

Encapsulation: As used herein, the term “encapsulation” or its grammatical equivalent refers to the process of confinement of individual mRNA molecules within nanoparticles.

Expression : As used herein, “expression” of an mRNA refers to the translation of an mRNA into a peptide (eg, antigen), polypeptide, or protein (eg, enzyme), and as the context indicates, a peptide, polypeptide, Alternatively, it may include post-translational modifications of a fully assembled protein (eg, an enzyme). In this application, the terms "expression" and "production" and grammatically equivalent expressions are used interchangeably.

Improve, increase or reduce : As used herein, the term “improvement,” “increase,” or “reduce,” or grammatically equivalent expression refers to a baseline measure, such as a treatment described herein. Relative to measurements in the same individual prior to initiation of, or in a control sample or subject (or multiple control samples or subjects) in the absence of a treatment described herein. A "control sample" is a sample that is subjected to the same conditions as the test sample, except for the test item. A “control subject” is a subject afflicted with the same type of disease as the subject being treated, and is approximately the same age as the subject being treated.

Impurities : As used herein, the term “impurities” refers to substances that are within a constrained amount of a liquid, gas, or solid that differ from the chemical composition of the target substance or compound. Impurities are also referred to as contaminants.

In vitro : As used herein, the term " in vitro " refers to an event that occurs not within a multicellular organism, but in an artificial environment such as, for example, a test tube or reaction vessel, cell culture, and the like.

In Vivo : As used herein, the term “ in vivo ” refers to events that occur within multicellular organisms such as humans and non-human animals. In the context of cell-based systems, the term may be used to refer to events that occur within live cells (eg, as opposed to ex vivo systems).

Isolated : As used herein, the term "isolated" refers to (1) separated from at least some of the constituents to which it was initially produced (either in its natural and/or experimental environment) and/or (2) ) means a substance and/or entity produced, manufactured and/or manufactured by human hands. An isolated substance and/or entity may contain about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% of the other constituents to which it was initially bound. %, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99%. In some embodiments, the isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about greater than 98%, about 99%, or about 99% purity. As used herein, a substance is "pure" when it is substantially free of other components. As used herein, excipients (eg, buffers, solvents, water, etc.) should not be included in the calculation of the percent purity of an isolated material and/or entity.

Local distribution or delivery : As used herein, the terms “localized distribution”, “localized delivery” or a grammatical equivalent thereof refer to tissue specific delivery or distribution. In general, local distribution or delivery requires that the peptide or protein (eg, enzyme) encoded by the mRNA be translated and expressed within the cell, or that it is restricted and does not enter the patient's circulation.

Messenger RNA (mRNA): As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide encoding at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. An mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems and optionally purified, and chemically synthesized. Where appropriate, for example, in the case of a chemically synthesized molecule, mRNA may contain nucleoside analogues such as chemically modified bases or analogues with sugars, backbone modifications, and the like. mRNA sequences are presented in 5' to 3' orientation unless otherwise indicated. In some embodiments, the mRNA is a natural nucleoside (eg, adenosine, guanosine, cytidine, uridine); Nucleoside analogs (eg, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propytidine) Nyl-uridine, 2-Aminoadenosine, C5-Bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methyl Cytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, pseudouridine, and 5-methylcytidine); chemically modified bases; biologically modified bases (eg, methylated bases); inserted base; modified sugars (eg, 2'-fluororibose, ribose, 2'-deoxyribose, arabinose and hexose); and/or modified phosphate groups (eg, phosphorothioate and 5'-N-phosphoamidite bonds).

Nucleic acid: As used herein, the term “nucleic acid” in its broadest sense refers to any compound and/or substance incorporated or capable of being incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and/or substance that is incorporated or can be incorporated into a polynucleotide chain via a phosphate diester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (eg, nucleotides and/or nucleosides). In some embodiments, “nucleic acid” refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, “nucleic acid” encompasses RNA as well as single and/or double stranded DNA and/or cDNA. Also, the terms “nucleic acid”, “DNA”, “RNA”, and/or similar terms include nucleic acid analogs, ie, analogs having other than a phosphodiester backbone.

Patient: As used herein, the term “patient” or “subject” refers to any organism to which a provided composition can be administered, eg, for experimental, diagnostic, prophylactic, cosmetic and/or therapeutic purposes. Typical patients include animals ( eg , mice, rats, rabbits, non-human primates, and/or mammals such as humans). In some embodiments, the patient is a human. Humans include pre-natal and post-natal forms.

Pharmaceutically acceptable : As used herein, the term "pharmaceutically acceptable" refers to tissues of humans and animals without undue toxicity, irritation, allergic reaction, or other problems or complications within the scope of thorough medical judgment. Refers to a substance suitable for use in contact with and commensurate with a reasonable benefit/risk ratio.

Pharmaceutically acceptable salts : Pharmaceutically acceptable salts are well known in the art. For example, SM Berge et al. describe in detail pharmaceutically acceptable salts in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts include amino groups formed with inorganic acids such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid. salts or salts of amino groups formed using other methods used in the art, such as ion exchange. Other pharmaceutically acceptable salts are adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate. , borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate ( dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptano Heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurin Laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, Nico nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3 -Phenylpropionate (3-phenylpropionate), phosphate (phosphate), picrate (picrate), pivalate (pivalate), propionate (propionate), stearate (stearate), succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts) and the like. Salts derived from suitable bases include alkali metal, alkaline earth metal, ammonium, and N ⁺ (C _1-4 alkyl) ₄ salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Additional pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, sulfonates, and aryl sulfonates. amine cations formed using Additional pharmaceutically acceptable salts include salts formed by quaternization of an amine to form a quaternized alkylated amino salt with a suitable electrophile, such as an alkyl halide.

Potency: As used herein, the term "potency " or grammatically equivalent expression refers to the expression of and/or a biological effect attributable to the protein(s) or peptide(s) encoded by the mRNA.

Salt : As used herein, the term “salt” refers to an ionic compound produced or capable of being produced by a neutralization reaction between an acid and a base.

Systemic distribution or delivery : As used herein, the terms "systemic distribution" or "systemic delivery" or grammatically equivalent expressions refer to a delivery or distribution mechanism or approach that affects the body or the whole organism. Systemic distribution or delivery is generally achieved through the body's circulatory system, eg, the bloodstream. Compared to the definition of "localized distribution or transmission".

Subject : As used herein, the term “subject” refers to a human or any non-human animal (eg, mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse or primate). Humans include pre-natal and post-natal forms. In many embodiments, the subject is a human. A subject refers to a human who goes to a health care provider for diagnosis or treatment of a disease, and may be a patient. The term “subject” is used interchangeably herein with “individual” or “patient”. A subject may be afflicted with or susceptible to a disease or disorder but may or may not exhibit symptoms of the disease or disorder.

Substantially : As used herein, the term “substantially” refers to a qualitative state that exhibits the full or near-total extent or degree of a characteristic or characteristic of interest. Those skilled in the art of biology will understand that it is rare (if any) that biological and chemical phenomena become perfect, progress to perfection, or achieve or avoid absolute results. Accordingly, the term “substantially” is used herein to express the potential lack of completeness inherent in many biological and chemical phenomena.

Target tissues : As used herein, the term “target tissue” refers to any tissue in which the disease being treated has developed. In some embodiments, target tissues include tissues that exhibit a disease-related pathology, symptom, or characteristic.

Treatment : As used herein, the term “treat, treatment, or treating” refers, in part, to alleviating, ameliorating, ameliorating, or inhibiting one or more symptoms or characteristics of a particular disease, disorder and/or condition. to prevent, prevent, delay the onset, reduce the severity, and/or reduce the frequency of its occurrence. Treatment may be administered with the aim of reducing the risk of developing a condition associated with a disease in a subject who does not show signs of the disease and/or has only early signs of the disease.

Yield : As used herein, the term “yield” refers to the percentage of mRNA recovered after encapsulation compared to total mRNA as the starting material. In some embodiments, the term “recovery” is used interchangeably with the term “yield”.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides improved methods for formulating lipid nanoparticles and encapsulating mRNA. In some embodiments, the present invention provides a method of encapsulating messenger RNA (mRNA) within a lipid nanoparticle (LNP), the method comprising: (a) mixing one or more lipids in a lipid solution with one or more mRNAs in an mRNA solution; forming encapsulated mRNA (mRNA-LNP) in LNP in LNP forming solution; (b) exchanging the LNP-forming solution for the drug product formulation solution to provide mRNA-LNP in the drug product formulation solution; and (c) heating the mRNA-LNP in the drug product formulation solution. Surprisingly, it was found that when step (c) is included in the method, the same mRNA-LNP can be encapsulated significantly higher compared to encapsulating mRNA-LNP after step (b).

In some embodiments, novel formulation methods have resulted in mRNA formulations with higher potency (peptide or protein expression) and higher potency (improvement of biologically relevant endpoints) in vitro and in vivo, Its tolerability is potentially better compared to the same mRNA formulation prepared without the additional step of heating the mRNA-LNP in the drug product formulation solution (step (c)). The higher the potency and/or efficacy of such formulations, the lower the dosage of the drug product and/or the frequency of administration may be reduced. In some embodiments, the present invention encompasses improved lipid formulations comprising cationic lipids, helper lipids, and PEG-modified lipids.

In some embodiments, the final encapsulation for mRNA-LNP after step (c) is increased by at least 10% compared to the encapsulation efficiency for the same mRNA-LNP after step (b). In some embodiments, the final encapsulation rate for mRNA-LNP after step (c) is increased by at least 5% compared to the encapsulation rate for the same mRNA-LNP after step (b). For the delivery of nucleic acids, achieving high encapsulation efficiency is important to achieve protection of the drug substance and reduce the loss of activity in vivo.

Various aspects of the invention are described in detail in the sections that follow. The use of sections is not intended to limit the invention. Each section can be applied to any aspect of the present invention.

messenger RNA (mRNA)

The present invention can be used to encapsulate any mRNA. mRNA is generally considered to be a type of RNA that carries information from DNA to ribosomes. Generally, in eukaryotes, mRNA processing involves adding a "cap" on the 5' end and adding a "tail" on the 3' end. A typical cap is a 7-methylguanosine cap, which is a guanosine linked to the first transcribed nucleotide via a 5'-5'-triphosphate bond. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The addition of a tail is usually a polyadenylation event, whereby a polyadenylyl moiety is added to the 3' end of the mRNA molecule. The presence of this "tail" serves to protect the mRNA from exonuclease degradation. Messenger RNA is translated by ribosomes into a series of amino acids that make up proteins.

mRNA can be synthesized according to any one of a variety of known methods. For example, mRNA according to the present invention can be synthesized via in vitro transcription (IVT). Briefly, IVT usually involves a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7 or SP6 RNA polymerase), DNAse I, pyrophosphatase, and/or RNAse inhibitors. The exact conditions will depend on the particular application.

In some embodiments, in vitro synthetic mRNA can be purified prior to formulation and encapsulation to remove undesirable impurities, including various enzymes and other reagents used during mRNA synthesis.

The present invention can be used to formulate and encapsulate mRNAs of various lengths. In some embodiments, the present invention provides a length of about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb 6 kb, 7 kb, 8 kb, 9 kb, 10 mRNAs greater than kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb can be used to formulate and encapsulate in vitro synthesized mRNA. In some embodiments, the present invention has a length of about 1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about 5-12 kb, about 5-10 kb kb, about 8-20 kb, or about 8-15 kb, can be used to formulate and encapsulate mRNA synthesized in vitro.

The present invention can be used to formulate and encapsulate unmodified mRNA or mRNA comprising one or more modifications that generally improve stability. In some embodiments, the modifications are selected from modified nucleotides, modified sugar phosphate backbones, and 5' and/or 3' untranslated regions.

In some embodiments, modification of mRNA may include modification of nucleotides in RNA. The modified mRNA according to the present invention may include, for example, a backbone modification, a sugar modification or a base modification. In some embodiments, the mRNA is a naturally occurring nucleotide including, but not limited to, purine (adenine (A), guanine (G)) or pyrimidine (thymine (T), cytosine (C), uracil (U)) and/or Or it can be synthesized from nucleotide analogues (modified nucleotides) and as modified nucleotide analogues or derivatives of purines and pyrimidines, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isophene. tenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thio- Uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethyl Aminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio -uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl- pseudouracil, queosin (queosine), beta-D-mannosyl-queosin, wybutoxosine, and phosphoramidate, phosphorothioate, peptide nucleotide, methylphosphonate, 7-de azaguanosine, 5-methylcytosine, pseudouridine, 5-methylcytidine, and inosine, and the like. Preparation of such analogs is described in US Patent No. 4,373,071, US Patent No. 4,401,796, US Patent No. 4,415,732, US Patent No. 4,458,066, US Patent No. 4,500,707, US Patent No. No. 4,668,777, U.S. Patent No. 4,973,679, U.S. Patent No. 5,047,524, U.S. Patent No. 5,132,418, U.S. Patent No. 5,153,319, U.S. Patent No. 5,262,530, and U.S. Patent No. 5,700,642, the disclosures of which are incorporated herein by reference in their entirety.

In general, mRNA synthesis involves adding a "cap" at the 5' end and adding a "tail" at the 3' end. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of a "tail" serves to protect the mRNA from exonuclease degradation.

Thus, in some embodiments, the mRNA comprises a 5' cap structure. The 5' cap is typically added as follows: first, RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphate groups; Then, guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyl transferase to create a 5'5'5 triphosphate bond; The 7-nitrogen of guanine is then methylated by methyltransferase. 2'-0-methylation may also occur at the first and/or second base following the 7-methyl guanosine triphosphate residue. Examples of cap structures include, but are not limited to, m7GpppNp-RNA, m7GpppNmp-RNA, and m7GpppNmpNmp-RNA, where m represents a 2'-0methyl residue.

In some embodiments, the mRNA comprises 5' and/or 3' untranslated regions. In some embodiments, the 5' untranslated region comprises one or more elements that affect the stability or translation of mRNA, eg, iron response elements. In some embodiments, the 5' untranslated region may be about 50 to 500 nucleotides in length.

In some embodiments, the 3' untranslated region comprises one or more of a polyadenylation signal, one or more binding sites for a protein that affects the positional stability of mRNA in a cell, or one or more binding sites for a miRNA. In some embodiments, the 3' untranslated region may be 50 to 500 nucleotides in length or longer.

While mRNA provided from in vitro transcription reactions may be preferred in some embodiments, other sources of mRNA are contemplated within the scope of the present invention, including mRNA produced from bacteria, fungi, plants and/or animals.

The present invention can be used to formulate and encapsulate mRNA encoding a variety of proteins. Non-limiting examples of mRNA suitable for the present invention include spinal motor neuron 1 (SMN), alpha-galactosidase (GLA), argininosuccinate synthetase (ASS1), ornithine transcarbamylase (OTC), mRNA encoding factor IX (FIX), phenylalanine hydroxylase (PAH), erythropoietin (EPO), cystic fibrosis transmembrane conduction receptor (CFFF), and firefly luciferase (FFL). Exemplary mRNA sequences as disclosed herein are listed below:

Codon-optimized human OTC coding sequence

AUGCUGUUCAACCUUCGGAUCUUGCUGAACAACGCUGCGUUCCGGAAUGGUCACAACUUCAUGGUCCGGAACUUCAGAUGCGGCCAGCCGCUCCAGAACAAGGUGCAGCUCAAGGGGAGGGACCUCCUCACCCUGAAAAACUUCACCGGAGAAGAGAUCAAGUACAUGCUGUGGCUGUCAGCCGACCUCAAAUUCCGGAUCAAGCAGAAGGGCGAAUACCUUCCUUUGCUGCAGGGAAAGUCCCUGGGGAUGAUCUUCGAGAAGCGCAGCACUCGCACUAGACUGUCAACUGAAACCGGCUUCGCGCUGCUGGGAGGACACCCCUGCUUCCUGACCACCCAAGAUAUCCAUCUGGGUGUGAACGAAUCCCUCACCGACACAGCGCGGGUGCUGUCGUCCAUGGCAGACGCGGUCCUCGCCCGCGUGUACAAGCAGUCUGAUCUGGACACUCUGGCCAAGGAAGCCUCCAUUCCUAUCAUUAAUGGAUUGUCCGACCUCUACCAUCCCAUCCAGAUUCUGGCCGAUUAUCUGACUCUGCAAGAACAUUACAGCUCCCUGAAGGGGCUUACCCUUUCGUGGAUCGGCGACGGCAACAACAUUCUGCACAGCAUUAUGAUGAGCGCUGCCAAGUUUGGAAUGCACCUCCAAGCAGCGACCCCGAAGGGAUACGAGCCAGACGCCUCCGUGACGAAGCUGGCUGAGCAGUACGCCAAGGAGAACGGCACUAAGCUGCUGCUCACCAACGACCCUCUCGAAGCCGCCCACGGUGGCAACGUGCUGAUCACCGAUACCUGGAUCUCCAUGGGACAGGAGGAGGAAAAGAAGAAGCGCCUGCAAGCAUUUCAGGGGUACCAGGUGACUAUGAAAACCGCCAAGGUCGCCGCCUCGGACUGGACCUUCUUGCACUGUCUGCCCAGAAAGCCCGAAGAGGUGGACGACGAGGUGUUCUACAGCCCGCGGUCGCUGGUCUUUCCGGAGGCCGAAAACAGGAAGUGGACUA UCAUGGCCGUGAUGGUGUCCCUGCUGACCGAUUACUCCCCGCAGCUGCAGAAACCAAAGUUCUGA ( SEQ ID NO: 1 )

Codon-optimized human ASS1 coding sequence

AUGAGCAGCAAGGGCAGCGUGGUGCUGGCCUACAGCGGCGGCCUGGACACCAGCUGCAUCCUGGUGUGGCUGAAGGAGCAGGGCUACGACGUGAUCGCCUACCUGGCCAACAUCGGCCAGAAGGAGGACUUCGAGGAGGCCCGCAAGAAGGCCCUGAAGCUGGGCGCCAAGAAGGUGUUCAUCGAGGACGUGAGCCGCGAGUUCGUGGAGGAGUUCAUCUGGCCCGCCAUCCAGAGCAGCGCCCUGUACGAGGACCGCUACCUGCUGGGCACCAGCCUGGCCCGCCCCUGCAUCGCCCGCAAGCAGGUGGAGAUCGCCCAGCGCGAGGGCGCCAAGUACGUGAGCCACGGCGCCACCGGCAAGGGCAACGACCAGGUGCGCUUCGAGCUGAGCUGCUACAGCCUGGCCCCCCAGAUCAAGGUGAUCGCCCCCUGGCGCAUGCCCGAGUUCUACAACCGCUUCAAGGGCCGCAACGACCUGAUGGAGUACGCCAAGCAGCACGGCAUCCCCAUCCCCGUGACCCCCAAGAACCCCUGGAGCAUGGACGAGAACCUGAUGCACAUCAGCUACGAGGCCGGCAUCCUGGAGAACCCCAAGAACCAGGCCCCCCCCGGCCUGUACACCAAGACCCAGGACCCCGCCAAGGCCCCCAACACCCCCGACAUCCUGGAGAUCGAGUUCAAGAAGGGCGUGCCCGUGAAGGUGACCAACGUGAAGGACGGCACCACCCACCAGACCAGCCUGGAGCUGUUCAUGUACCUGAACGAGGUGGCCGGCAAGCACGGCGUGGGCCGCAUCGACAUCGUGGAGAACCGCUUCAUCGGCAUGAAGAGCCGCGGCAUCUACGAGACCCCCGCCGGCACCAUCCUGUACCACGCCCACCUGGACAUCGAGGCCUUCACCAUGGACCGCGAGGUGCGCAAGAUCAAGCAGGGCCUGGGCCUGAAGUUCGCCGAGCUGGUGUACACCGGCUUCUGGCACAGCCCCGAGUGCGAGUUCG UGCGCCACUGCAUCGCCAAGAGCCAGGAGCGCGUGGAGGGCAAGGUGCAGGUGAGCGUGCUGAAGGGCCAGGUGUACAUCCUGGGCCGCGAGAGCCCCCUGAGCCUGUACAACGAGGAGCUGGUGAGCAUGAACGUGCAGGGCGACUACGAGCCCGCGCGCCGCCACCGGCUGUUCAUCAACAUCAAAGAGCACCOUGAGCUGCCUCAAAGAGAGCSU SEQ ID NO:2

Codon-optimized human CFTR coding sequence

AUG UAA (SEQ ID NO: 3)

Comparison of codon-optimized human CFTR mRNA coding sequences

AUG UAA (SEQ ID NO: 4)

Codon-optimized human PAH coding sequence

AUGAGCACCGCCGUGCUGGAGAACCCCGGCCUGGGCCGCAAGCUGAGCGACUUCGGCCAGGAGACCAGCUACAUCGAGGACAACUGCAACCAGAACGGCGCCAUCAGCCUGAUCUUCAGCCUGAAGGAGGAGGUGGGCGCCCUGGCCAAGGUGCUGCGCCUGUUCGAGGAGAACGACGUGAACCUGACCCACAUCGAGAGCCGCCCCAGCCGCCUGAAGAAGGACGAGUACGAGUUCUUCACCCACCUGGACAAGCGCAGCCUGCCCGCCCUGACCAACAUCAUCAAGAUCCUGCGCCACGACAUCGGCGCCACCGUGCACGAGCUGAGCCGCGACAAGAAGAAGGACACCGUGCCCUGGUUCCCCCGCACCAUCCAGGAGCUGGACCGCUUCGCCAACCAGAUCCUGAGCUACGGCGCCGAGCUGGACGCCGACCACCCCGGCUUCAAGGACCCCGUGUACCGCGCCCGCCGCAAGCAGUUCGCCGACAUCGCCUACAACUACCGCCACGGCCAGCCCAUCCCCCGCGUGGAGUACAUGGAGGAGGAGAAGAAGACCUGGGGCACCGUGUUCAAGACCCUGAAGAGCCUGUACAAGACCCACGCCUGCUACGAGUACAACCACAUCUUCCCCCUGCUGGAGAAGUACUGCGGCUUCCACGAGGACAACAUCCCCCAGCUGGAGGACGUGAGCCAGUUCCUGCAGACCUGCACCGGCUUCCGCCUGCGCCCCGUGGCCGGCCUGCUGAGCAGCCGCGACUUCCUGGGCGGCCUGGCCUUCCGCGUGUUCCACUGCACCCAGUACAUCCGCCACGGCAGCAAGCCCAUGUACACCCCCGAGCCCGACAUCUGCCACGAGCUGCUGGGCCACGUGCCCCUGUUCAGCGACCGCAGCUUCGCCCAGUUCAGCCAGGAGAUCGGCCUGGCCAGCCUGGGCGCCCCCGACGAGUACAUCGAGAAGCUGGCCACCAUCUACUGGUUCACCGUGGAGUUCGGCCUGU GCAAGCAGGGCGACAGCAUCAAGGCCUACGGCGCCGGCCUGCUGAGCAGCUUCGGCGAGCUGCAGUACUGCCUGAGCGAGAAGCCCAAGCUGCUGCCCCUGGAGCUGGAGAAGACCGCCAUCCAGAACUACACCGUGACCGAGUUCCAGCCCCUGUACUACGUGGCCGAGAGCUUCAACGACGCCAAGGAGAAGGUGCGCAACUUCGCCGCCACCAUCCCCCGCCCCUUCAGCGUGCGCUACGACCCCUACACCCAGCGCAUCGAGGUGCUGGACAACACCCAGCAGCUGAAGAUCCUGGCCGACAGCAUCAACAGCGAGAUCGGCAUCCUGUGCAGCGCCCUGCAGAAGAUCAAGUAA (SEQ ID NO: 5)

In some embodiments, an mRNA suitable for the present invention is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, have a nucleotide sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical. In some embodiments, an mRNA suitable for the present invention comprises a nucleotide sequence identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

mRNA solution

Since the mRNA can be provided as a solution for mixing with the lipid solution, the mRNA can be encapsulated in lipid nanoparticles. A suitable mRNA solution can be any aqueous solution containing the mRNA to be encapsulated at various concentrations. For example, a suitable mRNA solution is about 0.01 mg/ml, 0.05 mg/ml, 0.06 mg/ml, 0.07 mg/ml, 0.08 mg/ml, 0.09 mg/ml, 0.1 mg/ml, 0.15 mg/ml, 0.2 Contains mRNA at a concentration greater than or equal to mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml, 0.8 mg/ml, 0.9 mg/ml, or 1.0 mg/m can do. In some embodiments, a suitable mRNA solution is about 0.01-1.0 mg/ml, 0.01-0.9 mg/ml, 0.01-0.8 mg/ml, 0.01-0.7 mg/ml, 0.01-0.6 mg/ml, 0.01-0.5 mg/ml ml, 0.01-0.4 mg/ml, 0.01-0.3 mg/ml, 0.01-0.2 mg/ml, 0.01-0.1 mg/ml, 0.05-1.0 mg/ml, 0.05-0.9 mg/ml, 0.05-0.8 mg/ml , 0.05-0.7 mg/ml, 0.05-0.6 mg/ml, 0.05-0.5 mg/ml, 0.05-0.4 mg/ml, 0.05-0.3 mg/ml, 0.05-0.2 mg/ml, 0.05-0.1 mg/ml, It may contain mRNA at a concentration ranging from 0.1 to 1.0 mg/ml, 0.2 to 0.9 mg/ml, 0.3 to 0.8 mg/ml, 0.4 to 0.7 mg/ml, or 0.5 to 0.6 mg/ml. In some embodiments, a suitable mRNA solution is at most about 5.0 mg/ml, 4.0 mg/ml, 3.0 mg/ml, 2.0 mg/ml, 1.0 mg/ml, .09 mg/ml, 0.08 mg/ml, 0.07 mg/ml ml, 0.06 mg/ml, or 0.05 mg/ml mRNA.

In general, suitable mRNA solutions may also contain buffers and/or salts. In general, buffers may include HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate and sodium phosphate. In some embodiments, an appropriate concentration of the buffer is between about 0.1 mM and 100 mM, between 0.5 mM and 90 mM, between 1.0 mM and 80 mM, between 2 mM and 70 mM, between 3 mM and 60 mM, between 4 mM and 50 mM, between 5 mM and 5 mM. 40 mM, 6 mM to 30 mM, 7 mM to 20 mM, 8 mM to 15 mM, or 9 to 12 mM. In some embodiments, a suitable concentration of the buffer is about 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM or more.

Exemplary salts may include sodium chloride, magnesium chloride, and potassium chloride. In some embodiments, an appropriate concentration of salt in the mRNA solution is about 1 mM to 500 mM, 5 mM to 400 mM, 10 mM to 350 mM, 15 mM to 300 mM, 20 mM to 250 mM, 30 mM to 200 mM, 40 mM to 190 mM, 50 mM to 180 mM, 50 mM to 170 mM, 50 mM to 160 mM, 50 mM to 150 mM, or 50 mM to 100 mM. The salt concentration in a suitable mRNA solution is at least about 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM.

In some embodiments, suitable mRNA solutions are about 3.5-6.5, 3.5-6.0, 3.5-5.5, 3.5-5.0, 3.5-4.5, 4.0-5.5, 4.0-5.0, 4.0-4.9, 4.0-4.8, 4.0-4.7, It may have a pH in the range of 4.0-4.6, or 4.0-4.5. In some embodiments, a suitable mRNA solution is about 3.5, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.3, and 6.5 It may have the following pH.

An mRNA solution suitable for the present invention can be prepared using various methods. In some embodiments, mRNA can be directly lysed in the buffers described herein. In some embodiments, the mRNA solution can be prepared by mixing the mRNA stock solution and the buffer before mixing the mRNA solution with the lipid solution for encapsulation. In some embodiments, the mRNA solution can be prepared by mixing the mRNA stock solution and the buffer immediately prior to mixing the mRNA solution with the lipid solution for encapsulation. For example, a suitable mRNA stock solution contains about 0.2 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.8 mg/ml, 1.0 mg/ml, 1.2 mg/ml, 1.4 mg mRNA in water. /ml, 1.5 mg/ml, or 1.6 mg/ml, 2.0 mg/ml, 2.5 mg/ml, 3.0 mg/ml, 3.5 mg/ml, 4.0 mg/ml, 4.5 mg/ml, or 5.0 mg/ml or more concentration may be contained.

In some embodiments, the mRNA solution is prepared by mixing the mRNA stock solution with the buffer using a pump. Exemplary pumps include, but are not limited to, gear pumps, peristaltic pumps, and centrifugal pumps. In general, the buffer is mixed at a rate higher than that of the mRNA stock solution. For example, the buffer can be mixed at a rate at least 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, or 20x higher than the rate of the mRNA stock solution. In some embodiments, the buffer is about 100-6000 ml/min (e.g., about 100-300 ml/min, 300-600 ml/min, 600-1200 ml/min, 1200-2400 ml/min, 2400- 3600 ml/min, 3600-4800 ml/min, 4800-6000 ml/min, or 60-420 ml/min). In some embodiments, the buffer is about 60 ml/min, 100 ml/min, 140 ml/min, 180 ml/min, 220 ml/min, 260 ml/min, 300 ml/min, 340 ml/min, 380 ml flow rates of at least 420 ml/min, 480 ml/min, 540 ml/min, 600 ml/min, 1200 ml/min, 2400 ml/min, 3600 ml/min, 4800 ml/min, or 6000 ml/min mixed with

In some embodiments, the mRNA stock solution is about 10-600 ml/min (e.g., about 5-50 ml/min, about 10-30 ml/min, about 30-60 ml/min, about 60-120 ml/min min, about 120-240 ml/min, about 240-360 ml/min, about 360-480 ml/min, or about 480-600 ml/min). In some embodiments, the mRNA stock solution is about 5 ml/min, 10 ml/min, 15 ml/min, 20 ml/min, 25 ml/min, 30 ml/min, 35 ml/min, 40 ml/min, 45 ml/min, 50 ml/min, 60 ml/min, 80 ml/min, 100 ml/min, 200 ml/min, 300 ml/min, 400 ml/min, 500 ml/min, or 600 ml/min or more mixed with the flow rate.

lipid solution

According to the present invention, the lipid solution contains a mixture of lipids suitable for forming lipid nanoparticles for encapsulation of mRNA. In some embodiments, suitable lipid solutions are ethanol-based. For example, a suitable lipid solution may contain a mixture of the desired lipids dissolved in pure ethanol (ie, 100% ethanol). In another embodiment, a suitable lipid solution is isopropyl alcohol-based. In another embodiment, a suitable lipid solution is based on dimethylsulfoxide. In another embodiment, a suitable lipid solution is a mixture of a suitable solvent including, but not limited to, ethanol, isopropyl alcohol, and dimethylsulfoxide.

Suitable lipid solutions may contain mixtures of the desired lipids in varying concentrations. For example, a suitable lipid solution may contain a mixture of the desired lipids at about 0.1 mg/ml, 0.5 mg/ml, 1.0 mg/ml, 2.0 mg/ml, 3.0 mg/ml, 4.0 mg/ml, 5.0 mg/ml, 6.0 mg/ml, 7.0 mg/ml, 8.0 mg/ml, 9.0 mg/ml, 10 mg/ml, 15 mg/ml, 20 mg/ml, 30 mg/ml, 40 mg/ml, 50 mg/ml, or It may contain a total concentration of 100 mg/ml or more. In some embodiments, a suitable lipid solution comprises about 0.1-100 mg/ml, 0.5-90 mg/ml, 1.0-80 mg/ml, 1.0-70 mg/ml, 1.0-60 mg/ml, 1.0-50 mg/ml, 1.0-40 mg/ml, 1.0-30 mg/ml, 1.0-20 mg/ml/ml, 1.0-15 mg/ml/ml, 1.0-10 mg/ml, 1.0-9 mg /ml/ml, 1.0-8 mg/ml, 1.0-7 mg/ml, 1.0-6ml, or 1.0-5 mg/ml total concentration. In some embodiments, a suitable lipid solution contains a mixture of desired lipids up to about 100 mg/ml, 90 mg/ml, 80 mg/ml, 70 mg/ml, 60 mg/ml, 50 mg/ml, 40 mg/ml , 30 mg/ml, 20 mg/ml, or 10 mg/ml.

Any desired lipid may be mixed in any proportion suitable for encapsulating mRNA. In some embodiments, a suitable lipid solution contains a mixture of desired lipids comprising cationic lipids, helper lipids (eg, non-cationic lipids and/or cholesterol lipids), and/or pegylated lipids. In some embodiments, a suitable lipid solution contains a mixture of desired lipids comprising one or more cationic lipids, one or more helper lipids (eg, non-cationic lipids and/or cholesterol lipids), and/or one or more PEGylated lipids. do.

An exemplary lipid mixture for use with the present invention consists of four components: a cationic lipid, a non-cationic lipid (eg, DSPC, DPPC, DOPE or DEPE), a cholesterol-based lipid (eg, cholesterol), and PEG-modified lipids (eg DMG-PEG2K). In some embodiments, the ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) is about 20-50:25-35:20-50, respectively It can be from 1 to 5. In some embodiments, the ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) is approximately 20:30:48.5:1.5, respectively. In some embodiments, the ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) is approximately 40:30:20:10, respectively. In some embodiments, the ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) is approximately 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) is approximately 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipid(s) to non-cationic lipid(s) to cholesterol-based lipid(s) to PEG-modified lipid(s) is approximately 50:25:20:5.

In some embodiments, a lipid mixture for use with the present invention comprises no more than three distinct lipid components. In some embodiments, one distinct lipid component in such a mixture is a sterol-based or imidazole-based cationic lipid. An exemplary lipid mixture may consist of three lipid components: cationic lipids (eg, cholesterol-based or imidazole-based cationic lipids such as ICE, HGT4001, or HGT4002), non-cationic lipids (eg, DSPC, DPPC, DOPE, or DEPE), and PEG-modified lipids (eg, DMG-PEG2K). The molar ratio of cationic lipid:non-cationic lipid:PEG-modified lipid may be about 55-65:30-40:1-15, respectively. In some embodiments, a 60:35:5 cationic lipid (eg, a cholesterol- or imidazole-based lipid, such as ICE, HGT4001, or HGT4002): a non-cationic lipid (eg, DSPC, DPPC, DOPE, or DEPE) Molar ratios of :PEG-modified lipids (eg, DMG-PEG2K) are particularly suitable for use with the present invention.

cationic lipids

As used herein, the phrase "cationic lipid" refers to any one of a number of lipid species that exhibit a net positive charge at a selected pH, such as physiological pH. Several cationic lipids have been disclosed in the literature, many of which are commercially available. Cationic lipids particularly suitable for use in the compositions and methods of the present invention include those described in WO 2010/053572 (and, in particular, C12-200 described in paragraphs [00225]) and WO 2012/170930 and , both of which are incorporated herein by reference. In certain embodiments, cationic lipids suitable for use in the compositions and methods of the present invention are, for example, (15Z, 18Z)-N,N-dimethyl-6-(9Z, 12Z)-octadeca-9, 12-dien-1-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z, 18Z)-N,N-dimethyl-6-((9Z, 12Z)-octadega-9, 12-dien-1-yl)tetracosa-4,15,18-trien-1-amine (HGT5001), and (15Z,18Z)-N,N-dimethyl-6-((9Z, 12Z)-octa U.S. Provisional Patent Application No. 61/617,468, filed March 29, 2012, such as deca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002) ionizable cationic lipids described in (incorporated herein by reference).

In some embodiments, cationic lipids suitable for the compositions and methods of the present invention are 3,6-bis(4-(bis(9Z,12Z)-2-hydroxyoctadeca-9,12-dien-1-yl) cationic lipids such as amino)butyl)piperazine-2,5-dione (OF-02).

In some embodiments, cationic lipids suitable for the compositions and methods of the present invention are cationic lipids, such as those described in WO 2015/184256 A2 entitled "Biodegradable lipids for delivery of nucleic acids", incorporated herein by reference, such as 3- (4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-di Oxane-2,5-dione (target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydecyl) (2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (target 24).

In some embodiments, cationic lipids suitable for the compositions and methods of the present invention include cationic lipids described in WO 2013/063468 and US Provisional Patent Application, entitled "Lipid Formulations for Delivery of Messenger RNA," which All are incorporated herein by reference. In some embodiments, the cationic lipid is a compound of Formula I-c1-a :

(I-c1-a),

(I-c1-a) ,

or a pharmaceutically acceptable salt thereof, wherein:

each R ² is independently hydrogen or C _1-3 alkyl;

each q is independently 2 to 6;

each R' is independently hydrogen or C _1-3 alkyl;

each R ^L is independently C _8-12 alkyl.

In some embodiments, each R ² is hydrogen, methyl, or ethyl. In some embodiments, each R ² is hydrogen or methyl. In some embodiments, each R ² is hydrogen.

In some embodiments, each q is independently 3-6. In some embodiments, each q is independently 3-5. In some embodiments, each q is 4.

In some embodiments, each R′ is hydrogen, methyl, or ethyl. In some embodiments, each R′ is hydrogen or methyl. In some embodiments, each R′ is hydrogen.

In some embodiments, each R ^L is independently C _8-12 alkyl. In some embodiments, each R ^L is independently n -C _8-12 alkyl. In some embodiments, each R ^L is independently C _9-11 alkyl. In some embodiments, each R ^L is independently n -C _9-11 alkyl. In some embodiments, each R ^L is independently C ₁₀ alkyl. In some embodiments, each R ^L is independently n -C ₁₀ alkyl.

In some embodiments, each R ² is independently hydrogen or methyl; each q is independently 3 to 5; each R' is independently hydrogen or methyl; each R ^L is independently C _8-12 alkyl.

In some embodiments, each R ² is hydrogen; each q is independently 3 to 5; each R' is hydrogen; each R ^L is independently C _8-12 alkyl.

In some embodiments, each R ² is hydrogen; each q is 4; each R' is hydrogen; each R ^L is independently C _8-12 alkyl.

In some embodiments, the cationic lipid is a compound of Formula Ig :

(I-g),

(Ig) ,

or a pharmaceutically acceptable salt thereof, wherein each R ^L is independently C _8-12 alkyl. In some embodiments, each R ^L is independently n -C _8-12 alkyl. In some embodiments, each R ^L is independently C _9-11 alkyl. In some embodiments, each R ^L is independently n -C _9-11 alkyl. In some embodiments, each R ^L is independently C ₁₀ alkyl. In some embodiments, each R ^L is n -C ₁₀ alkyl.

In certain embodiments, a suitable cationic lipid is cKK-E12, or (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione). The structure of cKK-E12 is shown below:

.

.

Other suitable cationic lipids include cleavable cationic lipids described in International Patent Publication WO 2012/170889, incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the formula: or a pharmaceutically acceptable salt thereof:

,

,

wherein R ₁ is selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkyl amino (eg, alkyl amino such as dimethylamino), and pyridyl, and R ₂ is It is selected from the group consisting of one of the following two formulas:

및

and

wherein R ₃ and R ₄ are each independently selected from the group consisting of optionally substituted variable saturated or unsaturated C ₆ -C ₂₀ alkyl, and optionally substituted variable saturated or unsaturated C ₆ -C ₂₀ acyl; n is 0 or any positive integer such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more). In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid "HGT4001" having the compound structure:

(HGT4001)

and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid "HGT4002" having the compound structure:

(HGT4002)

and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid "HGT4003" having the compound structure:

(HGT4003)

and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid "HGT4004" having the compound structure:

(HGT4004)

and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid "HGT4005" having the compound structure:

(HGT4005)

and pharmaceutically acceptable salts thereof.

Additional exemplary cationic lipids are those of Formula I:

(I)

(I)

and pharmaceutically acceptable salts thereof,

during the ceremony

("OF-00")이거나, R is

("OF-00") or

("OF-01")이거나, R is

("OF-01") or

("OF-02")이거나,R is

("OF-02") or

("OF-03")이다.R is

("OF-03").

(See, eg, Fenton, Owen S. et al., "Bioinspired Alkenyl Amino Alcohol Ionizable Lipid Materials for Highly Potent In Vivo mRNA Delivery." Advanced materials (2016)).

In some embodiments, one or more cationic lipids suitable for the present invention may be N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride or “DOTMA”. (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987); US Pat. No. 4,897,355). Other suitable cationic lipids include, for example, 5-carboxyspermylglycinedioctadecylamide or “DOGS”, 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium or “DOSPA” (Behr et al., Proc Nat.'l Acad. Sci. 86, 6982 (1989); ,2-dioleoyl-3-trimethylammonium-propane or "DOTAP".

Additional exemplary cationic lipids are also 1,2-distearyloxy-N,N-dimethyl-3-aminopropane or “DSDMA”, 1,2-dioleyloxy-N,N-dimethyl-3-amino Propane or “DODMA”, 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or “DLinDMA”, 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane or “DLenDMA”, N-dioleyl-N,N-dimethylammonium chloride or “DODAC”, N,N-distearyl-N,N-dimethylammonium bromide or “DDAB”, N-(1,2-di Myristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide or "DMRIE", 3-dimethylamino-2-(cholest-5-ene)-3-beta-oxy Butane-4-oxy)-l-(cis,cis-9,12-octadecadienoxy)propane or "CLinDMA", 2-[5'-(cholest-5-en-3-beta-oxy)- 3'-oxapentoxy)-3-dimethyl ll-(cis,cis-9', l-2'-octadecadienoxy)propane or "CpLinDMA", N,N-dimethyl-3,4-dioleyloxy Benzylamine or "DMOBA", 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane or "DOcarbDAP", 2,3-dilinoleyloxy-N,N'-dimethylpropylamine or " DLinDAP", 1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane or "DLincarbDAP", 1,2-dilinoleoylcarbamyl-3-dimethylaminopropane or "DLinCDAP", 2 ,2-Dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxalane or "DLin--DMA", 2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-diox Solan or "DLin-K-XTC2-DMA", and 2-(2,2-di((9Z,12Z)-octadeca-9,l 2-dien-1-yl)-l,3-dioxolane- 4-yl)-N,N-dimethylethanamine (DLin-KC2-DMA)) (see WO 2010/042877; Semple et al., Nature Biotech. 28: 172-176 (2010)), or their including mixtures. (Heys, J. et al., J Controlled Release 107: 276-287 (2005); Morrissey, DV. et al., Nat. Biotechnol. 23(8): 1003-1007 (2005); PCT Publication WO2005) /121348A1). In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole, dialkylamino, or guanidinium moiety.

In some embodiments, the one or more cationic lipids are XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxalane), MC3 (((6Z,9Z,28Z,31Z)- Heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2, 2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine)), NC98-5 (4, 7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammonium propane), HGT4003 (WO 2012/170889, the teachings of which are incorporated herein by reference in their entirety), ICE (WO 2011/068810, the teachings of which are incorporated herein by reference in their entirety) is incorporated herein by reference), HGT5000 (U.S. Provisional Patent No. 61/617,468, the teachings of which are incorporated herein by reference in their entirety), or HGT5001 (cis or trans) (U.S. Provisional Patent No. 61/617,468) ), aminoalcohol lipidoids (such as those disclosed in WO2010/053572), DOTAP (1,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3 -trimethylammonium propane), DLinDMA (Heys, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids" J. Contr. Rel. 2005, 107, 276-287), DLin-KC2-DMA (Semple, SC et al., "Rational Design of Cationic Lipids for siRNA Delivery" Nature Biotech. 2010, 28, 172-176), C12-20 0 (Love, K.T. et al. (“Lipid-like materials for low-dose in vivo gene silencing” PNAS 2010, 107, 1864-1869), N1GL, N2GL, V1GL, and combinations thereof.

In some embodiments, the one or more cationic lipids comprise amino lipids. Amino lipids suitable for use in the present invention include those described in WO2017180917, which is incorporated herein by reference. Exemplary aminolipids in WO2017180917 include those described in paragraph [0744], such as DLin-MC3-DMA (MC3), (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-diene -1-amine (L608), and compound 18. Other amino lipids include compound 2, compound 23, compound 27, compound 10, and compound 20. Additionally, amino lipids suitable for use in the present invention include those described in WO2017112865, which is incorporated herein by reference. Exemplary amino lipids in WO2017112865 include formulas (I), (Ial)-(Ia6), (lb), (II), (IIa), (III), (Illa), (IV), (17-1) , the compound according to any one of (19-1), (19-11), and (20-1), and the compounds of paragraphs [00185], [00201], [0276]. In some embodiments, cationic lipids suitable for use in the present invention include those described in WO2016118725, which is incorporated herein by reference. Exemplary cationic lipids in WO2016118725 include such as KL22 and KL25. In some embodiments, cationic lipids suitable for use in the present invention include those described in WO2016118724, which is incorporated herein by reference. Exemplary cationic lipids in WO2016118725 include those such as KL10, 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), and KL25.

In some embodiments, the cationic lipid comprises at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55% of the total lipid in a suitable lipid solution by weight or mole. , 60%, 65%, or 70%. In some embodiments, the cationic lipid(s) comprises about 30-70% (e.g., about 30-65%, about 30-60%, about 35- 55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%).

Non-cationic lipids/helper lipids

As used herein, the term “non-cationic lipid” refers to any neutral, zwitterionic, or anionic lipid. As used herein, the term “anionic lipid” refers to any one of a number of lipid species that retain a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids are distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (dioleoylphosphatidylglycerol) Phosphatidylglycerol (dipalmitoylphosphatidylglycerol, DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (palmitoyloleoylphosphatidyloleoyl- phosphatidylethanolamine, POPC), palmitoylphosphatidylethanolamine (POPC) -Phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate, DOPE-mal), dipalmitoyl phosphatidylethanolamine (dipalmitoyl phosphatidyl ethanolamine, DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 1,2-dierucoyl-sn -glycero-3-phosphoethanolamine (1,2-dierucoyl-sn-glycero-3-phosphoethanolamine, DEPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), or mixtures thereof not limited In some embodiments, an admixture for use with the present invention comprises DSPC as the non-cationic lipid component. In some embodiments, the mixture for use with the present invention comprises DPPC as the non-cationic lipid component. In some embodiments, the mixture for use with the present invention comprises DOPE as the non-cationic lipid component. In another embodiment, the mixture for use with the present invention comprises DEPE as the non-cationic lipid component.

In some embodiments, the non-cationic lipid comprises at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% of the total lipids in a suitable lipid solution by weight or mole. %, 50%, 55%, 60%, 65%, or 70%. In some embodiments, the non-cationic lipid(s) comprises, by weight or mole, about 30-50% (e.g., about 30-45%, about 30-40%, about 35%) of the total lipids in a suitable lipid solution. -50%, about 35-45%, or about 35-40%).

cholesterol-based lipids

In some embodiments, a suitable lipid solution comprises one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include, for example, DC-Choi(N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl ) piperazine (Gao et al., Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al., BioTechniques 23, 139 (1997); US Pat. No. 5,744,335) or ICE. . In some embodiments, the cholesterol-based lipid(s) comprises at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of the total lipids in a suitable lipid solution by weight or mole. make up %. In some embodiments, the cholesterol-based lipid(s) comprises about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%) of the total lipids in a suitable lipid solution by weight or mole , about 35-45%, or about 35-40%).

PEGylated lipids

In some embodiments, a suitable lipid solution comprises one or more PGEylated lipids. For example, ceramides derived from polyethylene glycol (PEG)-modified phospholipids and N-octanoyl-sphingosine-l-[succinyl(methoxy polyethylene glycol)-2000](C8 PEG-2000 ceramide) (PEG) -CER) is also contemplated in the present invention. Contemplated PEG-modified lipids include polyethylene glycol chains of up to 2 kDa, up to 3 kDa, up to 4 kDa, or up to 5 kDa in length covalently linked to a lipid having an alkyl chain(s) of C ₆ -C ₂₀ length, but , but is not limited thereto. In some embodiments, the PEG-modified lipid or PEGylated lipid is PEGylated cholesterol or PEG-2K. For example, a suitable lipid solution may include a PEG-modified lipid such as 1,2-dimyristol-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2K). In some embodiments, particularly useful exchangeable lipids are PEG-ceramides with shorter acyl chains (eg, C ₁₄ or C ₁₈ ).

PEG-modified phospholipids and derivatized lipids constitute, by weight or mole, at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of the total lipids in a suitable lipid solution. can do. In some embodiments, the PEG-modified phospholipids and derivatized lipids comprise from about 0% to about 20%, from about 0.5% to about 20%, from about 1% to about 15%, about 1.5% of the total lipid present in the liposomal delivery vehicle. to about 5%. In some embodiments, the one or more PEG-modified lipids constitute about 1.5%, about 2%, about 3%, about 4%, or about 5% of the total lipids on a molar ratio basis. In some embodiments, the PEGylated lipid(s) comprises about 30-50% (e.g., about 30-45%, about 30-40%, about 35- 50%, about 35-45%, or about 35-40%).

Various combinations of lipids, including cationic lipids, non-cationic lipids, PEG-modified lipids, and optionally cholesterol, that can be used to prepare and include preformed lipid nanoparticles are described in the literature and herein. For example, suitable lipid solutions include: cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT5000, DOPE, cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, DPPC, cholesterol, and DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000, DPPC, cholesterol, and DMG-PEG2K; HGT5001, DPPC, cholesterol, and DMG-PEG2K; or ICE, DOPE, and DMG-PEG2K. Additional combinations of lipids are described in the art and are described, for example, in U.S. Patent Application Serial No. 62/420,421 (filed November 10, 2016), U.S. Patent Application Serial No. 62/421,021 (filed November 11, 2016) , U.S. Patent Application No. 62/464,327 (filed February 27, 2017), and in a PCT application filed November 10, 2017, entitled "Novel ICE-based Lipid Nanoparticle Formulation for Delivery of mRNA. and the disclosures of which are incorporated herein by reference in their entirety. Selection of cationic lipids, non-cationic lipids and/or PEG-modified lipids comprising the lipid mixture as well as the relative molar ratios of these lipids to each other will depend on the characteristics of the selected lipid(s) and the nature and characteristics of the mRNA to be encapsulated. based on Additional considerations include, for example, the saturation of the alkyl chain as well as the size, charge, pH, pKa, fusogenicity and toxicity of the selected lipid(s). Accordingly, the molar ratio can be appropriately adjusted.

mRNA-LNP formation

A method for forming LNPs encapsulating mRNA (mRNA-LNPs) by mixing an mRNA solution as described above with a lipid solution as described above to obtain a LNP forming solution suitable for mRNA-LNP formation has not been previously described. there is. For example, U.S. Pat. No. 9,668,980, entitled “Encapsulation of messenger RNA,” the disclosure of which is incorporated herein by reference in its entirety, cavulates messenger RNA into lipid nanoparticles by mixing the mRNA solution with the lipid solution. wherein the mRNA solution and/or the lipid solution are heated to a predetermined temperature above ambient temperature prior to mixing to form lipid nanoparticles encapsulating the mRNA. Alternatively, the mRNA solution and the lipid solution can be mixed into the LNP-forming solution to form mRNA-LNP without heating any one or more of the mRNA solution, the lipid solution, and the LNP-forming solution.

For certain cationic lipid nanoparticle formulations of mRNA, to enhance encapsulation of mRNA, the mRNA solution includes a citrate buffer. In some embodiments, the citrate buffered mRNA solution is heated to, for example, 65°C. In these methods, it is necessary to heat the mRNA solution (i.e., heating the separate components) before mixing the mRNA solution with the lipid solution, which is after mixing the mRNA solution and the lipid solution (after forming the nanoparticles). ) because it was found that heating the LNP-forming solution did not increase the encapsulation efficiency of mRNA in lipid nanoparticles. In some embodiments, one or both of the mRNA solution and the lipid solution are maintained and mixed at ambient temperature.

As used herein, the term “ambient temperature” refers to room temperature, or the temperature surrounding an object of interest in the absence of heating or cooling. In some embodiments, the ambient temperature at which one or more of the solutions are maintained is no greater than about 35°C, 30°C, 25°C, 20°C, or 16°C. In some embodiments, the ambient temperature at which one or more of the solutions are maintained is about 15-35 °C, about 15-30 °C, about 15-25 °C, about 15-20 °C, about 20-35 °C, about 25-35 °C , about 30-35°C, about 20-30°C, about 25-30°C, or about 20-25°C. In some embodiments, the ambient temperature at which one or more of the solutions are maintained is 20-25°C.

Thus, a given temperature above ambient temperature is generally greater than about 25°C. In some embodiments, a predetermined temperature suitable for the present invention is about 30° C., 37° C., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C., or 70° C. or higher. In some embodiments, a predetermined temperature suitable for the present invention is about 25-70°C, about 30-70°C, about 35-70°C, about 40-70°C, about 45-70°C, about 50-70°C, or It is in the range of about 60-70°C. In certain embodiments, a predetermined temperature suitable for the present invention is about 65°C.

In some embodiments, the mRNA solution or the lipid solution, or both, can be heated to a predetermined temperature above ambient temperature prior to mixing. In some embodiments, the mRNA solution and the lipid solution can be heated separately to a predetermined temperature prior to mixing. In some embodiments, the mRNA solution and the lipid solution are mixed at ambient temperature, but heated to a predetermined temperature after mixing. In some embodiments, the lipid solution is heated to a predetermined temperature and mixed with the mRNA solution at ambient temperature. In some embodiments, the mRNA solution is heated to a predetermined temperature and mixed with the lipid solution at ambient temperature.

In some embodiments, the mRNA solution is heated to the desired temperature by adding the mRNA stock solution at ambient temperature to the heated buffer to achieve the desired desired temperature.

In some embodiments, the lipid solution containing dissolved lipids may be heated to a predetermined temperature above ambient temperature prior to mixing. In some embodiments, the lipid solution containing the dissolved lipid may be separately heated to a predetermined temperature prior to mixing with the mRNA solution. In some embodiments, the lipid solution containing the dissolved lipid is mixed with the mRNA solution at ambient temperature, but heated to a predetermined temperature after mixing. In some embodiments, a lipid solution containing dissolved lipids is heated to a predetermined temperature and then mixed with an aqueous solution at ambient temperature. In some embodiments, heating the mRNA solution, lipid solution, or LNP-forming solution comprises mixing one or more lipids in the lipid solution with one or more mRNAs in the mRNA solution to generate mRNA (mRNA-LNP) encapsulated within the LNP in the LNP-forming solution. It does not occur before or after the forming step.

In some embodiments, the mRNA solution and the lipid solution are mixed using a pump. Because the encapsulation procedure with this mixing can be performed on a wide scale, different types of pumps can be used that can accommodate the desired scale. However, it is generally preferred to use a pulseless flow pump. As used herein, a pulseless flow pump refers to any pump capable of establishing continuous flow at a stable flow rate. Suitable types of pumps may include, but are not limited to, gear pumps and centrifugal pumps. Exemplary gear pumps include, but are not limited to, Cole-Parmer or Diener gear pumps. Exemplary centrifugal pumps include, but are not limited to, those manufactured by Grainger or Cole-Farmer.

The mRNA solution and the lipid solution can be mixed at various flow rates. In general, mRNA solutions can be mixed at a faster rate than lipid solutions. For example, the mRNA solution can be mixed at a rate at least 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 15x, or 20x faster than the rate of the lipid solution.

Appropriate flow rates for mixing can be determined on a scale basis. In some embodiments, the mRNA solution is about 40-400 ml/min, 60-500 ml/min, 70-600 ml/min, 80-700 ml/min, 90-800 ml/min, 100-900 ml/min , 110-1000 ml/min, 120-1100 ml/min, 130-1200 ml/min, 140-1300 ml/min, 150-1400 ml/min, 160-1500 ml/min, 170-1600 ml/min, 180-1700 ml/min, 150-250 ml/min, 250-500 ml/min, 500-1000 ml/min, 1000-2000 ml/min, 2000-3000 ml/min, 3000-4000 ml/min, or It is mixed at a flow rate ranging from 4000 to 5000 ml/min. In some embodiments, the mRNA solution is at about 200 ml/min, about 500 ml/min, about 1000 ml/min, about 2000 ml/min, about 3000 ml/min, about 4000 ml/min, or about 5000 ml/min. mixed at a flow rate of

In some embodiments, the lipid solution is about 25-75 ml/min, 20-50 ml/min, 25-75 ml/min, 30-90 ml/min, 40-100 ml/min, 50-110 ml/min , 75-200 ml/min, 200-350 ml/min, 350-500 ml/min, 500-650 ml/min, 650-850 ml/min, or 850-1000 ml/min. In some embodiments, the lipid solution is about 50 ml/min, about 100 ml/min, about 150 ml/min, about 200 ml/min, about 250 ml/min, about 300 ml/min, about 350 ml/min, about 400 ml/min, about 450 ml/min, about 500 ml/min, about 550 ml/min, about 600 ml/min, about 650 ml/min, about 700 ml/min, about 750 ml/min, about 800 ml/min, about 850 ml/min, about 900 ml/min, about 950 ml/min, or about 1000 ml/min.

drug formulation solution

In the present invention, a mixture of mRNA solution and lipid solution is mixed with an LNP-forming solution in which mRNA-encapsulated LNP is formed, and then the LNP-forming solution is exchanged with a solution constituting the final drug formulation solution (eg, 10% trehalose). , is based in part on the surprising finding that encapsulation of mRNA into LNPs can be further enhanced by heating some free mRNA that is not encapsulated in an LNP-forming solution, including a drug product formulation solution containing mRNA-LNP.

Exchanging the solution comprising mRNA-LNP from the LNP forming solution to the drug product formulation solution can be accomplished by any of a variety of buffer exchange techniques known in the art. For example, in some embodiments, the exchange of such solutions is accomplished by diafiltration. In some embodiments, exchanging the LNP-forming solution with the drug product formulation solution to provide mRNA-LNP in the drug product formulation solution involves purification and/or concentration of the mRNA-LNP. Various methods can be used to achieve solution exchange with purification of mRNA-LNP or concentration of mRNA-LNP in solution. In some embodiments, the solutions are exchanged and the mRNA-LNP is purified using tangential flow filtration. Tangential flow filtration (TFF), also referred to as cross -flow filtration, is a type of filtration in which the material to be filtered passes tangentially across the filter rather than through the filter. In TFF, the unwanted permeate passes through the filter, while the desired residues (mRNA-LNP and free mRNA) pass through the filter and are collected downstream. It is worth noting that the desired material is usually contained in the residue of the TFF, as opposed to what usually occurs in traditional dead-end filtration.

Depending on the material to be filtered, TFF is generally used for microfiltration or ultrafiltration. Microfiltration is generally defined as a filter having a pore size of 0.05 μm to 1.0 μm, whereas ultrafiltration generally includes filters having a pore size of less than 0.05 μm. The nominal molecular weight limit (NMWL), also referred to as the molecular weight cutoff (MWCO) for a particular filter, is also determined by the pore size, with microfiltration membranes typically having a NMWL greater than 1,000 kDa and ultrafiltration filters from 1 kDa to 1,000 kDa NMWL. has

The main advantage of tangential flow filtration is that during traditional "full" filtration, impermeable particles (sometimes referred to as "filter cake") that can aggregate and block the filter are rather carried along the surface of the filter. These advantages allow the widespread use of tangential flow filtration in industrial processes where continuous operation is required, as there is usually no need to remove and clean the filter, and thus downtime is significantly reduced.

Tangential flow filtration can be used for several purposes, including solution exchange, concentration, and purification, among others. Concentration is a process in which solvent is removed from solution while solute molecules remain. In order to effectively concentrate the sample, a membrane with a NMWL or MWCO substantially lower than the molecular weight of the solute molecule to be left is used. In general, one of ordinary skill in the art will be able to select a filter having a NMWL or MWCO that is 3 to 6 steps below the molecular weight of the target molecule(s).

Diafiltration is a fractionation process in which small, unwanted particles are passed through a filter and the desired larger nanoparticles remain in the residue without changing the concentration of these nanoparticles in solution. Diafiltration is often used to remove salts or reaction buffers from solutions. Diafiltration may be continuous or discontinuous. In the case of continuous diafiltration, the diafiltration solution is added to the sample feed at the same rate as the filtrate is produced. In the case of discontinuous diafiltration, the solution is first diluted and then concentrated back to the starting concentration. Discontinuous diafiltration can be repeated until the desired concentration of nanoparticles is reached.

The composition of the drug product formulation solution may include various ingredients found in the drug product formulation. For example, in some embodiments, the drug product formulation solution may include a buffer such as, for example, PBS.

In some embodiments, the drug product formulation solution may include a buffer or salt. Exemplary buffers may include HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, and sodium phosphate. Exemplary salts may include sodium chloride, magnesium chloride, and potassium chloride.

In some embodiments, the drug product formulation solution is an aqueous solution containing pharmaceutically acceptable excipients including, but not limited to, cryoprotectants. In some embodiments, the drug product formulation solution is an aqueous solution containing pharmaceutically acceptable excipients including, but not limited to, saccharides such as one or more of trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, the drug product formulation solution comprises trehalose. In some embodiments, the drug product formulation solution comprises sucrose. In some embodiments, the drug product formulation solution comprises mannose. In some embodiments, the drug product formulation solution comprises lactose. In some embodiments, the drug product formulation solution comprises mannitol.

In some embodiments, the drug product formulation solution is an aqueous solution comprising 5% to 20% (w/v) of a saccharide, such as trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, the drug product formulation solution is an aqueous solution comprising 5% to 20% (w/v) trehalose. In some embodiments, the drug product formulation solution is an aqueous solution comprising 5% to 20% (w/v) sucrose. In some embodiments, the drug product formulation solution is an aqueous solution comprising 5% to 20% (w/v) mannose. In some embodiments, the drug product formulation solution is an aqueous solution comprising 5% to 20% (w/v) lactose. In some embodiments, the drug product formulation solution is an aqueous solution comprising 5% to 20% (w/v) mannitol.

In some embodiments, the drug product formulation solution is an aqueous solution comprising about 10% (w/v) sugars such as trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, the drug product formulation solution is an aqueous solution comprising 10% (w/v) trehalose. In some embodiments, the drug product formulation solution is an aqueous solution comprising 10% (w/v) sucrose. In some embodiments, the drug product formulation solution is an aqueous solution comprising 10% (w/v) mannose. In some embodiments, the drug product formulation solution is an aqueous solution comprising 10% (w/v) lactose. In some embodiments, the drug product formulation solution is an aqueous solution comprising 10% (w/v) mannitol.

In some embodiments, one or both of the citrate and the non-aqueous solvent such as ethanol are absent in the drug product formulation solution. In some embodiments, the drug product formulation solution comprises only residual citrate. In some embodiments, the drug product formulation solution comprises only residual non-aqueous solvents, such as ethanol. In some embodiments, the drug product formulation solution contains less than about 10 mM (e.g., less than about 9 mM, about 8 mM, about 7 mM, about 6 mM, about 5 mM, about 4 mM, about 3 mM, less than about 2 mM, or about 1 mW) citrate. In some embodiments, the drug product formulation solution contains less than about 25% (e.g., about 20%, about 15%, about 10%, about 5%, about 4%, about 3%, about 2%, or less than about 1%) of a non-aqueous solvent such as ethanol. In some embodiments, the drug product formulation solution does not require any additional downstream processing (eg, buffer exchange and/or additional purification steps and/or additional excipients) prior to lyophilization. In some embodiments, the drug product formulation solution is subjected to any additional downstream processing (eg, buffer exchange and/or additional purification steps and/or additional excipients) prior to administration of a sterile fill to a vial, syringe, or other container. ) is not required. In some embodiments, the drug product formulation solution does not require any additional downstream processing (eg, buffer exchange and/or additional purification steps and/or additional excipients) prior to administration to a subject.

In some embodiments, the drug product formulation solution has a pH of between pH 4.5 and pH 7.5. In some embodiments, the drug product formulation solution has a pH of between pH 5.0 and pH 7.0. In some embodiments, the drug product formulation solution has a pH of between pH 5.5 and pH 7.0. In some embodiments, the drug product formulation solution has a pH greater than pH 4.5. In some embodiments, the drug product formulation solution has a pH greater than pH 5.0. In some embodiments, the drug product formulation solution has a pH greater than pH 5.5. In some embodiments, the drug product formulation solution has a pH greater than pH 6.0. In some embodiments, the drug product formulation solution has a pH greater than pH 6.5.

In some embodiments, the improved or enhanced encapsulation amount of mRNA-LNP in the drug product formulation solution after heating is maintained after subsequent freeze-thaw of the drug product formulation solution. In some embodiments, the drug product formulation solution is 10% trehalose and can be frozen stably.

In some embodiments, the mRNA-LNP in the drug product formulation solution after heating is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about It can be stably frozen in 45%, or about 50% trehalose solution (eg, maintains improved encapsulation). In some embodiments, the drug product formulation solution does not require any downstream purification or processing and can be stably stored in a frozen form.

Provided LNP encapsulating mRNA (mRNA-LNP)

The method according to the present invention shifts the therapeutic index in a positive direction by increasing the ability and efficacy to lower the dosage. In some embodiments, the method according to the invention produces a homogeneous and small particle size. In some embodiments, a method according to the invention produces a homogeneous and small particle size of 200 nm or less. In some embodiments, a method according to the present invention produces a homogeneous, small particle size of 150 nm or less. In some embodiments, the method according to the present invention not only produces a homogeneous and small particle size, but also significantly improves encapsulation efficiency and/or mRNA recovery compared to methods of the prior art.

Accordingly, the present invention provides a composition comprising the purified mRNA-encapsulated nanoparticles described herein. In some embodiments, the majority of the purified mRNA-encapsulated nanoparticles in the composition, i.e., about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% of the purified nanoparticles , 95%, 96%, 97%, 98%, or 99% is about 150 nm (eg, about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). In some embodiments, substantially all of the purified nanoparticles are about 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). According to the exemplary method described herein, lipid nanoparticle compositions are routinely obtained wherein the lipid nanoparticles have an average size of no more than about 150 nm, for example between 75 nm and 150 nm, in particular between 100 nm and 150 nm.

In addition, homogeneous nanoparticles with a narrow particle size range are achieved by the method of the present invention. For example, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the purified nanoparticles in a composition provided by the present invention is about 75%. -200 nm (e.g., about 75-150 nm, about 75-140 nm, about 75-135 nm, about 75-130 nm, about 75-125 nm, about 75-120 nm, about 75-115 nm, 75-110 nm, about 75-105 nm, about 75-100 nm, about 75-95 nm, about 75-90 nm, or about 75-85 nm). In some embodiments, substantially all of the purified nanoparticles are 75-200 nm (e.g., about 75-150 nm, about 75-140 nm, about 75-135 nm, about 75-130 nm, about 75- 125 nm, about 75-120 nm, about 75-115 nm, 75-110 nm, about 75-105 nm, about 75-100 nm, about 75-95 nm, about 75-90 nm, or about 75-85 nm ) has the size of the range.

In some embodiments, a measure of dispersibility, or molecular size heterogeneity (PDI), of nanoparticles in a composition provided by the present invention is less than about 0.23 (e.g., about 0.3, 0.2, 0.19, 0.18, 0.17, 0.16). , less than 0.15, 0.14, 0.13, 0.12, 0.11, 0.10, 0.09, or 0.08). According to the exemplary methods described herein, lipid nanoparticle compositions are routinely obtained having a PDI of about 0.15 or less, for example between about 0.01 and 0.15.

In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the nanoparticles in the compositions provided by the present invention are each individual particle. mRNA is encapsulated in In some embodiments, substantially all of the nanoparticles in the composition encapsulate mRNA within each individual particle.

In some embodiments, LNPs according to the present invention contain at least about 1 mg, 5 mg, 10 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA. In some embodiments, according to a method according to the present invention, about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% Excess mRNA is recovered.

In some embodiments, a composition according to the present invention is formulated so that a dosage can be administered to a subject. In some embodiments, the composition of mRNA-encapsulated LNP as described herein is less than 1.0 mg/kg mRNA lipid nanoparticles (e.g., 0.6 mg, 0.5 mg, 0.3 mg, 0.016 mg/kg mRNA lipid nanoparticles) mg, 0.05 mg, and 0.016 mg). In some embodiments, the dosage is reduced due to the unexpected discovery that even lower dosages yield high efficacy and efficacy. In some embodiments, the dosage is reduced by about 70%, 65%, 60%, 55%, 50%, 45%, or 40%.

In some embodiments, the ability of the mNRA-encapsulated LNPs produced by the present invention is greater than 100% (i.e. greater than 200%, greater than 300%, greater than 400%, greater than 500%, greater than 600%, greater than 700%, greater than 800%, or greater than 900%) to greater than 1000%.

Example

Although specific compounds, compositions, and methods of the present invention have been specifically described with respect to certain embodiments, the following examples serve only to illustrate the invention and are not intended to be limiting.

lipid substance

The formulations described in the following examples, unless otherwise specified, contain one or more cationic lipids, helper lipids (eg, non-cationic lipids and/or cholesterol lipids) designed to encapsulate various nucleic acid substances such as those discussed above; and multicomponent lipid mixtures in varying proportions in which pegylated lipids are used.

Example 1. Encapsulation of mRNA in lipid nanoparticles enhanced by the additional step of heating the drug product formulation solution

This example improves the encapsulation of mRNA in lipid nanoparticles by applying method A, then exchanging the LNP forming solution containing mRNA-LNP and free mRNA with the drug product formulation solution, and heating the drug product solution An exemplary method of the present invention for making As used herein, Method A is, for example, without preformation of lipids into lipid nanoparticles, as described in U.S. Provisional Patent Application No. 2018/0008680, which is incorporated herein by reference in its entirety, and mRNA refers to the conventional method of encapsulating mRNA by mixing with a lipid mixture.

An exemplary formulation method A is shown in FIG. 1 . In this method, in some embodiments, a lipid solution in which the LNP component lipid is dissolved (eg, a solution comprising ethanol) and an aqueous mRNA solution (containing citrate at pH 4.5) were prepared separately. In particular, a lipid (cationic lipid, helper lipid, zwitterionic lipid, PEG lipid, etc.) solution was prepared by dissolving the lipid in ethanol. The mRNA solution was prepared by dissolving the mRNA in a citrate buffer to produce the mRNA in a citrate buffer at pH 4.5. Then both mixtures were heated to 65° C. prior to mixing. The two solutions were then mixed using a pump system to provide mRNA-encapsulated LNPs in an LNP-forming solution comprising a mixture of a lipid solution and an mRNA solution. In some cases, a gear pump system was used to mix the two solutions. In certain embodiments, the two solutions are mixed using a “T” adapter (or “Y” adapter).

Then, the LNP-forming solution containing mRNA-LNP and free mRNA was diafiltered by TFF method. As part of this method, the LNP forming solution was removed and replaced with a drug product formulation solution containing 10% trehalose. Then, as shown in FIG . 2 , the resulting mRNA-LNP and free mRNA in the drug formulation solution were heated to 65° C. for 15 minutes. After heating, mRNA-LNP and free mRNA in the drug formulation solution were cooled and stored at 2-8° C. for subsequent analysis.

As outlined in Figure 2 , the encapsulation method described above was performed for 12 different mRNA-LNPs as described more specifically in Table 1 below. For each test article, the amount of mRNA encapsulated in the LNP formed in the drug product formulation solution of 10% trehalose was measured before and after heating using the kit RiboGreen assay for measuring free RNA according to the published method, Calculations were then performed to determine encapsulated mRNA. In addition, the amount of mRNA encapsulated in the LNP formed in the drug product formulation was measured after subsequent freeze-thaw using the same assay, so that the enhanced encapsulation observed when the mRNA-LNP was heated was comparable to that of the subsequent freeze-thaw of the mRNA-LNP. It was determined whether the overall consistency was maintained.

mRNA-LNP prepared according to the present invention Test Items cationic lipids LNP Lipid Ratio (Cationic Lipid: PEG-Modified Lipid: Cholesterol: DOPE) mRNA Encapsulation rate before heating (%) Encapsulation rate after heating (%) Encapsulation rate after freeze-thaw (%) Size before heating (nm)/PDI Size after heating (nm)/PDI One Cationic Lipid #1 40: 1.5: 28.5: 30 FFL 31.6 78.8 do not check 220.3/0.149 236/0.129 2 Cationic Lipid #2 40:3:25:32 OTC 69.9 90.6 do not check 114.9/0.1 114.7/0.08 3 Cationic Lipid #3 20: 1.5: 48.5: 30 EPO 75 80 do not check 134/0.378 125.1/0.213 4 Cationic Lipid #3 20: 1.5: 48.5: 30 FFL 54 69 do not check 145.7/0.373 133.6/0.207 5 Cationic Lipid #4 20: 1.5: 48.5: 30 EPO 35 69 do not check 125.3/0.088 130.7/0.106 6 Cationic Lipid #4 20: 1.5: 48.5: 30 FFL 25 58 do not check 134.6/0.132 137.9/0.117 7 Cationic Lipid #5 40:3:25:32 OTC 35 91 67.7 120/0.20 118.5/0.218 8 Cationic Lipid #5 40:5:25:30 OTC 14.2 77.9 64.9 172.2/0.215 120.3/0.1 9 Cationic Lipid #6 40:5:25:30 EPO 58.5 73.1 75.3 116.3/0.173 117.3/0.15 10 Cationic Lipid #6 40:5:25:30 FFL 46.3 52.7 52.2 153.8/0.168 150.9/0.169 11 Cationic Lipid #7 20: 1.5: 48.5: 30 EPO 29.3 77 62.8 161.9/0.035 141.2/0.024 12 Cationic Lipid #7 20: 1.5: 48.5: 30 FFL 13.9 66 55 180.5/0.028 147.4/0.041

As shown in Table 1 and Figure 3 , the encapsulation rate (%) of the mRNA encapsulated in the LNP formed in the same drug formulation solution was compared to immediately before heating. It was significant after heating. In addition, this enhanced encapsulation was maintained even after subsequent freeze-thaw of mRNA-LNP in the same drug product formulation solution.

Taken together, the data of this Example show that encapsulation for mRNA-encapsulated lipid nanoparticles in drug product formulation solution produced by Method A increases substantially after heating.

Example 2. In vivo expression of hEPO delivered by mRNA-LNP after heating the drug formulation solution

This example confirms that encapsulation for mRNA-encapsulated lipid nanoparticles in the drug product formulation solution, produced by method A, increases substantially after heating. In addition, the data of this Example show the in vivo expression of hEPO in mice after administration of human EPO (hEPO) mRNA encapsulated in lipid nanoparticles prepared according to the present invention.

In this Example, as described in Example 1 , hEPO mRNA was Encapsulated in the indicated lipid nanoparticles. For each test article, the amount of mRNA encapsulated in the LNP formed in the drug product formulation solution of 10 mM citrate in 10% sucrose was measured before and after heating using the method described in Example 1.

As shown in Table 2 , the encapsulation rate (%) of mRNA encapsulated in the LNP formed in the same drug product formulation solution was for all test items evaluated (each containing different cationic lipids) compared to immediately before heating. It was significant after heating the drug product formulation solution.

Then, after heating the drug formulation, a single dose of 1 μg/30 μL of hEPO mRNA encapsulated lipid nanoparticles produced by method A was administered to mice via the intramuscular route. Serum levels of hEPO protein were measured at 6 and 24 hours after administration.

The level of hEPO protein in the serum of mice after treatment can be used to evaluate the efficacy of mRNA by different delivery methods. As shown in Table 2 , the intramuscularly injected hEPO mRNA lipid nanoparticle formulation produced high levels of hEPO protein.

Characterization of mRNA-LNP prepared according to the present invention and in vivo manifestation composition Size (nm) PDI EE before heating EE after heating EPO at 6 hours (ng/mL) 24 hour difference EPO (ng/mL) MATE-GLA4-E16: DMG-PEG: Cholesterol: DOPE 40:1.5:28.5:30 117 0.18 46% 67% 2.89±0.89 1.54± 0.33 MATE-Suc2-E18:2: C8PEG2-ceramide:cholesterol:DOPE 40:1.5:28.5:30 122 0.48 50% 73% 5.20±0.39 1.17± 0.21 MATE-Suc2-E14: C8PEG2-Ceramide: Cholesterol: DOPE 40:1.5:13.5:45 119 0.12 63% 75% 10.33± 0.74 4.10± 0.27

Example 3. In vivo expression of mRNA delivered by pulmonary administration

This example confirms that the encapsulation for mRNA-encapsulated lipid nanoparticles in the drug product formulation solution produced by method A increases substantially after heating, which is applicable to a wide variety of cationic lipids. there is. In addition, the data of this Example show the in vivo expression of mRNA in mice after lung administration of mRNA encapsulated in lipid nanoparticles prepared according to the present invention.

In this example, as described in Example 1, mRNA was Encapsulated in the indicated lipid nanoparticles. For each test article, the amount of mRNA encapsulated in the LNP formed in the drug product formulation was measured before and after heating using the method described in Example 1.

Characterization of mRNA-LNP prepared according to the present invention Sample cationic lipids Composition (DMG-PEG2000: cationic lipid: cholesterol: DOPE) Size (nm) PDI EE before heating (%) EE after heating (%) A VD-3-DMA 5:40:25:30 66.88 0.19 53 80.9 B Cationic Lipid #8 5:60:0:35 68 0.127 57 92 C Cationic Lipid #9 5:60:0:35 55 0.178 56 77 D Cationic Lipid #10 5:40:25:30 72.09 0.13 29 93 E Cationic Lipid #11 5:60:0:35 63 0.201 49 86 F TL1-10D-PIP 3:40:25:32 143.2 0.244 63.8 76 G Cationic Lipid #12 5:60:0:35 71.9 0.193 58 64 H Cationic Lipid #13 5:60:0:35 64.8 0.152 55.0 89.4 I Cationic Lipid #14 5:60:0:35 61.1 0.14 53.0 88.2 J Cationic Lipid #15 5:60:0:35 55 0.224 58 68 K Cationic Lipid #16 5:60:0:35 50 0.171 44 89 L Cationic Lipid #17 5:40:25:30 53 0.204 59 89 M Cationic Lipid #18 5:40:25:30 50 0.258 55 96

As shown in Table 3 and Figure 4 , the encapsulation rate (%) of mRNA encapsulated in the LNP formed in the same drug product formulation solution was compared with immediately before heating for all test items evaluated (each containing different cationic lipids). ) was significant after heating the drug product formulation solution.

Then, 10 μg of mRNA-LNP prepared by method A was administered to mice via pulmonary delivery after heating the drug formulation. The fluorescence level of the expressed protein was measured 24 hours after administration. The resulting protein expression of the delivered mRNA was measured in units of p/s/cm ² /sr as shown in FIG . 5 . The data show that mRNA lipid nanoparticle formulations administered by pulmonary delivery resulted in high levels of protein expression.

Taken together, the data of this example show that the mRNA-LNP prepared by the present invention results in high encapsulation efficiency, which translates into high expression and efficacy.

equivalent

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is not intended that the scope of the invention be limited to the foregoing description, but rather is as set forth in the appended claims.

SEQUENCE LISTING <110> Translate Bio, Inc. <120> IMPROVED PROCESS OF PREPARING MRNA-LOADED LIPID NANOPARTICLES <130> MRT-2085WO <140> PCT/US20/32943 <141> 2020-05-14 <150> 62/847,837 <151> 2019-05-14 <160 > 5 <170> PatentIn version 3.5 <210> 1 <211> 1065 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <400> 1 augcuguuca accuucggau cuugcugaac aacgcugcgu uccggaaugg ucacaacuuc 60 acuugguccgga acuucagaug cggccagggg 120 gaccuccuca cccugaaaaa cuucaccgga gaagagauca aguacaugcu guggcuguca 180 gccgaccuca aauuccggau caagcagaag ggcgaauacc uuccuuugcu gcagggaaag 240 ucccugggga ugaucuucga gaagcgcagc acucgcacua gacugucaac ugaaaccggc 300 uucgcgcugc ugggaggaca ccccugcuuc cugaccaccc aagauaucca ucugggugug 360 aacgaauccc ucaccgacac agcgcgggug cugucgucca uggcagacgc gguccucgcc 420 cgcguguaca agcagucuga ucuggacacu cuggccaagg aagccuccau uccuaucauu 480 aauggauugu ccgaccucua ccaucccauc cagauucugg ccgauuaucu gacucugcaa 540 gaacauuaca gcucccugaa ggggcuuacc cuuucgugga ucggcgacgg caacaacauu 600 cugcacagc a uuaugaugag cgcugccaag uuuggaaugc accuccaagc agcgaccccg 660 aagggauacg agccagacgc cuccgugacg aagcuggcug agcaguacgc caaggagaac 720 ggcacuaagc ugcugcucac caacgacccu cucgaagccg cccacggugg caacgugcug 780 aucaccgaua ccuggaucuc caugggacag gaggaggaaa agaagaagcg ccugcaagca 840 uuucaggggu accaggugac uaugaaaacc gccaaggucg ccgccucgga cuggaccuuc 900 uugcacuguc ugcccagaaa gcccgaagag guggacgacg agguguucua cagcccgcgg 960 ucgcuggucu uuccggaggc cgaaaacagg aaguggacua ucauggccgu gauggugucc 1020 cugcugaccg auuacucccc gcagcugcag aaaccaaagu ucuga 1065 <210> 2 <211> 1239 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <400> 2 augagcagca agggcagcgu gguggcugggcc uacaggcugggcc uacagcggcg accugaguga cugagcggcg gccaggac ccgcaagaag gcccugaagc ugggcgccaa gaagguguuc 180 aucgaggacg ugagccgcga guucguggag gaguucaucu ggcccgccau ccagagcagc 240 gcccuguacg aggaccgcua ccugcugggc accagcc caucugguggaga accagccugg cccgccccug ucgccca gcgcgagggc gccaaguacg ugagccacgg cgccaccggc 360 aagggcaacg accaggugcg cuucgagcug agcugcuaca gccuggcccc ccagaucaag 420 gugaucgccc ccuggcgcau gcccgaguuc uacaaccgcu ucaagggccg caacgaccug 480 auggaguacg ccaagcagca cggcaucccc auccccguga cccccaagaa ccccuggagc 540 auggacgaga accugaugca caucagcuac gaggccggca uccuggagaa ccccaagaac 600 caggcccccc ccggccugua caccaagacc caggaccccg ccaaggcccc caacaccccc 660 gacauccugg agaucgaguu caagaagggc gugcccguga aggugaccaa cgugaaggac 720 ggcaccaccc accagaccag ccuggagcug uucauguacc ugaacgaggu ggccggcaag 780 cacggcgugg gccgcaucga caucguggag aaccgcuuca ucggcaugaa gagccgcggc 840 aucuacgaga cccccgccgg caccauccug uaccacgccc accuggacau cgaggccuuc 900 accauggacc gcgaggugcg caagaucaag cagggccugg gccugaaguu cgccgagcug 960 guguacaccg gcuucuggca cagccccgag ugcgaguucg ugcgccacug caucgccaag 1020 agccaggagc gcguggaggg caaggugcag gugagcgugc ugaagggcca gguguacauc 1080 cugggccgcg agagcccccu gagccuguac aacgaggagc uggugagcau gaacgugcag 1140 ggcgacuacg agcccaccga cgccaccgg c uucaucaaca ucaacagccu gcgccugaag 1200 gaguaccacc gccugcagag caaggugacc gccaaguga 1239 <210> 3 <211> 4443 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <400> 3 augcaacgcu cuccucuuga aguggugacca augcacua guggu cugga caugcag c uguccgauau cuaucaaauc 120 ccuuccgugg acuccgcgga caaccugucc gagaagcucg agagagaaug ggacagagaa 180 cucgccucaa agaagaaccc gaagcugauu aaugcgcuua ggcggugcuu uuucuggcgg 240 uucauguucu acggcaucuu ccucuaccug ggagagguca ccaaggccgu gcagccccug 300 uugcugggac ggauuauugc cuccuacgac cccgacaaca aggaagaaag aagcaucgcu 360 aucuacuugg gcaucggucu gugccugcuu uucaucgucc ggacccucuu guugcauccu 420 gcuauuuucg gccugcauca cauuggcaug cagaugagaa uugccauguu uucccugauc 480 uacaagaaaa cucugaagcu cucgagccgc gugcuugaca agauuuccau cggccagcuc 540 gugucccugc ucuccaacaa ucugaacaag uucgacgagg gccucgcccu ggcccacuuc 600 guguggaucg ccccucugca aguggcgcuu cugaugggcc ugaucuggga gcugcugcaa 660 gccucggca cacuguucca ggccggacug 720 gggcggauga ugaugaagua cagggaccag agagccggaa agauuuccga acggcuggug 780 aucacuucgg aaaugaucga aaacauccag ucagugaagg ccuacugcug ggaagaggcc 840 auggaaaaga ugauugaaaa ccuccggcaa accgagcuga agcugacccg caaggccgcu 900 uacgugcgcu auuucaacuc guccgcuuuc uucuucuccg gguucuucgu gguguuucuc 960 uccgugcucc ccuacgcccu gauuaaggga aucauccuca ggaagaucuu caccaccauu 1020 uccuucugua ucgugcuccg cauggccgug acccggcagu ucccaugggc cgugcagacu 1080 ugguacgacu cccugggagc cauuaacaag auccaggacu uccuucaaaa gcaggaguac 1140 aagacccucg aguacaaccu gacuacuacc gaggucguga uggaaaacgu caccgccuuu 1200 ugggaggagg gauuuggcga acuguucgag aaggccaagc agaacaacaa caaccgcaag 1260 accucgaacg gugacgacuc ccucuucuuu ucaaacuuca gccugcucgg gacgcccgug 1320 cugaaggaca uuaacuucaa gaucgaaaga ggacagcucc uggcgguggc cggaucgacc 1380 ggagccggaa agacuucccu gcugauggug aucaugggag agcuugaacc uagcgaggga 1440 aagaucaagc acuccggccg caucagcuuc uguagccagu uuuccuggau caugcccgga 1500 accauuaagg aaaacaucau cuucggcgug uccuacgaug aauaccgcua ccgguccgug 1560 aucaaagccu gccagcugga agaggauauu ucaaaguucg cggagaaaga uaacaucgug 1620 cugggcgaag gggguauuac cuugucgggg ggccagcggg cuagaaucuc gcuggccaga 1680 gccguguaua aggacgccga ccuguaucuc cuggacuccc ccuucggaua ccuggacguc 1740 cugaccgaaa aggagaucuu cgaaucgugc gugugcaagc ugauggcuaa caagacucgc 1800 auccucguga ccuccaaaau ggagcaccug aagaaggcag acaagauucu gauucugcau 1860 gagggguccu ccuacuuuua cggcaccuuc ucggaguugc agaacuugca gcccgacuuc 1920 ucaucgaagc ugauggguug cgacagcuuc gaccaguucu ccgccgaaag aaggaacucg 1980 auccugacgg aaaccuugca ccgcuucucu uuggaaggcg acgccccugu gucauggacc 2040 gagacuaaga agcagagcuu caagcagacc ggggaauucg gcgaaaagag gaagaacagc 2100 aucuugaacc ccauuaacuc cauccgcaag uucucaaucg ugcaaaagac gccacugcag 2160 augaacggca uugaggagga cuccgacgaa ccccuugaga ggcgccuguc ccuggugccg 2220 gacagcgagc agggagaagc cauccugccu cggauuuccg ugaucuccac ugguccgacg 2280 cuccaagccc ggcggcggca guccgugcug aaccugauga cccacagcgu gaaccagggc 2340 caaaacauuc accgcaagac uaccgcaucc acccggaaag ugucccuggc accuc aagcg 2400 aaucuuaccg agcucgacau cuacucccgg agacugucgc aggaaaccgg gcucgaaauu 2460 uccgaagaaa ucaacgagga ggaucugaaa gagugcuucu ucgacgauau ggagucgaua 2520 cccgccguga cgacuuggaa cacuuaucug cgguacauca cugugcacaa gucauugauc 2580 uucgugcuga uuuggugccu ggugauuuuc cuggccgagg ucgcggccuc acugguggug 2640 cucuggcugu ugggaaacac gccucugcaa gacaagggaa acuccacgca cucgagaaac 2700 aacagcuaug ccgugauuau cacuuccacc uccucuuauu acguguucua caucuacguc 2760 ggaguggcgg auacccugcu cgcgaugggu uucuucagag gacugccgcu gguccacacc 2820 uugaucaccg ucagcaagau ucuucaccac aagauguugc auagcgugcu gcaggccccc 2880 auguccaccc ucaacacucu gaaggccgga ggcauucuga acagauucuc caaggacauc 2940 gcuauccugg acgaucuccu gccgcuuacc aucuuugacu ucauccagcu gcugcugauc 3000 gugauuggag caaucgcagu gguggcggug cugcagccuu acauuuucgu ggccacugug 3060 ccggucauug uggcguucau caugcugcgg gccuacuucc uccaaaccag ccagcagcug 3120 aagcaacugg aauccgaggg acgauccccc aucuucacuc accuugugac gucguugaag 3180 ggacugugga cccuccgggc uuucggacgg cagcccuacu ucgaaacccu cuuccacaag 3240 gcccugaacc uccacaccgc caauugguuc cuguaccugu ccacccugcg gugguuccag 3300 augcgcaucg agaugauuuu cgucaucuuc uucaucgcgg ucacauucau cagcauccug 3360 acuaccggag agggagaggg acgggucgga auaauccuga cccucgccau gaacauuaug 3420 agcacccugc agugggcagu gaacagcucg aucgacgugg acagccugau gcgaagcguc 3480 agccgcgugu ucaaguucau cgacaugccu acugagggaa aacccacuaa guccacuaag 3540 cccuacaaaa auggccagcu gagcaagguc augaucaucg aaaacuccca cgugaagaag 3600 gacgauauuu ggcccuccgg aggucaaaug accgugaagg accugaccgc aaaguacacc 3660 gagggaggaa acgccauucu cgaaaacauc agcuucucca uuucgccggg acagcggguc 3720 ggccuucucg ggcggaccgg uuccgggaag ucaacucugc ugucggcuuu ccuccggcug 3780 cugaauaccg agggggaaau ccaaauugac ggcgugucuu gggauuccau uacucugcag 3840 caguggcgga aggccuucgg cgugaucccc cagaaggugu ucaucuucuc ggguaccuuc 3900 cggaagaacc uggauccuua cgagcagugg agcgaccaag aaaucuggaa ggucgccgac 3960 gaggucggcc ugcgcuccgu gauugaacaa uuuccuggaa agcuggacuu cgugcucguc 4020 gacgggggau guguccuguc gcacggacau aagcagcuca ugugccucgc acgguccgug 4080 c ucuccaagg ccaagauucu gcugcuggac gaaccuucgg cccaccugga uccggucacc 4140 uaccagauca ucaggaggac ccugaagcag gccuuugccg auugcaccgu gauucucugc 4200 gagcaccgca ucgaggccau gcuggagugc cagcaguucc uggucaucga ggagaacaag 4260 guccgccaau acgacuccau ucaaaagcuc cucaacgagc ggucgcuguu cagacaagcu 4320 auuucaccgu ccgauagagu gaagcucuuc ccgcaucgga acagcucaaa gugcaaaucg 4380 aagccgcaga ucgcagccuu gaaggaagag acugaggaag aggugcagga cacccggcuu 4440 uaa 4443 <210> 4 <211 > 4443 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <400> 4 augcagcggu ccccgcucga aaaggccagu gucgugucca aacucuucuu cucauggacu 60 cggccuaucc uuagaaaggg guaucggcag aggcuugagu ugucugacau cuaccagauc 120 cccucgguag auucggcgga uaaccucucg gagaagcucg aacgggaaug ggaccgcgaa 180 cucgcgucua agaaaaaccc gaagcucauc aacgcacuga gaaggugcuu cuucuggcgg 240 uucauguucu acgguaucuu cuuguaucuc ggggagguca caaaagcagu ccaaccccug 300 uuguuggguc gcauuaucgc cucguacgac cccgauaaca aagaagaacg gagcaucgcg 360 aucuaccucg ggaucggacu guguuugcuu u cacuuuu guugcaucca 420 gcaaucuucg gccuccauca caucgguaug cagaugcgaa ucgcuauguu uagcuugauc 480 uacaaaaaga cacugaaacu cucgucgcgg guguuggaua agauuuccau cggucaguug 540 gugucccugc uuaguaauaa ccucaacaaa uucgaugagg gacuggcgcu ggcacauuuc 600 guguggauug ccccguugca agucgcccuu uugaugggcc uuauuuggga gcuguugcag 660 gcaucugccu uuuguggccu gggauuucug auuguguugg cauuguuuca ggcugggcuu 720 gggcggauga ugaugaagua ucgcgaccag agagcgggua aaaucucgga aagacucguc 780 aucacuucgg aaaugaucga aaacauccag ucggucaaag ccuauugcug ggaagaagcu 840 auggagaaga ugauugaaaa ccuccgccaa acugagcuga aacugacccg caaggcggcg 900 uauguccggu auuucaauuc gucagcguuc uucuuuuccg gguucuucgu ugucuuucuc 960 ucgguuuugc cuuaugccuu gauuaagggg auuauccucc gcaagauuuu caccacgauu 1020 ucguucugca uuguauugcg cauggcagug acacggcaau uuccgugggc cgugcagaca 1080 ugguaugacu cgcuuggagc gaucaacaaa auccaagacu ucuugcaaaa gcaagaguac 1140 aagacccugg aguacaaucu uacuacuacg gagguaguaa uggagaaugu gacggcuuuu 1200 ugggaagagg guuuuggaga acuguuugag aaagcaaagc agaauaacaa caaccgca ag 1260 accucaaaug gggacgauuc ccuguuuuuc ucgaacuucu cccugcucgg aacacccgug 1320 uugaaggaca ucaauuucaa gauugagagg ggacagcuuc ucgcgguagc gggaagcacu 1380 ggugcgggaa aaacuagccu cuugauggug auuauggggg agcuugagcc cagcgagggg 1440 aagauuaaac acuccgggcg uaucucauuc uguagccagu uuucauggau caugcccgga 1500 accauuaaag agaacaucau uuucggagua uccuaugaug aguaccgaua cagaucgguc 1560 auuaaggcgu gccaguugga agaggacauu ucuaaguucg ccgagaagga uaacaucguc 1620 uugggagaag gggguauuac auugucggga gggcagcgag cgcggaucag ccucgcgaga 1680 gcgguauaca aagaugcaga uuuguaucug cuugauucac cguuuggaua ccucgacgua 1740 uugacagaaa aagaaaucuu cgagucgugc guguguaaac uuauggcuaa uaagacgaga 1800 auccugguga caucaaaaau ggaacaccuu aagaaggcgg acaagauccu gauccuccac 1860 gaaggaucgu ccuacuuuua cggcacuuuc ucagaguugc aaaacuugca gccggacuuc 1920 ucaagcaaac ucauggggug ugacucauuc gaccaguuca gcgcggaacg gcggaacucg 1980 aucuugacgg aaacgcugca ccgauucucg cuugagggug augccccggu aucguggacc 2040 gagacaaaga agcagucguu uaagcagaca ggagaauuug gugagaaaag aaagaacagu 210 0 aucuugaauc cuauuaacuc aauucgcaag uucucaaucg uccagaaaac uccacugcag 2160 augaauggaa uugaagagga uucggacgaa ccccuggagc gcaggcuuag ccucgugccg 2220 gauucagagc aaggggaggc cauucuuccc cggauuucgg ugauuucaac cggaccuaca 2280 cuucaggcga ggcgaaggca auccgugcuc aaccucauga cgcauucggu aaaccagggg 2340 caaaacauuc accgcaaaac gacggccuca acgagaaaag ugucacuugc accccaggcg 2400 aauuugacug aacucgacau cuacagccgu aggcuuucgc aagaaaccgg acuugagauc 2460 agcgaagaaa ucaaugaaga agauuugaaa gaguguuucu uugaugacau ggaaucaauc 2520 ccagcgguga caacguggaa cacauacuug cguuacauca cggugcacaa guccuugauu 2580 uucguccuca ucuggugucu cgugaucuuu cucgcugagg ucgcagcguc acuugugguc 2640 cucuggcugc uugguaauac gcccuugcaa gacaaaggca auucuacaca cucaagaaac 2700 aauuccuaug ccgugauuau cacuucuaca agcucguauu acguguuuua caucuacgua 2760 ggaguggccg acacucugcu cgcgaugggu uucuuccgag gacucccacu cguucacacg 2820 cuuaucacug ucuccaagau ucuccaccau aagaugcuuc auagcguacu gcaggcuccc 2880 auguccaccu ugaauacgcu caaggcggga gguauuuuga aucgcuucuc aaaagauauu 2940 gcaa uuuugg augaccuucu gccccugacg aucuucgacu ucauccaguu guugcugauc 3000 gugauugggg cuauugcagu agucgcuguc cuccagccuu acauuuuugu cgcgaccguu 3060 ccggugaucg uggcguuuau caugcugcgg gccuauuucu ugcagacguc acagcagcuu 3120 aagcaacugg agucugaagg gaggucgccu aucuuuacgc aucuugugac caguuugaag 3180 ggauugugga cguugcgcgc cuuuggcagg cagcccuacu uugaaacacu guuccacaaa 3240 gcgcugaauc uccauacggc aaauugguuu uuguauuuga guacccuccg augguuucag 3300 augcgcauug agaugauuuu ugugaucuuc uuuaucgcgg ugacuuuuau cuccaucuug 3360 accacgggag agggcgaggg acgggucggu auuauccuga cacucgccau gaacauuaug 3420 agcacuuugc agugggcagu gaacagcucg auugaugugg auagccugau gagguccguu 3480 ucgagggucu uuaaguucau cgacaugccg acggagggaa agcccacaaa aaguacgaaa 3540 cccuauaaga augggcaauu gaguaaggua augaucaucg agaacaguca cgugaagaag 3600 gaugacaucu ggccuagcgg gggucagaug accgugaagg accugacggc aaaauacacc 3660 gagggaggga acgcaauccu ugaaaacauc ucguucagca uuagccccgg ucagcgugug 3720 ggguugcucg ggaggaccgg gucaggaaaa ucgacguugc ugucggccuu cuugagacuu 3780 cugaauacag agggugagau ccagaucgac ggcguuucgu gggauagcau caccuugcag 3840 caguggcgga aagcguuugg aguaaucccc caaaaggucu uuaucuuuag cggaaccuuc 3900 cgaaagaauc ucgauccuua ugaacagugg ucagaucaag agauuuggaa agucgcggac 3960 gagguuggcc uucggagugu aaucgagcag uuuccgggaa aacucgacuu uguccuugua 4020 gaugggggau gcguccuguc gcaugggcac aagcagcuca ugugccuggc gcgauccguc 4080 cucucuaaag cgaaaauucu ucucuuggau gaaccuucgg cccaucugga cccgguaacg 4140 uaucagauca ucagaaggac acuuaagcag gcguuugccg acugcacggu gauucucugu 4200 gagcaucgua ucgaggccau gcucgaaugc cagcaauuuc uugucaucga agagaauaag 4260 guccgccagu acgacuccau ccagaagcug cuuaaugaga gaucauuguu ccggcaggcg 4320 auuucaccau ccgauagggu gaaacuuuuu ccacacagaa auucgucgaa gugcaagucc 4380 aaaccgcaga ucgcggccuu gaaagaagag acugaagaag aaguucaaga cacgcgucuu 4440 uaa 4443 <210> 5 <211> 1359 <212> RNA <213> Artificial Sequence <220> <223 > Synthetic polynucleotide <400> 5 augagcaccg ccgugcugga gaaccccggc cugggccgca agcugagcga cuucggccag 60 gagaccagcu acaucgagga caacugcaac cagaacggcg ccaucag ccu gaucuucagc 120 cugaaggagg aggugggcgc ccuggccaag gugcugcgcc uguucgagga gaacgacgug 180 aaccugaccc acaucgagag ccgccccagc cgccugaaga aggacgagua cgaguucuuc 240 acccaccugg acaagcgcag ccugcccgcc cugaccaaca ucaucaagau ccugcgccac 300 gacaucggcg ccaccgugca cgagcugagc cgcgacaaga agaaggacac cgugcccugg 360 uucccccgca ccauccagga gcuggaccgc uucgccaacc agauccugag cuacggcgcc 420 gagcuggacg ccgaccaccc cggcuucaag gaccccgugu accgcgcccg ccgcaagcag 480 uucgccgaca ucgccuacaa cuaccgccac ggccagccca ucccccgcgu ggaguacaug 540 gaggaggaga agaagaccug gggcaccgug uucaagaccc ugaagagccu guacaagacc 600 cacgccugcu acgaguacaa ccacaucuuc ccccugcugg agaaguacug cggcuuccac 660 gaggacaaca ucccccagcu ggaggacgug agccaguucc ugcagaccug caccggcuuc 720 cgccugcgcc ccguggccgg ccugcugagc agccgcgacu uccugggcgg ccuggccuuc 780 cgcguguucc acugcaccca guacauccgc cacggcagca agcccaugua cacccccgag 840 cccgacaucu gccacgagcu gcugggccac gugccccugu ucagcgaccg cagcuucgcc 900 caguucagcc aggagaucgg ccuggccagc cugggcgccc ccgacgagua caucgagaag 960 c uggccacca ucuacugguu caccguggag uucggccugu gcaagcaggg cgacagcauc 1020 aaggccuacg gcgccggccu gcugagcagc uucggcgagc ugcaguacug ccugagcgag 1080 aagcccaagc ugcugccccu ggagcuggag aagaccgcca uccagaacua caccgugacc 1140 gaguuccagc cccuguacua cguggccgag agcuucaacg acgccaagga gaaggugcgc 1200 aacuucgccg ccaccauccc ccgccccuuc agcgugcgcu acgaccccua cacccagcgc 1260 aucgaggugc uggacaacac ccagcagcug aagauccugg ccgacagcau caacagcgag 1320aucggcaucc ugugcagcgc ccugcagaag aucaaguaa 1359

Claims (27)

A method for encapsulating messenger RNA (mRNA) in lipid nanoparticles (LNP), the method comprising:
(a) mixing one or more lipids in a lipid solution with one or more mRNAs in an mRNA solution to form encapsulated mRNA (mRNA-LNP) within the LNP in a lipid nanoparticle (LNP) forming solution;
(b) exchanging the LNP-forming solution for the drug product formulation solution to provide mRNA-LNP in the drug product formulation solution; and
(c) heating the mRNA-LNP in the drug product formulation solution;
wherein the encapsulation efficiency of the mRNA-LNP produced in step (c) is greater than the encapsulation efficiency of the mRNA-LNP produced in step (b). The method of claim 1 , wherein in step (a), the one or more lipids comprise one or more cationic lipids, one or more helper lipids, and one or more PEG-modified lipids. The method of claim 2 , wherein the lipid further comprises one or more cholesterol lipids (eg, cholesterol). 4. The method of any one of claims 1 to 3, wherein, in step (c), the one or more cationic lipids are cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole-based). , HGT5000, HGT5001, HGT4001, HGT4002, HGT4003, HGT4004, HGT4005, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, DLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLinDAP , KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)( 2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentane-2- yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (target 24) , N1GL, N2GL, V1GL, and combinations thereof. 5. The method according to any one of claims 2 to 4, wherein, in step (c), the one or more helper lipids are distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), Dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), diol Leoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE) , distearoyl-phosphatidyl-ethanolamine (DSPE), 1,2-dierucoyl-sn-glycero-3-phosphoethanolamine (DEPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), and mixtures thereof. The method of claim 1 , wherein in step (a), the one or more PEG-modified lipids are covalently linked to a lipid having an alkyl chain(s) of C ₆ -C ₂₀ length at most 2 kDa, at most 3 kDa, at most 4 kDa, or at most A method comprising a polyethylene glycol chain of 5 kDa length. 7. The method of any one of claims 1-6, wherein the lipid component of the lipid solution consists of:
(a) cationic lipids;
(b) helper lipids;
(c) cholesterol-based lipids, and
(d) PEG-modified lipids. 9. The method of claim 8, wherein the molar ratio of cationic lipid to helper lipid to cholesterol-based lipid to PEG-modified lipid is about 20-50:25-35:20-50:1-5. 7. The method of any one of claims 1-6, wherein the lipid component of the lipid solution consists of:
(a) cationic lipids;
(b) helper lipids;
(c) PEG-modified lipids. 10. The method of claim 9, wherein the cationic lipid is a cholesterol-based or imidazole-based cationic lipid. 11. The method of claim 9 or 10, wherein the molar ratio of cationic lipid to helper lipid to PEG-modified lipid is about 55-65:30-40:1-5. 12. The method according to any one of claims 1 to 11, wherein the mRNA encodes a protein or peptide. 13. The method according to any one of claims 1 to 12, wherein in step (c), the drug product formulation solution is heated by applying heat to the solution from a heat source, and the solution is heated to a temperature higher than ambient temperature for 10 to 20 minutes. maintained for a while, in a way. 14. The method of claim 13, wherein the above ambient temperature is about 60-70°C. 15. The method according to any one of claims 1 to 14, wherein the encapsulation efficiency after step (c) provides at least 5% or more as compared to the encapsulation efficiency after step (b). 16. The method according to any one of claims 1 to 15, wherein the encapsulation efficiency after step (c) is improved by at least 10% compared to the encapsulation efficiency after step (b). 17. The method of any one of claims 1 to 16, wherein in step (a), the lipid solution comprises lipids dissolved in ethanol. 18. The method according to any one of claims 1 to 17, wherein, in step (a), the mRNA solution comprises mRNA dissolved in a citrate buffer. The method according to any one of claims 1 to 18, wherein the drug product formulation solution is an aqueous solution containing a pharmaceutically acceptable excipient including a cryoprotectant. The method according to any one of claims 1 to 19, wherein the drug product formulation solution is an aqueous solution comprising saccharides. 21. The method of claim 20, wherein the saccharide is selected from the group consisting of one or more of trehalose, sucrose, mannose, lactose, and mannitol. 22. The method of claim 21, wherein the saccharide comprises trehalose. 23. The method of any one of claims 1-22, wherein, in step (b), the drug product formulation solution is an aqueous solution comprising about 10% (w/v) trehalose. 24. The method of any one of claims 1-23, wherein both ethanol and citrate are absent from the drug product formulation solution. 25. The method of any one of claims 1-24, wherein the lipid solution comprises ethanol, the mRNA solution comprises citrate, and neither ethanol nor citrate is in the drug product formulation solution. 26. The method of any one of claims 1-25, wherein the mRNA solution has a pH of less than pH 5.0. 27. The method of any one of claims 1-26, wherein the drug product formulation solution has a pH of between pH 5.0 and pH 7.0.

Images