KR20220022560A - Human interferon-beta derivatives and pharmaceutical composition comprising the same - Google Patents

Abstract

The present invention provides a human interferon-beta variant in which the 27th and 73rd amino acids of human interferon-beta are substituted; polynucleotide encoding the same; a recombinant expression vector containing the polynucleotide; an animal cell transformed with the vector; a method for preparing a human interferon-beta variant using the animal cell, and a pharmaceutical composition containing the human interferon-beta variant. The human interferon-beta variant according to the present invention has a pharmacological activity more excellent than native human interferon beta and exhibits an increased in vivo half-life, and thus can be advantageously used for prevention or treatment of cancer or tumor, autoimmune disease, viral infection, HIV-related disease, hepatitis C, and the like.

Description

Human interferon-beta variant and pharmaceutical composition comprising the same

The present invention relates to a human interferon-beta variant and a pharmaceutical composition comprising the same, and more particularly, to a human interferon-beta variant in which amino acids 27 and 73 of human interferon-beta are substituted, a polynucleotide encoding the same, It relates to a recombinant expression vector containing a polynucleotide, an animal cell transformed with the vector, a method for producing a human interferon-beta mutant using the animal cell, and a pharmaceutical composition comprising the human interferon-beta mutant.

Interferon (interferon) is a glycoprotein of cytokines having antiviral activity, cell proliferation inhibition and autoimmune response regulation, among which interferon-beta, a globular protein composed of five α-helixes ( interferon-β) is used as the main treatment for multiple sclerosis.

In addition, interferon-beta has multiple intrinsic activities such as increasing lymphocyte cytotoxicity, inducing or inhibiting differentiation of target cells, activating macrophages, increasing cytokine production, increasing the effect of cytotoxic T cells, and increasing natural killer cells. Besides sclerosis, it is also known to treat HIV-related diseases, hepatitis C, and rheumatoid arthritis.

Peptides present in blood and tissues have a short half-life in the body, and it is difficult to achieve maximum clinical efficacy due to their sensitivity to proteases. Therefore, in order to develop interferon-beta as a pharmaceutical, it is necessary to improve solubility and stability in the body as well as further improve the intrinsic pharmacological effect.

In order to improve the activity of interferon-beta as described above, studies such as mutagenesis, PEGylation, glycosylation, and fusion proteins are being conducted.

Korean Patent Registration No. 10-0781666 discloses a human interferon-beta variant comprising an N-linked sugar chain at an asparagine residue of a sequence added to the C-terminus of interferon-beta (GNITV). In the human interferon-beta variant, an N-linked sugar chain may be added to an asparagine residue at the 25th amino acid by additionally replacing arginine at the 27th amino acid with serine or threonine (R27S/R27T). It is also disclosed that the human interferon-beta mutant has improved antiviral activity, cell growth inhibitory activity, immunomodulatory function, and in vivo half-life compared to native human interferon-beta.

Accordingly, the present inventors made efforts to develop a human interferon-beta mutant having improved activity and increased half-life in the body compared to native human interferon-beta. As a result, the 27th and 73rd amino acids of native human interferon-beta were substituted. A human interferon-beta mutant to which two N-linked sugar chains were added was developed, and the present invention was completed by confirming that the human interferon-beta mutant exhibits an increased half-life in the body while having excellent antiviral activity.

The information described above is only for improving understanding of the background of the present invention, and may not include information forming prior art known to those of ordinary skill in the art to which the present invention pertains.

It is an object of the present invention to provide a human interferon-beta variant having an increased half-life in the body.

Another object of the present invention is to provide a polynucleotide encoding the human interferon-beta variant and an expression vector comprising the same.

Another object of the present invention is to provide a cell transformed with the expression vector.

Another object of the present invention is to provide a method for producing the human interferon-beta mutant by culturing the transformed cell.

Another object of the present invention is to provide a pharmaceutical composition comprising the human interferon-beta variant.

In order to achieve the above object, in the present invention, the 27th amino acid of human interferon-beta, arginine, is substituted with serine or threonine, and the 73rd amino acid, aspartic acid, is substituted with asparagine, and N-linked sugar chains at the 25th and 73rd asparagine residues are It provides a human interferon-beta variant comprising each.

The present invention also provides polynucleotides encoding human interferon-beta variants.

The present invention also provides a recombinant expression vector comprising the polynucleotide.

The present invention also provides an animal cell transformed with the recombinant expression vector.

The present invention also provides a method for producing a human interferon-beta mutant comprising the step of culturing the animal cell.

The present invention also provides a pharmaceutical composition comprising the human interferon-beta mutant as an active ingredient and having the pharmacological effect of natural human interferon beta.

Since the human interferon-beta mutant according to the present invention exhibits an increased half-life in the body while having the pharmacological effect of native human interferon beta, cancer or tumors, autoimmune diseases, viral infections, HIV-related diseases, and hepatitis C It can be usefully used for prevention or treatment, etc.

1 is a schematic diagram of a human interferon-beta mutant expression vector.
2 shows the substituted base sequence and amino acid sequence of the interferon-beta variant.
3 shows western blot results of human interferon-beta native and mutants transiently expressed in HEK293F cells.
Figure 4 shows the cell growth inhibitory activity of human interferon-beta native and mutants.
5 shows the antiviral activity of the interferon-beta mutant and Avonex produced in the transformed production cell line.
6 shows the in vivo half-life of the interferon-beta mutant and Avonex produced in the transformed production cell line.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is those well known and commonly used in the art.

The present invention relates to human interferon-beta, wherein arginine, the 27th amino acid, is substituted with serine or threonine, and the 73rd amino acid, aspartic acid, is substituted with asparagine. Beta variants are provided.

As used herein, the term "human interferon-beta" refers to a polypeptide having the amino acid sequence of SEQ ID NO: 1 or a polypeptide comprising a substantial portion thereof or a polypeptide substantially similar to the native human interferon-beta.

The human interferon-beta mutant of the present invention is, for example, in the amino acid sequence of SEQ ID NO: 1, which is the amino acid sequence of native human interferon-beta, in which the 27th and 73rd amino acids are substituted as described above, preferably SEQ ID NO: 3 has an amino acid sequence of

When a polypeptide in which the 27th and 73rd amino acids of human interferon-beta are substituted as described above is expressed in animal cells, sugar chains are added to the 25th and 73rd asparagine residues, respectively, in the form of natural human interferon-beta The human interferon-beta mutant of the present invention having improved antiviral activity and increased half-life in vivo can be obtained.

As used herein, the term "glycosylation or sugar chain addition" refers to a processing method in which a glycosyl group is translocated to a protein. The glycosylation is performed by binding a glycosyl group to a serine, threonine, asparagine or hydroxylysine residue of a target protein by a glycosyltransferase. The glycosylated protein is used as a constituent of living tissue. Not only that, but it also plays an important role in cell recognition on the cell surface. Accordingly, the effect and half-life of the human interferon-beta mutant of the present invention can be further improved by further glycosylation of the human interferon-beta mutant of the present invention or by changing the pattern of the glycosylation.

The human interferon-beta mutant of the present invention is not particularly limited thereto, but may be PEGylated to enhance residence time in the administered body.

As used herein, the term “PEGylation” refers to a processing method for improving the residence time in the blood by introducing polyethylene glycol into the human interferon-beta mutant. In the present invention, pegylation may be performed by a method of forming an amide group by bonding the carboxyl group of the interferon-beta variant with the amine group of polyethylene glycol, but is not limited thereto, and pegylation can be performed in various ways. At this time, the polyethylene glycol is not particularly limited thereto, but preferably has a molecular weight between 100 and 1,000, and may have a linear or branched structure.

The glycosylation and/or pegylation pattern may be variously modified by methods known in the art as long as the function of the human interferon-beta mutant of the present invention is maintained, and the human interferon-beta mutant of the present invention is glycosylated. and/or mutant human interferon-beta variants in which pegylation patterns are variously modified.

The human interferon-beta mutant of the present invention also includes a human interferon-beta mutant in which a part of the amino acid sequence is substituted through a conservative substitution in the human interferon-beta mutant according to the present invention.

As used herein, "conservative substitution" refers to a modification of a polypeptide comprising substituting one or more amino acids with amino acids having similar biochemical properties that do not result in loss of biological or biochemical functions of the polypeptide. A “conservative amino acid substitution” is a substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Classes of amino acid residues having similar side chains are well known in the art. These classes include amino acids with basic side chains (eg lysine, arginine, histidine), amino acids with acidic side chains (eg aspartic acid, glutamic acid), amino acids with uncharged polar side chains (eg glycine) , asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains amino acids (eg, threonine, valine, isoleucine) with aromatic side chains (eg, tyrosine, phenylalanine, tryptophan, histidine). The human interferon-beta mutant of the present invention may still retain activity even with the above conservative amino acid substitutions.

The present invention also provides a polynucleotide encoding a human interferon-beta variant according to the present invention. As used herein, a polynucleotide may be present in a cell, a cell lysate, or may be present in a partially purified or substantially pure form. Polynucleotides can be prepared from other cellular components or other contaminants, e.g., by standard techniques including alkali/SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis, and others well known in the art. For example, it is "isolated" or "substantially pure" when it has been purified from the nucleic acid or protein of another cell. The polynucleotide of the present invention may be, for example, DNA or RNA, and may or may not contain an intron sequence. The nucleotide, which is the basic building block of polynucleotides, includes not only natural nucleotides, but also analogs in which sugar or base regions are modified. The sequence of the polynucleotides of the present invention may be modified. Such modifications include additions, deletions, or non-conservative or conservative substitutions of nucleotides.

In the present invention, the polynucleotide encoding the human interferon-beta variant may preferably be the polynucleotide of SEQ ID NO: 4, but considering the degeneracy of codons, the polynucleotide sequence is a change in the encoded amino acid sequence It can be varied without

Considering the modifications having the above-described biological equivalent activity, the human interferon-beta variant of the present invention or a polynucleotide encoding the same is interpreted as including a sequence showing substantial identity to the sequences set forth in SEQ ID NOs: 3 and 4 do. The substantial identity is, when the sequence of the present invention and any other sequences are arranged to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art, homology of 90% or more, Preferably, it refers to a sequence that exhibits at least 95% homology, more preferably at least 96%, at least 97%, at least 98%, or at least 99% homology.

Such homology can be determined by sequence comparison and/or alignment by methods known in the art. For example, sequence homology of the human interferon-beta variant of the present invention or a polynucleotide encoding the same can be determined using a sequence comparison algorithm (eg, NCBI Basic Local Alignment Search Tool; BLAST), manual alignment, visual inspection, etc. there is.

In another aspect, the present invention relates to a recombinant expression vector comprising the polynucleotide. For expression of human interferon-beta variants according to the present invention, DNA encoding them can be obtained by standard molecular biology techniques (e.g., PCR amplification or cDNA cloning) and the DNA is "actuated" into transcriptional and translational control sequences. It can be inserted into an expression vector by being “linked” as possible. Vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, enhancer elements, promoters, and transcription termination sequences.

As used herein, the term "vector" refers to a means for expressing a target gene in a host cell, such as a plasmid vector, a cosmid vector, a bacteriophage vector, an adenoviral vector, a retroviral vector, and an adeno-associated viral vector such as a viral vector. include In the vector, the polynucleotide encoding the human interferon-beta variant is operably linked to a promoter.

As used herein, the term “operably linked” refers to encoding a human interferon-beta variant such that transcriptional and translational control sequences in the vector serve the intended function of regulating the transcription and translation of a polynucleotide encoding the human interferon-beta variant. means that the polynucleotide is ligated into the vector. Expression vectors and expression control sequences are selected to be compatible with the cells for expression used. Polynucleotides encoding human interferon-beta variants are expressed by standard methods (e.g., ligation of complementary restriction enzyme sites on gene fragments and vectors, or blunt end ligation if no restriction enzyme sites are present) inserted into the vector.

Optionally, the recombinant expression vector may contain a sequence encoding a signal peptide that facilitates secretion of human interferon-beta variants from transformed cells. The polynucleotide encoding the human interferon-beta variant and the signal peptide-coding sequence can be cloned into a vector in frame so that the signal peptide is expressed by binding to the amino terminus of the human interferon-beta variant. The signal peptide may be an immunoglobulin signal peptide or a heterologous signal peptide (ie, a signal peptide from a protein other than immunoglobulin). In addition, the recombinant expression vector may include a regulatory sequence for controlling the expression of human interferon-beta mutant in transformed cells. "Regulatory sequences" may include promoters, enhancers and other expression control elements (eg, polyadenylation signals) that control the transcription or translation of a polynucleotide encoding a human interferon-beta variant. A person skilled in the art can recognize that the design of the expression vector may vary by selecting different control sequences depending on factors such as the selection of cells to be transformed, the level of protein expression, and the like.

The vectors of the present invention may also contain other sequences to be fused to a polynucleotide encoding a human interferon-beta variant to facilitate purification of the human interferon-beta variant expressed from the vector. This sequence may be, for example, a gene such as glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA), 6x His (hexahistidine; Quiagen, USA), etc. . The vector contains an antibiotic resistance gene commonly used in the art as a selection marker, and such genes include, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and There is a gene for resistance to tetracycline.

The present invention also provides a cell transformed with the expression vector. The cells according to the present invention may be derived from animal cells.

Specifically, the cell according to the present invention may be derived from a mammal. For example, COS-7 (monkey kidney cells 7), BHK (baby hamster kidney), CHO (Chinese hamster ovary), CHOK1, DXB-11, DG-44, CHO/-DHFR, CV1, HEK293, BHK, TM4 , VERO, HELA, MDCK, BRL 3A, W138, Hep G2, SK-Hep, MMT, TRI, MRC 5, FS4, 3T3, RIN, A549, PC12, K562, PER.C6, SP2/0, NS0, U20S, or HT1080 and the like are available, but are not limited thereto, preferably COS7 cells, NSO cells, SP2/0 cells, CHO cells, W138, BHK cells, MDCK, myeloma cell lines, HuT 78 cells and HEK293 cells, particularly preferably CHO cells may be used.

Various cell/vector combinations can be used to express human interferon-beta variants according to the present invention. Specifically, expression vectors suitable for eukaryotic cells include, but are not limited to, expression vectors derived from SV40, bovine papillomavirus, adenovirus, adeno-associated virus, cytomegalovirus, and retrovirus. it is not

The vector is transfected or transfected into cells. A variety of different techniques commonly used to introduce exogenous nucleic acids (DNA or RNA) into eukaryotic cells for "transfection" or "transfection", e.g., electrophoresis, calcium phosphate precipitation, DEAE-dex Trans transfection or lipofection may be used.

The present invention also provides a method for producing a human interferon-beta mutant comprising the step of culturing the transformed cell. In the production method of the present invention, when the recombinant expression vector capable of expressing the human interferon-beta variant is introduced into a cell, for example, an animal cell, a period sufficient to allow the human interferon-beta variant to be expressed in the cell. The human interferon-beta mutant can be prepared by culturing the cells during the period.

The cells may be cultured in various media, and commercially available media may be used without limitation as the culture medium. All other essential supplements known to those skilled in the art may be included in appropriate concentrations. Suitable culture conditions, for example, temperature, pH, etc., have already been used for protein expression in the selected host cell, and will be apparent to those skilled in the art.

In some cases, the expressed human interferon-beta mutant can be isolated from the cell culture medium and purified uniformly. Isolation or purification of the human interferon-beta variant may be performed by a conventional protein separation and purification method, for example, chromatography. The chromatography may include, for example, affinity chromatography using a protein A column or a protein G column, ion exchange chromatography, hydrophobic chromatography, or hydroxylapatite chromatography. In addition to the above chromatography, human interferon-beta mutants can be isolated and purified by further combining filtration, ultrafiltration, salting out, dialysis, and the like.

The present invention also provides a pharmaceutical composition comprising the human interferon-beta mutant as an active ingredient and having the pharmacological effect of natural human interferon-beta.

Since the pharmaceutical composition of the present invention has the pharmacological effect of native human interferon-beta, a disease that can be prevented or treated by this pharmacological effect, for example, cancer or tumor, autoimmune disease, viral infection, HIV - It can be used for preventing or treating diseases such as related diseases and hepatitis C.

As used herein, "cancer" and "tumor" are synonymous and refer to a physiological condition in mammals that is typically characterized by unregulated cell growth and proliferation.

"Prevention" refers to any act of inhibiting or delaying the progression of cancer or tumor, autoimmune disease or other diseases by administration of the composition according to the present invention, and "treatment" refers to inhibiting the development of cancer or tumor, cancer or tumor alleviation or elimination, inhibition, alleviation or elimination of autoimmune diseases or other diseases.

Cancers or tumors that can be treated with the composition of the present invention are not particularly limited, and include both solid cancers and hematologic cancers. Examples of such cancer include skin cancer such as melanoma, liver cancer, hepatocellular carcinoma, stomach cancer, breast cancer, lung cancer, ovarian cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colorectal cancer, colon cancer, pancreatic cancer, uterus Cervical cancer, brain cancer, prostate cancer, non-small cell lung cancer, bone cancer, skin cancer, thyroid cancer, parathyroid cancer, kidney cancer, esophageal cancer, biliary tract cancer, testicular cancer, rectal cancer, head and neck cancer, cervical spine cancer, ureter cancer, osteosarcoma, neuroblastoma, fibrosarcoma, rhabdomyosarcoma It may be selected from the group consisting of sarcoma, astrocytoma, glioblastoma, neuroblastoma, glioma, and other tumors (eg, small round blue cell tumors of childhood), but is not limited thereto.

More preferably, the cancer or tumor is prostate cancer, ovarian cancer, breast cancer, colon cancer, kidney cancer, non-small cell lung cancer, pancreatic cancer, head and neck cancer, melanoma, glioblastoma, neuroblastoma and other tumors (eg, small round blue cell tumors) It can be characterized by being selected from the group consisting of (of childhood). The cancer may be a primary cancer or a metastatic cancer.

In the present invention, the autoimmune disease may be asthma, rheumatoid arthritis, or multiple sclerosis, but is not limited thereto.

In the present invention, the pharmaceutical composition may include a therapeutically effective amount of the human interferon-beta variant of the present invention and a pharmaceutically acceptable additive. A “pharmaceutically acceptable carrier” is a substance that can be added to the active ingredient to help formulate or stabilize the agent and does not cause significant toxic effects in the patient.

The additive refers to a carrier or diluent that does not irritate the patient and does not inhibit the biological activity and properties of the administered compound. Examples of acceptable pharmaceutical carriers for compositions formulated as liquid solutions are sterile and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection, dextrose solution, maltodextrin solution, glycerol, ethanol and A mixture thereof may be used, and other conventional additives such as antioxidants, buffers, and bacteriostats may be added as needed. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets.

Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the preparation of sterile injectable solutions or dispersions for extemporaneous administration. The composition is preferably formulated for parenteral injection. The compositions may be formulated as solutions, microemulsions, liposomes, or other customized formulations suitable for high drug concentrations. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, a polyol (eg, glycerol, propylene glycol and liquid polyethylene glycol, etc.) and suitable mixtures thereof. In some cases, isotonic agents may be included in the composition, for example, sugars, polyalcohols such as mannitol, sorbitol or sodium chloride. Each formulation can be prepared using methods well known in the pharmaceutical art.

The dosage of the pharmaceutical composition according to the present invention may be determined within the dosage range of interferon-beta well known in the art and is not particularly limited, but the patient's health status and weight, severity of disease, type of drug, administration It can be changed according to various factors including route and administration time. The pharmaceutical composition according to the present invention may be administered via various routes, typically accepted oral or parenteral routes, in single or multiple doses per day. Specifically, it may be administered in a conventional manner via oral, intrarectal, topical, intravenous, intraperitoneal, intramuscular, intraarterial, transdermal, intranasal, inhalational, intraocular, intrapulmonary or intradermal routes, but is not limited thereto. not.

The present invention also comprises administering a therapeutically effective amount of said human interferon-beta variant to a patient in need of prevention or treatment of cancer or tumors, autoimmune diseases, viral infections, HIV-related diseases, and hepatitis C. To a method for the prevention or treatment of cancer or tumors, autoimmune diseases, viral infections, HIV-associated diseases, and hepatitis C. The prevention or treatment method may further include the step of identifying a patient in need of the prevention or treatment of the disease before the administering step.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1: Interferon with a mutant sequence-Securing beta mutant gene

R27T variant in which arginine (R), which is the 27th amino acid of native interferon-beta (SEQ ID NO: 1), is substituted with threonine (T), D73N mutant in which aspartic acid (D), which is the 73rd amino acid, is substituted with asparagine (N), And in order to clone the gene of the D73N/R27T mutant substituted at the 27th and 73rd amino acids at the same time, overlapping polymerase chain reaction using the corresponding primer pair (Table 1) and the native interferon-beta gene (SEQ ID NO: 2) as a template (polymerase chain reaction, PCR) was performed to secure the mutant gene. Expression vectors expressing the interferon-beta mutant protein in which 6X His is fused to the carboxy-terminus were prepared using the obtained PCR product and the N293F vector (FIG. 1 and Table 2).

Interferon-beta mutant cloning primer designation 5'→3' sequence SEQ ID NO: D73N-F atcttccggcagaattcctcctccaccggatggaacgagacaatcgtggaaa 5 D73N-R ggtggaggaggaattctgccggaagatggcgaagatgttctgcagcatctcg 6 R27T-F cagctgaacggcaccctggaatactgcctgaaggaccggatgaacttcgaca 7 R27T-R gcagtattccagggtgccgttcagctgccacagcagtttctgacactggaag 8

Interferon-beta mutant gene expression vector Plasmid name amino acid substitution base substitution N293F-IFNB-R27T R27T CGG→ACC N293F-IFNB-D73N D73N GAC→AAT N293F-IFNB-D73N/R27T D73N, R27T GAC→AAT, CGG→ACC

Example 2: Expression and purification of interferon-beta variants

Transfection was performed using PEI (polyethylenimine, 23966, Polysciences) under optimized conditions. Human HEK293F cells were inoculated into a medium (#Freestyle 293 AGT type; AG100009P1, Thermo.) at 5x10 ⁵ cells per ml and cultured until 1x10 ⁶ cells/ml. Each expression vector obtained in Example 1 and PEI were mixed to form a polyplex, and then transformed by adding to the cells, and then adding 5 g/L of Soytone (#212488, DIFCO) Incubated for an additional 6 days.

The expressed interferon-beta was purified using Ni-NTA resin. Each protein-producing culture medium was centrifuged at 8,000 rpm for 30 minutes to remove cell debris, and filtered using a bottle top filter having a pore size of 0.22 μm. To perform purification, 3 ml of Ni-NTA resin (#30230, QIAGEN,) was put into an empty column, and then the resin was packed with 20 ml of binding buffer (10 mM imidazole). The culture solution filtered on the packed resin was flowed at a gravity-flow rate to bind to the resin at a rate of 0.2 ml per minute. After washing with 100 ml of washing buffer (20 mM Imidazole), it was eluted with an elution buffer (250 mM imidazole). The resulting eluate was buffer-exchanged with DPBS (Dulbecco's phosphate-buffered saline) through dialysis (1 L, 3 times). The concentration of the protein was measured by nano-drop (Nano-drop).

Example 3: Characterization of interferon-beta variants

Example 3-1: Confirmation of addition of sugar chains

The culture supernatant containing the interferon-beta mutant obtained by culturing the transfected HEK293F cells described in Example 2 was electrophoresed on a 12% SDS-polyacrylamide gel, and after transfer to a nitrocellulose membrane Blocking was performed for 1 hour at room temperature with a blocking solution (5% skim milk/TBST). Then, after reacting with anti-interferon-beta mouse monoclonal antibody at 4° C. overnight, it was reacted with HRP-conjugated anti-mouse IgG at room temperature for 1 hour. After that, the ECL solution (#16024, Intron) was evenly sprayed, and the exposure time was set to 30 seconds with Chemi Doc (UVITEC, mini HD) to obtain an image.

As a result of Western blot, it was confirmed that the molecular weight was increased due to the addition of sugar chains in the interferon-beta variants compared to the control group Avonex (Avonex ^TM , Eisai Korea) and native interferon-beta (FIG. 3).

Example 3-2: Interferon-beta mutant cell growth inhibitory activity

To evaluate the cell growth inhibitory activity of interferon-beta mutants, the antiproliferative activity was investigated using Daudi cells.

Daudi cells were cultured in RPMI 1640 medium supplemented with 1% antibiotic-antimycotic, 1 mM pyruvate, 2 mM glutamine and 10% FBS. The test group and control interferon-beta protein were serially diluted two-fold to contain 100 μl/well in a 96-well multiplate using RPMI 1640 medium containing 10% FBS, and all samples were duplicated.

Cells were added to a 96-well multiplate at a concentration of 1× ^{10 4} cells per well and incubated at 37° C., 5% CO ₂ for 72 hours. After 3 days, 20 μl of CCK-8 reagent was added per well, and the absorbance was measured at 450 nm after incubation for 2 hours/3 hours.

The Daudi cell growth inhibitory activity of the interferon-beta mutant was proportional to the dose, and was equal to or greater than that of the control group Avonex ( FIG. 4 ).

Example 4: Interferon-beta mutant expression production cell line preparation

As a result of confirming the characteristics of the interferon-beta mutant in Example 3, a sugar chain was added to the interferon-beta mutant (D73N/R27T) and Daudi cell growth inhibitory activity was equivalent to Avonex, a control, interferon-beta mutant A production cell line capable of producing (D73N/R27T) protein was prepared using CHO-S cells.

To proceed with the transfection, CHO cells were inoculated into the medium at 1x10 ⁸ cells per mL the day before transfection and cultured until 2x10 ⁸ cells/mL. After preparing 8x10 ⁷ cells, they were prepared by diluting in an electroporation buffer, and after mixing 120 μg of interferon-beta mutant DNA with the prepared cells, the cells were transfected by electroporation using a Maxcyte device. Cells that were transfected were cultured for 24 hours at 37° C., 8% CO ₂ , and 130 rpm conditions, followed by selection.

24 hours after transfection, the selection markers, methotrexate and puromycine, were treated with 200 nM and 20 μg/ml concentrations, respectively, and the first-stage selection was performed. The cells were cultured with replacement of the medium every 7 days until the cells treated with the selection marker were recovered. After the number of viable cells and the survival rate were recovered, subculture was performed at intervals of 3 or 4 days, and the expression level of the interferon-beta mutant was measured using the culture medium on the 4th day, and the expression level, pcd (pg/cell/day) , the cell pool was selected in consideration of the specific growth rate (SGR).

In step 2, the selected cell pool was treated by increasing the concentration of the selection marker to 1,000 nM methotrexate and 50 μg/ml puromycin to proceed with the selection. Cells were cultured while changing the medium every 7 days until recovery. After the number of viable cells and the survival rate were recovered, subculture was carried out at intervals of 3 or 4 days, and the expression level of the interferon-beta mutant was measured using the 4th day culture medium. Cell pools were selected in consideration of specific growth rate (SGR).

Example 5: Production and purification of interferon-beta variants in production cell lines

The interferon-beta mutant cell pool obtained in Example 4 was cultured in batch culture for 6 days, the culture medium was collected, cells and suspended matter were removed through centrifugation and 0.22 μm filter filtration, and the supernatant was collected and purified. . Purification was performed in 4 steps.

The filtered culture supernatant was concentrated and buffer exchanged using the Cogent micro-scale TFF System. Next, primary purification was performed using an SP Sepharose FF column. The primary purified protein was subjected to Hitrap Blue HP affinity chromatography to perform secondary purification, and the third purification was performed using a CHT2-1 column, and impurities were removed by gradient elution and interferon-beta Fractions containing only variant proteins were collected. The tertiary purified protein was subjected to a final quaternary purification using a Superdex 200 column to remove large impurity proteins. The fourth purified protein was dialyzed against dPBS and concentrated with an Amicon ultra filter to obtain interferon-beta mutant protein.

Example 6: Biological activity of interferon-beta mutants expressed in production cell lines

Example 6-1: Antiviral activity of interferon-beta variants

The antiviral activity of the interferon-beta mutant was compared with native interferon-beta (control). Avonex was used as the native interferon-beta.

Vero cells were cultured in MEM medium containing 10% FBS. On the day of analysis, cells were prepared at 3x10 ⁵ cells per mL in the medium of the above composition, and 200 μl of cells were added to each well of a 48-well multiplate. The control and interferon-beta mutant proteins were sequentially diluted two-fold with the same medium as above to prepare 200 μl per well, in duplicate at each concentration. After adding the control and interferon-beta protein to the prepared cells, the plate was incubated at 37° C., 5% CO ₂ condition for 16 hours. After incubation, the medium was removed from the plate, EMCV (Encephalomyocarditis virus, 1x10 ⁶ Log10TCID ₅₀ /ml) diluted with the medium was added, and then the medium was removed and stained with crystal violet after incubation for 24 hours. After removing the staining solution, 200 μl of 2-methoxyethanol was added, and absorbance was measured at 450 nm to confirm antiviral activity.

The experimental group, the interferon-beta mutant, exhibited a two-fold or more high antiviral activity compared to the control group Avonex (FIG. 5).

Example 6-2: Interferon-beta mutant pharmacokinetic study

In order to test the in vivo half-life of the interferon-beta mutant expressed in the production cell line, the sample was administered to a rat vein, and the concentration change was measured over time. Compared with native interferon-beta, Avonex was used as native interferon-beta.

For the test, 8-week-old female rats of Sprague-Dawley strain were used, and the animals were used after acclimatization for 5 days after acquisition. After acclimatization, subjects suitable for the test were selected and randomly assigned so that the average body weight and standard deviation between each group were equal, and administration was performed after group separation.

At the time of administration, Avonex and interferon-beta mutants as a control group were injected into the caudal vein of rats using a disposable syringe. Before administration, at 5, 15, 30 minutes, 1.25, 3, 5, 24, and 48 hours after administration, 300 μl of blood was collected from the jugular vein for a total of 9 time points. The collected blood was treated with the anticoagulant sodium heparin and then centrifuged to separate only plasma and stored at -70°C. The amount of interferon-beta in the blood of experimental animals was measured by R&D's human IFNB ELISA Kit.

As a result of the measurement, there was an effect of increasing the half-life of the interferon-beta mutant with two sugar chains in the rat body nearly twice that of Avonex (Table 3, FIG. 6).

In vivo half-life in rats of Avonex and interferon-beta variants (D73N/R27T) Sample name Dosage AUC
(ng*hr/mL) Vdas
(mL/kg) Half-life (hr) Avonex 30 μg/kg 297.0 78.3 2.4 Interferon-beta variant (D73N/R27T) 60 μg/kg 663.3 85.0 4.4 AUC: area under curve
Vdss: steady-state volume of distribution

As a specific part of the present invention has been described in detail above, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. will be. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

<110> Y-Biologics Inc. <120> Human interferon-beta derivatives and pharmaceutical composition comprising the same <130> PN20212 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 166 <212> PRT <213> Homo sapiens <400> 1 Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln 1 5 10 15 Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu 20 25 30 Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln 35 40 45 Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln 50 55 60 Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn 65 70 75 80 Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn 85 90 95 His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr 100 105 110 Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg 115 120 125 Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr 130 135 140 Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu 145 150 155 160 Thr Gly Tyr Leu Arg Asn 165 <210> 2 <211> 498 <212> DNA <213> Homo sapiens <400> 2 atgtcttaca acctgctggg cttcctgcag cggtcctcca acttccagtg tcagaaactg 60 ctgtggcagc tgaacggccg gctggaatac tgcctgaagg accggatgaa cttcgacatc 120 cccgaggaaa tcaagcagct gcagcagttc cagaaagagg acgccgctct gaccatctac 180 gagatgctgc agaacatctt cgccatcttc cggcaggact cctcctccac cggatggaac 240 gagacaatcg tggaaaatct gctggccaac gtgtaccacc agatcaacca cctgaaaacc 300 gtgctggaag agaagctgga aaaagaagat ttcacccggg gcaagctgat gtcctctctg 360 cacctgaagc ggtactacgg cagaatcctg cactacctga aggccaaaga gtactcccac 420 tgcgcctgga ccatcgtgcg agtggaaatc ctgcggaact tctacttcat caaccggctg 480 accggctacc tgcggaat 498 <210> 3 <211> 166 <212> PRT <213> Artificial Sequence <220> <223> IFN-beta mutant (D73N/R27T) <400> 3 Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln 1 5 10 15 Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Thr Leu Glu Tyr Cys Leu 20 25 30 Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln 35 40 45 Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln 50 55 60 Asn Ile Phe Ala Ile Phe Arg Gln Asn Ser Ser Ser Thr Gly Trp Asn 65 70 75 80 Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn 85 90 95 His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr 100 105 110 Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg 115 120 125 Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr 130 135 140 Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu 145 150 155 160 Thr Gly Tyr Leu Arg Asn 165 <210> 4 <211> 498 <212> DNA <213> Artificial Sequence <220> <223> IFN-beta mutant (D73N/R27T) <400> 4 atgtcttaca acctgctggg cttcctgcag cggtcctcca acttccagtg tcagaaactg 60 ctgtggcagc tgaacggcac cctggaatac tgcctgaagg accggatgaa cttcgacatc 120 cccgaggaaa tcaagcagct gcagcagttc cagaaagagg acgccgctct gaccatctac 180 gagatgctgc agaacatctt cgccatcttc cggcagaact cctcctccac cggctggaac 240 gagacaatcg tggaaaatct gctggccaac gtgtaccacc agatcaacca cctgaaaacc 300 gtgctggaag agaagctgga aaaagaagat ttcacccggg gcaagctgat gtcctctctg 360 cacctgaagc ggtactacgg cagaatcctg cactacctga aggccaaaga gtactcccac 420 tgcgcctgga ccatcgtgcg agtggaaatc ctgcggaact tctacttcat caaccggctg 480 accggctacc tgcggaat 498 <210> 5 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 atcttccggc agaattcctc ctccaccgga tggaacgaga caatcgtgga aa 52 <210> 6 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ggtggaggag gaattctgcc ggaagatggc gaagatgttc tgcagcatct cg 52 <210> 7 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 cagctgaacg gcaccctgga atactgcctg aaggaccgga tgaacttcga ca 52 <210> 8 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gcagtattcc agggtgccgt tcagctgcca cagcagtttc tgacactgga ag 52

Claims (9)

Human interferon-beta mutant comprising an N-linked sugar chain at the 25th and 73rd asparagine residues, respectively, in which arginine, the 27th amino acid of human interferon-beta, is substituted with serine or threonine, and the 73rd amino acid, aspartic acid, is substituted with asparagine . The human interferon-beta variant according to claim 1, wherein the human interferon-beta has the amino acid sequence of SEQ ID NO: 1. A polynucleotide encoding the human interferon-beta variant of claim 1 or 2. A recombinant expression vector comprising the polynucleotide of claim 3 . An animal cell transformed with the recombinant expression vector of claim 4. A method for producing a human interferon-beta mutant comprising the step of culturing the animal cell of claim 5 . A pharmaceutical composition comprising the human interferon-beta mutant of claim 1 or 2 as an active ingredient, and having a pharmacological effect of natural human interferon beta. The pharmaceutical composition according to claim 7, wherein the pharmaceutical composition is for preventing or treating a disease selected from the group consisting of cancer or tumor, autoimmune disease, viral infection, HIV-related disease, and hepatitis C. The pharmaceutical composition according to claim 8, wherein the autoimmune disease is multiple sclerosis.

Images