KR20220022110A - Gene Editing for Hemophilia A Using Improved Factor VIII Expression - Google Patents

Abstract

In some embodiments, provided herein are materials and methods for treating hemophilia A ex vivo or in vivo in a subject. Also provided herein, in some embodiments, are materials and methods for knock-in into a genome a coding sequence encoding a synthetic FVIII having a B domain substitution.

Description

Gene Editing for Hemophilia A Using Improved Factor VIII Expression

The disclosure provided herein relates to materials and methods for treating hemophilia A, both ex vivo and in vivo. Also provided are materials and methods for gene editing for regulating the expression, function or activity of blood-clotting proteins, such as factor VIII (FVIII).

Hemophilia A (HemA) is caused by a genetic defect in the FVIII gene (F8) that results in low or undetectable levels of FVIII protein in the blood. This results in ineffective thrombus formation at the site of tissue damage, resulting in uncontrolled bleeding, which can be fatal if left untreated. Replacement of defective or non-functional FVIII protein is an effective treatment for HemA subjects and is the current standard of care. However, protein replacement therapy requires frequent intravenous administration of FVIII protein, is inconvenient for adults, problematic for children, is expensive (>$200,000/year), and unless the treatment regimen is strictly followed, It can lead to break through bleeding events.

A permanent cure for hemophilia A is highly desirable. Although virus-based gene therapy using adeno-associated virus (AAV) has shown some promise in preclinical animal models and in human subjects, it has numerous drawbacks. For example, the reported AAV-based gene therapy uses the FVIII coding sequence driven by a liver-specific promoter encapsulated inside the AAV virus capsid (usually especially with serotypes AAV5, AAV8 or AAV9 or AAVrh10). In general, AAV viruses used for gene therapy deliver a packaged coding sequence cassette into the nucleus of a transduced cell, where the cassette remains almost exclusively episomal, which results in a therapeutic protein It is an episomal copy of the coding sequence. AAV does not have a mechanism for integrating the encapsulated DNA into the genome of the host cell. Because the therapeutic coding sequence is maintained as an episome, it is therefore not replicated when the host cell divides and can be lost from daughter cells. It has been demonstrated that when liver cells containing AAV episomes are induced to divide, the AAV genome does not replicate, but instead is diluted. Therefore, AAV-based gene therapy is not expected to be effective in children whose liver has not yet reached adult size. Because current therapies are inadequate, there is a pressing need for new therapies for HemA in adults and children that are effective, permanent or long-lasting.

FVIII is initially expressed as a protein with the domain structure A1-A2-B-A3-C1-C2. The protein is activated by proteolytic cleavage of the bulky, highly glycosylated B domain, leaving heavy (A1-A2) and light (A3-C1-C2) chain heterodimers. The B domain of the FVIII protein is not required for biological activity. Removal of the large B domain from the FVIII coding sequence is essential to enable reliable packaging into AAV vectors used for in vivo delivery. However, removal of the B domain containing up to 18 N-linked glycosylation sites impairs secretion of the FVIII protein. Therefore, there is an urgent need for an improved form of FVIII that can be efficiently and effectively expressed.

We have discovered gene editing compositions and methods that can be used to compensate for a defective F8 gene, resulting in expression of a functional FVIII protein. Accordingly, the invention provided herein provides systems and compositions for altering host cell DNA sequences, methods for altering host cell genomes, methods and systems for inserting synthetic Factor VIII coding sequences that provide for improved expression, into a subject cells having a synthetic factor VIII coding sequence that provides improved expression that can be administered, methods of treating hemophilia A, and kits embodying any of the foregoing.

In one aspect, provided herein is a system for altering a host cell DNA sequence having: a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; a guide RNA (gRNA) or a nucleic acid encoding a gRNA having a spacer sequence complementary to the host cell locus; and a donor template having a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein comprises B domain substitutions, wherein the B domain substitutions have 0 to 9 N-linked glycosylation sites and 3 to about 40 amino acids in length. A donor template with

In another aspect, there is provided a method of editing a genome in a host cell comprising providing to the cell a gRNA or a nucleic acid encoding the gRNA having a spacer sequence complementary to a host cell locus; a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and a donor template having a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein has B domain substitutions, wherein the B domain substitutions have 0 to 9 N-linked glycosylation sites and 3 to about 40 amino acids in length. having a donor template.

In another aspect, provided is a cell wherein the genome of the cell comprises DNA encoding a synthetic FVIII protein, wherein the synthetic FVIII protein has a B domain substitution, wherein the B domain substitution has 0 to 9 N-linked glycosylation sites. and 3 to about 40 amino acids in length.

In another aspect, there is provided a method of treating hemophilia A in a subject by administering to the subject a cell having a DNA encoding a synthetic FVIII protein as described above.

In another aspect, there is provided a method of treating hemophilia A in a subject by providing to a cell in the subject: a gRNA having a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA; a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and a donor template having a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein has B domain substitutions, wherein the B domain substitutions have 0 to 9 N-linked glycosylation sites and 3 to about 40 amino acids in length. having a donor template.

In another aspect, provided herein is a kit comprising one or more elements of the system described above, further comprising instructions for use.

In another aspect, provided herein is a nucleic acid having a polynucleotide sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein has B domain substitutions, the B domain substitutions comprising 0-9 N-linked glycosylation sites and 3 to about 40 amino acids in length.

In another aspect, provided herein is a method of increasing the amount of FVIII in a subject by providing to a cell in the subject, wherein the subject has a first serum level of FVIII: a spacer sequence complementary to a host cell locus a nucleic acid encoding gRNA or gRNA having a; a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and a donor template having a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein has B domain substitutions, wherein the B domain substitutions have 0 to 9 N-linked glycosylation sites and 3 to about 40 amino acids in length. having a donor template.

An understanding of certain features and advantages of the present disclosure will be obtained by reference to the following detailed description and accompanying drawings, which set forth exemplary embodiments in which the principles of the disclosure may be employed:
1 depicts blood FVIII levels in mice following hydrodynamic injection of five plasmids encoding FVIII donor templates followed by LNP delivery of Cas9 mRNA and sgRNA.
Figure 2 depicts FVIII levels in the blood of mice injected with AAV8 virus encapsulating FVIII donor templates pCB099 and pCB102 and 4 weeks later administered LNP encapsulating spCas9 mRNA and gRNA mALbT1. FVIII levels were measured 10 days after LNP injection.
Figure 3 depicts blood FVIII activity of hemophilia A mice administered with four different FVIII donor plasmids by HDI followed by LNPs encapsulating spCas9 and mALbT1 gRNAs.
4 shows the blood FVIII activity of hemophilia A mice 11 and 28 days after LNP administration. Mice were given 2 x 10 ¹² vg/kg of AAV8 virus 4 weeks before LNP administration.
Figure 5 shows the hydrodynamic injection of plasmids pCB1007 (n=7 mice), pCB1019 (n=7) and pCB1020 (n=6), and retroorbitally injected LNP encapsulating mALbT1 gRNA and Cas9 mRNA. Blood FVIII activity is shown. FVIII was measured on days 6 and 9 after LNP administration.
Figure 6 shows the hydrodynamic injection of plasmids pCB1007 (n=7 mice), pCB1025 (n=7) and pCB1026 (n=6), and retroorbitally injected LNP encapsulating mALbT1 gRNA and Cas9 mRNA. Blood FVIII activity is shown. FVIII was measured on days 6 and 9 after LNP administration.
Figure 7 shows the results for the cleavage efficiency of guide RNAs T4, T5, T11 and T13 (targeting human albumin intron 1) in primary human hepatocytes from 4 donors by comparing the 19 base vs. 20 base target sequence. will be.
8 depicts intrinsic expression efficiency (FVIII activity divided by targeted integration frequency) for FVIII donor cassettes with 0-7 N-linked glycan motifs and different codon optimizations.
9 depicts FVIII constructs in which the B domain substitutions contain 0, 1, 3, 5 or 6 glycans.
10 shows blood FVIII activity of hemophilia A mice 11 days after administration of LNP.
Fig. 11 shows blood FVIII activity of mice with hemophilia A at 28 days after administration of LNP.
12 depicts intrinsic expression efficiency (FVIII activity divided by targeted integration frequency) for FVIII donor cassettes with 0, 1, 3, 5 or 6 N-linked glycan motifs.

RNA guided endonuclease editing offers advantages over, for example, lentiviral gene therapy methods. However, insertion of large sequences in editing protocols can be problematic, for example, because large sequences can be difficult to package for delivery, or because they can be difficult to manufacture compared to short sequences. Some proteins require the presence of N-linked glycosylation sites in order to be correctly secreted from the cell in which they are expressed. The consensus amino sequence of the N-glycosylation site is NXT/S, and X is any residue except proline. Glycans are added to N (asparagine) residues (KF Medzihradszky, Meth Mol Biol (2008) 446 :293-316). The inventors have discovered that by greatly reducing or even eliminating the number of N-linked glycosylation sites in such proteins, it is possible to reduce the size of protein coding sequences without adversely affecting transcription, translation or secretion. For example, we found that engineering of the B domain of the FVIII coding sequence to reduce or eliminate the number of glycosylation sites produces an engineered FVIII protein with FVIII function, while the resulting engineered (synthetic) FVIII It has been found that it is possible to reduce the size of the FVIII sequence to be used in gene editing without significantly affecting transcription, translation or secretion. Moreover, minimizing the number of N-glycan sites added to the B domain deleted FVIII minimizes the risk of generating a novel epitope for an antibody or T-cell, whereby the novel FVIII protein induces an immune response in a subject. will reduce the possible risk. The present disclosure provides compositions and methods for gene editing, particularly for modulating the expression, function or activity of a blood-coagulation protein, such as FVIII, in a cell by genome editing. The present disclosure also provides compositions and methods for treating a subject having hemophilia A, particularly both ex vivo and in vivo. In particular, the present invention provides genome editing methods and systems that provide improved integration and improved expression, and synthetic FVIII coding sequences and proteins that can ameliorate hemophilia A.

Justice

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this claimed subject matter belongs. It is to be understood that the specific details for carrying out the invention are illustrative and illustrative only, and not limiting of any claimed subject matter. In this application, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. In this application, the use of "or" means "and/or" unless stated otherwise. Additionally, use of the term “comprising”, as well as other forms, such as “comprises,” “includes,” and “included,” is not limiting.

Although features of the disclosure may be described in the context of a single embodiment, the features may also be provided individually or in any suitable combination. Conversely, although a disclosure may, for clarity, be described herein in the context of separate embodiments, the disclosure may also be practiced in a single embodiment. Any published patent application and any other published references, documents, manuscripts and scientific literature cited herein are incorporated herein by reference for any purpose. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

As used herein, ranges and amounts may be expressed as “about” a particular value or range. “About” also includes the precise amount. Thus, “about 5 μL” means “about 5 μL” and also “5 μL”. In general, the term “about” includes amounts expected to be within an experimental error, such as ±1%, ±2%, ±3%, ±5%, or ±10%.

When a range of numerical values is presented herein, it is contemplated that each intervening value between the lower limit and the upper limit of the range, the value being the upper and lower limit of the range, and all recited values having the range are encompassed within the present disclosure. do. All possible sub-ranges within the lower and upper limits of that range are also contemplated by the present disclosure.

The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to denote a series of linear amino acid residues linked together by peptide bonds, the series being proteins, polypeptides, oligopeptides, peptides and may contain fragments thereof. Proteins may be composed of naturally occurring amino acids and/or synthetic (eg, modified or non-naturally occurring) amino acids. As used herein, the term “amino acid” or “peptide residue” may refer to both naturally occurring and synthetic amino acids. The terms “polypeptide”, “peptide” and “protein” refer to fusion proteins with heterologous amino acid sequences, fusions with heterologous and homologous leader sequences with or without an N-terminal methionine residue; immunologically tagged proteins; fusion proteins with a detectable fusion partner, for example, fusion proteins including, but not limited to, fluorescent proteins, β-galactosidase, luciferase, and the like as fusion partners. It should also be noted that a dash symbol at the beginning or end of an amino acid sequence indicates either a peptide bond to an additional sequence of one or more amino acid residues, or a covalent bond to a carboxyl or hydroxyl end group. However, the absence of a dash symbol should not be construed to mean that no such peptide bond or covalent bond to a carboxyl or hydroxyl end group exists, as omitting it is customary in the representation of amino acid sequences.

The terms “polynucleotide”, “oligonucleotide”, “oligomer”, “oligo”, “coding sequence” and “nucleic acid” refer to nucleotides in the form of polymers of different lengths, i.e., ribonucleotides or deoxyribonucleotides. Accordingly, these terms include, without limitation, single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrid, or purine and pyrimidine bases, or other natural, chemically or biochemically modified polymers having a modified, unnatural or derivatized nucleotide base.

The term “functionally equivalent” or “functionally equivalent” has, without limitation, a structure or sequence derived from a compound disclosed herein, and the structure or sequence has the same or similar activity and utility, or is referenced by those skilled in the art based on such similarity Refers to any molecule, such as a nucleic acid or protein, sufficiently similar to those disclosed herein to be expected to exhibit the same or similar activity and utility as the compound. Modifications to obtain functional equivalents, “derivatives” or “variants” may include, for example, additions, deletions and/or substitutions of one or more of nucleic acid or amino acid residues.

A functional equivalent of a protein or a fragment of a functional equivalent may have one or more conservative amino acid substitutions. The term “conservative amino acid substitution” refers to the substitution of one amino acid for another amino acid having properties similar to the original amino acid, ie, the substitution of one amino acid for another amino acid from the same group. The groups of conservative amino acids are:

Conservative substitutions may be introduced at any position in a given peptide or fragment thereof. However, it may also be desirable to introduce non-conservative substitutions, particularly, but not limited to, non-conservative substitutions in any one or more positions. Non-conservative substitutions that result in the formation of a functionally equivalent fragment of a peptide are, for example, polarity, charge, conformational size and/or changes to another protein or nucleic acid while maintaining the anticoagulant function of the functional equivalent or variant fragment thereof. The binding will be different.

"Percent sequence identity" is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of a polynucleotide or polypeptide sequence within the comparison window is determined for optimal alignment of the two sequences (with no additions or deletions). It may have additions or deletions (ie, gaps) compared to a reference sequence that does not). In some cases, the percentage determines the number of positions in which the same nucleic acid base or amino acid residue is present in both sequences to provide the number of positions that are matched, divide the number of positions that are matched by the total number of positions within the comparison window, and result is calculated by multiplying by 100 to give the percentage of sequence identity. Sequence identity is identified using standard parameters (eg: gap opening penalty = 15; gap extension penalty = 6.6; gap separation penalty range = 8).

The term “identical” or “percentage of identity” in the context of two or more nucleic acid or polypeptide sequences, as measured using one of the following sequence comparison algorithms, or by manual alignment and visual inspection, spans a comparison window or marked region When compared and aligned for maximum correspondence, identical or a specified percentage of identical (eg, 60%, 65%, 70%, over a specific region, eg, the entire polypeptide sequence or individual domains of a polypeptide, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity) amino acid residues or nucleotides). Such sequences are then said to be "substantially identical". This definition also refers to the complement of a test sequence.

As used interchangeably herein, the terms "complementary" or "substantially complementary" means that a nucleic acid (eg, DNA or RNA) is non-covalently attached to another nucleic acid in a sequence-specific, antiparallel manner. It is meant to have a sequence of nucleotides that allows it to bind, ie to form Watson-Crick base pairing and/or G/U base pairing (ie, the nucleic acid specifically binds to a complementary nucleic acid). As is known in the art, standard Watson-Crick base-pairing includes: adenine (A) to base pair with thymidine (T), adenine (A) to base pair with uracil (U) and guanine (G), which base pairs with cytosine (C).

A DNA sequence that "encodes" a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein, or a DNA polynucleotide may encode an RNA that is not translated into a protein (e.g., tRNA, rRNA, or guide RNA; “non-coding” RNA or “ncRNA”) Also referred to as "). A protein coding sequence, or a sequence encoding a particular protein or polypeptide, is transcribed into mRNA (in the case of DNA) and translated into a polypeptide (in the case of mRNA) in vitro or in vivo when placed under the control of appropriate regulatory sequences. is a nucleic acid sequence.

As used herein, "codon" refers to a sequence of three nucleotides that together form a unit of the genetic code in a DNA or RNA molecule. As used herein, the term “codon degeneracy” refers to the property of the genetic code that allows for variations in the nucleotide sequence without affecting the amino acid sequence of the encoded polypeptide.

The term "codon-optimized" or "codon optimization" refers to the coding region of a gene or nucleic acid molecule for transformation of a suitable host, without altering the polypeptide encoded by the DNA, to reflect the codon usage of the host organism. Represents an alteration of a codon in a gene or the coding region of a nucleic acid molecule. Such optimization involves replacing at least one or more than one or a significant number of codons with one or more codons used more frequently in the genes of the organism in question. Codon usage tables are readily available, for example, in the "Codon Usage Database" available at www.kazusa.or.jp/codon/ (visited January 30, 2019). By using knowledge of codon usage or codon preference within each organism, one of ordinary skill in the art would apply the frequency to any given polypeptide sequence, encoding the polypeptide, but using codons that are optimal for the given species. You can create fragments. Codon-optimized coding regions are designed by methods known to those skilled in the art.

For example, when used in reference to a cell, nucleic acid, protein or vector, the term "recombinant" or "engineered" indicates that the cell, nucleic acid, protein or vector has been modified by, or is the result of, laboratory methods. . Thus, for example, recombinant or engineered proteins include proteins produced by laboratory methods. Recombinant or engineered proteins may contain amino acid residues that are not observed in the native (non-recombinant or wild-type) form of the protein, or may contain modified, eg, labeled amino acid residues. The term may include any modifications to a peptide, protein or nucleic acid sequence. Such modifications include: any chemical modification of a peptide, protein or nucleic acid sequence; additions, deletions and/or substitutions of one or more amino acids in the peptide or protein; and one or more additions, deletions and/or substitutions of nucleic acids within the nucleic acid sequence.

The term "genomic DNA" or "genomic sequence" refers to the DNA of the genome of an organism, including but not limited to the DNA of the genome of bacteria, fungi, algae, plants or animals.

As used herein, “transgene”, “exogenous gene” and “exogenous sequence” refer to a nucleic acid sequence or gene that is not present in the genome of a cell but is artificially introduced into the genome, for example, by genome-editing. indicates.

As used herein, “endogenous gene” or “endogenous sequence” refers to a nucleic acid sequence or gene that is naturally present in the genome of a cell without being introduced through any artificial means.

The term “vector” or “expression vector” refers to a replicon such as a plasmid, phage, virus or It means cosmid.

The term “expression cassette” refers to a vector having a DNA coding sequence operably linked to a promoter. "Operably linked" refers to the juxtaposition in which they exist under a relationship that allows the components so described to function in their intended manner. For example, a promoter is operably linked to a coding sequence if it affects its transcription or expression. The terms “recombinant expression vector” and “DNA construct” are used interchangeably herein to refer to a vector and a DNA molecule having at least one insert. Recombinant expression vectors are usually generated for the purpose of expression and/or amplification of the insert(s) or for the construction of other recombinant nucleotide sequences. The nucleic acid(s) may or may not be operably linked to a promoter sequence and may or may not be operably linked to a DNA regulatory sequence.

The term “regulatory sequence” includes, for example, promoters, enhancers and other expression control elements (eg, polyadenylation signals). Such regulatory sequences are known in the art and are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells, and those that direct expression of a nucleotide sequence only in a particular host cell (eg, tissue-specific regulatory sequences).

A cell is "genetically modified", "transformed", or "transfected" with exogenous DNA, eg, a recombinant expression vector, when such DNA is introduced inside the cell. The presence of exogenous DNA results in permanent or temporary genetic changes. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. Genetically modified (or transformed or transfected) cells that have therapeutic activity, eg, to treat hemophilia A, are used and may be referred to as “therapeutic cells”.

The term "concentration" as used in the context of a molecule, such as a peptide fragment, refers to the amount of molecule present in a given volume of solution, eg, number of moles of molecule.

The term “acute phase protein” refers to a protein whose expression or serum concentration changes in response to inflammation. Examples of acute phase proteins include albumin, transferrin, transthyretin, fibrinogen, antithrombin, and the like.

The terms “individual,” “subject,” and “host” refer to any subject for whom diagnosis, treatment, or therapy is desired. In some embodiments, the subject is a mammal. In some aspects, the subject is a human. In some embodiments, the subject is a human patient. In some embodiments, the subject has, is suspected of having, and/or has one or more symptoms of hemophilia A. In some embodiments, the subject is a human diagnosed as at risk for hemophilia A at or after diagnosis. In some cases, a diagnosis of being at risk for hemophilia A may be determined based on the presence of an endogenous FVIII gene or one or more mutations in a genomic sequence near the FVIII gene in the genome that may affect expression of the FVIII gene.

The term "treatment" as used in connection with a disease or disorder means that at least an improvement of the symptoms associated with the disorder in which the individual suffers is achieved, and the improvement is in a broad sense at least a parameter, e.g., the condition being treated (e.g., It is used to indicate a decrease in the intensity of symptoms associated with hemophilia A). Treatment also includes situations in which the condition or at least the symptoms associated therewith are completely inhibited, eg, its occurrence has been prevented, or has been completely eliminated, such that the host is no longer afflicted with the disease or at least the symptoms characteristic of the disease. Thus, treatment includes: (i) prophylaxis (ie, preventing the clinical symptoms from developing, eg, reducing the risk of developing clinical symptoms, including preventing disease progression) ; and (ii) inhibition (ie, arresting the development or further development of clinical symptoms, eg, alleviating or completely inhibiting active disease).

The terms “effective amount”, “pharmaceutically effective amount” and “therapeutically effective amount” refer to an amount of a composition that, when administered to a subject having a particular disease, is sufficient to provide the desired utility. In the context of ex vivo treatment of hemophilia A, the term "effective amount" refers to the amount of a population of therapeutic cells or their progeny required to prevent or ameliorate one or more signs or symptoms of hemophilia A and to provide the desired effect. A composition having therapeutic cells or their progeny to Accordingly, the term “therapeutically effective amount” refers to a therapeutic cell or composition comprising therapeutic cells sufficient to promote a particular effect when administered to a subject in need thereof, such as a subject having or at risk for hemophilia A. refers to the amount or number of Also, an effective amount is used to prevent or delay the onset of symptoms of a disease, alter the course of symptoms of a disease (eg, but not limited to slowing the progression of symptoms of a disease), or to reverse symptoms of a disease. a sufficient amount or number. In the context of in vivo treatment of hemophilia A in a subject (e.g., a patient) or genome editing performed in cells cultured in vitro, an effective amount comprises editing the genome of a cell in a subject or of a cell cultured in vitro. indicates the amount of components used for genome editing, such as gRNAs, donor templates, and/or site-directed polypeptides (eg, DNA endonuclease), required to It is understood that, for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art.

As used herein, the terms “pharmaceutical composition” and “medicament” refer to a cell of the invention (expressing a synthetic FVIII protein) and/or one or more components of a system of the invention (i.e., a gRNA or a gRNA that encodes a gRNA) nucleic acid, DNA endonuclease or a nucleic acid encoding a DNA endonuclease and/or a donor template encoding a synthetic factor VIII protein) in combination with a pharmaceutically acceptable excipient.

As used herein, the term “pharmaceutically acceptable excipient” refers to any suitable substance that provides a pharmaceutically acceptable carrier, excipient, or diluent for administration of the compound(s) of interest to a subject. "Pharmaceutically acceptable excipient" may include substances referred to as pharmaceutically acceptable diluents, pharmaceutically acceptable excipients and pharmaceutically acceptable carriers.

The term “synthetic FVIII” has significant sequence identity to the A and C domains of wild-type human factor VIII (GenBank: CAD97566.1; Vehar et al., Nature (1984) 312 :337-42), but wild-type B Proteins with B domain substitutions instead of domains are indicated. In one embodiment of the invention, the sequences of the A and C domains of the synthetic FVIII protein are 80, 90, 95, 98 or 99% identical to the wild-type sequences of the A and C domains. In some embodiments, the B domain substitution is a polypeptide of any sequence, having from about 10 to about 200 amino acids. In some embodiments, the B domain substitution has from about 20 to about 100 amino acids. In some embodiments, the B domain substitution is less than 40 amino acids (eg, having any number of amino acids from 3 to 40 amino acids) and 1 to 9 that, when expressed, provide for glycosylation of the B domain substitution. may have N-linked glycosylation sites. The B domain substitution may further comprise a protease cleavage site such that the synthetic FVIII protein can be cleaved into the heavy and light chains in the same manner as the wild-type protein. In one embodiment, the B domain substitution protein sequence comprises 1 to 10 amino acids from the N- and C-terminus of the wild-type B domain, in addition to 1 to 9 N-linked glycosylation (“glycans”) sites. do. In one embodiment, the B domain substitution protein sequence has 1 to 6 glycan sites. In one embodiment, the B domain substitution protein sequence has 1 to 5 glycan sites. In one embodiment, the B domain substitution protein sequence has 1 to 4 glycan sites. In one embodiment, the B domain substitution protein sequence has 2 to 4 glycan sites. In one embodiment, the B domain substitution protein sequence is at least 80% with the sequence of any one of SEQ ID NOs: 362-369, 371 and 373, or any one of SEQ ID NOs: 362-369, 371 and 373 , 90%, 95%, 98% or 99% identical sequences. In one embodiment, the B domain substitution protein sequence is at least 80% with the sequence of any one of SEQ ID NOs: 362-366, 371 and 373, or any one of SEQ ID NOs: 362-366, 371 and 373 , 90%, 95%, 98% or 99% identical sequences. In one embodiment, the B domain substitution protein sequence is at least 80% with the sequence of any one of SEQ ID NOs: 362 to 364, 371 and 373, or any one of SEQ ID NOs: 362 to 364, 371 and 373 , 90%, 95%, 98% or 99% identical sequences. In one embodiment, the B domain substitution protein sequence is at least 80%, 90%, 95%, 98 % or 99% identical sequences. In one embodiment, the B domain substitution protein sequence has the sequence of any one of SEQ ID NOs: 362-369. In one embodiment, the B domain substitution protein sequence has the sequence of any one of SEQ ID NOs: 362-366. In one embodiment, the B domain substitution protein sequence has the sequence of any one of SEQ ID NOs: 362 to 364. In one embodiment, the B domain substitution protein sequence has the sequence of any one of SEQ ID NOs: 362 to 363, 371 and 373. In one embodiment, the B domain substitution protein sequence has the sequence of any one of SEQ ID NOs: 371 or 373.

The term “safe harbor locus” refers to a cell that does not disrupt the metabolism or regulation of a cell (e.g., by causing apoptosis, proliferation, etc.) and/or other cells (non-edited cells) or (e.g., loci in the host cell genome that can be modified (e.g., by truncating or inserting donor sequences) without causing a hazard or deleterious effect to the host organism as a whole (by inappropriately causing overexpression of growth factors, etc.) indicates. In some embodiments, the safe harbor locus is a locus expressed in a host cell. In some embodiments, the safe harbor locus is the albumin locus, the fibrinogen locus, the AAVS1 locus, or the transferrin locus.

nucleic acid

Genome-targeting nucleic acid or guide RNA

The present disclosure provides genome-targeting nucleic acids capable of directing the activity of an associated polypeptide (eg, a site-directed polypeptide such as a DNA endonuclease) to a specific target sequence within the target nucleic acid. In some embodiments, the genome-targeting nucleic acid is RNA. Genome-targeting RNA is referred to herein as "guide RNA" or "gRNA". The guide RNA has at least a spacer sequence capable of hybridizing to a target nucleic acid sequence of interest, and a CRISPR repeat sequence. In type II systems, the gRNA has a second RNA, also referred to as a tracrRNA sequence. In type II gRNAs, the CRISPR repeat sequence and the tracrRNA sequence hybridize to each other to form a duplex. In type V gRNAs, crRNAs form a duplex. In both systems, the duplex binds the site-directed polypeptide, causing the gRNA and the site-directed polypeptide to form a complex. The genome-targeting nucleic acid provides target specificity to the complex due to association with the site-directed polypeptide. Thus, a genome-targeting nucleic acid directs the activity of a site-directed polypeptide.

In some embodiments, the genome-targeting nucleic acid is a double-molecule gRNA. Double-molecule gRNAs have two strands of RNA. The first strand has, in 5' to 3' direction, an optional spacer extension sequence, a spacer sequence and a minimal CRISPR repeat sequence. The second strand has a minimal tracrRNA sequence (complementary to a minimal CRISPR repeat sequence), a 3' tracrRNA sequence and an optional tracrRNA extension sequence. In some embodiments, the genome-targeting nucleic acid is a single-molecule gRNA. Single-molecule gRNAs in type II systems are in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimal CRISPR repeat sequence, a single-molecule guide linker, a minimal tracrRNA sequence, a 3' tracrRNA sequence and an optional tracrRNA has an extended sequence. The optional tracrRNA extension may have elements that confer additional functionality (eg, stability) to the gRNA. A single-molecule guide linker joins a minimal CRISPR repeat and a minimal tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension has one or more hairpins. In the type V system, the sgRNA has, in the 5' to 3' direction, a minimal CRISPR repeat sequence and a spacer sequence.

By way of illustration, gRNAs, or other smaller RNAs, used in the CRISPR/Cas/Cpf1 system can be readily synthesized by chemical means, as exemplified below and described in the art. Although chemical synthesis procedures continue to expand, purification of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to be more challenging because polynucleotides This is because the length increases significantly over a hundred nucleotides. One approach used to generate longer length RNA is to create two or more molecules that are ligated together. Even longer RNAs, such as those encoding Cas9 or Cpf1 endonucleases, are more readily produced enzymatically. RNA modifications, as described in the art, for example, modifications that enhance stability and/or reduce the likelihood or extent of an innate immune response and/or enhance other properties are those of chemical synthesis and/or or during or after enzymatic production.

spacer extension sequence

In some embodiments of a genome-targeting nucleic acid, a spacer extension sequence may alter activity and/or provide stability and/or provide a site for modification of the genome-targeting nucleic acid. Spacer extension sequences may alter on- or off-target activity or specificity. In some embodiments, a spacer extension sequence is provided. The spacer extension sequence is 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000 or 7000 or more nucleotides in length. The spacer extension sequence is about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240 , 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000 or 7000 or more nucleotides in length. The spacer extension sequence is 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, 7000 or less nucleotides in length. In some embodiments, the spacer extension sequence is less than 10 nucleotides in length. In some embodiments, the spacer extension sequence is between 10 and 30 nucleotides in length. In some embodiments, the spacer extension sequence is between 30 and 70 nucleotides in length.

In some embodiments, the spacer extension sequence has another moiety (eg, a stability control sequence, an endoribonuclease binding sequence, a ribozyme). In some embodiments, the moiety reduces or increases the stability of the nucleic acid targeting nucleic acid. In some embodiments, the moiety is a transcription terminator segment (ie, a transcription termination sequence). In some embodiments, the moiety functions in a eukaryotic cell. In some embodiments, the moiety functions in a prokaryotic cell. In some embodiments, the moiety functions in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties include 5' caps (eg, 7-methylguanylate cap (m7G)), riboswitch sequences (eg, regulated stability and/or regulation by proteins and protein complexes). sequences that form dsRNA duplexes (i.e. hairpins), sequences that target RNA to subcellular locations (e.g., nuclear, mitochondrial, chloroplast, etc.), tracking (e.g., fluorescent molecules) Modifications or sequences that provide for direct conjugation to, conjugation to a moiety that facilitates fluorescence detection, sequences that allow fluorescence detection, etc.), and/or proteins (eg, transcriptional activators, transcriptional repressors). , DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like).

spacer sequence

The spacer sequence can hybridize to a sequence within the target nucleic acid of interest. The spacer of the genome-targeting nucleic acid interacts with the target nucleic acid in a sequence-specific manner through hybridization (ie, base pairing). Thus, the nucleotide sequence of the spacer depends on the sequence of the target nucleic acid of interest.

In the CRISPR/Cas system herein, the spacer sequence is designed to hybridize to a target nucleic acid located 5' of the PAM of the Cas9 enzyme used in the system. The spacer may be perfectly identical to the target sequence, or may have mismatches. Each Cas9 enzyme has a specific PAM sequence that it recognizes in the target DNA. For example, Streptococcus pyogenes has the sequence 5'-NRG-3' in the target nucleic acid, wherein R has either A or G, N is any nucleotide, and N is the target targeted by the spacer sequence. It recognizes a PAM with a nucleic acid sequence immediately 3'.

In some embodiments, the target nucleic acid sequence has 20 nucleotides. In some embodiments, the target nucleic acid has less than 20 nucleotides. In some embodiments, the target nucleic acid has more than 20 nucleotides. In some embodiments, the target nucleic acid has at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid has at most 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid sequence has 20 bases immediately 5' to the first nucleotide of the PAM. For example, in the sequence having 5'-NNNNNNNNNNNNNNNNNNNN NRG -3' (SEQ ID NO: 191), the target nucleic acid comprises a sequence corresponding to N, where N is any nucleotide, and the underlined NRG sequence (R is G or A) Streptococcus pyogenes Cas9 PAM. In some embodiments, the PAM sequence used in the compositions and methods of the present disclosure recognized as a sequence by Sp Cas9 is NGG.

In some embodiments, the spacer sequence that hybridizes to the target nucleic acid is at least about 6 nucleotides (nt) in length. The spacer sequence may be at least about 6 nt, about 10 nt, about 15 nt, about 18 nt, about 19 nt, about 20 nt, about 25 nt, about 30 nt, about 35 nt or about 40 nt, about 6 nt to about 80 nt. nt, about 6 nt to about 50 nt, about 6 nt to about 45 nt, about 6 nt to about 40 nt, about 6 nt to about 35 nt, about 6 nt to about 30 nt, about 6 nt to about 25 nt, about 6 nt to about 20 nt, about 6 nt to about 19 nt, about 10 nt to about 50 nt, about 10 nt to about 45 nt, about 10 nt to about 40 nt, about 10 nt to about 35 nt, about 10 nt to about 30 nt, about 10 nt to about 25 nt, about 10 nt to about 20 nt, about 10 nt to about 19 nt, about 19 nt to about 25 nt, about 19 nt to about 30 nt, about 19 nt to about 35 nt, about 19 nt to about 40 nt, about 19 nt to about 45 nt, about 19 nt to about 50 nt, about 19 nt to about 60 nt, about 20 nt to about 25 nt, about 20 nt to about 30 nt, about 20 nt to about 35 nt, about 20 nt to about 40 nt, about 20 nt to about 45 nt, about 20 nt to about 50 nt, or about 20 nt to about 60 nt. In some embodiments, the spacer sequence has 20 nucleotides. In some embodiments, the spacer has 19 nucleotides. In some embodiments, the spacer has 18 nucleotides. In some embodiments, the spacer has 17 nucleotides. In some embodiments, the spacer has 16 nucleotides. In some embodiments, the spacer has 15 nucleotides.

In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99% or 100%. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, up to about 85%, up to about 90%, up to about 95%, up to about 97%, up to about 98%, up to about 99% or 100%. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is 100% over the 6 contiguous nucleotides 5′ most 5′ of the target sequence of the complementary strand of the target nucleic acid. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at least 60% over about 20 contiguous nucleotides. In some embodiments, the length of the spacer sequence and the target nucleic acid may differ by 1 to 6 nucleotides, which can be considered a bulge or bulges.

In some embodiments, the spacer sequence is designed or selected using a computer program. The computer program can determine variables such as predicted melting temperature, secondary structure formation, predicted annealing temperature, sequence identity, genomic context, chromatin accessibility, GC%, genomic occurrence (e.g., of identical or similar but mismatches, insertions or deletions). As a result, the frequency of sequences that vary in one or more spots), methylation status, presence of SNPs, etc. can be used.

Minimum CRISPR repeat sequence

In some embodiments, the minimal CRISPR repeat sequence is at least about 30%, about 40%, about 50%, about 60%, about 65 %, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or 100% sequence identity, e.g., JJ Ferretti et al., Proc Natl Acad Sci USA (2001) 98 (8):4658-63).

In some embodiments, the minimal CRISPR repeat sequence has nucleotides capable of hybridizing to the minimal tracrRNA sequence in the cell. The minimum CRISPR repeat sequence and the minimum tracrRNA sequence form a duplex. Together, the minimal CRISPR repeat sequence and the minimal tracrRNA sequence bind to the site-directed polypeptide. At least a portion of the minimal CRISPR repeat sequence is hybridized to the minimal tracrRNA sequence. In some embodiments, at least a portion of the minimum CRISPR repeat sequence is at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80% from the minimum tracrRNA sequence. , about 85%, about 90%, about 95% or 100% complementarity. In some embodiments, at least a portion of the minimum CRISPR repeat sequence is at most about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80% of the minimum tracrRNA sequence. , about 85%, about 90%, about 95% or 100% complementarity.

The minimum CRISPR repeat sequence may be from about 7 nucleotides to about 100 nucleotides in length. For example, the minimum CRISPR repeat sequence can have a length of about 7 nt to about 50 nt, about 7 nt to about 40 nt, about 7 nt to about 30 nt, about 7 nt to about 25 nt, about 7 nt to about 20 nt. nt, about 7 nt to about 15 nt, about 8 nt to about 40 nt, about 8 nt to about 30 nt, about 8 nt to about 25 nt, about 8 nt to about 20 nt, about 8 nt to about 15 nt, about 15 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt, or about 15 nt to about 25 nt. In some embodiments, the minimum CRISPR repeat sequence is approximately 9 nucleotides in length. In some embodiments, the minimum CRISPR repeat sequence is approximately 12 nucleotides in length.

In some embodiments, the minimal CRISPR repeat sequence spans a stretch of at least 6, 7, or 8 contiguous nucleotides (eg, a wild-type crRNA from Streptococcus pyogenes (eg, the above at least about 60% identical to JJ Ferretti et al.)). For example, the minimal CRISPR repeat sequence is at least about 65% identical, at least about 70% identical, at least about 75% identical, or , at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100% identical.

Minimum tracrRNA sequence

In some embodiments, the minimal tracrRNA sequence is at least about 30% from a reference tracrRNA sequence (e.g., wild-type tracrRNA from Streptococcus pyogenes (see, e.g., JJ Ferretti et al., supra)), a sequence having about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or 100% sequence identity.

In some embodiments, the minimal tracrRNA sequence has nucleotides that hybridize to the minimal CRISPR sequence in the cell. The minimum tracrRNA sequence and the minimum CRISPR repeat sequence form a duplex. Together, minimal tracrRNA sequence and minimal CRISPR repeats bind site-directed polypeptides. At least a portion of the minimal tracrRNA sequence is capable of hybridizing to a minimal CRISPR repeat sequence. In some embodiments, the minimal tracrRNA sequence comprises at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% of the minimum CRISPR repeat sequence. %, about 90%, about 95% or 100% complementary.

A minimal tracrRNA sequence may be from about 7 nucleotides to about 100 nucleotides in length. For example, the minimum length of the tracrRNA sequence is between about 7 nt and about 50 nt, between about 7 nt and about 40 nt, between about 7 nt and about 30 nt, between about 7 nt and about 25 nt, between about 7 nt and about 20 nt, about 7 nt to about 15 nt, about 8 nt to about 40 nt, about 8 nt to about 30 nt, about 8 nt to about 25 nt, about 8 nt to about 20 nt, about 8 nt to about 15 nt, about 15 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt, or about 15 nt to about 25 nt. In some embodiments, the minimum tracrRNA sequence is approximately 9 nucleotides in length. In some embodiments, the minimum tracrRNA sequence is approximately 12 nucleotides. In some embodiments, the minimal tracrRNA is described in M. Jinek et al., Science (2012) 337 (6096):816-21].

In some embodiments, the minimal tracrRNA sequence spans a stretch of at least 6, 7, or 8 contiguous nucleotides (eg, a wild-type tracrRNA from Streptococcus pyogenes (eg, JJ Ferretti et al., supra). al.])) at least about 60% identical to the sequence. For example, the minimal tracrRNA sequence is at least about 65% identical, about 70% identical, about 75% identical, or about 80% identical to the reference minimal tracrRNA sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides. , about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical, or 100% identical.

In some embodiments, the duplex between the minimum CRISPR RNA and the minimum tracrRNA has a double helix. In some embodiments, the duplex between the minimum CRISPR RNA and the minimum tracrRNA has at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. In some embodiments, the duplex between the minimum CRISPR RNA and the minimum tracrRNA has at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides.

In some embodiments, the duplex has a mismatch (ie, the two strands of the duplex are not 100% complementary). In some embodiments, the duplex has at least about 1, 2, 3, 4, or 5 mismatches. In some embodiments, the duplex has at most about 1, 2, 3, 4, or 5 mismatches. In some embodiments, the duplex has no more than 2 mismatches.

bulge

In some embodiments, there is a “bulge” within the duplex between the minimal CRISPR RNA and the minimal tracrRNA. A bulge is an unpaired region of nucleotides within a duplex. In some embodiments, the bulge contributes to binding of the duplex to the site-directed polypeptide. The bulge has unpaired 5'-XXXY-3' on one side of the duplex, where X is any purine, Y is a nucleotide capable of forming a wobble pair with a nucleotide on the opposite strand, and unpaired nucleotide regions on the other side of the duplex. The number of unpaired nucleotides on either side of the duplex may be different.

In one embodiment, the bulge has an unpaired purine (eg, adenine) on the minimum CRISPR repeat strand of the bulge. In some embodiments, the bulge has at least 5'-AAGY-3' unpaired tracrRNA sequence strands of the bulge, where Y has at least nucleotides capable of wobbling pairing with nucleotides on the CRISPR repeat strand .

In some embodiments, the bulge on the minimal CRISPR repeat side of the duplex has at least 1, 2, 3, 4, or 5 or more unpaired nucleotides. In some embodiments, the bulge on the side of the smallest CRISPR repeat of the duplex has at most 1, 2, 3, 4, or 5 or more unpaired nucleotides. In some embodiments, the bulge on the minimal CRISPR repeat side of the duplex has 1 unpaired nucleotide.

In some embodiments, the bulge on the side of the minimum tracrRNA sequence of the duplex has at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more unpaired nucleotides. In some embodiments, the bulge on the side of the minimum tracrRNA sequence of the duplex has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. In some embodiments, the bulge on the second side of the duplex (eg, on the side of the smallest tracrRNA sequence of the duplex) has 4 unpaired nucleotides.

In some embodiments, the bulge has at least one wobble pairing. In some embodiments, the bulge has at most one wobble pairing. In some embodiments, the bulge has at least one purine nucleotide. In some embodiments, the bulge has at least 3 purine nucleotides. In some embodiments, the bulge sequence has at least 5 purine nucleotides. In some embodiments, the bulge sequence has at least one guanine nucleotide. In some embodiments, the bulge sequence has at least one adenine nucleotide.

hairclip

In some embodiments, the one or more hairpins are located 3' to the minimum tracrRNA in the 3' tracrRNA sequence.

In some embodiments, the hairpin is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 that is 3' from the last paired nucleotide in the minimum CRISPR repeat and the minimum tracrRNA sequence duplex. or 20 or more nucleotides. In some embodiments, the hairpin is at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more that are at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 3' of the last paired nucleotide in the minimum CRISPR repeat and the minimum tracrRNA sequence duplex. It can start from nucleotides.

In some embodiments, the hairpin has at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more consecutive nucleotides. In some embodiments, the hairpin has at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or more consecutive nucleotides.

In some embodiments, the hairpin has CC dinucleotides (ie, two consecutive cytosine nucleotides).

In some embodiments, the hairpin has duplexed nucleotides (ie, the nucleotides of the hairpin that are hybridized together). For example, a hairpin has a CC dinucleotide hybridized to the GG dinucleotide of the hairpin duplex of the 3' tracrRNA sequence.

One or more of the hairpins may interact with a guide RNA-interacting region of the site-directed polypeptide. In some embodiments, there are two or more hairpins, and in some embodiments there are three or more hairpins.

3' tracrRNA sequence

In some embodiments, the 3' tracrRNA sequence is at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or 100% sequence identity.

In some embodiments, the 3' tracrRNA sequence is between about 6 nucleotides and about 100 nucleotides in length. For example, the 3' tracrRNA sequence may be from about 6 nt to about 50 nt, from about 6 nt to about 40 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, from about 6 nt to about 20 nt, about 6 nt to about 15 nt, about 8 nt to about 40 nt, about 8 nt to about 30 nt, about 8 nt to about 25 nt, about 8 nt to about 20 nt, about 8 nt to about 15 nt, about 15 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt, or about 15 nt to about 25 nt in length . In some embodiments, the 3' tracrRNA sequence is approximately 14 nucleotides in length.

In some embodiments, the 3' tracrRNA sequence is at least about 60% identical to the reference 3' tracrRNA sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, a 3' tracrRNA sequence is at least about 60% identical, about 65% identical, about 70% identical, or about 75% identical to a reference 3' tracrRNA sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides. identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical, or 100% identical.

In some embodiments, the 3' tracrRNA sequence has more than one duplexed region. In some embodiments, the 3' tracrRNA sequence has two duplexed regions.

In some embodiments, the 3' tracrRNA sequence has a stem loop structure. In some embodiments, the stem loop structure in the 3' tracrRNA has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides. In some embodiments, the stem loop structure in the 3' tracrRNA has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides. In some embodiments, the stem loop structure has a functional moiety. For example, a stem loop structure can have an aptamer, a ribozyme, a protein-interacting hairpin, a CRISPR array, an intron or an exon. In some embodiments, the stem loop structure has at least about 1, 2, 3, 4, or 5 or more functional moieties. In some embodiments, the stem loop structure has at most about 1, 2, 3, 4, 5 or more functional moieties.

In some embodiments, the hairpin in the 3' tracrRNA sequence has a P-domain. In some embodiments, the P-domain has a double-stranded region in the hairpin.

tracrRNA extension sequence

In some embodiments, the tracrRNA extension sequence may be provided whether the tracrRNA is in the context of a single-molecule guide or a double-molecule guide. In some embodiments, the tracrRNA extension sequence is between about 1 nucleotide and about 400 nucleotides in length. In some embodiments, the tracrRNA extension sequence is 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200 , 220, 240, 260, 280, 300, 320, 340, 360, 380 or greater than 400 nucleotides in length. In some embodiments, the tracrRNA extension sequence is about 20 to about 5000 or more nucleotides in length. In some embodiments, the tracrRNA extension sequence is greater than 1000 nucleotides in length. In some embodiments, the tracrRNA extension sequence is 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200 , 220, 240, 260, 280, 300, 320, 340, 360, 380, 400 or more nucleotides in length. In some embodiments, the tracrRNA extension sequence may be less than 1000 nucleotides in length. In some embodiments, the tracrRNA extension sequence is less than 10 nucleotides in length. In some embodiments, the tracrRNA extension sequence is between 10 and 30 nucleotides in length. In some embodiments, the tracrRNA extension sequence is between 30 and 70 nucleotides in length.

In some embodiments, the tracrRNA extension sequence has a functional moiety (eg, a stability control sequence, a ribozyme, an endoribonuclease binding sequence). In some embodiments, the functional moiety has a transcription terminator segment. In some embodiments, the functional moiety is from about 10 nt to about 100 nucleotides, from about 10 nt to about 20 nt, from about 20 nt to about 30 nt, from about 30 nt to about 40 nt, from about 40 nt to about 50 nt, about 50 nt to about 60 nt, about 60 nt to about 70 nt, about 70 nt to about 80 nt, about 80 nt to about 90 nt, or about 90 nt to about 100 nt, about 15 nt to about 80 nt, about 15 nt to about 50 nt, about 15 nt to about 40 nt, about 15 nt to about 30 nt, or about 15 nt to about 25 nt. In some embodiments, the functional moiety functions in a eukaryotic cell. In some embodiments, the functional moiety functions in a prokaryotic cell. In some embodiments, the functional moiety functions in both eukaryotic and prokaryotic cells.

Non-limiting examples of suitable tracrRNA extension functional moieties include a 3' poly-adenylated tail, a riboswitch sequence (e.g., to allow for regulated stability and/or regulated accessibility by proteins and protein complexes), Sequences that form dsRNA duplexes, sequences that target RNA to subcellular locations (e.g., nucleus, mitochondria, chloroplasts, etc.), tracking (e.g., direct conjugation to fluorescent molecules, moieties that facilitate fluorescence detection) Modifications or sequences that provide for conjugation of tyrosine, sequences allowing detection of fluorescence, etc.), and/or proteins (eg, transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyls). modifications or sequences that provide binding sites for proteins that act on DNA, including transferases, histone deacetylases, and the like. In some embodiments, the tracrRNA extension sequence has a primer binding site or molecular index (eg, a barcode sequence). In some embodiments, the tracrRNA extension sequence has one or more affinity tags.

single-molecule guide linker sequence

In some embodiments, the linker sequence of the single-molecule guide nucleic acid is between about 3 nucleotides and about 100 nucleotides in length. Exemplary linkers are about 3 nt to about 90 nt, about 3 nt to about 80 nt, about 3 nt to about 70 nt, about 3 nt to about 60 nt, about 3 nt to about 50 nt, about 3 nt to about 40 nt, about 3 nt to about 30 nt, about 3 nt to about 20 nt, about 3 nt to about 10 nt. For example, the linker may be from about 3 nt to about 5 nt, from about 5 nt to about 10 nt, from about 10 nt to about 15 nt, from about 15 nt to about 20 nt, from about 20 nt to about 25 nt, from about 25 nt to about 30 nt, about 30 nt to about 35 nt, about 35 nt to about 40 nt, about 40 nt to about 50 nt, about 50 nt to about 60 nt, about 60 nt to about 70 nt, about 70 nt to about 80 nt, from about 80 nt to about 90 nt or from about 90 nt to about 100 nt. In some embodiments, the linker of a single-molecule guide nucleic acid is 4 to 40 nucleotides. In some embodiments, the linker is at least about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides. In some embodiments, the linker is at most about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides.

The linker may have any of a variety of sequences, but in some embodiments the linker may not have a sequence having a broad region homologous to other parts of the gRNA that may result in intramolecular binding that may interfere with other functional regions of the gRNA. will be. supra, Jinek et al. ], the simple 4 nucleotide sequence -GAAA- is used, although many other sequences can likewise be used, including longer sequences.

In some embodiments, the linker sequence has a functional moiety. For example, a linker sequence can have one or more features, including aptamers, ribozymes, protein-interacting hairpins, protein binding sites, CRISPR arrays, introns or exons. In some embodiments, the linker sequence has at least about 1, 2, 3, 4, or 5 or more functional moieties. In some embodiments, the linker sequence has at most about 1, 2, 3, 4, 5 or more functional moieties.

In some embodiments, a genomic location targeted by a gRNA according to the present disclosure may be at, within or near a suitable endogenous locus in a genome, eg, the human genome. An endogenous locus may be selected based on the inclusion of a highly expressed gene or alternatively a highly selectively expressed gene (eg, a gene that is expressed only in a particular tissue or under particular conditions). Exemplary loci for expression in the liver include, for example, the albumin locus, the transferrin locus and the fibrinogen locus.

In some embodiments, provided herein is a gRNA comprising a spacer sequence that is complementary to a genomic sequence within or near an endogenous transferrin locus in a cell. In some embodiments, the gRNA comprises a spacer sequence that is complementary to a sequence in intron 1 of an endogenous transferrin gene in the cell. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 1-190 or a variant thereof having no more than 3 mismatches relative to any one of SEQ ID NOs: 1-190. In some embodiments, the gRNA is SEQ ID NO: 96, 5, 6, 9, 8, 11, 15, 16, 12, 7, 10, 17, 18, 29, 76, 50, 54, 81, 64, 51 , 1 to 4, 13, 14, 19 to 28, 30 to 49, 52, 53, 55 to 63, 65 to 75, 77 to 80, 82 to 95 and 97 to 190 or a spacer sequence from any one of SEQ ID NO: 96, 5, 6, 9, 8, 11, 15, 16, 12, 7, 10, 17, 18, 29, 76, 50, 54, 81, 64, 51, 1 to 4, 13, 14, 19-28, 30-49, 52, 53, 55-63, 65-75, 77-80, 82-95, and variants thereof having no more than 3 mismatches relative to any one of 97-190. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 5, 6, 9, 8, 11, 15, 16, 12, 7 and 10 or SEQ ID NOs: 5, 6, 9, 8, and variants thereof having no more than 3 mismatches relative to any of 11, 15, 16, 12, 7 and 10. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 17, 18, 29, 76, 50, 54, 81, 96, 64 and 51 or SEQ ID NOs: 17, 18, 29, 76, 50, 54, 81, 96, 64, and variants thereof having no more than 3 mismatches relative to any one of. In some embodiments, the spacer sequence is 19 nucleotides in length and does not include the nucleotide at position 1 of the sequence from which it is selected.

In some embodiments, a genomic location targeted by a gRNA according to the present disclosure may be at, within or near an endogenous fibrinogen-alpha chain (fibrinogen-α) locus in a genome, eg, the human genome. Exemplary guide RNAs targeting these positions include a Cas9 or Cpf1 cleavage site associated with a spacer sequence listed in any one of SEQ ID NOs: 192-270. As will be appreciated by those skilled in the art, each guide RNA is designed to include a spacer sequence that is complementary to its genomic target sequence. For example, each of the spacer sequences in any one of SEQ ID NOs: 192-270 listed may be comprised in a single RNA chimera or crRNA (along with the corresponding tracrRNA). The literature [M. Jinek et al., and E. Deltcheva et al., Nature (2011) 471 :602-07].

Exemplary guide RNAs that target an albumin locus include a spacer sequence from any one of SEQ ID NOs: 271-298 and an associated Cas9 or Cpf1 cleavage site. For example, a gRNA comprising a spacer sequence from SEQ ID NO: 271 may comprise the spacer sequence UAAUUUUCUUUUGCGCACUA (SEQ ID NO: 299). As will be appreciated by those skilled in the art, each guide RNA is designed to include a spacer sequence that is complementary to its genomic target sequence. For example, each of the spacer sequences from any one of SEQ ID NOs: 271-298 may be comprised in a single RNA chimera or crRNA (along with the corresponding tracrRNA).

donor template

Site-directed polypeptides, such as DNA endonucleases, can introduce double-stranded breaks or single-stranded breaks into nucleic acids, eg, genomic DNA. Double-strand breaks can occur in the cell's endogenous DNA-repair pathway (e.g., homology-dependent repair (HDR), non-homologous end joining or alternative non-homologous end joining (A-NHEJ), or microphase same sex-mediated terminal joining (MMEJ)). NHEJ can repair cleaved target nucleic acids without the need for homology templates. This can sometimes lead to small deletions or indels in the target nucleic acid at the cleavage site, which can lead to disruption or alteration of gene expression. HDR, also known as homologous recombination (HR), can occur when a homologous repair template or donor is available.

The homologous donor template has sequences homologous to sequences flanked by the target nucleic acid cleavage site. Sister chromatids are commonly used by cells as repair templates. However, for purposes of genome editing, repair templates are often supplied as exogenous nucleic acids, such as plasmids, duplex oligonucleotides, single-stranded oligonucleotides, double-stranded oligonucleotides, or viral nucleic acids. Using an exogenous donor template, additional nucleic acid sequences (such as transgenes) or modifications (such as single or multiple base changes or deletions) are introduced between the flanking regions of homology so that the added or altered nucleic acid sequences are also incorporated within the target locus it is common to be MMEJ causes genetic consequences similar to NHEJ in that small deletions and insertions can occur at the cleavage site. MMEJ uses homologous sequences of several base pairs flanking the cleavage site to induce favorable end-joining DNA repair results. In some instances, it may be possible to predict possible repair outcomes based on analysis of potential microhomologies in nuclease target regions.

Thus, in some cases, homologous recombination is used to insert an exogenous polynucleotide sequence into a target nucleic acid cleavage site. The exogenous polynucleotide sequence is referred to herein as a donor template (or donor, or donor sequence, or donor DNA template). In some embodiments, a donor template, a portion of a donor template, a copy of the donor template, or a portion of a copy of the donor template is inserted within the target nucleic acid cleavage site. In some embodiments, the donor template is a sequence that does not occur naturally at the target nucleic acid cleavage site.

If the exogenous DNA molecule is supplied in sufficient concentration within the nucleus of the cell in which the double-strand break occurs, the exogenous DNA can insert into the double-strand break during the NHEJ repair process, thus becoming a permanent addition to the genome. The donor template optionally contains the coding sequence for the gene of interest, such as the FVIII gene, along with relevant regulatory sequences, such as promoter, enhancer, polyA sequence and/or splice acceptor sequence (also referred to herein as "donor cassette") If so, the coding sequence can be expressed from an integrated copy within the genome, resulting in permanent expression throughout the life of the cell. Moreover, the integrated copy of the donor template can be transferred to daughter cells when the cells divide.

In the presence of a sufficient concentration of donor template containing flanking DNA sequences (referred to as homology arms) having homology to the DNA sequence on either side of the double-stranded break, the donor template can be integrated via the HDR pathway. there is. The homology arms serve as a substrate for homologous recombination between the donor template and the sequence on either side of the double-stranded break. This can result in erroneous insertion of the donor template, wherein the sequence on either side of the double-stranded break is unchanged from that in the unmodified genome.

Sourced donors for editing by HDR vary considerably, but generally contain the intended sequence with small or large flanking homology arms to allow annealing to genomic DNA. The region of homology flanking the introduced genetic change may be 30 bp or less, or as large as a several-kilobase cassette which may contain a promoter, cDNA, etc. Both single-stranded and double-stranded oligonucleotide donors can be used. These oligonucleotides range in size from less than 100 nt to more than a few kb, although longer ssDNAs can also be generated and used. Double-stranded donors are commonly used, including PCR amplicons, plasmids and mini-circles. In general, although AAV vectors have been found to be very effective vehicles of donor template, the packaging limit for individual donors is less than 5 kb. Active transcription of the donor resulted in a 3-fold increase in HDR, indicating that inclusion of the promoter may increase conversion. In contrast, CpG methylation of donors can reduce gene expression and HDR.

In some embodiments, donor DNA can be supplied by a variety of different methods, eg, by transfection, nano-particle, micro-injection, or viral transduction, independently or with a nuclease. Various tethering options may be used in some embodiments to increase donor availability for HDR. Examples include attachment of a donor to a nuclease, attachment to a DNA binding protein that binds nearby, or attachment to a protein involved in DNA end binding or repair.

In addition to genome editing by NHEJ or HDR, site-specific gene insertion using both the NHEJ pathway and HR can be done. Perhaps a combinatorial approach may be applicable in certain circumstances, including intron/exon boundaries. While NHEJ may prove effective for ligation in introns, error-free HDR may be more suitable in the coding domain.

In embodiments, the exogenous sequence to be inserted into the genome is a synthetic FVIII coding sequence encoding a synthetic FVIII protein having a B domain substitution at a position where the wild-type B domain would otherwise be present. The synthetic FVIII coding sequence may comprise a nucleic acid sequence encoding a synthetic FVIII protein having substantial activity, such as a procoagulation activity, of a wild-type FVIII protein. The synthetic FVIII protein has at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95% or about of the activity expressed by the wild-type FVIII protein. It may have a degree of activity of 100%. In some embodiments, the synthetic FVIII protein comprises at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% amino acid sequence identity. In some embodiments, the synthetic FVIII protein comprises at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% amino acid sequence identity. In some embodiments, one of ordinary skill in the art can test the functionality or activity of a compound, eg, a peptide or protein, using several methods known in the art. Synthetic FVIII proteins may also include any fragment of wild-type FVIII protein or fragments of a modified FVIII protein having conservative modifications at one or more of the amino acid residues in the full-length, wild-type FVIII protein. Thus, in some embodiments, the synthetic FVIII coding sequence is at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80% relative to the FVIII coding sequence, e.g., a wild-type FVIII coding sequence. , about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% nucleic acid sequence identity.

In embodiments of the invention, synthetic FVIII contains one or more conservative or non-conservative amino acid substitutions that improve the behavior of the protein without adversely affecting the anticoagulant properties of the protein. In one embodiment, the phenylalanine at position 309 is (non-conservatively) replaced with a serine or an alanine to provide the F309S and F309A mutant proteins, respectively. These substitutions are proposed to improve expression and secretion of proteins by disrupting a potential binding site for chaperone immunoglobulin binding protein (Bip) in the A1 domain (M. Swaroop et al., J Biol Chem (1997) ) 272 :24121-24]).

The B domain substitutions of the present invention replace the B domain of wild-type FVIII with a much smaller peptide chain, while still providing a protease cleavage site and one or more sites for N-linked glycosylation. B domain substitutions may have from about 10 to about 200 amino acids. In some embodiments, the B domain substitution has from about 20 to about 100 amino acids. In some embodiments, the B domain substitutions are from about 1 to about 40 amino acids, from about 1 to about 35 amino acids, from about 1 to about 30 amino acids, from about 1 to about 25 amino acids, from about 1 to about 25 amino acids. about 20 amino acids, about 1 to about 15 amino acids, about 1 to about 10 amino acids, or about 1 to about 5 amino acids. In some embodiments, the B domain substitutions are from about 5 to about 40 amino acids, from about 10 to about 40 amino acids, from about 15 to about 40 amino acids, from about 20 to about 40 amino acids, from about 25 to about 40 amino acids. have about 40 amino acids, about 30 to about 40 amino acids, or about 35 to about 40 amino acids. In some embodiments, the B domain substitutions are 1 amino acid, 2 amino acids, 3 amino acids, 4 amino acids. , 5 amino acids, 6 amino acids, 7 amino acids, 8 amino acids, 9 amino acids, 10 amino acids, 11 amino acids, 12 amino acids, 13 amino acids, 14 amino acids, 15 amino acids, 16 amino acids, 17 Dog Amino Acids, 18 Amino Acids, 19 Amino Acids, 20 Amino Acids, 21 Amino Acids, 22 Amino Acids, 23 Amino Acids, 24 Amino Acids, 25 Amino Acids, 26 Amino Acids, 27 Amino Acids, 28 Amino Acids, 29 Amino Acids , 30 amino acids, 31 amino acids, 32 amino acids, 33 amino acids, 34 amino acids, 35 amino acids, 36 amino acids, 37 amino acids, 38 amino acids, 39 amino acids, or 40 amino acids. In some embodiments, the nucleic acid encoding the B domain substitution is codon optimized. In some embodiments, the B domain substitution comprises a protease cleavage site, eg, RHQR.

In some embodiments where insertion of a synthetic FVIII coding sequence thereof is contemplated, the cDNA of the synthetic FVIII coding sequence can be inserted into the genome of a subject having a defective FVIII gene or regulatory sequence thereof. In this case, the donor DNA or donor template may be an expression cassette or vector construct having a sequence encoding synthetic FVIII. In some embodiments, the expression vector contains a sequence encoding synthetic FVIII, which is described elsewhere herein and may be used.

In some embodiments, according to any one of the donor templates described herein comprising a donor cassette, the donor cassette flanks the gRNA target site on one or both sides. For example, such a donor template may comprise a donor cassette having a gRNA target site 5' of the donor cassette and/or a gRNA target site 3' of the donor cassette. In some embodiments, the donor template comprises a donor cassette having a gRNA target site 5' of the donor cassette. In some embodiments, the donor template comprises a donor cassette having a gRNA target site 3' of the donor cassette. In some embodiments, the donor template comprises a donor cassette having a gRNA target site 5' of the donor cassette and a gRNA target site 3' of the donor cassette. In some embodiments, the donor template comprises a donor cassette having a gRNA target site 5' of the donor cassette and a gRNA target site 3' of the donor cassette, wherein the two gRNA target sites comprise identical sequences. In some embodiments, the donor template comprises at least one gRNA target site, and the at least one gRNA target site in the donor template comprises the same sequence as the gRNA target site in the target locus into which the donor cassette of the donor template will be integrated. In some embodiments, the donor template comprises at least one gRNA target site, and the at least one gRNA target site in the donor template comprises the reverse complement of the gRNA target site in the target locus into which the donor cassette of the donor template will be integrated. In some embodiments, the donor template comprises a donor cassette having a gRNA target site 5' of the donor cassette and a gRNA target site 3' of the donor cassette, wherein the two gRNA target sites in the donor template are the donor cassettes of the donor template. It contains the same sequence as the gRNA target site in the target locus to be integrated. In some embodiments, the donor template comprises a donor cassette having a gRNA target site 5' of the donor cassette and a gRNA target site 3' of the donor cassette, wherein the two gRNA target sites in the donor template are the donor cassettes of the donor template. and the reverse complement of the gRNA target site within the target locus to be integrated.

Nucleic Acids Encoding Site-Directed Polypeptides or DNA Endonucleases

In some embodiments, methods and compositions of genome editing may thus use a nucleic acid (or oligonucleotide) encoding a site-directed polypeptide, such as a DNA endonuclease. The nucleic acid sequence encoding the site-directed polypeptide may be DNA or RNA. If the nucleic acid sequence encoding the site-directed polypeptide is RNA, it may be covalently linked to the gRNA sequence or exist as a separate sequence. In some embodiments, a site-directed polypeptide (eg, a DNA endonuclease) may be used directly in place of the nucleic acid sequence encoding it.

vector

In another aspect, the present disclosure provides a genome-targeting nucleic acid of the present disclosure, a site-directed polypeptide of the present disclosure, and/or any nucleic acid or proteinaceous molecule necessary to perform an embodiment of a method of the present disclosure. A nucleic acid having a nucleotide sequence encoding is provided. In some embodiments, such nucleic acids are vectors (eg, recombinant expression vectors).

Contemplated expression vectors include vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviruses (e.g., murine leukemia virus, spleen necrosis virus, and retroviruses). including viral vectors based on, e.g., Rous sarcoma virus, Harvey's sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and vectors derived from breast tumor virus) and other recombinant vectors. However, it is not limited to these. Other vectors contemplated for eukaryotic target cells include, but are not limited to, the vectors pXT1, pSG5, pSVK3, pBPV, pMSG and pSVLSV40 (Pharmacia). Additional vectors contemplated for eukaryotic target cells include, but are not limited to, the vectors pCTx-1, pCTx-2, and pCTx-3. Other vectors may be used as long as they are compatible with the host cell.

In some embodiments, the vector has one or more transcriptional and/or translational control elements. Depending on the host/vector system used, any of a number of suitable transcriptional and translational control elements can be used in the expression vector, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, and the like. In some embodiments, the vector is a self-inactivating vector that inactivates viral sequences or components of the CRISPR machinery or other element.

Non-limiting examples of suitable eukaryotic promoters (ie , promoters functional in eukaryotic cells) include cytomegalovirus (CMV) acute early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long termini from retroviruses. Hybrid construct with cytomegalovirus (CMV) enhancer fused to repeat (LTR), human elongation factor-1 promoter (EF1), chicken beta-actin promoter (CAG), murine stem cell virus promoter (MSCV), phospho phosphoglycerate kinase-1 locus promoter (PGK) and from mouse metallothionein-I.

To express small RNAs, including gRNAs, promoters such as RNA polymerase III promoters, including for example U6 and H1, may be advantageous. Descriptions of enhancing the use of such promoters and their parameters are known in the art, and additional information and approaches are regularly described; For example, H. Ma et al., Mol Ther Nuc Acids 3 , e161 (2014) doi:10.1038/mtna.2014.12].

The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. Expression vectors may also contain appropriate sequences for amplifying expression. Expression vectors can also include nucleotide sequences encoding non-native tags (eg, histidine tags, hemagglutinin tags, green fluorescent protein, etc.) fused to site-directed polypeptides, resulting in fusion proteins.

In some embodiments, the promoter is an inducible promoter (eg, heat shock promoter, tetracycline-regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor-regulated promoter, etc.). In some embodiments, the promoter is a constitutive promoter (eg, CMV promoter, UBC promoter). In some embodiments, the promoter is a spatially restricted and/or temporally restricted promoter (eg, tissue specific promoter, cell type specific promoter, etc.). In some embodiments, the vector does not have a promoter for at least one gene to be expressed in the host cell if the gene will be expressed under an endogenous promoter present in the genome after the gene has been inserted into the genome.

site-directed polypeptide or DNA endonuclease

Modification of target DNA due to NHEJ and/or HDR may result in, for example, mutation, deletion, alteration, integration, gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, translocation and/or gene mutation. can cause The process of integration of non-native nucleic acids into genomic DNA is an example of genome editing.

Site-directed polypeptides are nucleases used in genome editing to cleave DNA. A site-directed polypeptide may be administered to a cell or subject as one or more mRNAs encoding one or more polypeptides or polypeptide(s).

In the context of the CRISPR/Cas or CRISPR/Cpf1 system, a site-directed polypeptide can bind to a gRNA, which in turn specifies a site in the target DNA to which the polypeptide is directed. In embodiments of the CRISPR/Cas or CRISPR/Cpf1 system herein, the site-directed polypeptide is an endonuclease, such as a DNA endonuclease.

In some embodiments, the site-directed polypeptide has a plurality of nucleic acid-cleaving (ie, nuclease) domains. Two or more nucleic acid-cleaving domains may be linked together via a linker. In some embodiments, the linker is a flexible linker. Linkers are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40 or more amino acids in length.

The naturally-occurring wild-type Cas9 enzyme has two nuclease domains, an HNH nuclease domain and a RuvC domain. As used herein, “Cas9” refers to both naturally-occurring Cas9 and recombinant Cas9. Cas9 enzymes contemplated herein have an HNH or HNH-like nuclease domain, and/or a RuvC or RuvC-like nuclease domain.

HNH and HNH-like domains have McrA-like folds. The HNH and HNH-like domains have two antiparallel β-strands and an α-helix and have a metal binding site (eg, a divalent cation binding site). The HNH and HNH-like domains can cleave one strand of a target nucleic acid (eg, the complementary strand of a crRNA targeting strand).

RuvC and RuvC-like domains have an RNaseH or RNaseH-like fold. The RuvC/RNaseH domain is involved in a diverse set of nucleic acid-based functions and acts on both RNA and DNA. The RNaseH domain has five β-strands surrounded by multiple α-helices. RuvC/RNaseH and RuvC/RNaseH-like domains have a metal binding site (eg, a divalent cation binding site) and one strand of a target nucleic acid (eg, a non-complementary strand of a double-stranded target DNA) can be cut.

In some embodiments, the site-directed polypeptide is an exemplary wild-type site-directed polypeptide (eg, Streptococcus pyogenes, US2014/0068797 Sequence ID No. 8 or R. Sapranauskas et al., Nuc Acids Res (2011) 39 (21):9275-82) and other site-directed polypeptides with at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70 %, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% amino acid sequence identity.

In some embodiments, the site-directed polypeptide comprises at least 10%, at least 15%, at least 20%, at least a nuclease domain of an exemplary wild-type site-directed polypeptide (eg, Cas9 from Streptococcus pyogenes). 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity It has an amino acid sequence with

In some embodiments, the site-directed polypeptide is at least 70, 75, 80, 85, 90, 95, 97 with a wild-type site-directed polypeptide (eg, Cas9 from Streptococcus pyogenes) over 10 contiguous amino acids. , a DNA endonuclease with 99 or 100% identity. In some embodiments, the site-directed polypeptide has at most 70, 75, 80, 85, 90, 95, 97, 99 or 100% identity to the wild-type site-directed polypeptide over 10 contiguous amino acids. In some embodiments, the site-directed polypeptide comprises a wild-type site-directed polypeptide and at least 70, 75, 80, 85, 90, 95, 97, 99 or have 100% identity. In some embodiments, the site-directed polypeptide comprises a wild-type site-directed polypeptide and up to 70, 75, 80, 85, 90, 95, 97, 99 or have 100% identity. In some embodiments, the site-directed polypeptide comprises a wild-type site-directed polypeptide and at least 70, 75, 80, 85, 90, 95, 97, 99 or have 100% identity. In some embodiments, the site-directed polypeptide comprises a wild-type site-directed polypeptide and up to 70, 75, 80, 85, 90, 95, 97, 99 or have 100% identity.

In some embodiments, the site-directed polypeptide has an exemplary modified form of the wild-type site-directed polypeptide. Exemplary modified forms of the wild-type site-directed polypeptide have mutations that reduce the nucleic acid-cleaving activity of the site-directed polypeptide. In some embodiments, exemplary modified forms of wild-type site-directed polypeptides are less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, 10 %, less than 5%, or less than 1% of the exemplary wild-type site-directed polypeptide has a nucleic acid-cleaving activity. The modified form of the site-directed polypeptide may not have substantial nucleic acid-cleaving activity. When a site-directed polypeptide is in a modified form that does not have substantial nucleic acid-cleaving activity, it is referred to herein as "enzymatically inactive."

In some embodiments, the modified form of the site-directed polypeptide has a mutation such that it results in a single-stranded break on the target nucleic acid (e.g., by cleaving only one of the sugar-phosphate backbones of the double-stranded target nucleic acid). SSB) can be induced. In some embodiments, the mutation is less than 90%, less than 80%, less than 70%, 60% in one or more of the plurality of nucleic acid-cleaving domains of a wild-type site directed polypeptide (eg, Cas9 from Streptococcus pyogenes). less than, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5% or less than 1% nucleic acid-cleaving activity. In some embodiments, the mutation results in at least one of the plurality of nucleic acid-cleaving domains retaining the ability to cleave the complementary strand of the target nucleic acid, but reducing its ability to cleave the non-complementary strand of the target nucleic acid. In some embodiments, the mutation results in at least one of the plurality of nucleic acid-cleaving domains retaining the ability to cleave the non-complementary strand of the target nucleic acid, but reduced its ability to cleave the complementary strand of the target nucleic acid. For example, by mutating residues such as Asp10, His840, Asn854, and Asn856 in an exemplary wild-type Streptococcus pyogenes Cas9 polypeptide, one or more of the plurality of nucleic acid-cleavage domains (eg, nuclease domains) is cleaved. Activate it. In some embodiments, the residues to be mutated correspond to residues Asp10, His840, Asn854 and Asn856 in an exemplary wild-type Streptococcus pyogenes Cas9 polypeptide (eg, as determined by sequence and/or structural alignment). Non-limiting examples of mutations include D10A, H840A, N854A and N856A. Those skilled in the art will recognize that mutations other than alanine substitutions are suitable.

In some embodiments, the D10A mutation is combined with one or more of the H840A, N854A, or N856A mutation to produce a site-directed polypeptide substantially lacking DNA cleavage activity. In some embodiments, the H840A mutation is combined with one or more of the D10A, N854A, or N856A mutation to produce a site-directed polypeptide substantially lacking DNA cleavage activity. In some embodiments, the N854A mutation is combined with one or more of the H840A, D10A, or N856A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. In some embodiments, the N856A mutation is combined with one or more of the H840A, N854A, or D10A mutation to produce a site-directed polypeptide substantially lacking DNA cleavage activity. A site-directed polypeptide having a substantially inactive nuclease domain is referred to as a “nickase”.

In some embodiments, RNA-guided endonucleases, such as nickase variants of Cas9, can be used to increase the specificity of CRISPR-mediated genome editing. Wild-type Cas9 is generally guided by a single guide RNA designed to hybridize to a specified about 20 nucleotide sequence within a target sequence (eg, an endogenous genomic locus). However, several discrepancies are tolerated between the guide RNA and the target locus, effectively reducing the length of homology required at the target site to as little as 13 nucleotides, for example, and thereby CRISPR elsewhere in the target genome. /Cas9 complex may increase the likelihood of double-stranded nucleic acid cleavage - also known as off-target cleavage - and binding. Because nickase variants of Cas9 each cleave only one strand, in order to create a double-stranded break, a pair of nickases binds to opposite strands in close proximity of the target nucleic acid, thereby resulting in the equivalent of a double-stranded break. It is necessary to create a pair of nicks. This requires that two separate gRNAs - one for each nickase - bind on opposite strands in close proximity of the target nucleic acid. This requirement essentially doubles the minimum length of homology required for a double-stranded break to occur, thereby reducing the likelihood that a double-stranded break event will occur elsewhere in the genome, where there are two gRNA sites - where they exist. If - is unlikely to be close enough to each other to cause a double-stranded break to occur. As described in the art, nickases can also be used to promote HDR compared to NHEJ. HDR can be used to introduce selected changes into target sites in the genome through the use of specific donor sequences that effectively mediate the desired change. Descriptions of CRISPR/Cas systems for use in gene editing are described, for example, in WO2013/176772; and JD Sander et al., Nature Biotech (2014) 32: 347-55], and the references cited therein.

In some embodiments, a site-directed polypeptide (eg, a variant, mutated, enzymatically inactive and/or conditionally enzymatically inactive site-directed polypeptide) targets a nucleic acid. In some embodiments, the site-directed polypeptide targets DNA. In some embodiments, the site-directed polypeptide targets RNA.

In some embodiments, the site-directed polypeptide has one or more non-native sequences (eg, the site-directed polypeptide is a fusion protein).

In some embodiments, the site-directed polypeptide comprises an amino acid sequence having at least 15% amino acid identity with Cas9 from a bacterium (eg, Streptococcus pyogenes), a nucleic acid binding domain, and two nucleic acid cleavage domains (eg, , HNH domain and RuvC domain).

In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 15% amino acid identity with Cas9 from bacteria, and two nucleic acid cleavage domains (ie, a HNH domain and a RuvC domain).

In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 15% amino acid identity with Cas9 from the bacterium, and two nucleic acid cleavage domains, wherein one or both nucleic acid cleavage domains are from Cas9 from the bacterium. has at least 50% amino acid identity with the nuclease domain.

In some embodiments, the site-directed polypeptide comprises an amino acid sequence having at least 15% amino acid identity with Cas9 from bacteria, two nucleic acid cleavage domains (e.g., HNH domain and RuvC domain), and a non-native sequence (e.g., for example, a nuclear localization signal) or a linker that connects the site-directed polypeptide to a non-native sequence.

In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 15% amino acid identity with Cas9 from a bacterium, two nucleic acid cleavage domains (eg, a HNH domain and a RuvC domain), wherein the site-directed polypeptide comprises: having a mutation in one or both of the nucleic acid cleavage domains that reduces the cleavage activity of the nuclease domain by at least 50%.

In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 15% amino acid identity with Cas9 from a bacterium, and two nucleic acid cleavage domains (eg, a HNH domain and a RuvC domain), wherein the nuclease domain one of the nuclease domains has a mutation of aspartic acid 10 and/or one of the nuclease domains has a mutation of histidine 840, wherein the mutation reduces the cleavage activity of the nuclease domain(s) by at least 50%.

In some embodiments, the one or more site-directed polypeptides, e.g., DNA endonucleases, are two nickases that together cause one double-strand break at a particular locus in the genome, or two nickases at a particular locus in the genome. It contains four nickases that together cause double-strand breaks. Alternatively, one site-directed polypeptide causes one double-stranded break at a particular locus in the genome.

In some embodiments, polynucleotides encoding site-directed polypeptides can be used for genome editing. In some of such embodiments, the polynucleotide encoding the site-directed polypeptide is codon-optimized according to methods known in the art for expression in cells containing the target DNA of interest. For example, when the intended target nucleic acid is present in a human cell, a human codon-optimized polynucleotide encoding Cas9 can be used for the production of a Cas9 polypeptide.

The following provides some examples of site-directed polypeptides that may be used in embodiments of the present disclosure.

CRISPR endonuclease system

CRISPR (clustered regularly spaced short palindromic repeats) genomic loci can be found in the genomes of many prokaryotes (eg, bacteria and archaea). In prokaryotes, the CRISPR locus encodes a product that functions as a type of immune system and helps defend the prokaryotes against foreign invaders such as viruses and phages. There are three stages of CRISPR locus function: integration of new sequences into the CRISPR locus, expression of CRISPR RNA (crRNA), and silencing of foreign invader nucleic acids. Five types of CRISPR systems have been identified (eg, types I, II, III, U and V).

The CRISPR locus contains a number of short repeat sequences referred to as “repeats”. Repeats, when expressed, may form secondary hairpin structures (eg, hairpins) and/or may have unstructured single-stranded sequences. Repeats usually occur in clusters, frequently diverging between species. Repeats are regularly interspersed with unique intervening sequences referred to as “spacers”, resulting in a repeat-spacer-repeat locus structure. The spacer is identical to or highly homologous to a known foreign invader sequence. The spacer-repeat unit encodes a crRNA, which is processed into the mature form of the spacer-repeat unit. A crRNA has a "seed" or spacer sequence that is involved in targeting a target nucleic acid (in its naturally occurring form in prokaryotes, the spacer sequence targets a foreign invader nucleic acid). A spacer sequence is located at the 5' or 3' end of the crRNA.

The CRISPR locus also has a polynucleotide sequence encoding a CRISPR associated (Cas) gene. The Cas gene encodes an endonuclease involved in the interfering steps of biogenesis and crRNA function in prokaryotes. Some Cas genes have homologous secondary and/or tertiary structures.

Type II CRISPR System

CrRNA biogenesis in the type II CRISPR system in nature requires trans-activating CRISPR RNA (tracrRNA). The tracrRNA is modified by endogenous RNaseIII, which then hybridizes to the crRNA repeats of the pre-crRNA array. Endogenous RNase III is recruited to cleave pre-crRNA. The cleaved crRNA undergoes exoribonuclease trimming to generate a mature crRNA form (eg, 5' trimmed). The tracrRNA remains hybridized to the crRNA, and the tracrRNA and crRNA are associated with a site-directed polypeptide (eg, Cas9). The crRNA of the crRNA-tracrRNA-Cas9 complex guides the complex to a target nucleic acid to which the crRNA can hybridize. Hybridization of crRNA to a target nucleic acid activates Cas9 for targeted nucleic acid cleavage. In type II CRISPR systems the target nucleic acid is referred to as a protospacer adjacent motif (PAM). In nature, PAM is essential to facilitate binding of a site-directed polypeptide (eg, Cas9) to a target nucleic acid. Type II systems (also referred to as Nmeni or CASS4) are further classified into types II-A (CASS4) and II-B (CASS4a). The literature [M. Jinek et al.] report that the CRISPR/Cas9 system is useful for RNA-programmable genome editing, and WO2013/176772 describes the CRISPR/Cas endonuclease system for site-specific gene editing. provides numerous examples and applications of

V-Type CRISPR System

The type V CRISPR system has several important differences from the type II system. For example, Cpf1 is a single RNA-guided endonuclease lacking tracrRNA, in contrast to the type II system. In fact, Cpf1-associated CRISPR arrays are engineered into mature crRNAs without the need for additional trans-activating tracrRNAs. Type V CRISPR arrays are engineered into short mature crRNAs of 42-44 nucleotides in length, each mature crRNA starting with a direct repeat of 19 nucleotides followed by a spacer sequence of 23-25 nucleotides. In contrast, mature crRNAs of type II systems begin with a spacer sequence of 20 to 24 nucleotides followed by a direct repeat of about 22 nucleotides. Moreover, Cpf1 uses a T-rich protospacer-adjacent motif to efficiently cleave the target DNA following the short T-rich PAM, in contrast to the G-rich PAM following the target DNA for the type II system, where the Cpf1-crRNA complexes make it Thus, type V systems cleave at points distal from the PAM, whereas type II systems cleave at points proximal to the PAM. Also, in contrast to type II systems, Cpf1 cleaves DNA through staggered DNA double-strand breaks with 5' overhangs of 4 or 5 nucleotides. Type II systems cut through blunt double-strand breaks. Similar to the type II system, Cpf1 contains the predicted RuvC-like endonuclease domain, but lacks a second HNH endonuclease domain, in contrast to the type II system.

Cas gene/polypeptide and protospacer adjacent motifs

Exemplary CRISPR/Cas polypeptides are described in I. Fonfara et al., Nucleic Acids Res. (2014) 42 :2577-90]. The CRISPR/Cas gene naming system underwent excessive rewriting because the Cas gene was discovered. 5 of Fonfara, supra, provides PAM sequences for Cas9 polypeptides from different species.

Complexes of genome-targeting nucleic acids and site-directed polypeptides

A genome-targeting nucleic acid interacts with, and forms a complex with, a site-directed polypeptide (eg, a nucleic acid-guided nuclease such as Cas9). A genome-targeting nucleic acid (eg, gRNA) guides a site-directed polypeptide to a target nucleic acid.

As previously noted, in some embodiments, the site-directed polypeptide and the genome-targeting nucleic acid may each be administered separately to a cell or subject. In some embodiments, the site-directed polypeptide may be pre-complexed with one or more guide RNAs, or one or more crRNAs along with tracrRNAs. The pre-complexed material can then be administered to the cell or subject. These pre-complexed substances are known as ribonucleoprotein particles (RNPs).

Systems for genome editing

Provided herein are systems for genome editing, particularly for inserting synthetic FVIII coding sequences into the genome of a cell. These systems can be used in the methods described herein, such as to edit the genome of a cell, and to treat a subject, eg, a subject with hemophilia A.

In some embodiments, (a) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; (b) a gRNA that targets the albumin locus in the genome of the cell; and (c) a donor template comprising a nucleic acid sequence encoding a synthetic FVIII protein. In some embodiments, the gRNA targets intron 1 of the albumin gene. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 271-298.

In some embodiments, (a) a deoxyribonucleic acid (DNA) endonuclease or a nucleic acid encoding a DNA endonuclease; (b) a guide RNA (gRNA) comprising a spacer sequence from any one of SEQ ID NOs: 271-298; and (c) a donor template comprising a nucleic acid sequence encoding a synthetic FVIII protein. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 274, 275, 281, and 283. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 274. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 275. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 281. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 283.

In some embodiments, according to any of the systems described herein, the DNA endonuclease comprises Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb1, Csb2, Csx17, Csx14, Csb2 Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, or Cpf1 endonuclease, or a functional equivalent thereof. In some embodiments, the DNA endonuclease is Cas9. In some embodiments, the Cas9 is from Streptococcus pyogenes ( spCas9). In some embodiments, the Cas9 is from Staphylococcus lugenesis (SluCas9).

In some embodiments, in accordance with the systems described herein, the nucleic acid sequence encoding the synthetic FVIII protein is codon-optimized for expression in a host cell. In some embodiments, the nucleic acid sequence encoding the synthetic FVIII protein is codon-optimized for expression in a human cell.

In some embodiments, according to any one of the systems described herein, the system comprises a nucleic acid encoding a DNA endonuclease. In some embodiments, the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a host cell. In some embodiments, the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a human cell. In some embodiments, the nucleic acid encoding the DNA endonuclease is DNA, eg, a DNA plasmid. In some embodiments, the nucleic acid encoding the DNA endonuclease is RNA, eg, mRNA.

In some embodiments, according to any one of the systems described herein, the donor template is encoded in an AAV vector. In some embodiments, the donor template comprises a donor cassette comprising a synthetic FVIII coding sequence, the donor cassette flanked by the gRNA target site on one or both sides. In some embodiments, the donor cassette flanks the gRNA target site on both sides. In some embodiments, the gRNA target site is a target site for a gRNA in the system. In some embodiments, the gRNA target site of the donor template is the reverse complement of the cellular genomic gRNA target site to the gRNA in the system.

In some embodiments, according to any one of the systems described herein, a DNA endonuclease or a nucleic acid encoding a DNA endonuclease is formulated in liposomes or lipid nanoparticles. In some embodiments, the liposome or lipid nanoparticle also comprises a gRNA. In some embodiments, the liposomes or lipid nanoparticles are lipid nanoparticles. In some embodiments, the system comprises a lipid nanoparticle comprising a nucleic acid encoding a DNA endonuclease and a gRNA. In some embodiments, the nucleic acid encoding a DNA endonuclease is an mRNA encoding a DNA endonuclease.

In some embodiments, according to any one of the systems described herein, the DNA endonuclease is complexed with the gRNA to form an RNP complex.

Genome editing methods

Provided herein are methods of genome editing, particularly insertion of its synthetic FVIII protein into the genome of a cell. This method can be used to treat a subject, eg, a patient with hemophilia A, in which case the cells can be isolated from the subject or individual donor. The chromosomal DNA of the cell is then edited using the materials and methods described herein.

Provided herein are methods of knocking in a synthetic FVIII coding sequence into a genome. In one aspect, the disclosure provides for insertion of a nucleic acid sequence of a synthetic FVIII coding sequence, ie, a nucleic acid sequence encoding a synthetic FVIII protein, into the genome of a cell. The synthetic FVIII protein has a significant activity of the wild-type FVIII protein, e.g., at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% of the activity expressed by the wild-type FVIII protein. %, about 95% or about 100%. In some embodiments, one of ordinary skill in the art can test the functionality or activity of a compound, eg, a peptide or protein, using several methods known in the art. In some embodiments, the synthetic FVIII protein may also include any fragment of a wild-type FVIII protein, or a fragment of a modified FVIII protein having conservative modifications in one or more of the amino acid residues in the full-length, wild-type FVIII protein. In some embodiments, the synthetic FVIII protein may also comprise any modification(s), e.g., deletions, insertions and/or mutations, of one or more amino acids that do not substantially negatively affect the function of the wild-type FVIII protein. there is. Thus, in some embodiments, the nucleic acid sequence of the synthetic FVIII coding sequence is at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% nucleic acid sequence identity.

In some embodiments, the synthetic FVIII coding sequence is inserted into a genomic sequence in a cell. In some embodiments, the insertion site is at or within the albumin locus, transferrin locus, or fibrinogen alpha locus in the genome of the cell. In some embodiments, the insertion site is an albumin locus. The insertion method uses one or more gRNAs that target the first intron (or intron 1) of the albumin gene. In some embodiments, the donor DNA is single or double-stranded DNA having a synthetic FVIII coding sequence.

In some embodiments, the genome editing method uses a DNA endonuclease, such as the CRISPR/Cas system, to genetically introduce (smark-in) a synthetic FVIII coding sequence. In some embodiments, the DNA endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx3, Csx15, Csx10, Csx16, Csx10, Csx15, Csx10 Csf1, Csf2, Csf3, Csf4, or Cpf1 endonuclease, or homologues thereof, recombination of naturally occurring molecules, codon-optimized or modified versions thereof, and combinations of any of the foregoing. In some embodiments, the DNA endonuclease is Cas9. In some embodiments, the Cas9 is from Streptococcus pyogenes ( spCas9). In some embodiments, the Cas9 is from Staphylococcus lugenesis (SluCas9).

In some embodiments, the cell undergoing genome-editing has one or more mutation(s) in its genome, which results in a decrease in expression of the endogenous FVIII gene as compared to expression in a normal that does not have such mutation(s). Normal cells may be healthy or control cells originating (or isolated) from different subjects without the FVIII gene defect. In some embodiments, cells undergoing genome-editing may originate (or be isolated) from a subject in need of treatment for a FVIII gene related disease or disorder, eg, hemophilia A. Thus, in some embodiments, the expression of the endogenous FVIII gene in such cells is about 10%, about 20%, about 30%, about 40%, about 50%, about 60% compared to the expression of endogenous FVIII gene expression in normal cells. %, about 70%, about 80%, about 90% or about 100%.

In some embodiments, the genome editing method results in targeted integration (in a non-coding region of the genome) of a functional FVIII coding sequence, eg, a FVIII coding sequence, operably linked to a supplied promoter, resulting in FVIII in vivo. stable protein production. In some embodiments, the targeted integration of the FVIII coding sequence occurs in an intron of an albumin gene that is highly expressed in a cell type of interest, eg, hepatocytes or allogeneic endothelial cells.

In one aspect, the nucleic acid sequence of the synthetic FVIII coding sequence is inserted into the genome of a cell. In embodiments, the synthetic FVIII coding sequence to be inserted is a modified FVIII coding sequence. In some embodiments, in the modified FVIII coding sequence, the B-domain of the wild-type FVIII coding sequence is deleted and replaced with a B domain substitution. In some embodiments, synthetic FVIII outperforms full-length wild-type FVIII because of its smaller size (4371 bp versus 7053 bp). Thus, in some embodiments, the synthetic FVIII coding sequence lacking the FVIII signal peptide and containing a splice acceptor sequence at its 5' end (N-terminus of the FVIII coding sequence) is a locus of a locus in hepatocytes of mammals, including humans. It is specifically integrated into intron 1. In one embodiment, the locus is an albumin locus. In another embodiment, the locus is a transferrin locus. In another embodiment, the locus is the fibrinogen alpha locus.

Transcription of the synthetic FVIII coding sequence from the transferrin promoter can result in a pre-mRNA containing a portion of exon 1, intron 1 of transferrin and the synthetic FVIII coding sequence to be integrated. When this pre-mRNA undergoes the natural splicing process to remove the intron, the splicing machinery replaces the splice donor on the 3' side of transferrin exon 1 with the 5' end of the synthetic FVIII coding sequence of the inserted DNA donor. You can connect to an available splice acceptor as the next best thing to become a splice acceptor at. This can result in a mature mRNA containing transferrin exon 1 fused to the mature coding sequence for synthetic FVIII.

Transcription of this synthetic FVIII coding sequence from the albumin promoter can result in a pre-mRNA containing a portion of exon 1, intron 1 of albumin and the synthetic FVIII coding sequence to be integrated. When this pre-mRNA undergoes the natural splicing process to remove the intron, the splicing machinery replaces the splice donor on the 3' side of albumin exon 1 with the 5' end of the synthetic FVIII coding sequence of the inserted DNA donor. You can connect to an available splice acceptor as the next best thing to become a splice acceptor at. This can result in a mature mRNA containing albumin exon 1 fused to the mature coding sequence for synthetic FVIII. Exon 1 of albumin encodes a signal peptide plus two additional amino acids and one third of the codon that normally encodes the protein sequence DAH at the N-terminus of albumin in humans. Thus, in some embodiments, following predicted cleavage of the albumin signal peptide during secretion from the cell, a synthetic FVIII protein is generated with three additional amino acid residues added at the N-terminus, resulting in the N-terminus of the synthetic FVIII protein. amino acid sequence -DA H ATRRYY (SEQ ID NO: 300)-. Since the third of these three amino acids (underlined) is encoded in part by the terminus of exon 1 and in part by the synthetic FVIII DNA donor template, the identity of the third additional amino acid residue is Leu, Pro, It can be selected to be any one of His, Gin, or Arg. Of these options, Leu is used in some embodiments because Leu has minimal molecular complexity and is therefore least likely to form new T-cell epitopes, which are located at the N-terminus of the synthetic FVIII protein. resulting in the amino acid sequence - DAL ATRRYY-. Alternatively, the DNA donor template can be designed to delete the third residue, resulting in the amino acid sequence DAL TRRYY at the N-terminus of the synthetic FVIII protein. In some cases, adding additional amino acids to the sequence of a native protein may increase the risk of immunogenicity. Thus, by in silico analysis to predict the potential immunogenicity of two possible options for the N-terminus of synthetic FVIII, some demonstrated that deletion of one residue ( DAL TRRYY) had a lower immunogenicity score. In embodiments, this may be a design in at least some embodiments.

In some embodiments, a DNA sequence encoding a synthetic FVIII with optimized codon usage can be used to improve expression in mammalian cells (so-called codon optimization). Different computer algorithms for performing codon optimization are also available in the art, which generate distinct DNA sequences (VP Mauro et al., Trends Mol Med (2014) 20 :604-13). Examples of commercially available codon optimization algorithms are those used by ATUM and the GeneArt company (part of Thermo Fisher Scientific). Codon optimization of the FVIII coding sequence has been demonstrated to significantly improve expression of FVIII following gene-based delivery to mice (AC Nathwani et al., Blood (2006) 107(7) :2653-61.); NJ Ward et al., Blood (2011) 117 (3):798-807; PA Radcliffe et al., Gene Ther . (2008) 15 (4):289-97). Codon optimization is an established approach for improving the expression of a coding sequence of interest and is primarily based on substituting less frequently used codons with more frequently used codons without altering the encoded amino acid sequence. Since the initial recognition that codon bias can affect protein expression, codon optimization methods have been developed and algorithms are commercially available, including those provided by DNA synthesis companies such as GeneArt and ATUM. These commercially available algorithms are available free of charge to users as part of a DNA synthesis service, and are also designed to eliminate cryptic splicing signals and divide the G/C content evenly across the coding sequence. Delivery of an exogenous nucleic acid to a cell in vivo can induce an innate immune response induced, at least in part, by recognition of a CG dinucleotide (also referred to as a CpG sequence) by the Toll receptor system, wherein the CG dinucleotide Reduction of the nucleotide content is proposed as a method for reducing the innate immune response to these nucleic acids, especially when plasmid DNA is a transfer vector. Also, the literature [P. Colella et al., Mol Ther Methods Clin Dev (2018) 8 :87-104]. When the naturally occurring (native) coding sequence for a gene is optimized for expression in a mammalian species, the number of CG dinucleotides is generally increased, which means that the more frequently used codon is a third (wobble) of the codon. )) because it contains a higher frequency of G and C nucleotides at the position. Thus, an increase in the total content of G and C nucleotides in the coding sequence will result in a higher content of GC dinucleotides.

In some embodiments, the sequence homology or identity between a synthetic FVIII coding sequence that has been codon optimized with different algorithms and a native FVIII sequence (as seen in the human genome) is about 30%, about 40%, about 50%, about 60% , about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100%. In some embodiments, the codon-optimized synthetic FVIII coding sequence has from about 75% to about 79% sequence homology or identity to the native FVIII sequence. In some embodiments, the codon-optimized synthetic FVIII coding sequence is about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77% relative to the native FVIII sequence. , about 78%, about 79%, or about 80% sequence homology or identity.

In some embodiments, a donor template or donor construct is prepared to contain a DNA sequence encoding synthetic FVIII. In some embodiments, the DNA donor template is designed to contain a codon optimized human synthetic FVIII coding sequence. In some embodiments, codon-optimization is such that the sequence at the 5' end encoding the signal peptide of FVIII is deleted and replaced with a splice acceptor sequence, and a polyadenylation signal is added at the 3' end after the FVIII stop codon. (MAB8A - SEQ ID NO: 301). The splice acceptor sequence may be selected from among known splice acceptor sequences from known genes, or a consensus splice acceptor sequence derived from an alignment of many splice acceptor sequences known in the art may be used. there is. In some embodiments, splice acceptor sequences from highly expressed genes are used, as such sequences are believed to provide optimal splicing efficiency. In some embodiments, the consensus splicing acceptor sequence is a consensus sequence T/CNC/TT/CA/GAC/T (SEQ ID NO: 302) followed by a polypyrimidine tract of 10-12 bases within 20 bp (C or T) followed by a branching site with AG>G/A, where > is the location of the intron/exon boundary. In one embodiment, a synthetic splice acceptor sequence (ctgac ctcttctcttcctccc acag—SEQ ID NO: 303) is used. In another embodiment, a native splice acceptor sequence from the albumin gene intron 1/exon 2 boundary of a human ( TTAAC AAT CCTTTTTTTTCTTCCCTT GCC CAG - SEQ ID NO: 304) or mouse (ttaaatatgttgtgtgg tttttctctccctgttt ccacag - SEQ ID NO: 305) this is used

The polyadenylation sequence provides the cell with a signal to add the polyA tail, which is essential for the stability of mRNA in the cell. In some embodiments where the DNA-donor template will be packaged into AAV particles, embodiments of the invention maintain the size of the DNA being packaged within packaging limits for AAV, which may be less than about 5 Kb or less than or equal to about 4.7 Kb. Thus, in some embodiments, a polyA sequence as short as possible, e.g., about 10-mer, about 20-mer, about 30-mer, about 40-mer, about 50-mer or about 60-mer or the above Any intervening number of nucleotides is used. A consensus synthetic poly A signal sequence has been described in N. Levitt et al., Genes Dev (1989) 3 (7):1019-25, along with the sequence AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGTTTTTTTGTGG (SEQ ID NO: 306), and numerous expression vectors is commonly used in

In some embodiments, additional sequence elements may be added to the DNA donor template to improve the frequency of integration. One such element is the homology arm. The sequence (LHA) from the left of the double-strand break is appended to the 5' (N-terminal to the FVIII coding sequence) end of the DNA donor template, and the sequence (RHA) from the right of the double-stranded break is added to the DNA donor template, e.g. For example, it is appended to the 3' (C-terminus of the FVIII coding sequence) terminus of MAB8B (SEQ ID NO: 308).

An alternative DNA donor template design provided in some embodiments has a sequence complementary to the recognition sequence for the sgRNA to be used to cleave the genomic site. MAB8C (SEQ ID NO: 309) represents an example of this type of DNA donor template. By including the sgRNA recognition site, the DNA donor template will be cleaved by the sgRNA/Cas9 complex inside the nucleus of the cell to which the DNA donor template and sgRNA/Cas9 are delivered. Cleavage of the donor template into linear fragments may increase the frequency of integration at the double strand breaks by non-homologous end joining mechanisms or by HDR mechanisms. This can be particularly advantageous in the case of delivery of a donor template packaged in AAV, since it is known that after delivery to the nucleus, the AAV genome concatenates to form larger circular double-stranded DNA molecules. [H. Nakai et al., J Virol (2001) 75: 6969-76]). Thus, in some cases, circular concatemers may be less efficient donors for integration, particularly at double-strand breaks by the NHEJ mechanism. It has been previously reported that the efficiency of targeted integration using a circular plasmid DNA donor template can be increased by including a zinc finger nuclease cleavage site in the plasmid (S. Cristea et al., Biotechnol ). Bioeng . (2013) 110 :871-80]). More recently, this approach was also applied using the CRISPR/Cas9 nuclease (K. Suzuki et al., Nature (2017)). 540 :144-49]). While the sgRNA recognition sequence is active when present on either strand of the double-stranded DNA donor template, the use of the reverse complement of the sgRNA recognition sequence present in the genome is predicted to favor stable integration, since reverse orientation Incorporation of the sgRNA regenerates the recognition sequence, as it can be re-cleaved to release the inserted donor template. It is predicted that integration of this donor template within the genome in the forward orientation by NHEJ does not regenerate the sgRNA recognition sequence, rendering the integrated donor template unable to be excised from the genome. The benefits of including a sgRNA recognition sequence in a donor with or without homology arms for the efficiency of integration of the FVIII donor template include, for example, using AAV for delivery of donors and delivery of the CRISPR-Cas9 component. can be tested and determined in mice using LNPs (lipid nanoparticles) for

In some embodiments, the donor template comprises a synthetic FVIII coding sequence in a donor cassette according to any one of the embodiments described herein flanked by a gRNA target site on one or both sides. In some embodiments, the donor template comprises a gRNA target site 5' of the donor cassette and/or a gRNA target site 3' of the donor cassette. In some embodiments, the donor template comprises two flanking gRNA target sites, wherein the two gRNA target sites comprise identical sequences. In some embodiments, the donor template comprises at least one gRNA target site, and the at least one gRNA target site in the donor template is a target site for at least one of the one or more gRNAs targeting the first intron of the albumin gene. In some embodiments, the donor template comprises at least one gRNA target site, wherein the at least one gRNA target site in the donor template is the reverse complement of the target site to at least one of the one or more gRNAs in the first intron of the albumin gene . In some embodiments, the donor template comprises a gRNA target site 5' of the donor cassette and a gRNA target site 3' of the donor cassette, wherein the two gRNA target sites in the donor template are one targeting the first intron of the albumin gene. targeted by more than one gRNA. In some embodiments, the donor template comprises a gRNA target site 5' of the donor cassette and a gRNA target site 3' of the donor cassette, wherein the two gRNA target sites in the donor template are at least one gRNA in the first intron of the albumin gene. is the inverse complement of the target site to at least one of

Insertion of the FVIII coding sequence into the target site, ie, a genomic location into which the FVIII coding sequence is inserted, may be at the endogenous albumin locus or a neighboring sequence thereof. In some embodiments, the FVIII coding sequence is inserted in such a way that expression of the inserted coding sequence is controlled by the endogenous promoter of the albumin gene. In some embodiments, the FVIII coding sequence is inserted into one of the introns of the albumin gene. In some embodiments, the FVIII coding sequence is inserted into one of the exons of the albumin gene. In some embodiments, the FVIII coding sequence is inserted at the junction of an intron:exon (or vice versa). In some embodiments, the insertion of the FVIII coding sequence is within the first intron (or intron 1) of the albumin locus. In some embodiments, insertion of the FVIII coding sequence does not significantly affect the expression of the albumin gene, eg, does not upregulate or downregulate.

In embodiments, the target site for insertion of the FVIII coding sequence is in, within or near the endogenous albumin gene. In some embodiments, the target site is in an intergenic region upstream of the promoter of the albumin locus in the genome. In some embodiments, the target site is within the albumin locus. In some embodiments, the target site is in one of the introns of the albumin locus. In some embodiments, the target site is in one of the exons of the albumin locus. In some embodiments, the target site is at one of the junctions between an intron and an exon (or vice versa) of the albumin locus. In some embodiments, the target site is in the first intron (or intron 1) of the albumin locus. In certain embodiments, the target site is at least, about or at most 0, 1, 5, 10, 20, 30, 40, 50, 100, 150 of the first exon of the albumin gene (ie, from the last nucleic acid of the first exon). , 200, 250, 300, 350, 400, 450 or 500 or 550 or 600 or 650 bp downstream. In some embodiments, the target site is at least about, or at most about 0.1 kb, about 0.2 kb, about 0.3 kb, about 0.4 kb, about 0.5 kb, about 1 kb, about 1.5 kb, about 2 kb of the first intron of the albumin gene. , about 2.5 kb, about 3 kb, about 3.5 kb, about 4 kb, about 4.5 kb, or about 5 kb upstream. In some embodiments, the target site is about 0 bp to about 100 bp upstream, about 101 bp to about 200 bp upstream, about 201 bp to about 300 bp upstream, about 301 bp to about 400 bp upstream of the second exon of the albumin gene , about 401 bp to about 500 bp upstream, about 501 bp to about 600 bp upstream, about 601 bp to about 700 bp upstream, about 701 bp to about 800 bp upstream, about 801 bp to about 900 bp upstream, about 901 bp to about 1000 bp upstream, about 1001 bp to about 1500 bp upstream, about 1501 bp to about 2000 bp upstream, about 2001 bp to about 2500 bp upstream, about 2501 bp to about 3000 bp upstream, about 3001 bp to about 3500 bp upstream, anywhere from about 3501 bp to about 4000 bp upstream, from about 4001 bp to about 4500 bp upstream, or from about 4501 bp to about 5000 bp upstream. In some embodiments, the target site is at least 37 bp downstream of the terminus (ie, the 3′ end) of the first exon of the human albumin gene in the genome. In some embodiments, the target site is at least 330 bp upstream of the start (ie, 5′ start) of the second exon of the human albumin gene in the genome.

In some embodiments, provided herein is a method of editing a genome in a cell, the method comprising providing to the cell: (a) a guide RNA (gRNA) that targets an albumin locus in the genome of the cell; (b) a DNA endonuclease or a nucleic acid encoding said DNA endonuclease; and (c) a donor template comprising a nucleic acid sequence encoding a synthetic FVIII protein. In some embodiments, the gRNA targets intron 1 of the albumin gene. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 271-298.

In some embodiments, provided herein is a method of editing a genome in a cell, the method comprising providing to the cell: (a) comprising a spacer sequence from any one of SEQ ID NOs: 271-298 gRNA; (b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and (c) a donor template comprising a nucleic acid sequence encoding a synthetic FVIII protein. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 274, 275, 281, and 283. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 274. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 275. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 281. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 283. In some embodiments, the cell is a human cell (eg, a human hepatocyte).

In some embodiments, according to a method for editing a genome in a cell described herein, the DNA endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100 , Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csx10, Csb3, Csb2, Csx14, Csb2, Csb3 , Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, or Cpf1 endonuclease, or a functional equivalent thereof. In some embodiments, the DNA endonuclease is Cas9. In some embodiments, Cas9 is spCas9. In some embodiments, Cas9 is SluCas9.

In some embodiments, according to the methods of genome editing in a cell described herein, the nucleic acid sequence encoding the synthetic FVIII protein is codon-optimized for expression in the cell. In some embodiments, the cell is a human cell.

In some embodiments, according to a method for editing a genome in a cell described herein, the method employs a nucleic acid encoding a DNA endonuclease. In some embodiments, the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a cell. In some embodiments, the cell is a human cell (eg, a human hepatocyte). In some embodiments, the nucleic acid encoding the DNA endonuclease is DNA, eg, a DNA plasmid. In some embodiments, the nucleic acid encoding the DNA endonuclease is RNA, eg, mRNA.

In some embodiments, according to any one of the methods of editing a genome in a cell described herein, the donor template is encoded in an AAV vector. In some embodiments, the donor template comprises a donor cassette comprising a nucleic acid sequence encoding a synthetic FVIII protein, the donor cassette flanked by a gRNA target site on one or both sides. In some embodiments, the donor cassette flanks the gRNA target site on both sides. In some embodiments, the gRNA target site is the target site for the administered gRNA. In some embodiments, the gRNA target site of the donor template is the reverse complement of the cellular genomic gRNA target site to the gRNA.

In some embodiments, according to any one of the methods of editing a genome in a cell described herein, a DNA endonuclease or a nucleic acid encoding a DNA endonuclease is formulated in liposomes or lipid nanoparticles. In some embodiments, the liposome or lipid nanoparticle also comprises a gRNA. In some embodiments, the liposomes or lipid nanoparticles are lipid nanoparticles. In some embodiments, the method uses lipid nanoparticles comprising a nucleic acid encoding a DNA endonuclease and a gRNA. In some embodiments, the nucleic acid encoding a DNA endonuclease is an mRNA encoding a DNA endonuclease.

In some embodiments, according to any one of the methods of editing a genome in a cell described herein, the DNA endonuclease is precomplexed with the gRNA to form an RNP complex.

In some embodiments, according to any one of the methods of editing a genome in a cell described herein, gRNA and a DNA endonuclease or nucleic acid encoding a DNA endonuclease are provided to the cell after providing the donor template to the cell do. In some embodiments, the gRNA and DNA endonuclease or nucleic acid encoding the DNA endonuclease is provided to the cell after a time greater than 4 days after the donor template is provided to the cell. In some embodiments, the gRNA and DNA endonuclease or nucleic acid encoding the DNA endonuclease is provided to the cell at least 14 days after providing the donor template to the cell. In some embodiments, the gRNA and DNA endonuclease or nucleic acid encoding the DNA endonuclease is provided to the cell at least 17 days after providing the donor template to the cell. In some embodiments, (a) and (b) are provided to the cell as lipid nanoparticles comprising a nucleic acid encoding a DNA endonuclease and a gRNA. In some embodiments, the nucleic acid encoding a DNA endonuclease is an mRNA encoding a DNA endonuclease. In some embodiments, (c) is provided to the cell as an AAV vector encoding a donor template.

In some embodiments, according to any one of the methods of editing a genome in a cell described herein, one or more additional doses of gRNA and a DNA endonuclease or a nucleic acid encoding a DNA endonuclease comprise a first dose of gRNA and a DNA endonuclease or a nucleic acid encoding the DNA endonuclease, followed by the cell. In some embodiments, one or more additional doses of gRNA and DNA endonuclease or nucleic acid encoding DNA endonuclease comprises a first dose of gRNA and DNA endonuclease or nucleic acid encoding DNA endonuclease It is then provided to the cell until targeted integration of the target level of the nucleic acid sequence encoding the synthetic FVIII protein and/or expression of the target level of the nucleic acid sequence encoding the synthetic FVIII protein is achieved.

In some embodiments, according to a method of genome editing in a cell described herein, a nucleic acid sequence encoding a synthetic FVIII protein is expressed under the control of an endogenous albumin promoter.

In some embodiments, (a) a Cas DNA endonuclease (eg, Cas9) or a nucleic acid encoding a Cas DNA endonuclease, (b) a gRNA or a nucleic acid encoding a gRNA, wherein the gRNA is a Cas DNA endonuclease A donor template according to any one of the embodiments described herein comprising a gRNA or a nucleic acid encoding a gRNA capable of directing a nuclease to cleave a target polynucleotide sequence within the albumin locus, and (c) a synthetic FVIII coding sequence. Provided herein is a method of inserting a synthetic FVIII coding sequence into an albumin locus of a cell genome comprising introducing into the cell. In some embodiments, the method comprises introducing an mRNA encoding a Cas DNA endonuclease into the cell. In some embodiments, the method comprises introducing into a cell an LNP according to any one of the embodiments described herein comprising i) an mRNA encoding a Cas DNA endonuclease and ii) a gRNA. In some embodiments, the donor template is an AAV donor template. In some embodiments, the donor template comprises a donor cassette comprising a synthetic FVIII coding sequence, the donor cassette flanked on one or both sides by the target site of the gRNA. In some embodiments, the gRNA target site flanking the donor cassette is the reverse complement of the gRNA target site within the albumin locus. In some embodiments, a Cas DNA endonuclease or a nucleic acid encoding a Cas DNA endonuclease and a gRNA or a nucleic acid encoding a gRNA are introduced into the cell after introduction of the donor template into the cell. In some embodiments, the Cas DNA endonuclease or nucleic acid encoding the Cas DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are sufficient to allow the donor template to enter the cell nucleus after introduction of the donor template into the cell. introduced into the cell after an hour. In some embodiments, a Cas DNA endonuclease or a nucleic acid encoding a Cas DNA endonuclease and a gRNA or a nucleic acid encoding the gRNA comprise a single stranded AAV genome within the cell nucleus after introduction of the donor template into the cell. It is introduced into the cell after a time sufficient to allow it to be converted into a double-stranded DNA molecule from In some embodiments, the Cas DNA endonuclease is Cas9.

In some embodiments, according to any one of the methods of insertion of a synthetic FVIII coding sequence into an albumin locus of a cell genome described herein, the target polynucleotide sequence is within intron 1 of the albumin gene. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 271-298. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 274, 275, 281, and 283. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 274. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 275. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 281. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 283.

In some embodiments, (a) i) an mRNA encoding a Cas9 DNA endonuclease and ii) a gRNA, wherein the gRNA is capable of guiding the Cas9 DNA endonuclease to cleave a target polynucleotide sequence within the albumin locus. A cell comprising the step of introducing into the cell an LNP according to any one of the embodiments described herein comprising, and (b) an AAV donor template according to any one of the embodiments described herein comprising (b) a synthetic FVIII coding sequence. Provided herein are methods of inserting a synthetic FVIII coding sequence into an albumin locus of a genome. In some embodiments, the donor template comprises a donor cassette comprising a synthetic FVIII coding sequence, the donor cassette flanked on one or both sides by the target site of the gRNA. In some embodiments, the gRNA target site flanking the donor cassette is the reverse complement of the gRNA target site within the albumin locus. In some embodiments, the LNP is introduced into the cell following introduction of the AAV donor template into the cell. In some embodiments, the LNP is introduced into the cell after a time sufficient to allow the donor template to enter the cell nucleus following introduction of the AAV donor template into the cell. In some embodiments, the LNP is introduced into the cell after a sufficient time after introduction of the AAV donor template into the cell to allow the donor template to convert from the single stranded AAV genome to a double stranded DNA molecule in the cell nucleus. In some embodiments, after the initial introduction of LNP into the cell, one or more additional introductions of LNP into the cell (eg, 2, 3, 4, 5 or more) are performed. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 271-298. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 274, 275, 281, and 283. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 274. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 275. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 281. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 283.

Insertion of the FVIII coding sequence into the target site may be at the endogenous fibrinogen-α locus or its neighboring sequence. In some embodiments, the FVIII coding sequence is inserted in such a way that expression of the inserted coding sequence is controlled by the endogenous promoter of the fibrinogen-α gene. In some embodiments, the FVIII coding sequence is inserted into one of the introns of the fibrinogen-α gene. In some embodiments, the FVIII coding sequence is inserted into one of the exons of the fibrinogen-α gene. In some embodiments, the FVIII coding sequence is inserted at the junction of an intron:exon (or vice versa). In some embodiments, the insertion of the FVIII coding sequence is within the first intron (or intron 1) of the fibrinogen-α locus. In some embodiments, insertion of the FVIII coding sequence does not significantly affect the expression of the fibrinogen-α gene, eg, does not upregulate or downregulate it.

In certain embodiments, the target site is at least, about, or at most 0, 1, 5, 10, 20, 30, 40 of the first exon of the fibrinogen-α gene (ie, from the last base pair or 3′ end of the first exon). , 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1071 bp or any in-between is the length of the nucleic acid downstream. In some embodiments, the target site is at least, about, or at most 0.1 kb, about 0.2 kb, about 0.3 kb, about upstream of a nucleic acid of length 0.4 kb, about 0.5 kb, about 1 kb, or any in between. In some embodiments, the target site is about 0 bp to about 100 bp, about 101 bp to about 200 bp, about 201 bp to about 300 bp, about 301 bp to about 400 bp, about 401 bp to about 500 bp, about 501 bp to about 600 bp, about 601 bp to about 700 bp, about 701 bp to about 800 bp, about 801 bp to about 900 bp, from about 901 bp to about 1000 bp, from about 1001 bp to about 1071 bp upstream.

In some embodiments, the target site for insertion of the FVIII coding sequence is at least 40 bp downstream of the end of the first exon of the human fibrinogen-a gene in the genome and at least of the start of the second exon of the human fibrinogen-a gene in the genome 60 bp upstream.

In some embodiments, the target site for insertion of the FVIII coding sequence is at least 42 bp downstream of the terminus of the first exon of the human fibrinogen-α gene in the genome, and at least of the beginning of the second exon of the human fibrinogen-α gene in the genome. 65 bp upstream.

In some embodiments, the insertion is at least 12 bp downstream of the end of the first exon of the human fibrinogen-α gene in the genome, and at least 52 bp upstream of the start of the second exon of the human fibrinogen-α gene in the genome.

In some embodiments, the insertion is at least 94 bp downstream of the end of the first exon of the human fibrinogen-a gene in the genome, and at least 86 bp upstream of the start of the second exon of the human fibrinogen-a gene in the genome.

In some embodiments, according to any one of the systems described herein, the donor template comprises a nucleic acid sequence encoding a synthetic FVIII for targeted integration into intron 1 of the transferrin gene, wherein the donor template comprises 5' to 3' , i) a first gRNA target site; ii) a splice grantee; iii) a nucleotide sequence encoding synthetic FVIII; and iv) a polyadenylation signal. In some embodiments, the donor template further comprises iv) a second gRNA target site downstream of the polyadenylation signal. In some embodiments, the first gRNA target site and the second gRNA target site are the same. In some embodiments, the donor template comprises the terminus of the transferrin signal peptide encoded in exon 2 of the transferrin gene that retains at least a portion of the activity of the endogenous sequence between ii) the splice acceptor and iii) the nucleotide sequence encoding the synthetic FVIII protein. and a sequence encoding the portion or a variant thereof. In some embodiments, the donor template further comprises a polynucleotide spacer between i) the first gRNA target site and ii) the splice acceptor. In some embodiments, the polynucleotide spacer is 18 nucleotides in length. In some embodiments, the donor template flanks a first AAV ITR (inverted terminal repeat) on one side and/or flanks a second AAV ITR on the other side. In some embodiments, the first AAV ITR is an AAV2 ITR and/or the second AAV ITR is an AAV2 ITR. In some embodiments, iii) a nucleotide sequence encoding a synthetic FVIII having a B domain substitution comprising 3, 4, 5 or 6 N-linked glycosylation sites. Exemplary sequences for donor template components can be found in the donor template sequences of SEQ ID NOs: 310 and/or 311.

Target sequence selection

In some embodiments, shifts in the position of the 5' border and/or the 3' border with respect to a particular reference locus are used to facilitate or enhance certain applications of gene editing, which are further described and exemplified herein. As such, it depends in part on the endonuclease system chosen for editing.

In a first non-limiting aspect of this target sequence selection, a number of endonuclease systems provide rules or criteria that guide the initial selection of potential target sites for cleavage, such as those of CRISPR type II or V endonucleases. In some cases, it has the requirement of a PAM sequence motif within a specific position adjacent to the DNA cleavage site.

In another non-limiting aspect of target sequence selection or optimization, the frequency of off-target activity for a particular combination of target sequence and DNA endonuclease (i.e., the frequency of double helix breaks occurring at sites other than the selected target sequence) is assessed for the frequency of on-target activity. In some cases, cells edited correctly at the locus of interest may have a selection advantage over other cells. Illustrative, non-limiting examples of selection advantages include attributes such as improved replication rate, persistence, resistance to certain conditions, improved successful transplantation rate or persistence in vivo after introduction into a subject, and maintenance or increased number of such cells or Includes acquisition of other attributes related to survivability. In other cases, cells that have been correctly edited at the locus of interest can be selected positively by one or more screening methods used to identify, sort, or otherwise select the correctly edited cells. Both selection favours and induced selection methods can take advantage of phenotypes associated with correction. In some embodiments, cells may be edited two or more times to create a second modification that creates a new phenotype that is used to select or purify an intended population of cells. This second modification can be created by adding a second gRNA for a selectable or screenable marker. In some cases, cells can be edited precisely at the desired locus using cDNA and also DNA fragments containing a selectable marker.

In an embodiment, whether any selection advantage is applicable or any induced selection will be applied in a particular case, target sequence selection also enhances the application effect and/or is desired at sites other than the desired target. It is guided by considering the off-target frequency to reduce the likelihood of undesirable changes. As further described and exemplified herein and in the art, the generation of off-target activity is driven by a number of factors, including the similarities and dissimilarities between the target and off-target sites, as well as the particular endonuclease used. get affected. Bioinformatics tools are available that aid in the prediction of off-target activity, and frequently these tools can also be used to identify the most probable sites of off-target activity, which can then be evaluated in an experimental setting to evaluate the off-target activity. Assessing the relative frequency of on-target activity versus on-target activity, thereby allowing selection of sequences with higher relative on-target activity. Examples of such techniques are provided herein, others known in the art.

Another aspect of target sequence selection relates to homologous recombination events. Sequence sharing regions of homology can serve as pivot points for homologous recombination events that result in deletion of intervening sequences. These recombination events occur during the normal course of replication of chromosomes and other DNA sequences, and also occur when DNA sequences are synthesized, such as in the case of repair of double-strand breaks (DSBs). DSB occurs regularly during the normal cell replication cycle, but can also be enhanced by factors such as UV light and other inducers of DNA breakage, or by the presence of agents (such as chemical inducers). Many of these inducers cause DSBs to develop non-discriminately in the genome, which are regularly induced and repaired in normal cells. During repair, the original sequence can be reconstructed with complete accuracy, but in some cases small indels are introduced at the DSB site.

DSBs can also be induced specifically at a particular location, as in the case of the endonuclease system described herein, which can be induced at a selected chromosomal location or used to trigger a preferential genetic modification event. The propensity of homologous sequences to undergo recombination with respect to DNA repair (as well as replication) can be exploited in a number of settings and is the basis for one application of gene editing systems, such as CRISPR, where homology-guided repair is used to The sequence of interest is inserted into the desired chromosomal location through the use of a "donor" template.

Regions of homology between particular sequences, which may be small regions of “microhomology” that may have 10 or fewer base pairs, may also be used to cause the desired deletion. For example, a single DSB is introduced at a site exhibiting microhomology with a nearby sequence. During the normal repair process of these DSBs, a high frequency result is the deletion of intervening sequences as a result of recombination facilitated by the DSB and the simultaneous cell repair process.

However, in some circumstances, selecting a target sequence within a region of homology can also result in even larger deletions, including gene fusions (where the deletion is in the coding region), which is desirable given the particular circumstances. or may not be desirable.

The examples provided herein further illustrate the selection of target regions for generation of DSBs designed to insert FVIII coding sequences, as well as selection of specific target sequences within those regions designed to minimize off-target events compared to on-target events. .

targeted integration

In some embodiments, the methods provided herein integrate a synthetic FVIII coding sequence at a specific location within the genome of a hepatocyte, which is referred to as “targeted integration”. In some embodiments, targeted integration is enabled by using sequence-specific nucleases to create double-stranded breaks in genomic DNA.

The CRISPR/CAS system used in some embodiments has the advantage of being able to rapidly screen multiple genomic targets to identify optimal CRISPR/CAS designs. sgRNA molecules targeting any region of the genome can be designed in silico by placing a 20 bp sequence adjacent to all PAM motifs. PAM motifs are present on average every 15 bp in the genome of eukaryotes. However, sgRNAs designed by the in silico method will produce double-strand breaks with different efficiencies in cells, and it is currently not possible to predict the cleavage efficiency of a series of sgRNA molecules using the in silico method. Because sgRNAs can be rapidly synthesized in vitro, this allows for rapid screening of all possible sgRNA sequences in a given genomic region to identify the sgRNA that results in the most efficient cleavage. In general, when a series of sgRNAs within a given genomic region are tested in cells, a range of cleavage efficiencies from 0 to 90% is observed. In silico algorithms and laboratory tests can also be used to determine the off-target potential of any given sgRNA. While a perfect match to the 20 bp recognition sequence of an sgRNA will occur predominantly only once in most eukaryotic genomes, there will be many additional sites in the genome with one or more base pair mismatches to the sgRNA. These sites can be cleaved with variable frequency, which is often not predictable based on the number or location of mismatches. Cleavage at additional off-target sites not identified by in silico analysis may also occur. Therefore, screening of multiple sgRNAs in relevant cell types to identify sgRNAs with the most desirable off-target profile is a decisive factor in selecting optimal sgRNAs for therapeutic use. A preferred off-target profile will take into account the actual number of off-target sites and the frequency of cleavage at these sites, as well as the location of these sites in the genome. For example, an off-target site near or within a functionally important gene, particularly an oncogene or anti-oncogene, is considered less desirable than a site within an intergenic region of unknown function. Therefore, the identification of optimal sgRNA cannot simply be predicted by in silico analysis of the genome sequence of an organism and requires experimental testing. Although in silico analysis can help narrow the number of guides to examine, it cannot predict guides with high on-target cleavage or guides with low desirable off-target cleavage. Experimental data show that the cleavage efficiency of sgRNAs each with a perfect match to the genome within the region of interest (eg albumin intron 1) varies from no cleavage to greater than 90% cleavage, and is not predictable by any known algorithm. appear. The ability of a given sgRNA to facilitate cleavage by the Cas enzyme may be related to the accessibility of a particular site in genomic DNA, which may be determined by the chromatin structure within that region. In differentiated resting cells, such as hepatocytes, the majority of genomic DNA resides in highly condensed heterochromatin, but a more open chromatin state in which regions that are actively transcribed are known to be more accessible to macromolecules such as proteins such as the Cas protein. exists as Even within actively transcribed genes, some specific regions of DNA are more accessible than others due to the presence or absence of associated transcription factors or other regulatory proteins. It is not possible to predict sites within the genome or within a particular genomic locus or region of a genomic locus, such as introns and such as albumin intron 1, and will therefore need to be determined empirically in the cell type concerned. Once some sites have been selected as possible sites for insertion, it may be possible to add some variations to these sites, for example by moving a few nucleotides upstream or downstream from the selected site, with or without experimental testing.

In some embodiments, the gRNA that can be used in the methods disclosed herein is one of SEQ ID NOs: 271-298, or any functional equivalents thereof having at least about 85% nucleotide sequence identity to those of SEQ ID NOs: 271-298 More than that.

Nucleic Acid Modifications

In some embodiments, a polynucleotide introduced into a cell is further described herein and known in the art, for example, to enhance activity, stability or specificity, to alter transport, or to be native to the host cell. having one or more modifications that can be used individually or in combination to reduce or otherwise enhance an immune response.

In certain embodiments, the modified polynucleotide is used in the CRISPR/Cas9/Cpf1 system, in which case guide RNA (single-molecule guide or double-molecule guide) and/or Cas or Cpf1 endonuclease introduced into the cell. The encoding DNA or RNA can be modified as described and exemplified below. Such modified polynucleotides can be used in the CRISPR/Cas9/Cpf1 system to edit any one or more genomic loci.

For the purposes of non-limiting examples of this use, the CRISPR/Cas9/Cpf1 system is used to generate gRNAs, which can be single-molecule guides or double-molecules, and Cas or Cpf1 endonucleases using modifications of guide RNAs. Eggplant may enhance the formation or stability of the CRISPR/Cas9/Cpf1 genome editing complex. Modifications of gRNAs can also or alternatively be used to improve the initiation, stability or kinetics of interactions between the genome editing complex and a target sequence in the genome, which can be used, for example, to enhance on-target activity. Modifications of guide RNAs can also or alternatively be used to improve specificity, eg, the relative speed of genome editing at on-target sites compared to effects at other (off-target) sites.

The modification may also or alternatively be used to increase the stability of the guide RNA, for example by increasing its resistance to degradation by ribonucleases (RNases) present in the cell, thereby increasing its half-life in the cell. can increase Modifications that enhance guide RNA half-life may be particularly useful in embodiments in which a Cas or Cpf1 endonuclease is introduced into the cell to be edited via the RNA that needs to be translated to produce the endonuclease, because the endonuclease This is because an increase in the half-life of the guide RNA that is introduced simultaneously with the RNA encoding the nuclease can be used to increase the time the guide RNA and the encoded Cas or Cpf1 endonuclease reside together in the cell.

Modifications may also or alternatively be used to reduce the likelihood or extent to which RNA introduced into a cell will elicit an innate immune response. As described below and in the art, well-characterized in the context of RNA interference (RNAi), including small-interfering RNA (siRNA), such responses are associated with reduced half-life of RNA and/or cytokines or immune responses. It tends to be associated with the triggering of other factors.

Modifications that enhance the stability of RNA (eg, by increasing its degradation by RNAse present in the cell), modifications that enhance translation of the resulting product (ie endonuclease), and/or that the RNA introduced into the cell is innate One or more types of modifications may also be made to the RNA encoding the endonuclease to be introduced into the cell, including, but not limited to, modifications that reduce the likelihood or extent of eliciting an immune response.

Variations, such as combinations of the above and others, may likewise be used. In the case of CRISPR/Cas9/Cpf1, for example, one or more types of modifications can be made to the guide RNA (including those exemplified above) and/or one or more types of modifications encode a Cas endonuclease. RNA (including those exemplified above).

By way of illustration, guide RNAs or other smaller RNAs used in the CRISPR/Cas9/Cpf1 system can be readily synthesized by chemical means, which, as exemplified below and described in the art, have numerous modifications. to be easily incorporated. Although chemical synthesis procedures continue to expand, purification of these RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to be more challenging because polynucleotides This is because the length increases significantly with more than several hundred nucleotides. One approach used to generate chemically-modified RNA of greater length is to generate two or more molecules that are ligated together. Much longer RNAs, such as those encoding Cas9 endonuclease, are more readily produced enzymatically. Fewer types of modifications are generally available for use in enzymatically produced RNA, but as described below and further in the art, for example, to improve stability and/or enhance innate immunity There are still modifications that can be used to reduce the likelihood or extent of a response and/or enhance other properties; New types of variants are being developed regularly.

By way of illustration of the types of modifications, particularly those frequently used with smaller chemically synthesized RNA, the modifications include one or more nucleotides modified at the 2' position of the sugar, in some embodiments 2'-0-alkyl, 2′-O-alkyl-O-alkyl or 2′-fluoro-modified nucleotides. In some embodiments, the RNA modification comprises a 2′-fluoro, 2′-amino or 2′ O-methyl modification on the ribose of a pyrimidine, free base residue or inverted base at the 3′ end of the RNA. These modifications are incorporated into oligonucleotides, which are reported to have a higher T _m (ie, higher target binding affinity) than 2'-deoxyoligonucleotides for a given target.

It has been reported that a number of nucleotide and nucleoside modifications make the oligonucleotides into which they are incorporated more resistant to nuclease degradation than native oligonucleotides; These modified oligonucleotides remain intact for a longer period of time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include modified backbones such as phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatom or heterocyclic intersugar linkages. include those containing Some oligonucleotides have oligonucleotides with phosphorothioate backbones and heteroatom backbones, especially CH ₂ -NH-O-CH ₂ , CH,~N(CH ₃ )~O~CH ₂ (methylene(methylimino) or known as MMI backbone), CH ₂ --O--N(CH ₃ )-CH ₂ , CH ₂ -N(CH ₃ )-N(CH ₃ )-CH ₂ and ON(CH ₃ )-CH ₂ - those with a CH ₂ backbone, the native phosphodiester backbone being O-P--O-CH,); amide backbones (see A. De Mesmaeker et al., Ace Chem Res (1995) 28 :366-374); morpholino backbone structures (see Summerton and Weller, US Pat. No. 5,034,506); and a peptide nucleic acid (PNA) backbone (described below). Phosphorus-containing linkages are methyl and other alkyl with phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, 3′alkylene phosphonates and chiral phosphonates. Phosphoramidates with phosphonates, phosphinates, 3'-amino phosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs and those with inverted polarity, wherein adjacent pairs of nucleoside units are 3'- 5' to 5'-3' or 2'-5' to 5'-2'linked; US Pat. No. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.

Morpholino-based oligomeric compounds are described in DA Braasch et al., Biochem (2002) 41 (14):4503-10; SC Ekker et al., Genesis (2001) 30 (3):89-93 (and other articles in that publication); Literature [J. Heasman, Dev Biol (2002) 243 :209-14]; Literature [A. Nasevicius et al., Nat Genet (2000) 26 :216-20]; Literature [G. Lacerra et al., Proc Natl Acad Sci USA (2000) 97 :9591-96]; and US Pat. No. 5,034,506.

Cyclohexenyl nucleic acid oligonucleotide mimetics are described in J. Wang et al., J Am Chem. Soc (2000) 122 :8595-602].

A modified oligonucleotide backbone that does not contain a phosphorus atom therein may contain short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages or one or more short chain heteroatoms or heterocyclic nucleosides. It has a backbone formed by intercleoside bonds. These include morpholino linkages (formed in part from the sugar moiety of the nucleoside); siloxane backbone; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene-containing backbone; sulfamate backbone; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbone; and others having mixed N, O, S and CH ₂ component moieties; US Pat. No. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is incorporated herein by reference.

One or more substituted sugar moieties may be included in the 2' position, for example one of the following: OH, SH, SCH ₃ , F, OCN, OCH ₃ OCH ₃ , OCH ₃ O(CH ₂ ) _n CH ₃ , O(CH ₂ ) _n NH ₂ , or O(CH ₂ ) _n CH ₃ , wherein n is from 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF ₃ ; OCF ₃ ; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH ₃ ; SO ₂ CH ₃ ; ONO ₂ ; NO ₂ ; N ₃ ; NH ₂ ; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; RNA cleaving group; reporter group; intercalator; groups for improving the pharmacokinetic properties of oligonucleotides; or groups for improving the pharmacodynamic properties of oligonucleotides and other substituents having similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (also known as 2'-O-CH ₂ CH ₂ OCH ₃ , 2'-O-(2-methoxyethyl)) (see [ P. Martin et al., Helv Chim Acta (1995) 78 :486]). Other variations include 2'-methoxy (2'-O-CH ₃ ), 2'-propoxy (2'-OCH ₂ CH ₂ CH ₃ ) and 2'-fluoro(2'-F). Similar modifications can also be made at other positions on the oligonucleotide, particularly on the 3' position of the sugar on the 3' terminal nucleotide and on the 5' position of the 5' terminal nucleotide. Oligonucleotides may also have a sugar mimic, such as cyclobutyl, in place of a pentofuranosyl group.

In some embodiments, the sugar and internucleoside linkages of the nucleotide units, ie, the backbone, are replaced with novel groups. Base units are maintained for hybridization with the appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic, reported to have excellent hybridization properties is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of the oligonucleotide is replaced with an amide containing backbone, for example an aminoethylglycine backbone. The nucleobase is retained and is bonded directly or indirectly to the aza nitrogen atom of the amide portion of the backbone. Representative US patents that teach the preparation of PNA compounds include US Pat. Nos. 5,539,082; 5,714,331; and 5,719,262. Additional teachings of PNA compounds can be found in PE Nielsen et al., Science (1991) 254 :1497-500.

In some embodiments, the guide RNA may also additionally or alternatively include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “native” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleobases are nucleobases found only sparingly or transiently in natural nucleic acids, for example, hypoxanthine, 6-methyladenine, 5-Me pyrimidine, especially 5-methylcytosine (5-methyl-2' deoxy Also referred to as cytosine and commonly referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2 -Aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalkylamino)adenine or other heterosubstituted alkyladenine, 2-thiouracil, 2-thiothymine, 5- bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, and 2,6-diaminopurine (G. Gebeyehu et al. ., Nucl Acids Res (1997) 15 :4513]). "Universal" bases known in the art, such as inosine, may also be included. 5-Me-C substitution has been reported to increase nucleic acid duplex stability by 0.6 to 1.2° C. (YS Sanghvi et al., “Antisense Research and Applications”, CRC Press, Boca Raton, 1993, pp. 276-278). ), an embodiment of base substitution.

In some embodiments, the modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, adenine and guanine. 6-methyl and other alkyl derivatives of, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine , 6-azouracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenine and guanine, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine , 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

Nucleobases are also described in US Pat. No. 3,687,808, The Concise Encyclopedia of Polymer Science And Engineering', pages 858-859, Kroschwitz, JI, ed. John Wiley & Sons, 1990; Englisch et al., Ange. Chemie, Int'l Ed , (1991) 30 :613 and YS Sanghvi, Chapter 15, “Antisense Research and Applications”, pp 289-302, Crooke, ST and Lebleu, B. ed., CRC Press, 1993]. These specific nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the present disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines such as 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine . 5-methylcytosine substitution has been reported to increase nucleic acid duplex stability by 0.6-1.2° C. (YS Sanghvi, supra , pp. 276-78), more particularly in combination with 2'-O-methoxyethyl sugar modifications. case is an embodiment of base substitution. Modified nucleobases are described in US Pat. Nos. 3,687,808 and 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,681,941; 5,750,692; 5,763,588; 5,830,653; 6,005,096; and US Patent Application Publication No. 2003/0158403.

In some embodiments, the guide RNA and/or mRNA (or DNA) encoding the endonuclease is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include lipid moieties such as cholesterol moieties (Letsinger et al . , Proc Natl Acad Sci USA , (1989) 86 :6553-56); cholic acid (Manohran et al., Bioorg Med Chem Let (1994) 4 :1053-60); Thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann NY Acad Sci (1992) 660 :306-09) and Manoharan et al., Bioorg Med Chem Let , (1993) ) 3 :2765-70]); thiocholesterol (Oberhauser et al., Nucl Acids Res (1992) 20 :533-538); Aliphatic chains such as dodecanediol or undecyl residues (Kabanov et al., FEBS Lett . (1990) 259 :327-330) and Svinarchuk et al., Biochimie (1993) 75 :49- 54]); Phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manohran et al., Tetrahedron Lett (1995) 36 :3651-54 and Shea et al., Nucl Acids Res (1990) 18 :3777-83); polyamine or polyethylene glycol chains (Mancharan et al., Nucleosides & Nucleotides (1995) 14 :969-73); adamantane acetic acid (Manohran et al., Tetrahedron Lett (1995) 36 :3651-54); palmityl moieties (Mishra et al ., Biochim Biophys Acta (1995) 1264 :229-37); or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety (Crooke et al., J Pharmacol Exp Ther (1996) 277 :923-37). US Pat. No. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; See also 5,599, 928 and 5,688,941.

In some embodiments, sugars and other moieties can be used to target proteins and complexes having nucleotides, such as cationic polysomes and liposomes, to specific sites. For example, hepatocyte-induced transduction may be mediated through the asialoglycoprotein receptor (ASGPR); See, eg, Hu et al., Protein Pept Lett (2014) 21 (10):1025-30. Other systems known in the art can be used to target the biomolecules and/or complexes thereof used in this case, particularly to target cells of interest.

In some embodiments, these targeting moieties or conjugates may include a conjugate group that is covalently bound to a functional group, such as a primary or secondary hydroxyl group. Conjugate groups of the present disclosure include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers and groups that enhance the pharmacokinetic properties of oligomers. Exemplary conjugate groups include cholesterol, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, and dyes. Groups that enhance pharmacodynamic properties in the context of the present disclosure include groups that improve uptake and/or improve resistance to degradation and/or enhance sequence-specific hybridization with a target nucleic acid. Groups that improve pharmacokinetic properties in the context of the present disclosure include groups that improve absorption, distribution, metabolism or excretion of a compound of the present disclosure. Representative conjugate groups are disclosed in International Patent Application Serial No. PCT/US92/09196 and U.S. Patent No. 6,287,860, filed October 23, 1992, which are incorporated herein by reference. The conjugate moiety may be a lipid moiety such as a cholesterol moiety, cholic acid, a thioether such as hexyl-5-tritylthiol, thiocholesterol, an aliphatic chain such as dodecanediol or an undecyl residue, a phospholipid , for example di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, polyamine or polyethylene glycol chains, or adamane tan acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety. See, for example, U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; No. 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241; 5,391,723; 5,416,203; 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; See Nos. 5,599,928 and 5,688,941.

Longer polynucleotides less suitable for chemical synthesis and generally produced by enzymatic synthesis may also be modified. Such modifications may include, for example, introduction of specific nucleotide analogs, incorporation of specific sequences or other moieties at the 5' or 3' end of the molecule, and other modifications. By way of example, the mRNA encoding Cas9 is approximately 4 kb in length and can be synthesized by in vitro transcription. Modifications to the mRNA may be applied, for example, to increase its translation or stability (eg by increasing its resistance to degradation within the cell) or after introduction of an exogenous RNA, in particular a longer RNA encoding such as Cas9 into the cell It can reduce the tendency of RNA to trigger an innate immune response commonly observed in

Many of these modifications, such as polyA tails, 5' cap analogs (eg, Anti Reverse Cap Analog (ARCA) or m7G(5')ppp(5')G(mCAP)), modified 5' or 3' untranslated region (UTR), modified base (eg pseudo-UTP, 2-thio-UTP, 5-methylcytidine-5'-triphosphate (5-methyl-CTP) or N6-methyl- ATP) or treatment with phosphatase to remove the 5' terminal phosphate has been described in the art. These and other modifications are known in the art, and new modifications of RNA are being developed regularly.

It has been reported that improved therapeutic effects can be achieved using chemically modified mRNA delivered in vivo; See, eg, Kormann et al., Nature Biotechnol (2011) 29: 154-57. Such modifications can be used, for example, to increase the stability of an RNA molecule and/or to decrease its immunogenicity. Using chemical modifications such as pseudo-U, N6-methyl-A, 2-thio-U and 5-methyl-C, only a quarter of the uridine and cytidine residues were replaced with 2-thio-U and 5, respectively. It was observed that substitution with -methyl-C resulted in a significant reduction in the toll-like receptor (TLR) mediated recognition of mRNA in mice. By reducing the activation of the innate immune system, these modifications can be used to efficiently increase the stability and persistence of mRNA in vivo; See, eg, Kormann et al. ].

In addition, it has been reported that repeated administration of synthetic messenger RNA incorporating modifications designed to bypass the innate anti-viral response can reprogram differentiated human cells to pluripotency. See, eg, Warren et al., Cell Stem Cell (2010) 7 (5):618-30. These modified mRNAs, which act as key reprogramming proteins, can be an efficient means of reprogramming many human cell types. These cells are referred to as induced pluripotent stem cells (iPSCs) and use enzymatically synthesized RNA incorporating 5-methyl-CTP, pseudo-UTP and an anti-reverse transcription cap analog (ARCA) for the antiviral response of the cells. was observed to be able to avoid efficiently; See, eg, Warren et al ., supra.

Other modifications of polynucleotides described in the art include, for example, use of a polyA tail, addition of a 5' cap analog (eg m7G(5')ppp(5')G (mCAP)), 5' or 3' modification of the untranslated region (UTR), and treatment with phosphatase to remove the 5' terminal phosphate.

Numerous compositions and techniques applicable to the production of modified RNAs for use herein have been developed in connection with the modification of RNAi, including siRNAs. siRNAs present certain challenges in vitro, as their effects in gene silencing via mRNA interference are usually transient, which may require repeated administration. In addition, siRNA is double-stranded RNA (dsRNA), and mammalian immune responses are often developed to detect and neutralize dsRNA, which is a by-product of viral infection. Thus, mammalian enzymes such as PKR (dsRNA-reactive kinase), and potential retinoic acid-inducible gene I (RIG-I) that can mediate cellular responses to dsRNA, and induction of cytokines in response to these molecules There are Toll-like receptors (such as TLR3, TLR7 and TLR8) that can trigger See, eg, Angart et al., Pharmaceuticals (Basel) (2013) 6 (4):440-68; Kanasty et al., Mol Ther (2012) 20 (3):513-24; Burnett et al., Biotechnol J (2011) 6 (9): 1130-46; See the review by Judge and MacLachlan, Hum Gene Ther (2008) 19 (2):111-24 and the references cited therein.

A wide variety of modifications have been developed and applied to improve RNA stability and/or to reduce the innate immune response and/or to achieve other advantages that may be useful in connection with the introduction of polynucleotides into human cells; See, eg, Ann Rev Chem Biomol Eng (2011) 2 :77-96; Gaglione and Messere, Mini Rev Med Chem (2010) 10 (7):578-95; Chernolovskaya et al., Curr Opin Mol Ther (2010) 12 (2):158-67; Deleavey et al., Curr Protoc Nuc Acid Chem, Chapter 16:Unit 16.3 (2009); Behlke, Oligonucleotides (2008) 18 (4):305-19; Fucini et al., Nucleic Acid Ther (2012) 22 (3): 205-210; See review of Bremsen et al., Front Genet (2012) 3 :154.

A number of commercial sources of modified RNA exist, many of which have specialized in modifications designed to improve the efficiency of siRNA. Various approaches are provided based on findings reported in the literature. For example, Dharmacon has extensively used the replacement of non-bridging oxygen with sulfur (phosphorothioate, PS) as reported by Kole, Nature Rev Drug Disc (2012) 11 :125-40 As shown, it is noted that the nuclease resistance of the siRNA was improved. It has been reported that modification of the ribose 2'-position improves nuclease resistance of internucleotide phosphate bonds while increasing duplex stability (Tm), which also provides protection from immune activation. The combination of moderate PS backbone modifications with small, widely-accepted 2'-substitutions (2'-O-methyl, 2'-fluoro, 2'-hydro) is described in Soutschek et al., Nature (2004) 432 :173-78, has been associated with highly stable siRNAs for in vivo applications; 2'-O-methyl modification is reported to be effective in improving stability as reported in Volkov, Oligonucleotides (2009) 19 :191-202]. With respect to reducing the induction of the innate immune response, modification of specific sequences to 2'-O-methyl, 2'-fluoro, 2'-hydro generally retains silencing activity, while the TLR7/TLR8 interaction has been reported to reduce; See, eg, Judge et al., Mol Ther (2006) 13 :494-505; and Cekaite et al., J Mol Biol (2007) 365 :90-108. Additional modifications such as 2-thiouracil, pseudouracil, 5-methylcytosine, 5-methyluracil, and N6-methyladenosine have also been reported to minimize immune effects mediated by TLR3, TLR7 and TLR8; See, for example, K. Kariko et al., Immunity (2005) 23 :165-75].

Also known in the art and commercially available, polynucleotides, such as RNA, for use herein that can enhance their transport and/or uptake by cells, for example, cholesterol, tocopherol and folic acid, lipids, peptides, polymers, linkers and aptamers; See, eg, Winkler, Ther. Deliv . (2013) 4 :791-809], and the references cited therein.

carrying

In some embodiments, any nucleic acid molecule used in the methods provided herein, e.g., a nucleic acid encoding a genome-targeting nucleic acid and/or site-directed polypeptide of the present disclosure, can be used in a delivery vehicle for delivery into a cell. packaged in or on the surface. Delivery vehicles include, but are not limited to, nanospheres, liposomes, quantum dots, nanoparticles, polyethylene glycol particles, hydrogels, and micelles. As described in the art, a variety of targeting moieties can be used to enhance preferential interaction of such vehicles with a desired cell type or location.

Complexes, polypeptides and nucleic acids of the present disclosure can be subjected to viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection. cell injection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technique, calcium phosphate precipitation, direct micro-injection, nanoparticle-mediated transport of nucleic acids, and the like.

In an embodiment, the guide RNA polynucleotide (RNA or DNA) and/or endonuclease polynucleotide(s) (RNA or DNA) may be delivered by viral or non-viral delivery vehicles known in the art. Alternatively, the site-directed polypeptide(s) can be delivered by viral or non-viral delivery vehicles known in the art, such as electroporation or lipid nanoparticles. In some embodiments, the DNA endonuclease may be delivered as one or more polypeptides, either alone or pre-complexed with one or more crRNAs in combination with one or more gRNAs or tracrRNAs.

In an embodiment, polynucleotides are non-, including, but not limited to, nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small molecule RNA-conjugates, aptamer-RNA chimeras, and RNA-fusion protein complexes. delivered by a virus delivery vehicle. Some exemplary non-viral delivery vehicles are described in Peer and Lieberman, Gene Ther (2011) 18 :1127-33 (which focuses on non-viral delivery vehicles for siRNAs that are also useful for delivery of other polynucleotides) is described in

In an embodiment, polynucleotides, such as guide RNAs, sgRNAs and mRNA encoding endonucleases, can be delivered to cells or subjects by lipid nanoparticles (LNPs).

Although several non-viral delivery methods for nucleic acids have been tested in both animal models and humans, the best developed system is lipid nanoparticles. LNPs are generally composed of ionizable cationic lipids and at least three additional components, usually cholesterol, DOPE and polyethylene glycol (PEG) containing lipids (see, eg, Example 1). Cationic lipids can bind positively charged nucleic acids to form dense complexes that protect the nucleic acids from degradation. During passage through the microfluidic system, the components self-assemble to form particles ranging in size from 50 to 150 nM, wherein the nucleic acids are complexed with cationic lipids and encapsulated within a core surrounded by a lipid bilayer-like structure. do. After injection into the circulatory system of a subject, these particles can bind to apolipoprotein E (apoE). ApoE is a ligand for the LDL receptor and mediates uptake into hepatocytes of the liver through receptor-mediated endocytosis. This type of LNP has been reported to efficiently deliver mRNA and siRNA to hepatocytes of rodent, primate and human livers. After endocytosis, LNP is present in the endosome. Encapsulated nucleic acids undergo a process of endosomal evasion mediated by the ionizable nature of cationic lipids. It delivers the nucleic acid into the cytoplasm, where the mRNA can be translated into the encoded protein. Thus, in some embodiments, encapsulation of gRNA and Cas9 encoding mRNA into LNPs is used to efficiently deliver both components to hepatocytes after intravenous injection. After endosomal evasion, Cas9 mRNA is translated into Cas9 protein and forms a complex with gRNA. In some embodiments, inclusion of a nuclear localization signal within the Cas9 protein sequence promotes translocation of the Cas9 protein/gRNA complex to the nucleus. Alternatively, the small gRNA traverses the nuclear pore complex, forming a complex with the Cas9 protein in the nucleus. Once the gRNA/Cas9 complex is present in the nucleus, it scans the genome for homologous target sites, preferentially creating double-stranded breaks at the desired target site in the genome. The half-life of RNA molecules in vivo is short, on the order of several hours to several days. Similarly, the half-life of proteins tends to be short, on the order of hours to days. Thus, in some embodiments, delivery of gRNA and Cas9 mRNA using LNPs may result in only transient expression and activity of the gRNA/Cas9 complex. This may provide the advantage of reducing the frequency of off-target cleavage, thus minimizing the risk of genotoxicity in some embodiments. LNPs are generally less immunogenic than viral particles. Many humans have pre-existing immunity to AAV, but no pre-existing immunity to LNP. Additional and adaptive immune responses to LNP are less likely to occur, allowing repeated administration of LNP.

When a subject is administered gene editing based gene therapy in which a therapeutic coding sequence is integrated into a host genomic locus, such as a safe harbor locus, it would be advantageous to achieve a level of gene expression that provides an optimal therapeutic benefit to the subject. For example, in hemophilia A, the most desirable level of FVIII protein in the blood will range from 20% to 100%, 30% to 100%, 40% to 100% or 50% to 100% of normal levels. Standard AAV-based gene therapy, which uses a strong promoter to drive expression of a therapeutic coding sequence from an episomal copy of the AAV genome, does not allow for the regulation of the level of expression achieved, since the AAV virus has only 1 It can be administered only once and the level of expression achieved varies significantly between subjects (S. Rangarajan et al., N Engl J Med (2017) 377 :2519-30). After administration of the AAV virus to subjects, they develop high titers of antibodies to the viral capsid protein, which is expected to prevent effective re-administration of the virus based on preclinical models (H. Petry et al. , Gene Ther (2008) 15 :54-60]). One approach in which a therapeutic gene delivered by an AAV virus is integrated into the genome at a safe harbor locus, such as albumin intron 1, where this targeted integration occurs through the creation of double-stranded breaks in the genome, is the level of targeted integration and This provides an opportunity to modulate the level of therapeutic coding sequence products. After liver transduction with an AAV encapsulating an AAV genome containing a donor DNA cassette encoding synthetic FVIII, the AAV genome is maintained episomal in the nucleus of the transduced cell. These episomal AAV genomes are relatively stable over time, thus providing a pool of donor templates for targeted integration at the double-strand breaks generated by CRISPR/Cas9.

Several different ionizable cationic lipids have been developed for use in LNPs. These are among others C12-200 (KT Love et al., Proc Natl Acad Sci USA (2010) 107 :1864-69), MC3 (M. Jayaraman et al., Angew Chem Int Ed Engl ( 2012) 51 :8529-33), LN16 and MD1 (Fougerolles et al., US Pat. No. 8754062). C12-200 is 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl) (2-hydroxydodecyl)amino)ethyl)pipe Razin-1-yl)ethyl)azanediyl)bis(dodecan-2-ol). In one type of LNP, a GalNac moiety is attached to the outside of the LNP and acts as a ligand for uptake into the liver via the asialoglycoprotein receptor. Either of these cationic lipids is used to formulate LNPs for delivery of gRNA and Cas9 mRNA to the liver.

In some embodiments, the LNPs have a diameter of less than about 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, the nanoparticles can range in size from about 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm.

LNPs can be prepared from cationic, anionic or neutral lipids. Neutral lipids such as fusogenic phospholipid DOPE or membrane component cholesterol can be included in LNPs as 'helper lipids' to enhance transfection activity and nanoparticle stability. Limitations of cationic lipids may include poor stability and rapid clearance, as well as low potency due to generation of an inflammatory or anti-inflammatory response. LNPs may also have hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.

Any lipid or combination of lipids known in the art can be used to generate LNPs. Examples of lipids used to produce LNPs include DOTMA, DOSPA, DOTAP, DMRIE, DC-cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE and GL67A-DOPE-DMPE-polyethylene glycol (PEG). Examples of cationic lipids include 98N12-5, C12-200, DLin-KC2-DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1 and 7C1. Examples of neutral lipids include DPSC, DPPC, POPC, DOPE and SM. Examples of PEG-modified lipids include PEG-DMG, PEG-CerC14 and PEG-CerC20.

In embodiments, lipids may be combined in any number of molar ratios to produce LNPs. In addition, polynucleotide(s) can be combined with lipid(s) in a wide range of molar ratios to produce LNPs.

In an embodiment, the site-directed polypeptide and the genome-targeting nucleic acid may each be administered separately to a cell or subject. The site-directed polypeptide may be pre-complexed with one or more guide RNAs, or one or more crRNAs along with tracrRNAs. The pre-complexed material can then be administered to the cell or subject. These pre-complexed substances are known as ribonucleoprotein particles (RNPs).

RNA can form specific interactions with RNA or DNA. Although its properties are exploited in many biological processes, it also carries the risk of indiscriminate interactions in the nucleic acid-rich cellular environment. One solution to this problem is to form ribonucleoprotein particles (RNPs), where the RNA is pre-complexed with an endonuclease. Another benefit of RNPs is that RNA is protected from degradation.

In some embodiments, the endonuclease in the RNP is modified or unmodified. Likewise, gRNA, crRNA, tracrRNA or sgRNA may be modified or unmodified. Numerous variations are known in the art and can be used.

Endonucleases and sgRNAs are generally combined in a molar ratio of about 1:1. Alternatively, the endonuclease, crRNA and tracrRNA may be combined in a molar ratio of about 1:1:1. However, a wide variety of molar ratios can be used to generate RNPs.

In some embodiments, recombinant AAV vectors are used for delivery. Techniques for generating rAAV particles in which cells are provided with an AAV genome to be packaged comprising polynucleotides to be delivered, rep and cap genes, and helper virus functions are standard in the art. Production of rAAV requires that the following components are present in a single cell (referred to herein as packaging cell): the rAAV genome, the AAV rep and cap genes isolated from (i.e. not present within) the rAAV genome, and helpers. virus function. The AAV rep and cap genes can be derived from any AAV serotype from which the recombinant virus can be derived, and the AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6 AAV serotypes different from the rAAV genomic ITR, including but not limited to, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13 and AAV rh.74 can be derived from The generation of pseudotyped rAAV is disclosed, for example, in International Patent Application WO 01/83692. See Table 1.

Table 1 AAV serotypes and Genbank accession numbers of selected AAVs.

In some embodiments, a method of generating a packaging cell comprises generating a cell line stably expressing all of the essential components for AAV particle production. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking the AAV rep and cap genes, AAV rep and cap genes isolated from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, can be generated in the genome of a cell. integrated within GC tailing the AAV genome (RJ Samulski et al., Proc Natl Acad Sci USA (1982) 79:2077-81), addition of a synthetic linker containing a restriction endonuclease cleavage site (Reference [RJ Samulski et al., Proc Natl Acad Sci USA (1982) 79 :2077-81]) CA Laughlin et al., Gene (1983) 23 :65-73) or direct blunt-end ligation (P. Senapathy et al., J Biol Chem (1984) 259 :4661-66). has been introduced into a bacterial plasmid by The packaging cell line is then infected with a helper virus, such as an adenovirus. The advantage of this method is that the cells are selectable and suitable for large-scale production of rAAV. Another suitable method is to introduce the rAAV genome and/or rep and cap genes into packaging cells using adenoviruses or baculoviruses rather than plasmids.

The general principles of rAAV production are described, for example, in BJ Carter, Cur Op Biotechnol (1992) 3 (5):533-39; and [N. Muzyczka, Curr Topics Microbiol Immunol (1992) 158 :97-129]. Some approaches are described in JD Tratschin et al., Mol Cell Biol (1984) 4 :2072-81; [PL Hermonat et al., Proc Natl Acad Sci USA (1984) 81 :6466-70]; [JD Tratschin et al., Mol Cell Biol (1985) 5 :3251-60]; [SK McLaughlin et al., J Virol (1988) 62 :1963-73]; [JS Lebkowski et al., Mol Cell Biol (1988) 8 :3988-96]; [RJ Samulski et al., J Virol (1989) 63 :3822-28); US Pat. No. 5,173,414; International Patent No. WO95/13365 and corresponding U.S. Patent No. 5,658.776; International Patent No. WO95/13392; International Patent No. WO96/17947; International Patent No. PCT/US98/18600; International Patent No. WO97/09441 (PCT/US96/14423); International Patent No. WO97/08298 (PCT/US96/13872); International Patent No. WO97/21825 (PCT/US96/20777); International Patent No. WO97/06243 (PCT/FR96/01064); International Patent No. WO99/11764; Literature [P. Perrin et al., Vaccine (1995) 13 :1244-50]; [RW Paul et al., Human Gene Ther (1993) 4 :609-15]; [Clark et al., Gene Ther (1996) 3 :1124-32]; US Pat. No. 5,786,211; US Pat. No. 5,871,982; and US Pat. No. 6,258,595.

The AAV vector serotype can be matched to the target cell type. For example, the following exemplary cell types can be transduced with the specifically indicated AAV serotypes. For example, serotypes of AAV vectors suitable for liver tissue/cell types include, but are not limited to, AAV3, AAV5, AAV8 and AAV9.

In addition to adeno-associated viral vectors, other viral vectors may be used. Such viral vectors include, but are not limited to, lentivirus, alphavirus, enterovirus, pestivirus, baculovirus, herpesvirus, Epstein Barr virus, papovavirus, poxvirus, vaccinia virus and herpes simplex virus.

In some embodiments, the Cas9 mRNA, sgRNA targeting one or two loci in the albumin gene, and donor DNA are each individually formulated into a lipid nanoparticle, all co-formulated into one lipid nanoparticle, or two co-formulated into more than one lipid nanoparticle.

In some embodiments, Cas9 mRNA is formulated in lipid nanoparticles, while sgRNA and donor DNA are delivered in an AAV vector. In some embodiments, Cas9 mRNA and sgRNA are co-formulated in lipid nanoparticles, while donor DNA is delivered in an AAV vector.

Options are available to deliver the Cas9 nuclease as a DNA plasmid, as mRNA, or as a protein. The guide RNA may be expressed from the same DNA, or may be carried as RNA. RNA can be chemically modified to alter or improve its half-life, or to reduce the likelihood or extent of an immune response. The endonuclease protein can be complexed with the gRNA prior to delivery. Viral vectors allow for efficient delivery; A split version of Cas9 and an ortholog of the smaller Cas9 can be packaged in an AAV, such as a donor for HDR. Various non-viral delivery methods that can deliver each of these components also exist, or non-viral and viral methods can be used simultaneously. For example, nanoparticles can be used to deliver proteins and guide RNAs, while AAVs can be used to deliver donor DNA.

In some embodiments relating to delivery of a genome-editing component for a therapeutic treatment, at least two components: a sequence specific nuclease and a DNA donor template are delivered into the nucleus of the cell to be transformed, e.g., a hepatocyte . In some embodiments, the donor template is packaged into an AAV having tropism for the liver. In some embodiments, the AAV is selected from serotypes AAV8, AAV9, AAVrh10, AAV5, AAV6 or AAV-DJ. In some embodiments, the AAV packaged DNA donor template is administered to the subject, eg, first by peripheral intravenous injection, followed by the sequence specific nuclease. An advantage of first delivering the AAV packaged donor template is that the delivered donor template will remain stable in the nucleus of the transduced hepatocytes, allowing for subsequent administration of sequence-specific nucleases. This creates a double-stranded break in the genome, with subsequent integration of the donor template by HDR or NHEJ. In some embodiments, it is preferred that the sequence specific nuclease remain active at a level sufficient for the desired therapeutic effect only for a period of time necessary to promote targeted integration of the transgene in the target cell. If the sequence-specific nuclease remains active in the cell for an extended period of time, it will result in an increased frequency of double-strand breaks at the off-target site. Specifically, the frequency of off-target cleavage is a function of the off-target cleavage efficiency multiplied by the time the nuclease is active. Delivery of sequence-specific nucleases in the form of mRNAs results in short durations of nuclease activity ranging from hours to days, because mRNAs and translated proteins are short-lived in cells. Thus, delivery of sequence specific nucleases into cells already containing the donor template is expected to result in a better ratio of targeted integration compared to off-target integration. In addition, AAV-mediated delivery of the donor template to the nucleus of hepatocytes following peripheral intravenous injection, the time required for the virus to infect the cells, evade endosomes, and transport to the nucleus, and the single-stranded AAV genome by host components Due to the conversion of α to double-stranded DNA molecules, it generally takes about 1 to 14 days. Thus, in some embodiments, delivery of the donor template to the nucleus is complete prior to supplying the CRISPR/Cas9 components, since these nuclease components are active for about 1-3 days.

In some embodiments, the DNA endonuclease is CRISPR/Cas9, which together with a Cas9 nuclease consists of a sgRNA directed against a DNA sequence in intron 1 of the albumin gene. In some embodiments, the Cas9 endonuclease is delivered as an mRNA encoding a Cas9 protein operably fused to one or more nuclear localization signals (NLS). In some embodiments, the sgRNA and Cas9 mRNA are packaged in lipid nanoparticles and delivered to hepatocytes. In some embodiments, the lipid nanoparticles contain lipid C12-200 (KT Love et al., Proc Natl Acad Sci USA (2010) 107: 1864-69). In some embodiments, the ratio of sgRNA to Cas9 mRNA packaged in the LNP is 1:1 (mass ratio), which results in maximal DNA cleavage in mice in vivo. In alternative embodiments, different mass ratios packaged in LNPs, for example 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1 or 2 A ratio of sgRNA to Cas9 mRNA of :1 or inverse can be used. In some embodiments, the Cas9 mRNA and sgRNA are packaged into separate LNP formulations, wherein the LNP containing Cas9 mRNA is delivered to the subject about 1 to about 8 hours prior to the LNP containing the sgRNA so that the Cas9 mRNA is translated prior to delivery of the sgRNA. Optimal time for

In some embodiments, an LNP formulation that encapsulates gRNA and Cas9 mRNA (“LNP-nuclease formulation”) is administered to a subject, eg, to a subject who has previously administered a DNA donor template packaged into an AAV. In some embodiments, the LNP-nuclease formulation is administered to the subject within 1 to 28 days or within 7 to 28 days or within 7 to 14 days after administration of the AAV donor template. The optimal timing of delivery of the LNP-nuclease formulation relative to the AAV-donor template can be determined using techniques known in the art, for example, studies conducted in animal models including mice and monkeys.

In some embodiments, the DNA-donor template is delivered to hepatocytes of a subject, eg, to a subject using a non-viral delivery method. Although some subjects (typically 30%) have pre-existing neutralizing antibodies directed against the most commonly used AAV serotypes that prevent efficient gene transfer by AAV, all subjects are treatable with non-viral delivery methods. Several methods of non-viral delivery are known in the art. In particular, LNPs are known to efficiently deliver their encapsulated cargo into the cytoplasm of hepatocytes after intravenous injection in animals and humans. These LNPs are actively taken up by the liver through the process of receptor mediated endocytosis, resulting in preferential uptake into the liver.

In some embodiments, to promote nuclear localization of the donor template, DNA sequences capable of promoting nuclear localization of the plasmid, e.g., the simian virus 40 (SV40) origin of replication and the 366 bp region of the early promoter, are transferred to the donor template. can be added Other DNA sequences that bind cellular proteins can also be used to improve nuclear import of DNA.

In some embodiments, the level of expression or activity of the introduced FVIII is, for example, after an AAV donor template, of a LNP-nuclease formulation containing gRNA and a Cas9 nuclease or mRNA encoding a Cas9 nuclease. After the first administration, it is measured in a subject, eg, the subject's blood. If the FVIII level is not sufficient to treat the disease, e.g., at a level of 5% of the normal level, administration of a second or third LNP-nuclease formulation may be provided for further treatment into the genome safe harbor locus. It can promote targeted integration. The feasibility of using multiple doses of LNP-nuclease formulations to obtain the desired therapeutic level of FVIII has been tested using techniques known in the art, for example, animal models including mice and monkeys. can be tested and optimized using

In some embodiments, an initial dose of LNP-nuclease according to any one of the methods described herein comprising administration to the subject i) an AAV donor template comprising a donor cassette and ii) a LNP-nuclease formulation The formulation is administered to the subject within about 1 to about 28 days after administration of the AAV donor template to the subject. In some embodiments, the initial dose of the LNP-nuclease formulation is administered to the subject after a time sufficient to permit delivery of the donor template to the nucleus of the target cell. In some embodiments, the initial dose of the LNP-nuclease formulation is administered to the subject after a time sufficient to permit conversion of the single-stranded AAV genome into a double-stranded DNA molecule in the nucleus of the target cell. In some embodiments, one or more (eg, 2, 3, 4, 5 or more) additional doses of the LNP-nuclease formulation are administered to the subject after administration of the initial dose. In some embodiments, one or more doses of the LNP-nuclease formulation are administered to the subject until targeted integration of the target level of donor cassette and/or expression of the target level of the donor cassette is achieved. In some embodiments, the method comprises determining the level of targeted integration of the donor cassette and/or the level of expression of the donor cassette after each administration of the LNP-nuclease formulation and targeted integration of the target level of the donor cassette and/or administering an additional dose of the LNP-nuclease formulation if the target level of expression of the donor cassette is not achieved. In some embodiments, the amount of at least one of the additional doses of the LNP-nuclease formulation is the same as the initial dose. In some embodiments, the amount of at least one of the additional doses of the LNP-nuclease formulation is less than the initial dose. In some embodiments, the amount of at least one of the additional doses of the LNP-nuclease formulation is greater than the initial dose.

Genetically Modified Cells and Cell Populations

In one aspect, the present disclosure provides a method of generating a genetically modified cell by editing the genome within the cell. In some aspects, a population of genetically modified cells is provided. A “genetically modified cell” thus refers to a cell having at least one genetic modification introduced by genome editing (eg, using the CRISPR/Cas9/Cpf1 system). In some embodiments, the genetically modified cell is a genetically modified hepatocyte. Genetically modified cells having an exogenous genome-targeting nucleic acid and/or an exogenous nucleic acid encoding the genome-targeting nucleic acid are contemplated herein.

In some embodiments, the genome of a cell can be edited by inserting the nucleic acid sequence of the synthetic FVIII coding sequence into the genomic sequence of the cell. In some embodiments, the cell undergoing genome-editing has one or more mutation(s) in its genome, which results in a decrease in expression of the endogenous FVIII gene as compared to expression in a normal that does not have such mutation(s). Normal cells may be healthy or control cells originating (or isolated) from different subjects that do not have the FVIII gene defect. In some embodiments, cells undergoing genome-editing may originate (or be isolated) from a subject in need of treatment for a FVIII gene-related disease or disorder. Thus, in some embodiments, the expression of the endogenous FVIII gene in such cells is about 10%, about 20%, about 30%, about 40%, about 50%, about 60% compared to the expression of endogenous FVIII gene expression in normal cells. %, about 70%, about 80%, about 90% or about 100%.

After successful insertion of a nucleic acid encoding a transgene, e.g., a synthetic FVIII coding sequence, the expression of the synthetic FVIII coding sequence introduced into the cell is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 200%, about 300%, about 400%, about 500% , about 600%, about 700%, about 800%, about 900%, about 1,000%, about 2,000%, about 3,000%, about 5,000%, about 10,000%, or more. In some embodiments, the activity of the introduced FVIII coding sequence product, comprising the synthetic FVIII coding sequence in the genome-edited cell, is at least about 10%, about 20%, about 30% compared to the expression of an endogenous FVIII gene in the cell. , about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 200%, about 300%, about 400%, about 500%, about 600%, about 700%, about 800%, about 900%, about 1,000%, about 2,000%, about 3,000%, about 5,000%, about 10,000%, or more. In some embodiments, the expression of the FVIII coding sequence introduced into the cell is at least about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold compared to the expression of an endogenous FVIII gene in the cell. , about 8 times, about 9 times, about 10 times, about 15 times, about 20 times, about 30 times, about 50 times, about 100 times, about 1000 times, or more. Further, in some embodiments, the activity of the introduced synthetic FVIII coding sequence in genome-edited cells may be similar to or greater than the activity of the FVIII gene product in normal healthy cells.

In embodiments for the treatment or amelioration of hemophilia A, the primary target for gene editing is a human cell. In some embodiments, in the ex vivo method and in the in vivo method, the human cell is a hepatocyte. In some embodiments, by performing gene editing in autologous cells derived from a subject in need thereof and thus already fully immunologically consistent with the patient, they can be safely reintroduced into the patient and associated with the patient's disease. Cells can be generated that efficiently result in a population of cells that are effective for amelioration of one or more clinical conditions. In some embodiments for such treatment, hepatocytes can be isolated, genetically modified, and used to generate therapeutically effective cells according to any method known in the art. In one embodiment, the liver stem cells are genetically modified ex vivo and then reintroduced into a subject, wherein they give rise to genetically modified hepatocytes or allogeneic endothelial cells expressing the inserted FVIII coding sequence. .

therapeutic approach

Hemophilia is classified as “mild” (FVIII protein serum concentration of 0.40 to 0.05 IU/mL), “moderate” (0.05 to 0.01 IU/mL), or “severe” (< 0.01 IU/mL, less than 1% of normal). (GC White et al., Thromb Haemost (2001) 85 (3):560-75). By analysis of patients with hemophilia A receiving FVIII replacement protein therapy, at the predicted FVIII trough levels of 3%, 5%, 10%, 15% and 20% of normal, the frequency of no bleeding was 71%, respectively; 79%, 91%, 97% and 100% have been reported (G. Spotts et al., Blood (2014) 124 :689). This suggests that when the FVIII level is maintained above the minimum level of 15-20%, the ratio of bleeding events is reduced close to zero. Although the precise FVIII level required to cure hemophilia A has not been defined and is likely to vary between subjects, levels of about 5% to about 30% are expected to provide a significant reduction in bleeding events.

In one aspect, provided herein is a gene therapy approach for treating hemophilia A in a subject by editing the subject's genome. In some embodiments, the gene therapy therapy incorporates a functional synthetic FVIII coding sequence into the genome of the relevant cell type in the subject, which provides a permanent cure for hemophilia A. In some embodiments, the synthetic FVIII coding sequence is integrated into hepatocytes because these cells efficiently express and secrete many proteins into the blood. In addition, this integration approach using hepatocytes can be considered for pediatric subjects whose livers have not fully grown, because when the hepatocytes divide, the integrated coding sequences are passed on to daughter cells.

In another aspect, provided herein are cellular ex vivo and in vivo methods for using genome engineering tools to create permanent changes in the genome by branding a synthetic FVIII coding sequence into a locus and restoring FVIII protein activity. is provided on Such methods use an endonuclease, such as a CRISPR-associated (CRISPR/Cas9, Cpf1, etc.) nuclease, to permanently delete, insert, edit, correct, replace, or replace any sequence from the genome. , inserts an exogenous sequence, eg, a synthetic FVIII coding sequence, into the genomic locus. In this way, the examples described in this disclosure restore the activity of the FVIII gene using a single treatment (rather than delivering a potential therapy for the life of the subject).

In some embodiments, ex vivo cell-based therapy uses hepatocytes isolated from a subject. The chromosomal DNA of these cells is edited using the materials and methods described herein. Finally, the edited cells and/or their progeny are administered or transplanted into the subject.

One advantage of the ex vivo cell therapy approach is the ability to perform a comprehensive analysis of the therapeutic agent prior to administration. Nuclease-based therapeutics have some level of off-target effect. Performing gene editing in vitro allows characterization of the corrected cell population prior to administration. Aspects of the present disclosure sequence the genome of the corrected cell to ensure that there are any off-target cleavages at genomic locations associated with minimal risk to the subject. In addition, specific populations of cells, including clonal populations, may be screened or isolated prior to administration or transplantation.

Another embodiment is an in vivo based therapy. In such methods, the chromosomal DNA of cells in the subject is corrected using the materials and methods described herein. In some embodiments, the cell is a hepatocyte.

The advantage of in vivo gene therapy lies in the ease of therapeutic production and administration. The same therapeutic approaches and therapies can be used to treat more than one subject, eg, multiple subjects sharing the same or similar genotypes or alleles. In contrast, ex vivo cell therapy generally uses the subject's own cells, which are isolated, engineered, and returned to the same subject.

In some embodiments, the subject has symptoms of hemophilia A. In some embodiments, the subject is a human suspected of having hemophilia A. Alternatively, the subject is a human diagnosed as at risk for hemophilia A. In some embodiments, the subject in need of treatment has one or more genetic defects (eg, deletions, insertions, and/or mutations) in an endogenous FVIII gene or regulatory sequence thereof, such that the activity (including expression level or function) of the FVIII protein ) is substantially reduced compared to a healthy normal subject.

In some embodiments, provided herein is a method of treating hemophilia A in a subject, the method comprising providing to a cell in the subject: (a) a gRNA that targets an albumin locus in the genome of the cell; (b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and (c) a donor template comprising a nucleic acid sequence encoding a synthetic FVIII protein. In some embodiments, the gRNA targets intron 1 of the albumin gene. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 271-298.

In some embodiments, provided herein is a method of treating hemophilia A in a subject, the method comprising providing a cell in the subject: (a) from any one of SEQ ID NOs: 271-298 gRNA comprising a spacer sequence of; (b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and (c) a donor template comprising a nucleic acid sequence encoding a synthetic FVIII protein. In some embodiments, the gRNA comprises a spacer sequence of any one of SEQ ID NOs: 274, 275, 281, and 283. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 274. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 275. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 281. In some embodiments, the gRNA comprises the spacer sequence of SEQ ID NO: 283. In some embodiments, the cell is a human cell (eg, a human hepatocyte). In some embodiments, the subject has or is suspected of having hemophilia A. In some embodiments, the subject is diagnosed as at risk for hemophilia A.

In some embodiments, according to any of the methods of treating hemophilia A described herein, the DNA endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12). ), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb2, Cmr6, Csb2 Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cpf1 endonucleases, and functional equivalents thereof. In some embodiments, the DNA endonuclease is Cas9. In some embodiments, Cas9 is spCas9. In some embodiments, Cas9 is SluCas9.

In some embodiments, according to a method of treating hemophilia A described herein, a nucleic acid sequence encoding a synthetic FVIII coding sequence is codon-optimized for expression in a cell. In some embodiments, the cell is a human cell.

In some embodiments, according to any one of the methods of treating hemophilia A described herein, the method uses a nucleic acid encoding a DNA endonuclease. In some embodiments, the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a cell. In some embodiments, the cell is a human cell (eg, a human hepatocyte). In some embodiments, the nucleic acid encoding the DNA endonuclease is DNA, eg, a DNA plasmid. In some embodiments, the nucleic acid encoding the DNA endonuclease is RNA, eg, mRNA.

In some embodiments, according to any one of the methods of treating hemophilia A described herein, the donor template is encoded in an AAV vector. In some embodiments, the donor template comprises a donor cassette comprising a nucleic acid sequence encoding a synthetic FVIII protein, the donor cassette flanked by a gRNA target site on one or both sides. In some embodiments, the donor cassette flanks the gRNA target site on both sides. In some embodiments, the gRNA target site is the target site for the administered gRNA. In some embodiments, the gRNA target site of the donor template is the reverse complement of the cellular genomic gRNA target site to the administered gRNA. In some embodiments, providing the donor template to the cell comprises administering the donor template to the subject. In some embodiments, administration is intravenous.

In some embodiments, according to any one of the methods of treating hemophilia A described herein, a DNA endonuclease or a nucleic acid encoding a DNA endonuclease is formulated in a liposome or LNP. In some embodiments, the liposome or LNP also comprises a gRNA. In some embodiments, providing the gRNA and the DNA endonuclease or nucleic acid encoding the DNA endonuclease to the cell comprises administering the liposome or LNP to the subject. In some embodiments, administration is intravenous. In some embodiments, the liposome or LNP is LNP. In some embodiments, the method uses a LNP comprising a gRNA and a nucleic acid encoding a DNA endonuclease. In some embodiments, the nucleic acid encoding a DNA endonuclease is an mRNA encoding a DNA endonuclease.

In some embodiments, according to any one of the methods of treating hemophilia A described herein, the DNA endonuclease is pre-complexed with the gRNA to form an RNP complex.

The process by which AAV infects cells, including liver cells, involves evasion from endosomes, viral uncoating and transport of the AAV genome to the nucleus. In the case of AAV used in these studies where the single-stranded genome is packaged into a virus, the single-stranded genome undergoes the process of second-stranded DNA synthesis, forming a double-stranded DNA genome. The time required for complete conversion from single-stranded to double-stranded genomes is not widely established, but is considered to be a rate limiting step (Ferrari et al., J Virol (1996) 70 :3227-34). The double-stranded linear genome is then concatenated into a multimeric prototype composed of monomers linked head-to-tail and tail-to-head (Sun et al., Human Gene Ther. (2010) 21 :750-62]).

In some embodiments, according to any one of the methods of treating hemophilia A described herein, the gRNA and DNA endonuclease or nucleic acid encoding the DNA endonuclease administered are administered to the cell after providing the donor template to the cell. is provided on In some embodiments, the administered gRNA and the DNA endonuclease or nucleic acid encoding the DNA endonuclease are provided to the cell for a time greater than 4 days after the donor template is provided to the cell. In some embodiments, the gRNA and DNA endonuclease or nucleic acid encoding the DNA endonuclease is provided to the cell at least 14 days after providing the donor template to the cell. In some embodiments, the gRNA and DNA endonuclease or nucleic acid encoding the DNA endonuclease is provided to the cell at least 17 days after providing the donor template to the cell. In some embodiments, providing the gRNA and the DNA endonuclease to the cell comprises administering to the subject (eg, by an intravenous route) an LNP comprising a nucleic acid encoding the DNA endonuclease and the gRNA. . In some embodiments, the nucleic acid encoding a DNA endonuclease is an mRNA encoding a DNA endonuclease. In some embodiments, providing the donor template to the cell comprises administering to the subject (eg, by an intravenous route) a donor template encoded in an AAV vector.

In some embodiments, according to any one of the methods of treating hemophilia A described herein, one or more additional doses of gRNA and a DNA endonuclease or a nucleic acid encoding a DNA endonuclease comprise a first dose of gRNA and a DNA endonuclease or a nucleic acid encoding the DNA endonuclease, followed by providing to the cell. In some embodiments, one or more additional doses of gRNA and DNA endonuclease or nucleic acid encoding DNA endonuclease comprises a first dose of gRNA and DNA endonuclease or nucleic acid encoding DNA endonuclease It is then provided to the cell until targeted integration of the target level of the nucleic acid sequence encoding the synthetic FVIII protein and/or expression of the target level of the nucleic acid sequence encoding the synthetic FVIII protein is achieved. In some embodiments, providing the gRNA and the DNA endonuclease to the cell comprises administering to the subject (eg, by an intravenous route) lipid nanoparticles comprising a nucleic acid encoding the DNA endonuclease and the gRNA. include In some embodiments, the nucleic acid encoding a DNA endonuclease is an mRNA encoding a DNA endonuclease.

In some embodiments, according to any one of the methods of treating hemophilia A described herein, the nucleic acid sequence encoding the synthetic FVIII protein is expressed under the control of an endogenous albumin promoter. In some embodiments, the nucleic acid sequence encoding the synthetic FVIII protein is expressed under the control of an endogenous transferrin promoter. In some embodiments, the nucleic acid sequence encoding the synthetic FVIII protein is expressed under the control of an endogenous fibrinogen-alpha chain promoter.

In some embodiments, according to the methods of treating hemophilia A described herein, the nucleic acid sequence encoding the synthetic FVIII protein is expressed in the liver of the subject.

delivery of cells to a subject

In some embodiments, an ex vivo method of the present disclosure comprises administering a genome-edited cell into a subject in need thereof. This can be accomplished using any method of parenteral administration known in the art. For example, the genetically modified cells can be injected directly into the blood of a subject, directly into or near the liver (transplanted), or otherwise administered to a patient.

In some embodiments, the methods disclosed herein administer to the subject a therapeutic cell genetically-modified by a method or pathway that results in at least partial localization of the introduced cells at the site desired to produce the desired effect(s). implanting or “inserting” into The therapeutic cells or their differentiated progeny may be introduced by any suitable route that results in transport to a desired location in a subject, wherein at least a portion of the transplanted cell or component of the cell remains viable. The duration of survival of cells following administration to a subject can be as short as several hours, eg, 24 hours, or can be up to several days, years, or even as long as the lifetime of the subject, ie, long-term engraftment.

When provided prophylactically, the therapeutic cells described herein are administered to a subject prior to any symptoms of hemophilia A. Accordingly, in some embodiments, prophylactic administration of a genetically modified hepatocyte population is provided to prevent the development of hemophilia A symptoms.

In some embodiments, when provided therapeutically, the genetically engineered hepatocytes are provided at the onset of (or after) the symptoms or indications of hemophilia A, eg, at the onset of the disease.

In some embodiments, the therapeutic hepatocyte population being administered according to the methods described herein has allogeneic therapeutic hepatocytes obtained from one or more donors. “Allogeneic” refers to a biological sample or hepatocytes having hepatocytes obtained from one or more different donors of the same species, wherein the genes at one or more loci are not identical. For example, the hepatocyte population being administered to a subject may be derived from one or more unrelated donor subjects or from one or more non-identical siblings. In some embodiments, a syngeneic hepatocyte population may be used, such as those obtained from genetically identical animals (or identical twins). In other embodiments, the hepatocytes are autologous; That is, cells are obtained or isolated from a subject and administered to the same subject, ie, the donor and recipient are the same.

In one embodiment, the term "effective amount" refers to the amount of a population of therapeutic cells required to prevent or ameliorate one or more signs or symptoms of hemophilia A, to provide a desired effect, e.g., type A A sufficient amount of the composition for treating a subject having hemophilia. In one embodiment, thus, the term “therapeutically effective amount” refers to a therapeutic cell or composition comprising therapeutic cells sufficient to promote a particular effect when administered to a subject, such as a subject having or at risk for hemophilia A. refers to the quantity. Also, an effective amount is used to prevent or delay the onset of symptoms of a disease, alter the course of symptoms of a disease (eg, but not limited to slowing the progression of symptoms of a disease), or to reverse symptoms of a disease. contain a sufficient amount. It is understood that, for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using routine experimentation.

For use in the embodiments described herein, an effective amount of a therapeutic cell, e.g., a gene edited hepatocyte, is at least about 10 ² cells, at least about 5 X 10 ² cells, at least about 10 ³ cells, at least about 5 X 10 ³ cells, at least about 10 ⁴ cells, at least about 5 X 10 ⁴ cells, at least about 10 ⁵ cells, at least about 2 X 10 ⁵ cells, at least about 3 X 10 ⁵ cells, at least about 4 X 10 ⁵ cells, at least about 5 X 10 ⁵ cells, at least about 6 X 10 ⁵ cells, at least about 7 X 10 ⁵ cells, at least about 8 X 10 ⁵ cells, at least about 9 X 10 ⁵ cells cells, at least about 1 X 10 ⁶ cells, at least about 2 X 10 ⁶ cells, at least about 3 X 10 ⁶ cells, at least about 4 X 10 ⁶ cells, at least about 5 X 10 ⁶ cells, at least about 6 X 10 ⁶ cells, at least about 7 X 10 ⁶ cells, at least about 8 X 10 ⁶ cells, at least about 9 X 10 ⁶ cells, or a multiple thereof. Therapeutic cells are derived from one or more donors or are obtained from autologous sources. In some embodiments described herein, the therapeutic cells are expanded in culture prior to administration to a subject in need thereof.

In some embodiments, moderate and incremental increases in the level of functional FVIII expressed in cells of a subject with hemophilia A are combined with other treatments to ameliorate one or more symptoms of the disease, increase long-term survival, and/or It may be beneficial to reduce the associated side effects. Upon administration of such cells to a human subject, the presence of therapeutic cells that are producing increased levels of functional FVIII is advantageous. In some embodiments, effective treatment of a subject results in at least about 1%, 3%, 5% or 7% of functional FVIII as compared to the total FVIII in the treated subject. In some embodiments, the functional FVIII will be at least about 10% of the total FVIII. In some embodiments, the functional FVIII is at least, about or up to 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the total FVIII. Similarly, the introduction of a relatively more limited subpopulation of cells with significantly increased levels of functional FVIII is beneficial in a subject, since in some circumstances normal cells have a selection advantage over diseased cells. However, even moderate levels of therapeutic cells with elevated levels of functional FVIII are beneficial in ameliorating one or more aspects of hemophilia A in a subject. In some embodiments, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or more of the therapeutic agent in the subject to which such cells are administered produces increased levels of functional FVIII.

In an embodiment, “administered” refers to delivery of a therapeutic cell composition to a subject by a method or route that results in at least partial localization of the cell composition at a desired site. The cell composition can be administered by any suitable route that results in effective treatment in a subject, i.e., administration results in delivery to a desired location in the subject, wherein at least a portion of the delivered composition, i.e., at least about 1 x 10 ⁴ cells are transported to the desired site for a predetermined period of time. Modes of administration include injection, infusion, instillation or ingestion. “Injection” includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracystic, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subepidermal, intraarticular, capsular subarachnoid, intrathecal, intracerebrospinal and intrasternal injections and infusions. In some embodiments, the route is intravenous. For delivery of cells, administration by injection or infusion may be performed.

In one embodiment, the cells are administered systemically, ie, the therapeutic cell population is not administered directly to the target site, tissue or organ, but instead enters the subject's circulation and thus undergoes metabolism and other similar processes. is administered to

The efficacy of treatment with a composition for the treatment of hemophilia A can be determined by the skilled artisan. However, treatment may be such that any one or more of the signs or symptoms of the disease, by way of example only, the level of functional FVIII is altered in a favorable manner (eg, increased by at least 10%), or other of the disease A treatment is considered "effective treatment" if clinically acceptable symptoms or markers are ameliorated or alleviated. Efficacy can also be measured by the individual's failure to exacerbate when assessed by the need for medical intervention or hospitalization (eg, disease progression is stopped or at least slowed). Methods for measuring these indicators are known to those skilled in the art and/or described herein. Treatment includes any treatment of a disease in an individual or animal (some non-limiting examples include humans, or mammals), and includes: (1) inhibition of the disease, e.g., a symptom arrest, or slowing of its progression; or (2) alleviation of the disease, eg, causing regression of symptoms; and (3) preventing or reducing the likelihood of occurrence of symptoms.

composition

In one aspect, the present disclosure provides a composition for performing the methods disclosed herein. The composition may comprise one or more of the following: a genome-targeting nucleic acid (eg, gRNA); a nucleotide sequence encoding a site-directed polypeptide (eg, a DNA endonuclease) or a site-directed polypeptide; and a polynucleotide to be inserted (eg, a donor template) for effecting the desired genetic modification of the methods disclosed herein.

In some embodiments, the composition has a nucleotide sequence encoding a genome-targeting nucleic acid (eg, gRNA).

In some embodiments, the composition has a site-directed polypeptide (eg, a DNA endonuclease). In some embodiments, the composition has a nucleotide sequence encoding a site-directed polypeptide.

In some embodiments, the composition has a polynucleotide (eg, a donor template) to be inserted into the genome.

In some embodiments, the composition comprises (i) a nucleotide sequence encoding a genome-targeting nucleic acid (eg, gRNA) and (ii) a site-directed polypeptide (eg, DNA endonuclease) or site-directed polypeptide has a nucleotide sequence encoding

In some embodiments, the composition has (i) a nucleotide sequence encoding a genome-targeting nucleic acid (eg, gRNA) and (ii) a polynucleotide (eg, a donor template) to be inserted into the genome.

In some embodiments, the composition comprises (i) a nucleotide sequence encoding a site-directed polypeptide (eg, a DNA endonuclease) or a site-directed polypeptide and (ii) a polynucleotide to be inserted into the genome (eg, donor template).

In some embodiments, the composition comprises (i) a nucleotide sequence encoding a genome-targeting nucleic acid, (ii) a nucleotide sequence encoding a site-directed polypeptide or a site-directed polypeptide, and (iii) a polynucleotide to be inserted into the genome (e.g., For example, donor template).

In some embodiments of any of the above compositions, the composition has a single-molecule guide genome-targeting nucleic acid. In some embodiments of any of the above compositions, the composition has a dual-molecule genome-targeting nucleic acid. In some embodiments of any of the above compositions, the composition has two or more double-molecule guides or single-molecule guides. In some embodiments, the composition has a vector encoding a nucleic acid targeting nucleic acid. In some embodiments, the genome-targeting nucleic acid is a DNA endonuclease, particularly Cas9.

In some embodiments, the composition contains one or more gRNAs suitable for genome-editing, particularly insertion of a synthetic FVIII coding sequence into the genome of a cell. The gRNA for the composition may target a genomic region within or near an endogenous albumin gene. In some embodiments, the gRNA has a spacer sequence that is complementary to a genomic sequence of, within or near the albumin gene.

In some embodiments, the gRNA for the composition contains at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90% or about 95% identity or homology thereof. In some embodiments, the variant of the gRNA has at least about 85% homology to any one of SEQ ID NOs: 271-298.

In some embodiments, the gRNA for the composition has a spacer sequence that is complementary to a target site in the genome. In some embodiments, the spacer sequence is between 15 and 20 bases in length. In some embodiments, the complementarity between the spacer sequence and the genomic sequence is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100%.

In some embodiments, the composition has a donor template having a DNA endonuclease or a nucleic acid encoding the DNA endonuclease and/or a nucleic acid sequence of a synthetic FVIII coding sequence. In some embodiments, the DNA endonuclease is Cas9. In some embodiments, the nucleic acid encoding the DNA endonuclease is DNA or RNA.

In some embodiments, one or more of any oligonucleotide or nucleic acid sequence is encoded in an AAV vector. Thus, in some embodiments, the gRNA is encoded in an AAV vector. In some embodiments, the nucleic acid encoding the DNA endonuclease is encoded in an AAV vector. In some embodiments, the donor template is encoded in an AAV vector. In some embodiments, two or more oligonucleotide or nucleic acid sequences are encoded in a single AAV vector. Thus, in some embodiments, the gRNA sequence and the DNA endonuclease-encoding nucleic acid are encoded in a single AAV vector.

In some embodiments, the composition has liposomes or lipid nanoparticles. Thus, in some embodiments, any compound of the composition (eg, a DNA endonuclease or its encoding nucleic acid, gRNA and donor template) can be formulated in liposomes or LNPs. In some embodiments, one or more such compounds are associated with the liposome or LNP via a covalent or non-covalent bond. In some embodiments, any one of the compounds is contained individually or together in a liposome or LNP. Thus, in some embodiments, each of the DNA endonuclease or its encoding nucleic acid, gRNA and donor template is individually formulated in a liposome or LNP. In some embodiments, the DNA endonuclease is formulated in liposomes or LNPs with the gRNA. In some embodiments, the DNA endonuclease or its encoding nucleic acid, gRNA and donor template are formulated together in a liposome or LNP.

In some embodiments, any kit described above further comprises one or more additional reagents, wherein such additional reagents include a buffer, a buffer for introducing the polypeptide or polynucleotide into the cell, a wash buffer, a control reagent, control vectors, control RNA polynucleotides, reagents for generating polypeptides in vitro from DNA, adapters for sequencing, and the like. The buffer may be a stabilization buffer, a reconstitution buffer, a dilution buffer, and the like. In some embodiments, the composition also includes one or more components that can be used to facilitate or enhance on-target binding or cleavage of DNA by an endonuclease, or to improve the specificity of targeting.

In some embodiments, any component of the composition is formulated with pharmaceutically acceptable excipients such as carriers, solvents, stabilizers, adjuvants, diluents, and the like, depending on the particular mode of administration and dosage form. In an embodiment, the guide RNA composition is formulated to achieve a pH ranging from about 3 to about 11, from about pH 3 to about pH 7, depending on a generally physiologically compatible pH and formulation and route of administration. In some embodiments, the pH is adjusted to range from about pH 5.0 to about pH 8.0. In some embodiments, the composition has a therapeutically effective amount of at least one compound as described herein in association with one or more pharmaceutically acceptable excipients. Optionally, the composition may comprise a combination of compounds described herein or will comprise a second active ingredient useful for the treatment or prevention of bacterial growth (eg, but not limited to, an anti-bacterial or anti-microbial agent). or may include a combination of reagents of the present disclosure. In some embodiments, the gRNA is formulated with one or more other oligonucleotides, eg, nucleic acids encoding a DNA endonuclease, and/or a donor template. Alternatively, the nucleic acid encoding the DNA endonuclease and the donor template are formulated using the methods described above for gRNA formulation, either individually or in combination with other oligonucleotides.

Suitable excipients include, for example, slowly metabolized large macromolecules such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers, and carrier molecules including inactive viral particles. Other exemplary excipients include antioxidants (eg, but not limited to, ascorbic acid), chelating agents (eg, but not limited to, EDTA), carbohydrates (eg, but not limited to, dextrins, hydroxyalkylcelluloses and hydroxy alkylmethylcellulose), stearic acid, liquids (such as but not limited to oils, water, saline, glycerol and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.

In some embodiments, any compound of the composition (eg, a DNA endonuclease or its encoding nucleic acid, gRNA and donor template) is delivered via transfection, such as electroporation. In some exemplary embodiments, the DNA endonuclease is precomplexed with the gRNA to form an RNP complex prior to presentation to the cell, and the RNP complex can be electroporated. In such embodiments, the donor template may be delivered via electroporation.

In some embodiments, “composition” refers to a therapeutic composition having therapeutic cells for use in an ex vivo method of treatment.

In an embodiment, the therapeutic composition contains a physiologically acceptable carrier together with a cell composition and optionally at least one additional bioactive agent as described herein dissolved or dispersed therein as an active ingredient. In some embodiments, the therapeutic composition is not substantially immunogenic when administered to a mammalian or human subject for therapeutic purposes.

Generally, the genetically modified therapeutic cells described herein are administered as a suspension in association with a pharmaceutically acceptable carrier. Those skilled in the art will recognize that a pharmaceutically acceptable carrier to be used in a cell composition will not contain buffers, compounds, cryopreservatives, preservatives or other agents in amounts that would materially interfere with the viability of cells to be delivered to a subject. . Formulations comprising cells may include, for example, an osmotic buffer to maintain cell membrane integrity, and optionally nutrients to maintain cell viability or enhance engraftment upon administration. Such formulations and suspensions are known to those skilled in the art and/or can be adapted for use with cells as described herein.

In some embodiments, the cell composition may also be emulsified or present as a liposomal composition, provided that the emulsification procedure does not adversely affect cell viability. The cells and any other active ingredient may be admixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient, in amounts suitable for use in the methods of treatment described herein.

Additional agents included in the cell composition may include therein pharmaceutically acceptable salts of ingredients. Pharmaceutically acceptable salts include acid addition salts (formed using the free amino group of the polypeptide) formed with inorganic acids such as, for example, hydrochloric or phosphoric or organic acids such as acetic, tartaric, mandelic, and the like. Salts formed using free carboxyl groups also include inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxide and isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like. It may be derived from an organic base.

Physiologically acceptable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions containing, in addition to the active ingredient and water, substances free or buffers such as sodium phosphate at physiological pH values, physiological saline, or both, such as phosphate-buffered saline. Still further, the aqueous carrier may contain more than one buffer salt, as well as salts such as sodium and potassium chloride, dextrose, polyethylene glycol, and other solutes. The liquid composition may also contain a liquid phase in addition to and excluding water. Examples of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of active compound employed in a cell composition effective for the treatment of a particular disorder or condition will depend on the nature of the disorder or condition and can be determined by standard clinical techniques.

kit

Some embodiments provide a kit containing any one of the compositions described above, eg, a composition for genome editing or a therapeutic cell composition, and one or more additional components.

In some embodiments, the kit may have one or more additional therapeutic agents that may be administered concurrently or sequentially with the composition for a desired purpose, such as genome editing or cell therapy.

In some embodiments, the kit may further comprise instructions for using the components of the kit to practice the method. Instructions for carrying out the method are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, or the like. Instructions may be present within the kit as package inserts, such as on the label (ie, associated with packaging or subpackaging) of the container of the kit or components thereof. The instructions may exist as an electronic storage data file residing on a suitable computer-readable storage medium, for example, a CD-ROM, diskette, flash drive, or the like. In some instances, the actual instructions are not present in the kit, but a means is provided for obtaining instructions from a remote source (eg, via the Internet). An example of such an embodiment is a kit comprising a web address where the instructions can be viewed and/or a web address where the instructions can be downloaded. With respect to the instructions, this method for obtaining the instructions may be recorded on a suitable substrate.

Additional therapeutic approaches

Gene editing can be done using site-directed polypeptides engineered to target specific sequences. To date, there are four main types of such nucleases: meganucleases and their functional equivalents, zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs) and CRISPR/CAS nucleases. my system. In particular, since the specificity of ZFNs and TALENs is achieved through protein-DNA interactions, while RNA-DNA interactions mainly guide Cas proteins, nuclease platforms differ in design difficulty, targeting density and mode of action. Cas9 cleavage also requires a contiguous motif, PAM, that differs between different CRISPR systems. Cas9 from Streptococcus pyogenes is cleaved using NRG PAM, and CRISPR from Neisseria meningitidis is NNNNGATT (SEQ ID NO: 312), NNNNNGTTT (SEQ ID NO: 313) and NNNNGCTT ( It can be cleaved at a site with a PAM comprising SEQ ID NO: 314). Numerous other Cas9 orthologs target protospacers adjacent to alternative PAMs.

In embodiments of the methods of the present disclosure, a CRISPR endonuclease such as Cas9 may be used. Furthermore, the teachings described herein, such as therapeutic target sites, can be applied to other types of endonucleases, such as ZFN, TALEN, HE, or MegaTAL, or using combinations of nucleases. However, to apply the teachings of the present disclosure to such endonucleases, it will be necessary, among other things, to engineer proteins directed against specific target sites.

Additional binding domains may be fused to the Cas9 protein to increase specificity. The target sites of these constructs map to the identified gRNA specific sites, but additional binding motifs are required, such as for zinc finger domains. In the case of Mega-TAL, the meganuclease can be fused to the TALE DNA-binding domain. A meganuclease domain can increase specificity and provide cleavage. Similarly, inactivated or dead Cas9 (dCas9) may be fused to a cleavage domain and may require an sgRNA/Cas9 target site and a contiguous binding site for the fused DNA-binding domain. This would probably require some protein engineering of dCas9, in addition to catalytic inactivation, to reduce binding without additional binding sites.

In some embodiments, genome editing (eg, insertion of a FVIII coding sequence into an albumin locus) compositions and methods according to the present disclosure use any one of the following approaches.

zinc finger nuclease

Zinc finger nucleases (ZFNs) are modular proteins with an engineered zinc finger DNA binding domain linked to the catalytic domain of the type II endonuclease FokI. Because FokI functions only as a dimer, a pair of ZFNs must bind to a cognate target "half-site" sequence on opposite DNA strands and have the correct spacing between them so that a catalytically active FokI dimer can be formed. must be engineered. Upon dimerization of the FokI domain, which itself does not have sequence specificity, a DNA double-strand break is generated between the ZFN half-sites as an initiating step in genome editing.

The DNA binding domain of each ZFN usually has 3 to 6 zinc fingers of the abundant Cys2-His2 structure, each finger recognizing a triple nucleotide mainly on one strand of the target DNA sequence, but with a fourth nucleotide Cross-strand interactions may also be important. Altering the amino acid of a finger at a position of critical contact with DNA alters the sequence specificity of a given finger. Thus, a four-finger zinc finger protein will selectively recognize a target sequence of 12 bp, where the target sequence is a complex of triple preferences contributed by each finger, but the triple preference is affected to varying degrees by neighboring fingers. can receive An important aspect of ZFNs is that they can be readily re-targeted to virtually any genomic address by simply modifying individual fingers, but it requires considerable expertise to do so well. In most applications of ZFNs, proteins from 4 to 6 fingers are used, each recognizing 12 to 18 bp. Thus, a pair of ZFNs will generally recognize a combined target sequence of 24-36 bp, which does not include a spacer of 5-7 bp between the half-sites. The binding site may be further separated by larger spacers, including 15 to 17 bp. A target sequence of this length will be unique in the human genome, assuming that repeat sequences or genetic homologues are excluded during the design process. Nevertheless, ZFN protein-DNA interactions are not absolute in their specificity, so that off-target binding and cleavage events occur either as a heterodimer between two ZFNs or as a homodimer of one or the other of the ZFNs. The latter possibility is to engineer the dimerization interface of the FokI domain to allow "plus" and "minus" variants, also known as obligate heterodimer variants (which cannot dimerize by themselves and only dimer with each other). was effectively removed by creating Enforcing absolute heterodimers prevents the formation of homodimers. It has greatly improved specificity of ZFNs, as well as any other nucleases that adopt these FokI variants.

Various ZFN-based systems have been described in the art, variations thereof have been duly reported, and numerous references describe the rules and parameters used to guide the design of ZFNs; See, for example, Segal et al . , Proc Natl Acad Sci USA (1999) 96 (6):2758-63]; Literature [B. Dreier et al . , J Mol Biol. (2000) 303 (4):489-502]; Literature [Q. Liu et al . , J Biol Chem. (2002) 277 (6):3850-6]; See Dreier et al . , J Biol Chem (2005) 280 (42):35588-97]; and Dreier et al . , J Biol Chem. (2001) 276 (31):29466-78].

Transcriptional activator-like effector nucleases (TALENs)

TALENs represent another format of modular nucleases whereby, as in ZFNs, an engineered DNA binding domain is linked to a FokI nuclease domain and a pair of TALENs work in tandem to achieve targeted DNA cleavage. do. The main difference from ZFNs is the nature of the DNA binding domain and the associated target DNA sequence recognition properties. The TALEN DNA binding domain is derived from the TALE protein, which was originally described in the plant bacterial pathogen Xanthomonas sp . TALEs have a tandem array of 33 to 35 amino acid repeats, each repeat recognizing a single base pair in a target DNA sequence that is typically up to 20 bp in length, providing a total target sequence length of up to 40 bp. The nucleotide specificity of each repeat is determined by a repeat variable di-residue (RVD), which contains only two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine and thymine are usually recognized by four RVDs: Asn-Asn, Asn-Ile, His-Asp and Asn-Gly, respectively. This constitutes a much simpler recognition code, but not for zinc fingers, and thus represents an advantage over the latter in nuclease design. Nevertheless, as with ZFNs, the protein-DNA interactions of TALENs are not absolute in their specificity, and TALENs also benefit from the use of absolute heterodimeric variants of the FokI domain to reduce off-target activity.

Additional variants of the FokI domain with inactivated catalytic functions have been generated. If one half of either a TALEN or ZFN pair contains an inactive FokI domain, only single-stranded DNA cleavage (nicking) will occur at the target site rather than at the DSB. The results are similar to the use of a CRISPR/Cas9/Cpf1 "nickase" mutant in which one of the Cas9 cleavage domains is inactivated. DNA nicks can be used to induce genome editing by HDR with lower efficiencies than in DSB. The main advantage is that off-target nicks are repaired quickly and accurately, unlike NHEJ-mediated repair-error-prone DSBs.

Various TALEN-based systems have been described in the art, and variations thereof have been duly reported; See, eg, Boch, Science (2009) 326 (5959):1509-12]; Mak et al., Science (2012) 335 (6069):716-9]; and Moscou et al., Science (2009) 326 (5959):1501]. The use of TALENs based on the “Golden Gate” platform or cloning scheme has been described by a number of groups; For example, in T. Cermak et al . , Nucleic Acids Res. (2011) 39 (12):e82]; Li et al., Nucleic Acids Res. (2011) 39 (14):6315-25]; Weber et al., PLoS One (2011) 6 (2):e16765]; See Wang et al . , J Genet Genomics (2014) 41 (6):339-47, Epub 2014 Can 17]; and [T. Cermak et al . , Methods Mol Biol. (2015) 1239 :133-59].

Homing Endonuclease

Homing endonucleases (HEs) are site-specific endonucleases that have long recognition sequences (14 to 44 base pairs) and cleave DNA with high specificity (often at unique sites in the genome). LAGLIDADG (SEQ ID NO: 6), GIY-YIG, His-Cis box, HNH, PD-(D/E) derived from a wide range of hosts, including eukaryotes, protists, bacteria, archaea, cyanobacteria and phage There are at least six known families of HE as classified by their structure, including xK, and Vsr-like. As with ZFNs and TALENs, HE can be used to generate DSBs at target loci as an early step in genome editing. In addition, some native HE and engineered HE cleave only a single strand of DNA, thereby functioning as a site-specific nickase. The large target sequences of HE and the specificity they provide make them attractive candidates for generating site-specific DSBs.

Various HE-based systems have been described in the art, and modifications thereof are regularly reported; See, eg, Steentoft et al . , Glycobiology (2014) 24 (8):663-80]; See Belfort and Bonocora, Methods Mol Biol. (2014) 1123 :1-26]; Hafez and Hausner, Genome (2012) 55 (8):553-69]; and a review of the references cited therein.

MegaTAL / Tev-mTALEN / MegaTev

As further examples of hybrid nucleases, the MegaTAL platform and the Tev-mTALEN platform use a fusion of a TALE DNA binding domain and a catalytically active HE, allowing both tunable DNA binding and specificity of TALE, as well as that of HE. using cleavage sequence specificity; See, eg, Boissel et al., Nuc. Acids Res. (2014) 42 :2591-601]; [Kleinstiver et al., G3 (2014) 4 :1155-65]; and Boissel and Scharenberg, Methods Mol. Biol. (2015) 1239 :171-96].

In a further variation, the MegaTev structure is a fusion of a nuclease domain derived from a meganuclease (Mega) and the GIY-YIG homing endonuclease I-TevI (Tev). The two active sites are located about 30 bp apart on the DNA substrate, resulting in two DSBs with non-compatible aggregation ends; See, eg, Wolfs et al., Nuc. Acids Res. (2014) 42: 8816-29]. It is anticipated that other combinations of existing nuclease-based approaches will be developed and will be useful in achieving the targeted genomic modifications described herein.

dCas9-FokI or dCpf1-Fok1 and other nucleases

The combination of structural and functional properties of the nuclease platforms described above provides additional approaches to genome editing that can potentially overcome some of the inherent deficiencies. As an example, CRISPR genome editing systems typically use a single Cas9 endonuclease to generate DSBs. The specificity of targeting is a 20 or 22 nucleotide sequence in the guide RNA that has undergone Watson-Crick base-pairing with the target DNA (also two additional bases in the adjacent NAG or NGG PAM sequence in the case of Cas9 from Streptococcus pyogenes). is induced by Although these sequences are long enough to be unique in the human genome, the specificity of the RNA/DNA interaction is not absolute, and significant promiscuity is sometimes tolerated, particularly in the 5' half of the target sequence, effectively reducing the number of bases that drive specificity. Reduce. One solution to this is to completely inactivate the Cas9 or Cpf1 catalytic function - retaining only RNA-guided DNA binding function - instead fusing the FokI domain to the inactivated Cas9; See, eg, Tsai et al., Nature Biotech (2014) 32 :569-76; and Guilinger et al., Nature Biotech. (2014) 32 :577-82]. Since FokI must dimerize to become catalytically active, two guide RNAs are required to tether two FokI fusions in close proximity to form a dimer and cleave DNA. This essentially doubles the number of bases at the combined target site, thereby increasing the stringency of targeting by CRISPR-based systems.

As a further example, fusion of a TALE DNA binding domain to a catalytically active HE, such as I-TevI, takes advantage of both the tunable DNA binding and specificity of TALE, as well as the cleavage sequence specificity of I-TevI, and uses off- It is expected that target cleavage may be further reduced.

The details of one or more embodiments of the present disclosure are set forth in the accompanying description below. Other features, objects and advantages of the present disclosure will become apparent from the description of the invention. In the description, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present description will control.

It is understood that the examples and embodiments described herein are for illustrative purposes only, and that modifications or variations in light thereof will be suggested to those skilled in the art, and will be included within the object and scope of the present application and the scope of the appended appendices. All publications, patents, and patent applications cited herein are incorporated by reference in their entirety for all purposes.

Some embodiments of the disclosure provided herein are further illustrated by the following non-limiting examples.

Exemplary embodiment

Embodiment 1. A deoxyribonucleic acid (DNA) endonuclease or a nucleic acid encoding a DNA endonuclease; a guide RNA (gRNA) comprising a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA; and a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein comprises B domain substitutions, wherein the B domain substitutions have 0 to 9 N-linked glycosylation sites and 3 to about 40 A system comprising a donor template comprising amino acids in length.

Embodiment 2. The system of embodiment 1, wherein the B domain substitution comprises 0-6 N-linked glycosylation sites.

Embodiment 3. The system of embodiment 2, wherein the B domain substitution comprises 0-3 N-linked glycosylation sites.

Embodiment 4. The system of embodiment 1, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362 to 369, 371 and 373.

Embodiment 5. The method according to embodiment 4, wherein the B domain substitution is at least for the amino acid sequence of any one of SEQ ID NOs: 362 to 366, 371 and 373 or any one of SEQ ID NOs: 362 to 366, 371 and 373 A system comprising a variant thereof with 80% identity.

Embodiment 6. The system of embodiment 5, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362 to 364, 371 and 373.

Embodiment 7. The system according to any one of embodiments 1 to 6, wherein the host cell locus is a locus of a gene expressed in the liver.

Embodiment 8 The system according to any one of embodiments 1 to 7, wherein the host cell locus is the locus of a gene encoding an acute phase protein.

Embodiment 9 The system according to embodiment 8, wherein the acute phase protein is albumin, transferrin or fibrinogen.

Embodiment 10 The system of any one of embodiments 1-7, wherein the host cell locus is a Safe Harbor locus.

Embodiment 11. DNA endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1 , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx3, Csx10, Csf1, Csx15, Csx1 The system of any one of embodiments 1 to 10, wherein the system is selected from the group consisting of , Csf2, Csf3, Csf4, or Cpf1 endonuclease, and functional derivatives thereof.

Embodiment 12 The system of embodiment 11, wherein the DNA endonuclease is Cas9.

Embodiment 13 The system of any one of embodiments 1 to 11, wherein the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a host cell.

Embodiment 14 The system of any one of embodiments 1-13, wherein the nucleic acid encoding the DNA endonuclease is deoxyribonucleic acid (DNA).

Embodiment 15 The system of any one of embodiments 1-13, wherein the nucleic acid encoding the DNA endonuclease is ribonucleic acid (RNA).

Embodiment 16 The system according to embodiment 15, wherein the RNA encoding the DNA endonuclease is mRNA.

Embodiment 17 The system of any one of embodiments 1 to 16, wherein the donor template nucleic acid sequence is codon optimized for expression in a host cell.

Embodiment 18 The system of any one of embodiments 1-17, wherein the donor template nucleic acid sequence comprises a reduced content of CpG di-nucleotides compared to a wild-type nucleic acid sequence encoding the FVIII protein.

Embodiment 19 The system of embodiment 18, wherein the donor template nucleic acid sequence does not comprise a CpG di-nucleotide.

Embodiment 20 The system of any one of embodiments 1-19, wherein the donor template is encoded in an AAV vector.

Embodiment 21 The donor template according to any one of embodiments 1 to 20, wherein the donor template comprises a donor cassette comprising a nucleic acid sequence encoding a synthetic FVIII protein, and wherein the donor cassette is located on one or both sides at the gRNA target site. flanking system.

Embodiment 22 The system of embodiment 21, wherein the donor cassette is flanked on both sides by the gRNA target site.

Embodiment 23 The system of embodiment 21, wherein the donor cassette flanks the gRNA target site on its 5' side.

Embodiment 24 The system of any one of embodiments 21-23, wherein the gRNA target site is a target site for a gRNA in the system.

Embodiment 25 The system of embodiment 24, wherein the gRNA target site of the donor template is the reverse complement of the genomic gRNA target site to the gRNA in the system.

Embodiment 26 The system according to any one of embodiments 1 to 25, wherein the DNA endonuclease or nucleic acid encoding the DNA endonuclease is contained in the liposome or lipid nanoparticle.

Embodiment 27 The system of embodiment 26, wherein the liposome or lipid nanoparticle also comprises a gRNA.

Embodiment 28 The system of any one of embodiments 1-27, wherein the DNA endonuclease is complexed with the gRNA to provide a ribonucleoprotein (RNP) complex.

Embodiment 29. (a) a gRNA comprising a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA; (b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and (c) a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein comprises B domain substitutions, wherein the B domain substitutions have 0 to 9 N-linked glycosylation sites and 3 to about A method for editing a genome in a host cell comprising providing to the cell a donor template comprising 40 amino acids in length.

Embodiment 30 The method of embodiment 29, wherein the B domain substitution comprises 0-6 N-linked glycosylation sites.

Embodiment 31 The method of embodiment 30, wherein the B domain substitution comprises 0-3 N-linked glycosylation sites.

Embodiment 32 The method of embodiment 29, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362-369, 371 and 373.

Embodiment 33. The method according to embodiment 32, wherein the B domain substitution is at least for the amino acid sequence of any one of SEQ ID NOs: 362 to 366, 371 and 373 or any one of SEQ ID NOs: 362 to 366, 371 and 373 A method comprising a variant thereof having 80% identity.

Embodiment 34 The method of embodiment 33, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362 to 364, 371 and 373.

Embodiment 35 The method of any one of embodiments 29 to 34, wherein the host cell endogenous locus is a locus of a gene expressed in the liver.

Embodiment 36 The method of any one of embodiments 29 to 35, wherein the host cell endogenous locus is the locus of a gene encoding an acute phase protein.

Embodiment 37 The method of embodiment 36, wherein the acute phase protein is albumin, transferrin or fibrinogen.

Embodiment 38 The method of any one of embodiments 29 to 34, wherein the host cell endogenous locus is a Safe Harbor locus.

Embodiment 39. DNA endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1 , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx3, Csx10, Csf1, Csx15, Csx1 The method of any one of embodiments 29 to 38, wherein the method is selected from the group consisting of , Csf2, Csf3, Csf4, or Cpf1 endonuclease, or a functional derivative thereof.

Embodiment 40 The method of embodiment 39, wherein the DNA endonuclease is Cas9.

Embodiment 41 The method of any one of embodiments 29-40, wherein the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a host cell.

Embodiment 42 The method of any one of embodiments 29-41, wherein the nucleic acid encoding the DNA endonuclease is deoxyribonucleic acid (DNA).

Embodiment 43 The method of any one of embodiments 29-41, wherein the nucleic acid encoding the DNA endonuclease is ribonucleic acid (RNA).

Embodiment 44 The method of embodiment 43, wherein the RNA encoding the DNA endonuclease is mRNA.

Embodiment 45 The method of embodiment 29, wherein the donor template is encoded in an AAV vector.

Embodiment 46 The method of any one of embodiments 29 to 45, wherein the donor template nucleic acid sequence is codon optimized for expression in a host cell.

Embodiment 47 The method of any one of embodiments 29 to 46, wherein the donor template nucleic acid sequence comprises a reduced content of CpG di-nucleotides compared to the wild-type nucleic acid sequence encoding FVIII.

Embodiment 48 The method of embodiment 47, wherein the donor template nucleic acid sequence does not comprise a CpG di-nucleotide.

Embodiment 49. The method according to any one of embodiments 29 to 48, wherein the donor template comprises a donor cassette comprising a nucleic acid sequence encoding a synthetic FVIII protein, wherein the donor cassette is at the gRNA target site on one or both sides. sideways way.

Embodiment 50 The method of embodiment 49, wherein the donor cassette is flanked on both sides by the gRNA target site.

Embodiment 51 The method of embodiment 49, wherein the donor cassette flanks the gRNA target site on its 5' side.

Embodiment 52 The method of any one of embodiments 49-51, wherein the gRNA target site is a target site for the gRNA to be administered.

Embodiment 53 The method of embodiment 52, wherein the gRNA target site of the donor template is the reverse complement of the gRNA target site in the cell genome to the administered gRNA.

Embodiment 54 The method of any one of embodiments 29-53, wherein the DNA endonuclease or nucleic acid encoding the DNA endonuclease is formulated in a liposome or lipid nanoparticle.

Embodiment 55 The method of embodiment 54, wherein the liposome or lipid nanoparticle also comprises a gRNA.

Embodiment 56. The method of any one of embodiments 29 to 55, wherein the DNA endonuclease and the gRNA are administered to the host cell as a ribonucleoprotein (RNP) complex comprising the DNA endonuclease pre-complexed with the gRNA. how it is provided.

Embodiment 57. The method of any one of embodiments 29 to 56, wherein the gRNA or nucleic acid encoding the gRNA and the DNA endonuclease or the nucleic acid encoding the DNA endonuclease provide a donor template to the cell. A method provided to cells after a period of time greater than one day.

Embodiment 58. The method according to any one of embodiments 29 to 57, wherein the gRNA or nucleic acid encoding the gRNA and the DNA endonuclease or the nucleic acid encoding the DNA endonuclease provide a donor template to the cell at least A method provided to cells after 14 days.

Embodiment 59. The method of embodiment 57 or 58, wherein one or more additional doses of the gRNA or nucleic acid encoding the gRNA and the DNA endonuclease or nucleic acid encoding the DNA endonuclease comprise the first dose of the gRNA or gRNA. A method of providing a cell after a nucleic acid encoding and a DNA endonuclease or a nucleic acid encoding a DNA endonuclease.

Embodiment 60. The method of embodiment 59, wherein at least one additional dose of the gRNA or nucleic acid encoding the gRNA and the DNA endonuclease or nucleic acid encoding the DNA endonuclease comprises a first dose of the gRNA or gRNA. After the nucleic acid and the DNA endonuclease or the nucleic acid encoding the DNA endonuclease, a targeted integration of the target level of the nucleic acid sequence encoding the synthetic FVIII protein is achieved or the target level of the nucleic acid sequence encoding the synthetic FVIII protein. provided to the cell until expression is achieved.

Embodiment 61 The method of any one of embodiments 29 to 60, wherein the cell is a liver cell.

Embodiment 62 The method of embodiment 61, wherein the cell is a human hepatocyte or a human sinusoidal epithelial cell.

Embodiment 63. A cell, wherein the genome of said cell comprises DNA encoding a synthetic FVIII protein, wherein said synthetic FVIII protein comprises a B domain substitution, wherein said B domain substitution comprises 0 to 9 N-linked glycosides. A cell comprising a sylation site and 3 to about 40 amino acids in length.

Embodiment 64 The cell of embodiment 63, wherein the synthetic FVIII protein is operably linked to an endogenous albumin promoter, an endogenous transferrin promoter or an endogenous fibrinogen alpha promoter.

Embodiment 65 The cell of embodiment 63, wherein the nucleic acid sequence encoding the synthetic FVIII protein is codon-optimized for expression in the cell.

Embodiment 66 The cell according to embodiment 63, wherein the cell is a human liver cell.

Embodiment 67 The cell of embodiment 66, wherein the cell is a human hepatocyte or a human allogeneic epithelial cell.

Embodiment 68 The cell of embodiment 67, wherein the cell is produced by the method of any one of embodiments 29-62.

Embodiment 69. (a) a gRNA comprising a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA; (b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and (c) a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein comprises B domain substitutions, wherein the B domain substitutions have 0 to 9 N-linked glycosylation sites and 3 to about A method of treating hemophilia A in a subject comprising providing to cells of the subject a donor template comprising a length of 40 amino acids.

Embodiment 70 The method of embodiment 69, wherein the B domain substitution comprises 0-6 N-linked glycosylation sites.

Embodiment 71 The method of embodiment 70, wherein the B domain substitution comprises 0-3 N-linked glycosylation sites.

Embodiment 72 The method of embodiment 29, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362-369, 371 and 373.

Embodiment 73. The method according to embodiment 72, wherein the B domain substitution is at least for the amino acid sequence of any one of SEQ ID NOs: 362 to 366, 371 and 373 or any one of SEQ ID NOs: 362 to 366, 371 and 373 A method comprising a variant thereof having 80% identity.

Embodiment 74 The method of embodiment 73, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362 to 364, 371 and 373.

Embodiment 75 The method of any one of embodiments 69 to 74, wherein the host cell locus is a locus of a gene expressed in the liver.

Embodiment 76 The method of any one of embodiments 69 to 75, wherein the host cell locus is the locus of a gene encoding an acute phase protein.

Embodiment 77 The method of embodiment 76, wherein the acute phase protein is albumin, transferrin or fibrinogen.

Embodiment 78 The method of any one of embodiments 69 to 74, wherein the host cell locus is a Safe Harbor locus.

Embodiment 79. DNA endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1 , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx3, Csx10, Csf1, Csx15, Csx1 The method of any one of embodiments 69 to 78, wherein the method is selected from the group consisting of , Csf2, Csf3, Csf4, or Cpf1 endonuclease, and functional derivatives thereof.

Embodiment 80 The method of embodiment 79, wherein the DNA endonuclease is Cas9.

Embodiment 81 The method of embodiment 80, wherein Cas9 is spCas9 or SluCas9.

Embodiment 82 The method of any one of embodiments 69 to 81, wherein the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a cell.

Embodiment 83 The method of any one of embodiments 69 to 82, wherein the nucleic acid encoding the DNA endonuclease is deoxyribonucleic acid (DNA).

Embodiment 84 The method of any one of embodiments 69 to 82, wherein the nucleic acid encoding the DNA endonuclease is ribonucleic acid (RNA).

Embodiment 85 The method of embodiment 84, wherein the RNA encoding the DNA endonuclease is mRNA.

Embodiment 86. The method according to any one of embodiments 69 to 85, wherein at least one of a gRNA or a nucleic acid encoding a gRNA, a DNA endonuclease or a nucleic acid encoding a DNA endonuclease and a donor template is a liposome or a lipid A method of being formulated into nanoparticles.

Embodiment 87 The method of any one of embodiments 69 to 86, wherein the donor template is encoded in an AAV vector.

Embodiment 88 The method of any one of embodiments 69 to 87, wherein the donor template nucleic acid sequence is codon optimized for expression in a host cell.

Embodiment 89 The method of any one of embodiments 69 to 88, wherein the donor template nucleic acid sequence comprises a reduced content of CpG di-nucleotides compared to a wild-type nucleic acid sequence encoding FVIII.

Embodiment 90 The method of embodiment 89, wherein the donor template nucleic acid sequence does not comprise a CpG di-nucleotide.

Embodiment 91 The donor template according to any one of embodiments 69 to 90, wherein the donor template comprises a donor cassette comprising a nucleic acid sequence encoding a synthetic FVIII protein, wherein the donor cassette is at the gRNA target site on one or both sides. sideways way.

Embodiment 92 The method of embodiment 91, wherein the donor cassette is flanked on both sides by the gRNA target site.

Embodiment 93 The method of embodiment 91, wherein the donor cassette flanks the gRNA target site on its 5' side.

Embodiment 94 The method of any one of embodiments 91 to 93, wherein the gRNA target site is a target site for a gRNA.

Embodiment 95 The method of embodiment 94, wherein the gRNA target site of the donor template is the reverse complement of the gRNA target site in the genome of the cell to the gRNA.

Embodiment 96 The method of any one of embodiments 69-95, wherein providing the donor template to the cells comprises administering the donor template intravenously to the subject.

Embodiment 97 The method of any one of embodiments 69 to 96, wherein the DNA endonuclease or nucleic acid encoding the DNA endonuclease is formulated in a liposome or lipid nanoparticle.

Embodiment 98 The method of embodiment 97, wherein the liposome or lipid nanoparticle also comprises a gRNA.

Embodiment 99. The method of embodiment 98, wherein the step of providing to the cell a gRNA or a nucleic acid encoding the gRNA and a DNA endonuclease or a nucleic acid encoding a DNA endonuclease comprises administering the liposomes or lipid nanoparticles to the subject intravenously. A method comprising administering.

Embodiment 100 The DNA endonuclease of any one of embodiments 69 to 99, wherein the DNA endonuclease and the gRNA are provided to the host cell as a ribonucleoprotein (RNP) complex, and wherein the RNP complex is complexed with the gRNA. A method comprising a clease.

Embodiment 101. The method of any one of embodiments 69-100, wherein the gRNA or nucleic acid encoding the gRNA and the DNA endonuclease or nucleic acid encoding the DNA endonuclease provide a donor template to the cell. A method provided to cells after a period of time greater than one day.

Embodiment 102. The method of any one of embodiments 69 to 101, wherein the gRNA or nucleic acid encoding the gRNA and the DNA endonuclease or the nucleic acid encoding the DNA endonuclease provide a donor template to the cell at least A method provided to cells after 14 days.

Embodiment 103 The first dose of the gRNA or gRNA of embodiment 101 or 102, wherein the one or more additional doses of the gRNA or nucleic acid encoding the gRNA and the DNA endonuclease or nucleic acid encoding the DNA endonuclease A method of providing a cell after a nucleic acid encoding and a DNA endonuclease or a nucleic acid encoding a DNA endonuclease.

Embodiment 104. The method of embodiment 103, wherein the one or more additional doses of the gRNA or nucleic acid encoding the gRNA and the DNA endonuclease or nucleic acid encoding the DNA endonuclease encode the first dose of the gRNA or gRNA. Targeted integration of a nucleic acid and a DNA endonuclease or a nucleic acid encoding a DNA endonuclease followed by a target level of a nucleic acid sequence encoding a synthetic FVIII protein and/or expression of a target level of a nucleic acid sequence encoding a synthetic FVIII protein provided to the cells until this is achieved.

Embodiment 105 The nucleic acid encoding a DNA endonuclease according to any one of embodiments 101 to 104, wherein the step of providing to the cell a gRNA and a DNA endonuclease or a nucleic acid encoding a DNA endonuclease and administering to the subject lipid nanoparticles comprising gRNA.

Embodiment 106 The method of any one of embodiments 101-105, wherein providing the donor template to the cell comprises administering to the subject a donor template encoded in an AAV vector.

Embodiment 107 The method of any one of embodiments 69 to 106, wherein the cell is a hepatocyte.

Embodiment 108 The method of any one of embodiments 69 to 107, wherein the nucleic acid sequence encoding the synthetic FVIII protein is expressed in the liver of the subject.

Embodiment 109. A method of treating hemophilia A in a subject comprising administering to the subject the cell of any one of embodiments 63-68.

Embodiment 110 The method of embodiment 109, wherein the cell is autologous to the subject.

Embodiment 111 The method of embodiment 110, further comprising obtaining a biological sample from the subject, wherein the biological sample comprises liver cells, wherein the cells are prepared from the liver cells.

Embodiment 112 A kit comprising one or more elements of the system of any one of Embodiments 1-28, further comprising instructions for use.

Embodiment 113 A nucleic acid comprising a polynucleotide sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein comprises a B domain substitution, wherein the B domain substitution comprises 0 to 9 N-linked glycosylation sites and 3 A nucleic acid comprising from to about 40 amino acids in length.

Embodiment 114 The nucleic acid of embodiment 113, wherein the B domain substitution comprises 0-6 N-linked glycosylation sites.

Embodiment 115 The nucleic acid of embodiment 113, wherein the B domain substitution comprises 0-3 N-linked glycosylation sites.

Embodiment 116 The nucleic acid of embodiment 113, wherein said B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362-369, 371 and 373.

Embodiment 117. The method according to embodiment 116, wherein the B domain substitution is at least for the amino acid sequence of any one of SEQ ID NOs: 362 to 364, 371 and 373 or any one of SEQ ID NOs: 362 to 364, 371 and 373 A nucleic acid comprising a variant thereof having 80% identity.

Embodiment 118 The nucleic acid of embodiment 116, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362 to 363, 371 and 373.

Embodiment 119 The nucleic acid according to any one of embodiments 113 to 118, wherein the polynucleotide sequence encoding the synthetic FVIII protein is codon optimized for expression in a host cell.

Embodiment 120 The nucleic acid according to any one of embodiments 113 to 119, wherein the polynucleotide sequence encoding the synthetic FVIII protein comprises a reduced content of CpG di-nucleotides compared to a wild-type nucleic acid sequence encoding FVIII.

Embodiment 121 The nucleic acid according to embodiment 120, wherein the polynucleotide sequence encoding the synthetic FVIII protein does not comprise a CpG di-nucleotide.

Embodiment 122 The nucleic acid according to any one of embodiments 113 to 121, wherein the nucleic acid is a viral vector.

Embodiment 123 The nucleic acid according to embodiment 122, wherein the viral vector is an AAV vector.

Embodiment 124 A method of increasing the amount of FVIII in a subject, the method comprising: (a) a gRNA comprising a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA; (b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and (c) a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein comprises B domain substitutions, wherein the B domain substitutions have 0 to 9 N-linked glycosylation sites and 3 to about A method comprising providing a donor template comprising a length of 40 amino acids to a cell of a subject, wherein the subject has a first serum level of FVIII.

Embodiment 125 The method of embodiment 124, wherein the first serum level of FVIII is less than about 0.40 IU/mL.

Embodiment 126 The method of embodiment 125, wherein the first serum level of FVIII is less than about 0.05 IU/mL.

Embodiment 127 The method of embodiment 125, wherein the first serum level of FVIII is less than about 0.01 IU/mL.

Embodiment 128 Use of the system of any one of embodiments 1-28 for the treatment of hemophilia A.

Embodiment 129 Use of the system of any one of embodiments 1-28 for the manufacture of a medicament for the treatment of hemophilia A.

Embodiment 130. Use of the cell of any one of embodiments 63 to 68 for the treatment of hemophilia A.

Embodiment 131 Use of the cell of any one of embodiments 63 to 68 for the manufacture of a medicament for the treatment of hemophilia A.

Embodiment 132 Use of the kit of embodiment 112 for the treatment of hemophilia A.

Embodiment 133 Use of the kit of embodiment 112 for the manufacture of a medicament for the treatment of hemophilia A.

Embodiment 134 Use of the nucleic acid of any one of embodiments 113 to 123 for the treatment of hemophilia A.

Embodiment 135 Use of the nucleic acid of any one of embodiments 113 to 123 for the manufacture of a medicament for the treatment of hemophilia A.

Embodiment 136. A synthetic FVIII protein, wherein the synthetic FVIII protein comprises a B domain substitution, wherein the B domain substitution comprises 0 to 9 N-linked glycosylation sites and is no more than about 40 amino acids in length. protein.

Example

Example 1 : Amino acid sequence containing N-glycosylation motif improves expression of FVIII after targeted integration into mouse albumin intron 1 mediated by CRISPR/Cas9 cleavage

building design

A challenge for inserting the FVIII encoding nucleic acid sequence into the genome is that the native FVIII coding sequence is 7053 bp, making it difficult, among other things, to be packaged into adeno-associated viruses (AAV is mediated by sequence-specific nucleases such as Cas9). has a packaging limit in the range of 4800 to 5000 bp for in vivo delivery as a template for integration at the resulting double-stranded break). To solve the problem, we designed a set of FVIII coding sequences with altered B domains. The B domain of FVIII is not required for function, but it improves secretion of FVIII. These FVIII coding sequences were designed to express synthetic FVIII with a short B domain (substituted B domain). To evaluate the synthetic FVIII coding sequence with a substitutional B domain for their ability to make and secrete FVIII protein after integration into the genome, the construct was designed to target the integration of the FVIII coding sequence into intron 1 of the mouse albumin gene. . The albumin locus provides a strong promoter active in liver cells to allow expression of the appropriate FVIII coding sequence inserted at this locus when operably linked to the albumin promoter.

A series referred to herein as pCB076 (SEQ ID NO: 316), pCB100 (SEQ ID NO: 320), pCB1003 (SEQ ID NO: 324), pCB085 (SEQ ID NO: 3319) or pCB080 (SEQ ID NO: 318) plasmids were constructed using known molecular biology techniques. The same pUC19-based bacterial plasmid backbone (containing the bacterial origin of replication and kanamycin resistance gene) was used for all five plasmids. Plasmids were constructed (in order) using the following elements: gRNA target site (for gRNA mAlbT1, SEQ ID NO: 338, targeting exon 1 of the mouse albumin gene) | 18 bp spacer | Splice Recipient Site (“SA”) | FVIII coding sequence | Polyadenylation signal (“sPA”). The plasmids differed only in codon optimization of the human FVIII coding sequence and in the presence (pCB076) or absence (pCB100, pCB1003, pCB085 and pCB080) of the sequence encoding the B domain substitution. The B domain substitutions used in this example consisted of the first 6 N-glycosylation motifs from the N-terminus of the human FVIII B domain.

Plasmids pCB100, pCB1003, pCB085 and pCB080 all contain the coding sequence for human FVIII with a B domain deleted B domain replaced by an “SQ linker” (encoding amino acid SFSQNPPVLKRHQR, SEQ ID NO: 337). The SQ linker contains a protease cleavage site (RHQR), but lacks an N-linked glycosylation site. Plasmid pCB076 (SEQ ID NO: 316) had the same codon-optimized B domain deleted human FVIII coding sequence as pCB100 (“co1”, see Example 4 below) and a human FVIII B domain inserted into the SQ linker instead of the B domain. contains an additional DNA sequence encoding 17 amino acids corresponding to the first 6 N-glycosylation motifs from the N-terminus of (thus forming B domain substitutions). Other plasmids have the following codon optimizations: pCB100-co1 (SEQ ID NO: 320), pCB1003-co2 (SEQ ID NO: 324), pCB085-co3 (SEQ ID NO: 319) and pCB080-co4 (SEQ ID NO: : 318) (see Example 4 below). The plasmid was designed to be a donor for targeted integration into the double-stranded break generated in intron 1 of the mouse albumin gene using the CRISPR/Cas9 system using the gRNA mALbT1 (tgccagttcccgatcgttac, SEQ ID 338). The liver is the target organ for this targeted integration, specifically hepatocytes. In vivo, hepatocytes are mostly quiescent, and it is known that the predominant cellular mechanism for repairing double-strand breaks in DNA in non-dividing cells is non-homologous end joining (NHEJ) (Z. Mao et al. , Cell Cycle (2008) 7 :2902-06]). In the presence of a linear double-stranded DNA molecule (donor) and a double-stranded break in the genome, the donor DNA can be inserted into the double-stranded break by the NHEJ machinery.

Alternatively, the ends of double-strand breaks in the genome can be religated with each other by an event that is more frequent than insertion of the same NHEJ machinery, usually a donor template. Repair by NHEJ is an error-prone process, which results in the introduction of insertions or deletions at the site of double-strand breaks. Targeted integration of the donor template delivered as a plasmid to a double-stranded break in the genome of the cell can be enhanced by including a cleavage site for the nuclease in the donor plasmid. Because plasmids are circular molecules, they are not templates for integration at double-strand breaks. Inclusion of a single guide RNA cleavage site in the plasmid results in linearization of the plasmid in the presence of the Cas9/gRNA complex. Therefore, a single guide RNA cleavage site for the mALbT1 guide was inserted at the 5' end of the FVIII cassette as the reverse complement of the sequence present in the mouse genome.

The use of the reverse complement of the guide sequence in the genome theoretically favors integration in the forward orientation when using two guide sites flanked by a cassette. However, this advantage is unlikely to be maintained if only one guide cutting site is used. Inclusion of a guide cleavage site flanking the coding sequence results in two linear fragments consisting of a coding sequence cassette and a bacterial plasmid backbone (encoding an antibiotic resistance gene and origin of replication), in which case the bacterial backbone fragment is a double in the genome. - Compete for unity at strand breaks. For this reason, we designed the plasmid such that a single guide cleavage site was used. The synthetic FVIII coding sequence cassette consisted of the following elements in order, starting at the 5' end; mAlbT1 gRNA target site, 18 bp spacer sequence, splice acceptor sequence (ACTAAAGAATTATTCTTTTACATTTCAG, SEQ ID NO: 307), B domain-deleted human FVIII coding sequence with signal peptide replaced by dinucleotide TG, and polyadenylation signal (aataaaagatcttgttgtgtttcattagatttgttttt , SEQ ID NO: 306).

The construct was designed such that, after integration of albumin into intron 1, a hybrid pre-mRNA containing exon 1 of albumin, a portion of intron 1 of albumin and the FVIII coding sequence cassette was generated. After integration into albumin intron 1, it has been shown that, with some frequency, the cell's splicing machinery splices intron 1, resulting in mature mRNA in which albumin exon 1 is fused in-frame to the coding sequence for mature FVIII. It is expected. A TG dinucleotide was included in the construct to maintain the translational reading frame. Translation of this mRNA was expected to produce a protein in which a signal peptide and a pro-peptide of albumin were fused to the mature coding sequence of FVIII. Upon passage through the secretory machinery of the cell, the signal peptide and pro-peptide were predicted to be cleaved, leaving three amino acids (Glu-Ala-Leu) added to the native N-terminus of mature FVIII. The FVIII protein produced using this method was active in mice despite the presence of these additional three amino acids.

gRNA

The gRNA used in these experiments was chemically synthesized by incorporating chemically modified nucleotides to improve resistance to nucleases. In one embodiment, the gRNA consists of the structure: 5' usgscsCAGUUCCCGAUCGUUAC GUUUUAGAgcuaGAAAuagcAAGUUAAAAUAAGGCUAGUCCGUUAUCaacuuGAAAaaguggcaccgagucggugcusususU-3' (SEQ ID NO: 339), wherein "a, C," is a native RNA nucleotide, "a, g, G, U u, c" is a 2'-O-methyl nucleotide, and "s" is a phosphorothioate backbone. The mouse albumin targeting sequence of the gRNA is underlined, the rest of the gRNA sequence is the consensus scaffold sequence.

mRNA

mRNA can be produced by methods known in the art. One such method as used herein is in vitro transcription using T7 polymerase, wherein the sequence of mRNA is encoded in a plasmid containing the T7 polymerase promoter. Briefly, incubation of the plasmid in an appropriate buffer containing T7 polymerase and ribonucleotides resulted in RNA molecules encoding the amino acid sequence of the desired protein. Natural ribonucleotides or chemically modified ribonucleotides can be used in the reaction mixture to produce mRNA molecules having the native chemical structure of native mRNA or having a modified chemical structure. In the studies described herein, native (unmodified) ribonucleotides were used. In addition, a capping component was included in the transcription reaction, allowing the 5' end of the mRNA to be capped.

spCas9 mRNA was designed to encode an spCas9 protein fused to a nuclear localization domain (NLS) required to transport the spCas9 protein into a nuclear compartment where cleavage of genomic DNA can occur. An additional component of Cas9 mRNA is a polyA tail at the 3' end consisting of a series of A residues and a KOZAK sequence at the 5' end before the first codon to promote ribosome binding. An example of an spCas9 mRNA having an NLS sequence is set forth in SEQ ID NO: 340. In addition, the sequence of the spCas9 coding sequence was optimized for codon usage by using the most frequently used codon for each amino acid. In addition, to facilitate efficient translation of mRNA to spCas9 protein, the coding sequence was optimized to remove the cryptic ribosome binding site and the upstream open reading frame.

LNP

The major component of LNP used in these studies is the lipid C12-200 (Love et al., 2010, supra). C12-200 forms a complex with negatively charged RNA molecules. In general, C12-200 was combined with 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), DMPE-mPEG2000 and cholesterol. For example, when mixed with nucleic acids, such as gRNA and mRNA, under controlled conditions in a NanoAssemblr® device (Precision NanoSystems, Vancouver BC), self-assembly of the LNP occurred, and the nucleic acid was inside the LNP. encapsulated in To assemble gRNA and Cas9 mRNA into LNPs, ethanol and lipid stock solutions were pipetted into glass vials as appropriate. An exemplary ratio consisted of C12-200, DOPE, cholesterol and mPEG2000-DMG in a molar ratio of 50:10:38.5:1.5. gRNA and mRNA were diluted in 100 mM sodium citrate (pH 3.0) and 300 mM NaCl in RNase-free tubes. The NanoAssemblr® cartridge (Precision Nanosystems) was washed with ethanol on the lipid side and water on the RNA side. A working stock of lipids was drawn into the syringe, the air was evacuated from the syringe, and the syringe was inserted into the cartridge. The same procedure was used to load the mixture of gRNA and Cas9 mRNA into the syringe. The Nanoassemblr® run was then performed under the conditions recommended by the manufacturer. The LNP suspension was dialyzed for 4 h in 4 liters of PBS using a 10 K molecular weight cut-off (MWCO) dialysis cartridge, followed by 3 washes in PBS during centrifugation, using a 100 K MWCO spin cartridge (Amicon ( Amicon)) by centrifugation. Finally, the LNP suspension was sterile filtered through a 0.2 μm syringe filter. Endotoxin levels were determined using a commercial endotoxin kit (Limulus transformed cell lysate (LAL) assay) and particle size distribution was determined by dynamic light scattering.

The concentration of encapsulated RNA was determined using the RiboGreen® assay (Thermo Fisher). Alternatively, gRNA and Cas9 mRNA were separately formulated into LNPs and then mixed together and then treated with cells in culture or injected into animals. Separately formulated gRNA and Cas9 mRNA were used to allow specific ratios of gRNA and Cas9 mRNA to be tested.

Alternative LNP formulations using alternative cationic lipid molecules are also used for in vivo delivery of gRNA and Cas9 mRNA.

In vivo testing of constructs

A murine model was used to test the ability of the designed constructs to generate FVIII. Mouse models of hemophilia A are known in the art (eg L. Bi et al., Nat Genet . (1995) 10 :119-21, doi: 10.1038/ng0595-119). Plasmids pCB076, pCB100, pCB1003, pCB085 and pCB080 were purified using Qiagen EndoFree® plasmid maxi prep kit (Cat. No. 12362), then to a final concentration of 15 μg/mL in 0.9% saline. diluted. Hemophilia A mice (strain B6; 129S-F8 ^tm1Kaz /J), strains of mice lacking the mouse FVIII protein were obtained from The Jackson Laboratory (Bar Harbor, Maine, USA). Cohorts of hemophilia A mice were injected via tail vein with 2 mL of diluted plasmid DNA per mouse by hydrodynamic injection (“HDI”) over a period of 5 to 6 seconds. The HDI process has been reported to result in the transfer of plasmid DNA into the nucleus of hepatocytes, including hepatocytes (see, e.g., F. Niola et al., Meth Mol Biol (2019) 1961 :329-41). ). One day after injection, mice were given a retroorbital (“RO”) injection of an LNP formulation encapsulating spCas9 mRNA and guide RNA mAlbT1. The dose of LNP administered to mice was 1 mg/kg (body weight) of spCas9 mRNA + 1 mg/kg of gRNA/kg body weight.

Groups of mice administered only LNP were sacrificed after 3 days, DNA was extracted from whole liver, and TIDE analysis for insertions and deletions at the expected cleavage site for mAlbT1 gRNA (EK Brinkman et al., Nuc Acid Res (2014) 42 :e168]). In the TIDE analysis, the genomic region of the predicted CRISPR/Cas9 cleavage site is amplified by PCR from the genomic DNA of the treated cells and then subjected to Sanger sequencing. The sequencing chromatograms are analyzed using the TIDE software program to determine the frequency of insertions and deletions in regions near the expected cleavage site.

In these experiments, the frequency of insertions and deletions at on-target sites was determined to be 25.4%. Six days after LNP administration to mice injected with the plasmid, blood samples were taken in sodium citrate by RO bleed (1:9 ratio sodium citrate to blood), and plasma was collected by centrifugation. FVIII activity in plasma was determined using the FVIII activity assay (Diapharma, Chromogenix Coatest® SP Factor FVIII, catalog number K824086). Kogenate® (Bayer), ie recombinant human FVIII, was used for the standard, and units of FVIII activity in blood per mL were converted to percentage of normal activity (1 U/mL = 100%) . The results are summarized in FIG. 1 . Mice injected with plasmid pCB076 containing six N-glycan B domain substitution sequences instead of the B domain had mean synthetic FVIII levels equivalent to 20% of normal human FVIII levels. In contrast, mice injected with the pCB100 plasmid identical to pCB076, except for the absence of the six N-glycan B domain substitution sequences, had no detectable FVIII levels in their blood. Mice injected with plasmids pCB1003, pCB085 or pCB080 containing a differentially codon-optimized B domain deleted FVIII coding sequence lacking six N-glycan B domain substitution sequences were treated with non-genetically edited (naive) )) had low or no measurable FVIII activity in their blood when compared to hemophilia A mice. Some of the mice injected with pCB1003 and pCB080 had detectable FVIII in their blood in the range of 1 to 3% of normal, indicating that codon-optimized co2 (pCB1003) and co4 (pCB080) were codon-optimized co1 (pCB100) and co3 (pCB085).

The level of FVIII produced in the blood of mice in this study was governed by both the frequency of targeted integration into albumin intron 1 (an orientation capable of producing FVIII protein) and the efficiency of intrinsic expression of the FVIII coding sequence. became The intrinsic expression efficiency of the FVIII coding sequence is a function of transcription efficiency, translation efficiency (depending on the type of codon optimization used) and the efficiency of the secretion process. In the case of FVIII protein, it has been reported that secretion of the protein may be a rate limiting step and is associated with an unfolded protein response that may be induced when FVIII is expressed at high levels in cells. (M. Swaroop et al., J Biol Chem (1997) 272 :24121-24; RJ Kaufman, Blood (2009) 114 :SCI-19).

To distinguish the intrinsic expression efficiency of the synthetic FVIII coding sequence from the targeted integration frequency, which may vary between mice due to variability in the efficiency of delivery of donors by HDI or other factors, the targeted integration frequency was calculated using droplet digital PCR (DD). -PCR) was used for quantification. DD-PCR is a method for quantifying the absolute copy number of a nucleic acid sequence in a sample. To quantify the forward orientation of the synthetic FVIII coding sequence cassette inserted into albumin intron 1, a pair of PCR primers was designed, the forward primer was located in albumin intron 1 at the 5' site of the gRNA mALbT1 cleavage site, and the reverse primer was FVIII It is located at the 5' end of the coding sequence. A fluorescent probe complementary to the sequence between the two primers was designed. A reference primer/probe set was designed against the native mouse albumin gene sequence at a site distal from the mALbT1 gRNA site. Reference primer probes were used to normalize to the amount of input mouse genomic DNA in each assay.

To perform this assay, mice from the experiments described above were sacrificed 8 days after administration of LNP to the mice. Whole livers were homogenized and whole genomic DNA was purified using the Qiagen DNeasy® tissue kit. Genomic DNA of equal mass was then assayed for targeted integration frequencies using the DD-PCR assay described above. Results for each mouse are summarized in Table 2. Targeted integration frequencies of forward orientation ranged from 0.09% to 0.95% (0.09 to 0.95 copies per 100 haploid genomes). Peak FVIII levels in blood correlated positively with integration frequency, indicating that the levels of FVIII depended on the number of copies of the FVIII cassette integrated into albumin intron 1. The mean targeted integration frequency in mice injected with pCB076 was 0.47 ± 0.26, compared to 0.28 ± 0.15 in mice injected with pCB100, which was not statistically significant, although B domain substitutions were used instead of the SQ linker. showing a trend for higher integration frequency in mice injected with pCB076 containing

Table 2 Targeted integration frequency in the liver of mice compared to peak FVIII levels in blood

Normalization of each mouse's blood FVIII level to the integration frequency provides a measure of the efficiency of intrinsic expression of the FVIII coding sequence. The mean of the ratio of FVIII levels divided by the targeted integration frequency was 42 for pCB076 and 5.3 for pCB100, and this difference was statistically significant as determined using a two-tailed Student's T-test. (p=0.0004). These results show that the intrinsic expression efficiency of the synthetic FVIII coding sequence in pCB076 is about 8-fold greater than that of the coding sequence in pCB100. This shows that inclusion of the sequence encoding the B domain substitution instead of the SQ linker improved the native expression efficiency of this codon-optimized FVIII coding sequence by about 8-fold. The magnitude of this improvement is more significant than the 2-fold improvement reported for the same six glycan motif sequences when the FVIII coding sequence is delivered in a non-integrating AAV virus and the FVIII coding sequence is driven by a strong liver-specific promoter. significantly larger (J. McIntosh et al., Blood (2013) 121 :3335-44).

Example 2 : Replacement of the SQ linker with a B domain substitution increases FVIII expression from the FVIII donor cassette delivered by AAV and integrated into intron 1 of albumin.

To determine whether the same beneficial effect of the B domain-substituted peptide occurs when the synthetic FVIII coding sequence is transferred to the liver of mice using AAV, plasmids pCB099 (SEQ ID NO: 311) and pCB102 (SEQ ID NO: 341) ) and packaged in AAV8 (Vector Biolabs, Malvern, PA or SabTech, Philadelphia, PA). Plasmids were constructed (in order) using the following elements: ITR | gRNA target site (for mAlbT1) | 18 bp spacer | Splice Recipient Site (“SA”) | FVIII coding sequence | polyadenylation signal (“sPA”) | gRNA target site | ITR. The FVIII coding sequences for pCB099 and pCB102 were identical to the FVIII coding sequences for pCB076 (with B domain substitution) and pCB100 (with SQ linker only), respectively. These FVIII cassettes lack a promoter and thus cannot express FVIII as a non-integrated AAV episomal genome. Integration adjacent to the appropriate promoter is required for expression of FVIII delivered by these AAV viruses.

In these experiments, hemophilia A mice were injected intravenously with 2×10 ¹² vector genomes (“vg”) of AAV8-pCB099 or AAV8-pCB102 per kilogram of body weight. After 4 weeks, mice were injected intravenously with a 1:1 mixture of two LNPs, one LNP encapsulating mAlbT1 gRNA and the other LNP encapsulating spCas9 mRNA. LNPs were prepared as described in Example 1, and the total dose was 2 mg of RNA per kg body weight. FVIII activity was measured in the blood of mice 10 days after LNP administration using the method presented in Example 1. Blood FVIII levels of mice 10 days after administration of LNP ( FIG. 2 ) were on average 20% of normal human FVIII levels relative to mice receiving AAV9-pCB099, whereas AAV8-pCB102 (lack of B domain substitution) In the provided mouse, it was background level.

Twenty-four days after LNP administration, mice were sacrificed, whole livers were homogenized, and total genomic DNA was extracted from a portion of liver lysates. The frequency of targeted integration into albumin intron 1 in forward orientation was quantified using the DD-PCR assay described in Example 1. Results for each mouse are summarized in Table 3.

The results show that the mean targeted integration frequency (% per haploid genome) in mice injected with AAV8-pCB099 was 1.86 (±0.25), while in mice injected with AAV8-pCB102, the average targeted integration frequency was 0.46 (±0.25). 0.2) was shown. This difference was statistically significant using two-tailed Student's T-test (p<0.01). These results show that inclusion of the B domain substitution resulted in a 4-fold greater frequency of targeted integration, which would only result in the previous inclusion of a glycan in place of the B domain of FVIII to appear to improve the expression level of FVIII. Considering that, this is an unexpected result. The mean FVIII level in the blood of mice injected with AAV8-pCB099 was 18.6 (± 2.2)% of normal, whereas in mice injected with AAV8-pCB102, the mean FVIII level was 1.7 (± 1.1)% of normal. This 11-fold difference was statistically significant (p<0.01) using a two-tailed Student's T-test. FVIII levels were divided by the targeted integration frequency in individual mice, and FVIII levels were normalized to the targeted integration frequency (Table 3). The mean of the ratio of FVIII activity divided by the targeted integration frequency was 10.2 (±1.7) for AAV8-pCB099 injected mice and 3.1 (± 1.7) for AAV8-pCB102 injected mice. This difference was statistically significant using two-tailed Student's T-test (p<0.01).

These data show that the intrinsic expression efficiency of the FVIII coding sequence in AAV8-pCB099 is 3-fold higher than that of AAV8-pCB102. Because AAV8-pCB099 differs from AAV8-pCB102 only in the presence of an N-glycan motif containing sequence, these data show that the N-glycan motif in AAV8-pCB099 confers a 3-fold improvement in intrinsic expression efficiency. Thus, an overall 11-fold improvement in blood FVIII levels in mice is due to the combination of a 4-fold higher targeted integration with a 3-fold improved expression efficiency of the integrated FVIII coding sequence.

Table 3 Targeted integration frequency in the liver of mice compared to peak FVIII levels in blood for mice injected with AAV8 virus followed by LNP encapsulating Cas9 mRNA and mALbT1 gRNA

Example 3 : Optimization of the number of N-glycans in B domain substitutions

Data from Examples 1 and 2 show that insertion of a B domain substitution containing six N-linked glycan motifs improved the expression of FVIII and the frequency of targeted integration. However, the dependence of this improvement on the number of N-glycan sequences in the B domain substitution was not known. Therefore, we designed experiments to examine this aspect of FVIII expression. In particular, it was desirable to determine the minimum number of N-linked glycan motifs required for improvement of FVIII expression.

Plasmid constructs

To explore the effect of different numbers of N-glycan motifs on expression, a series of donor plasmids containing 1 to 9 N-glycan motifs were constructed. These are summarized in Table 4. All plasmids consisted of the following sequence elements in 5' to 3' order: target sequence for mAlbT1 gRNA | 18 bp spacer | Splice Grants | B domain deleted FVIII coding sequence with signal peptide replaced by TG dinucleotide | Polyadenylation signal sequence. In each of these plasmids, the FVIII coding sequence was based on the codon optimized sequence used in pCB076 (see Example 1), in which the signal peptide was replaced by a TG dinucleotide, but 1 to 9 N-linked in the B domain substitution. It has a glycosylation site. All plasmids contained the same pUC19-based bacterial plasmid backbone (containing the bacterial origin of replication and the kanamycin resistance gene).

Table 4 FVIII donor plasmids containing different numbers of N-glycosylation site triplets in B domain substitutions

In vivo testing of constructs: 5, 6 and 7 glycans

Hemophilia A mice were administered with 30 μg of plasmids pCB077, pCB1006, pCB1007 or pCB1008 per mouse by hydrodynamic injection using the method of Example 1. One day later, the same mice were injected retroorbitally with a 1:1 mixture of LNP encapsulating spCas9 mRNA and mALbT1 gRNA at a total RNA dose of 2 mg/kg body weight. LNPs were prepared as described in Example 1. FVIII activity was measured in the blood of mice after 6 days using the method presented in Example 1. The results are summarized in Figure 3 and showed that the levels of FVIII produced by the four plasmid donors were similar.

The level of FVIII produced in the blood of mice in this study is dependent on both the frequency of targeted integration into albumin intron 1 in the forward orientation (an orientation capable of producing FVIII protein) and the intrinsic expression efficiency of the FVIII coding sequence. The intrinsic expression efficiency of the FVIII coding sequence is a function of transcription rate, translation efficiency (affected by the type of codon optimization used) and the efficiency of the secretion process. In the case of the FVIII protein, secretion of the protein may be a rate limiting step (M. Swaroop et al. supra) and is associated with the unfolded protein response that occurs when FVIII is expressed at high levels in cells. has been suggested (RJ Kaufman, supra). To differentiate between the targeted integration frequency, which is expected to vary between individual mice, and the intrinsic expression efficiency of the targeted synthetic FVIII coding sequence, the targeted integration frequency was subjected to droplet digital PCR (DD-PCR) as described in Example 1 . was used for quantification.

Eight days after LNP administration to mice, mice were sacrificed, whole livers were homogenized, and whole genomic DNA was purified using Qiagen DNeasy® tissue kit. Genomic DNA of equal mass was then assayed for targeted integration frequency using DD-PCR. Results for each mouse are summarized in Table 5. The frequency of targeted integration of the forward orientation ranged from 0.17% to 0.70% in individual mice, but the mean within groups of each mouse for the four plasmids was 0.49%, 0.47%, 0.52 for pCB077, pCB1006, pCB1007 and pCB1008, respectively. % and 0.38%. The mean ratios of FVIII activity to TI for mice injected with pCB077, pCB1006, pCB1007 and pCB1008 were 51.33, 48.54, 48.9 and 38.9, respectively, and the differences between the plasmids were not statistically significant. These results show that the synthetic FVIII coding sequence contains either 5 N-glycan sites (pCB1007) or 7 glycan sites (pCB1008), or one of the glycan tripeptide motifs is changed from NDS to NDT (pCB1006) is 6 N - Shows that it has a similar intrinsic expression efficiency compared to the synthetic FVIII coding sequence encoding the glycan region (pCB077).

The same mouse study was performed using plasmids pCB1015 (SEQ ID NO: 328) and pCB1016 (SEQ ID NO: 329) in which the number of N-glycan motifs was changed to 8 and 9, respectively. In addition, a plasmid identical to pCB077 was constructed except that it had only one or two N-glycan motifs, and after targeted integration into mouse albumin intron 1 using the same gRNA and spCas9 mRNA delivered from the LNP, they released FVIII. The ability to express was tested.

TABLE 5 Targeted Integration Frequency in the Liver of Mice Compared to Peak FVIII Levels in Blood

In vivo testing of constructs: 3, 4 and 5 glycans

Plasmids pCB1007, pCB1017 and pCB1018 were purified as described above and administered to hemophilia A mice. One day later, mice received retroorbital (“RO”) injections of C12-200-based LNPs encapsulating spCas9 mRNA (1 mg/kg) and guide RNA (gRNA) mAlbT1 (1 mg/kg). On days 5 and 7 post LNP administration, blood samples were taken in sodium citrate by RO bleed (sodium citrate to blood in a 1:9 ratio) and plasma was collected by centrifugation. FVIII activity in plasma was measured using the method set forth in Example 1.

The mean blood FVIII activity on day 5 was 8.1%, 5.0% and 23.5% in mice injected with pCB1007, pCB1018 and pCB1018, respectively. At day 7, FVIII activity averaged 7.9%, 3.0% and 13.5% in mice injected with pCB1007, pCB1018 and pCB1018, respectively. Thus, FVIII activity in mice injected with plasmids carrying either four N-glycan motifs (pCB1017) or three N-glycan motifs (pCB1018) was determined by containing five N-glycan motifs in the B domain substitution. It was similar to that of the mouse that received the plasmid (pCB1007).

After taking blood samples on day 7 post LNP administration, mice were sacrificed, whole livers removed, and stored in RNAlater™ buffer (Qiagen). Whole livers were homogenized using a bead-based homogenizer and DNA was purified from an aliquot of the homogenate using a Qiagen DNA/RNA mini kit (Cat. No. 80204). Liver genomic DNA was analyzed for frequency of integration of the FVIII donor cassette in forward orientation by DD-PCR as described in Example 1. The mean targeted integration frequencies were 0.27%, 0.27% and 0.55% for mice injected with pCB1007, pCB1017 and pCB1018, respectively, and these values were not statistically different (two-tailed Student's T-test).

Normalization of each mouse's blood FVIII level to the integration frequency provides a measure of the efficiency of intrinsic expression of the FVIII coding sequence. The mean of the ratio of FVIII levels divided by the targeted integration frequency was 23.6 for pCB1007 (5 N-glycans) injected mice, 11.6 for pCB1017 (4 N-glycans) injected mice, and pCB1018 (3 N-glycans). N-glycan) was 23.3 for injected mice. FVIII divided by the targeted integration ratio for pCB1017 and pCB1018 injected mice was not statistically different from that of pCB1007 injected mice.

These data show that when the use of a synthetic FVIII coding sequence containing a B domain substitution with either four N-glycan motifs or three N-glycan motifs is integrated into albumin intron 1, 5 N-glycan It is shown to result in expression similar to the FVIII coding sequence containing the Can motif. Thus, a synthetic FVIII construct with a B domain substitution with three N-glycan motifs provides improved FVIII expression equivalent to that provided by a B domain substitution with five N-glycan motifs. Inferred, since a B domain substitution containing 5 N-glycan motifs is equivalent to a B domain substitution containing 6 N-glycan motifs, the inventors found that 3 N-glycan motifs are equivalent to 6 N-glycans Infer that it is equally powerful as the motif.

In vivo testing of constructs: 1 and 2 glycans

Plasmids pCB1018 (including FVIII donors with B domain substitutions with three N-glycan motifs), pCB1029 (including FVIII donors with B domain substitutions with two N-glycan motifs) and pCB1030 (one N -including FVIII donors with B domain substitutions with glycan motifs) were purified as described above and administered to hemophilia A mice by hydrodynamic injection. One day later, mice received retroorbital (“RO”) injections of C12-200-based LNPs encapsulating spCas9 mRNA (1 mg/kg) and gRNA mAlbT1 (1 mg/kg). On days 5 and 8 post LNP administration, blood samples were taken in sodium citrate by RO bleed (sodium citrate to blood 1:9) and plasma was collected by centrifugation. FVIII activity in plasma was measured as described above and expressed as a percentage of normal activity (1 U/mL = 100%).

The mean blood FVIII activity on day 5 was 12.8%, 15.8% and 13.4% in mice injected with pCB1018, pCB1029 and pCB1030, respectively. At day 8, FVIII activity averaged 13.8%, 14.5% and 16.0% in mice injected with pCB1018, pCB1029 and pCB1030, respectively. Thus, in mice injected with a plasmid containing a B domain substitution with three N-glycan motifs (pCB1018), two N-glycan motifs (pCB1029) or one N-glycan motif (pCB1030) FVIII expression was similar to each other.

After blood samples were taken on day 7 post LNP administration, mice were sacrificed, whole livers removed, and stored in RNAlater™ buffer (Qiagen). Whole livers were homogenized and liver genomic DNA was analyzed by DD-PCR for frequency of integration of the FVIII donor cassette in forward orientation as described in Example 1. The mean targeted integration frequencies were 0.29%, 0.47% and 0.36%, respectively, for mice injected with pCB1018, pCB1029 and pCB1030: these values were not statistically different (two-tailed Student's T-test).

Normalization of each mouse's blood FVIII level to the integration frequency provides a measure of the efficiency of intrinsic expression of the FVIII coding sequence. The mean of the ratio of FVIII levels divided by the targeted integration frequency was 41.9 for pCB1018 (3 N-glycans) injected mice, 31.4 for pCB1029 (2 N-glycans) injected mice, and pCB1030 (1 N-glycan). N-glycan) was 40.2 for injected mice. The intrinsic expression efficiencies for pCB1029 (3 N-glycans) and pCB1030 (2 N-glycans) injected mice were not statistically different from those of pCB1018 (3 N-glycans) injected mice. These data show that the FVIII donor cassette containing a B domain substitution containing either two N-glycan motifs (amino acid sequence NATNVS) or one N-glycan motif (amino acid sequence NAT) contains three N-glycan motifs. It is shown to be expressed with the same efficiency as the FVIII donor cassette containing the B domain substitution with

Table 6 FVIII activity in mice injected with FVIII donors pCB1018, pCB1029 and pCB1030, targeted integration frequency and FVIII activity normalized to integration frequency

Comparison of in vivo FVIII expression results for FVIII donor cassettes containing B domain substitutions containing 0, 1, 2, 3, 4, 5, 6 or 7 N-linked glycan motifs

The intrinsic expression efficiencies of the different FVIII cassettes tested above were compared. Using the same strain of mice (hemophilia A mice) and the same experimental protocol, the data set described in Example 3 was generated for a total of 5 studies. FVIII activity was measured on day 5 or 6, and again on day 8 or 9. Targeted integration frequencies were determined in DNA extracted from whole livers of mice sacrificed on the day of the last FVIII activity measurement (day 8 or 9). A collection of intrinsic expression efficiencies is shown in FIG. 8 . FVIII cassettes with different codon optimizations are included in this comparison. A comparison of the effect of different numbers of glycans on normalized FVIII expression can be performed for donors with codon optimization referred to as “co1”, the first nine bars in FIG. 8 . These donors contain FVIII cassettes that differ only in the number of N-glycan motifs in the B domain substitutions. Intrinsic expression efficiencies were not significantly different for glycan variants containing 1 to 7 N-glycan motifs. Although donors with two N-glycan motifs (“co1-2”) tended to lower normalized FVIII activity (compared to a value of about 45 for variants with 5, 6 or 7 N-glycans), value of 30), this difference was not statistically significant. Donors without an N-glycan motif in place of the B domain (“co1-0”) had significantly lower normalized FVIII activity (a value of 7.4 compared to 40-50 for glycans and variants with the same codon optimization) was shown. The FVIII donor with 5 glycans and codon-optimized co2 was equivalent to co1 with 5 N-glycan motifs, while co3 with 5 N-glycans showed an increase in the efficiency of co1 with 5 N-glycans. expressed in about 50%. These data confer FVIII expression levels equivalent to that achieved with B domain substitutions comprising 2-7 N-glycan motifs in which a FVIII coding sequence containing a B domain substitution comprising a single N-glycan motif would show that it is sufficient to The FVIII coding sequence containing a B domain substitution comprising a single N-glycan motif (“co1-1” / pCB1030 in FIG. 8) is the same FVIII coding sequence lacking the B domain substitution (“co1-0”) / pCB100) about 5.4 times more efficiently (40.1/7.4) than the expression. Thus, less than 6 N-glycans, for example 5 N-glycans, 4 N-glycans, 3 N-glycans, 2 N-glycans or 1 N-glycan The FVIIII coding sequence containing the B domain substitution with

Example 4 : Identification of optimal codon optimization of the FVIII coding sequence for expression following targeted integration into a safe harbor locus (eg, albumin locus) in mice

Plasmid constructs

Experiments were performed to determine the effect of different types of codon optimization on the expression of synthetic FVIII. The mature (lacking signal peptide) B domain deleted human FVIII coding sequence (total coding sequence of 1438 amino acids) containing a 14 amino acid SQ linker in place of the B domain was subjected to a commercially available algorithm available from GeneArt (co3). codon optimization, which increased the number of CG dinucleotides from 54 to 198 present in the native sequence. B domain deleted FVIII by manually removing all 198 CG dinucleotides by selecting the next most frequent or more frequently used alternative codons according to the published H. sapiens codon usage table of the co3 form (“co4”) was generated (HC Brown et al., Mol Ther Meth & Clin Dev (2018) 9 :57-69 (doi: 10.1016/j.omtm.2018.01.004)) ). The B domain deleted FVIII (“FVIII-BDD”) coding sequence was codon optimized using an algorithm based on the codon bias of genes highly expressed in the liver (HC Brown et al., supra), resulting in 176 CG dinucleotides. FVIII-BDD co2 containing This construct, referred to herein as FVIII-BDD co5, was also synthesized, further modified to remove all CG dinucleotides. Literature [J. McIntosh et al., Blood (2013) 121 (17):3335-44] and US 9,393,323 (SEQ ID NO: 1 supra) also constructed a codon-optimized FVIII-BDD coding sequence, herein “ co1”. An additional codon optimized variant of the B domain deleted FVIII coding sequence disclosed in WO2011/005968 (SEQ ID NO: 5 supra) containing 245 CG dinucleotides was synthesized (herein “FVIII-BDD co6”). ”). Plasmids were constructed as follows, wherein the donor sequence codon optimization was co2 (pCB1002, SEQ ID NO: 323), co3 (pCB1001, SEQ ID NO: 322), co4 (pCB1000, SEQ ID NO: 321) or co5 ( pCB103, SEQ ID NO: 336): pUC19 plasmid backbone | ITR | Target site for gRNA mALbT1 | 18 bp spacer | Splice Grants (SA) | TG dinucleotide | B domain deleted FVIII sequence | poly A (sPA) | Target site for gRNA mALbT1 | ITR.

The FVIII donor cassette in each plasmid was flanked by the AAV2 ITR, which was used to package the cassette into AAV8 using a HEK293-based packaging system and purified using cesium chloride density centrifugation. The resulting AAV8 virus (designated AAV8-pCB103, AAV8-pCB1002, AAV8-pCB1001 and AAV8-pCB1000) was titrated using Q-PCR or DD-PCR with a primer/probe set located within the coding sequence for the FVIII gene. did. These FVIII donor cassettes are designed to express FVIII only after targeted integration into albumin intron 1. The donor cassette lacks a promoter and thus cannot be transcribed into mRNA from the non-integrated episomal viral genome. In addition, all FVIII donor cassettes lack a signal peptide sequence at the N-terminus of the FVIII coding sequence, so that any protein that can be expressed from a non-integrated episomal viral copy cannot be secreted into the circulation. Following integration into albumin intron 1, transcription from the albumin promoter in the genome produces a hybrid pre-mRNA comprising mouse albumin exon 1, a portion of intron 1 and the synthetic FVIII coding sequence, included at the 5' end of the FVIII donor cassette. The polyadenylation signal is terminated. By splicing this pre-mRNA between the splice donor of albumin exon 1 and the splice acceptor contained at the 5' end of the FVIII donor cassette, exon 1 of albumin is frame- to generate mRNA encoding the pre-pro-peptide to be fused within. The protein encoded by this hybrid mRNA is processed through the cell's secretory machinery, during which the signal peptide and albumin's pre-propeptide are cleaved, leaving three amino acids not normally present in FVIII at the N-terminus of the heavy chain. would result in the predicted two-stranded FVIII molecule being

In vivo testing of constructs

To test these formulations, each of the AAV8 viruses (AAV8-pCB103, AAV8-pCB1002, AAV8-pCB1001 and AAV8-pCB1000) was administered at a dose of 2×10 ¹² vg/kg to cohorts of 4 or 5 hemophilia A mice. was injected through the tail vein. After 4 weeks, all mice were injected intravenously with a 1:1 mixture of mAlbT1 gRNA and LNP encapsulating spCas9 mRNA at a total RNA dose of 2 mg/kg. LNPs were formulated according to the method described in Example 1. Blood FVIII activity was measured using the method set forth in Example 1. The results are summarized in FIG. 4 .

In these experiments, mice given AAV8-pCB103 and AAV8-pCB1002 (containing FVIII-BDD with codon optimized co5 and co2, respectively) had no detectable FVIII activity in their blood. Mice given the viral pCB1001 (codon optimized co3) had an average of 8% FVIII activity on day 11 and 20% FVIII activity on day 28 after LNP administration. 3 of 5 mice given the virus AAV8-pCB1000 (codon optimized co4) had FVIII activity levels between 1% and 3% of normal. These data showed that the FVIII-BDD DNA sequence (AAV8-pCB1001, co3), which was codon-optimized using the GeneArt algorithm, was codon-optimized based on the most frequent codons of genes highly expressed in the liver (AAV8-pCB103 and AAV8). -pCB1002), resulting in higher levels of FVIII expression. Modification of the GeneArt codon-optimized FVIII-BDD sequence to remove CG dinucleotides (AAV8-pCB1000, co4) compared to the same cassette in which FVIII-BDD was codon-optimized using the GeneArt algorithm and retaining CG dinucleotides. This resulted in a decrease in FVIII expression. FVIII-BDD with co4 codon optimization could produce measurable FVIII activity, in contrast to co2 and co5 codon optimization. Mice that received AAV8-pCB102 (co1 codon optimized FVIII-BDD DNA sequence, see Example 2) were delivered in AAV8 at the same dose of 2 x 10 ¹² vg/kg, using the same dose of LNP ( Example 2, FIG. 2 , AAV8-pCB102) did not produce FVIII activity in hemophilia A mice. This shows that co1 was inferior to the co3 and co4 codon optimized FVIII-BDD sequences in the expression of FVIII after targeted integration into albumin intron 1 in mice.

Example 5 : Expression of FVIII in mice after targeted integration into albumin intron 1 of a donor template encoding synthetic FVIII with 5 N-glycans and alternative codon optimized co4 and co5

To test the effect of different codon optimizations using synthetic FVIII with B domain substitutions, the FVIII-BDD coding sequence lacking the signal peptide was constructed using three codon-optimized DNA sequences denoted co1, co4 and co5. and additionally contained a B domain substitution instead of the B domain. The B domain substitution contained five N-glycan motifs (SEQ ID NO: 343). These coding sequences are flanked on the 5' side by a target site for mALbT1 gRNA, an 18 bp spacer, a splice acceptor and two nucleotides (TG). The TG dinucleotide maintains the correct reading frame after splicing into mouse albumin exon 1. A short polyadenylation signal (sPA) was included at the 3' end of the coding sequence. The synthetic FVIII coding sequences in these three plasmids encode FVIII proteins with identical amino acid sequences, but the coding sequences are encoded by different DNA sequences due to different codon optimizations. These plasmids, designated pCB1007 (co1, SEQ ID NO: 326), pCB1019 (co4, SEQ ID NO: 332) and pCB1020 (co5, SEQ ID NO: 333), were digested by CRISPR/Cas9 cleavage at the target site for mALbT1 gRNA. Their ability to express active FVIII protein after targeted integration into albumin intron 1 mediated was tested in hemophilia A mice.

The experimental protocol was the same as that of Example 1. Plasmid DNAs of plasmids pCB1007, pCB1019 and pCB1029 were purified using the Qiagen Endopre® Maxiprep Kit (Cat. No. 12362) and then diluted in 0.9% saline to a final concentration of 15 μg/mL. Cohorts of hemophilia A mice were injected with 2 mL of diluted plasmid DNA per mouse by HDI. One day later, mice received retroorbital injection of C12-200-based LNPs encapsulating spCas9 mRNA (1 mg/kg body weight) and gRNA mAlbT1 (1 mg/kg body weight). A cohort of 5 hemophilia A mice injected only with LNP encapsulating spCas9 mRNA and mALbT1 gRNA were sacrificed 3 days after administration, and genomic DNA extracted from whole liver was subjected to insertions and deletions at on-target sites within albumin intron 1. was analyzed. The average frequency of insertions and deletions was 52.9%, indicating efficient cleavage at on-target sites in the liver.

6 and 9 days after LNP administration to mice injected with the plasmid, blood samples were taken in sodium citrate by RO bleed (1:9 ratio sodium citrate to blood), and plasma was collected by centrifugation. FVIII activity in plasma was measured using the method set forth in Example 1. The results are summarized in FIG. 5 .

Mean FVIII activity in mice receiving plasmids pCB1007, pCB1019 or pCB1020 was 22.3%, 17.6% and 17.8% of normal on day 6 after LNP administration. Mean FVIII activity in mice receiving plasmids pCB1007, pCB1019 or pCB1020 was 19.7, 14.1 and 14.9% of normal on day 9 after LNP administration. FVIII levels in mice administered the three plasmids were not statistically significantly different at day 6 or day 9 when assessed using a two-sided T-test of equal variance (two-sample equal variance) (p values were all >0.28).

These results show that in the context of a donor template encoding synthetic FVIII with a B domain substitution containing five N-glycan motifs instead of the B domain, codon-optimized co1, co4 and co5 (all of which lack CG dinucleotides) ) produced similar levels of FVIII after targeted integration into albumin intron 1. Thus, there is no obvious advantage for specific codon optimization, and any CpG-free codon optimization (eg, co1, co4 and co5) provides similar levels of synthetic FVIII protein after targeted integration.

Example 6 : Combination of B domain substitution and F309 to S or A mutation

It has been reported that a point mutation (F309S) in a potential binding site for a chaperone immunoglobulin binding protein (BiP) in the A1 domain improved the secretion of B domain-deleted FVIII in cells in culture approximately 3-fold (M (Swaroop et al., J Biol Chem (1997) 272 :24121-24]). The F309A mutant protein of FVIII had similarly improved secretion. The combination of F309S and the 226 amino acid N-terminal portion of the B domain improved FVIII levels in vivo in mice 20-30 fold compared to B domain deleted FVIII, while the addition of the 226 amino acid N-terminal portion of the B domain Only a 5-fold improvement in FVIII levels has been reported (HZ Miao et al., Blood (2004) 103 (9):3412-19).

To evaluate whether the combination of B domain substitutions with substitution of the phenylalanine residue of 309 with serine or alanine results in further improvement of FVIII expression after targeted integration, plasmids pCB1025 (SEQ ID NO: 334) and pCB1026 (SEQ ID NO: 334) ID NO: 335) was constructed. Both plasmids contained a co4 codon optimized FVIII DNA sequence with a B domain substitution containing five N-linked glycosylation sites. The plasmid had the following elements: pUC19 plasmid backbone | Target site for gRNA mALbT1 | 18 bp spacer | Splice Grants (SA) | TG dinucleotide | FVIII sequence with 5 site B domain substitutions (co4) | Poly A (sPA). Plasmid pCB1007 was identical to pCB1025 and pCB1026, except that pCB1025 had Ala instead of Phe at position 309 and pCB1026 had Ser instead of Phe at position 309. Plasmid pCB1007 was used as comparator in the study.

The experimental protocol was the same as that of Example 1. Plasmids pCB1007, pCB1025 and pCB1026 were purified using the Qiagen Endopre® Maxiprep Kit (Cat. No. 12362) and then diluted in 0.9% saline to a final concentration of 15 μg/mL. Cohorts of hemophilia A mice were injected with 2 mL of diluted plasmid DNA per mouse by HDI. One day later, mice received RO injections of C12-200-based LNPs encapsulating spCas9 mRNA (1 mg/kg) and gRNA mAlbT1 (1 mg/kg). After 5 days of LNP administration (pCB1025, pCB1026) or 6 days after LNP administration (pCB1019), blood samples were taken in sodium citrate by RO bleed (1:9 ratio sodium citrate to blood), and plasma was centrifuged collected. FVIII activity in plasma was measured using the method set forth in Example 1. FVIII activity was similar in the three groups of mice injected with pCB1019, pCB1025 or pCB1026, and the mean FVIII activity was 17.6%, 27.2% and 24.5%, respectively.

Blood FVIII activity of the same hemophilia A mice was also assayed on day 9 post LNP (pCB1019 injected mice) or 7 days post LNP (pCB1025 and pCB1026 injected mice). Mice were then sacrificed, whole livers prepared and analyzed for integration frequency as described in Example 1 above. Targeted integration frequencies were similar between the three groups, with mean frequencies of 0.42 for pCB1019 injected mice, 0.47 for pCB1025 injected mice and 0.36 for pCB1026 injected mice.

Normalization of each mouse's blood FVIII level to the integration frequency provides a measure of the efficiency of intrinsic expression of the FVIII coding sequence. The mean of the ratio of FVIII levels divided by the targeted integration frequency was 37.4 for pCB1019 injected mice, 41.5 for pCB1025 injected mice and 49.9 for pCB1026 injected mice. The difference in FVIII activity normalized to targeted integration in pCB1025 and pCB1026 injected mice compared to pCB1019 injected mice was not statistically significant (two-tailed Student's T-test), indicating that (5 N instead of B domain) -in the context of the FVIII-BDD cassette containing a glycan motif) shows that the change from amino acid F309 to serine or alanine did not improve FVIII expression. Thus, any amino acid changes made to the FVIII protein have no effect on FVIII expression after targeted integration into albumin intron 1.

Example 7 : Targeted Integration of Synthetic FVIII into Transferrin Intron 1 by CRISPR/Cas Nucleases Results in Therapeutic Levels of Expression of Human FVIII

DNA construct

To test integration into and expression from the transferrin locus, as an alternative to the albumin locus, the human FVIII donor cassette (SEQ ID NO: 224) was constructed using the following sequence elements in 5' to 3' order: were: inverted terminal repeat (ITR) of AAV2 | Target site for gRNA mTF-T2 | 18 bp spacer | Splice Grants | sequence encoding the last 4 amino acids of the signal peptide of mouse transferrin (ggctgtgtctggct, SEQ ID NO: 225) | Synthetic FVIII Coding Sequence | polyadenylation signal (spA) | Target site for gRNA mTF-T2 | Inverted terminal repeat (ITR) of AAV2. The sequence of the target site for the gRNA mTF-T2 was the reverse complement of the target sequence in the mouse genome, which may favor integration in the forward orientation. The polyadenylation signal is a short 49 bp sequence that has been reported to induce polyadenylation efficiently (N. Levitt et al., Genes Dev (1989) 3 :1019-25). The synthetic FVIII coding sequence encoded a B domain substitution containing the amino acid sequence SFSQN ATNVSNNSNTSNDSNVS PPVLKRHQR (SEQ ID NO: 226) in place of the B domain and comprised a heterologous 31 amino acid sequence replacing the B domain. This sequence contains 6 tripeptides corresponding to N-linked glycosylation sites (in bold) and has been shown to improve expression of FVIII (J. McIntosh et al., Blood (2013) 121 : 3335-44]).

Packaging of pCB1009 FVIII donor DNA into AAV8 was achieved using established viral packaging methods in HEK293 cells transfected with three plasmids, one plasmid encoding the AAV packaging protein and the second plasmid encoding an adenovirus helper protein. , and the third plasmid contained the FVIII donor DNA sequence flanked by the AAV ITR sequence. The transfected cells give rise to AAV particles of a serotype specified by the composition of the AAV capsid protein encoded on the first plasmid. These AAV particles were collected from cell supernatant or supernatant and lysed cells and purified over a CsCl gradient. Purified viral particles were quantified by determining the number of genomic copies of donor DNA by digital droplet PCR (DD-PCR).

In vivo testing of constructs

A cohort of 5 hemophilia A mice was injected intravenously (iv) into the tail vein with AAV8-pCB1009 at a dose of 2 x 10 ¹² vg/kg body weight. AAV8 virus preferentially transduces hepatocytes. After 4 weeks, the same mice were injected intravenously with a 1:1 (by mass of RNA) mixture of two LNPs at a total RNA dose of 2 mg/kg body weight, one encapsulating spCas9 mRNA and one guide Encapsulates RNA mTF-T2. LNP is mainly taken up by hepatocytes. Ten days after LNP administration, blood samples were obtained and assayed as described above. FVIII activity averaged 954% (± 251%) of normal human FVIII levels ( FIG. 6 ), which is equivalent to 9.54 IU/mL or 9.5-fold greater than the mean level in humans without hemophilia. Naïve hemophilia A mice had undetectable FVIII activity (less than 0.5% of normal).

These data show that the targeting of integration of the FVIII coding sequence into intron 1 of transferrin can result in high levels of FVIII expression and activity, which can be used to treat diseases with defective FVIII, such as hemophilia A. demonstrates the usefulness of the method.

Example 8 : Additional delivery method

In another example, the donor template is delivered in vivo using a non-viral LNP delivery system. DNA molecules are encapsulated into LNP particles similar to those described above and delivered to the liver by intravenous injection. Although endosome to cytoplasmic DNA evasion occurs relatively efficiently, translocation of large charged DNA molecules into the nucleus is not. In one case, delivery of DNA to the nucleus is improved by mimicking the AAV genome by incorporating an AAV ITR sequence into a donor template. In this case, the ITR sequence stabilizes the DNA or otherwise improves nuclear translocation. Removal of CG dinucleotides (CpG sequences) from the donor template sequence also improves nuclear delivery. DNA containing CG dinucleotides is recognized and cleared by the innate immune system. By removal of the CpG sequence present in the artificial DNA sequence, the persistence of DNA delivered by non-viral and viral vectors is improved. The codon optimization process generally increases the content of CG dinucleotides, since in many cases the most frequent codons have a C residue in position 3, which reduces the chance of generating a CG if the next codon starts with a G. because it increases The combination of LNP containing gRNA and Cas9 mRNA is evaluated in hemophilia A mice 1 hour to 5 days following LNP delivery of the donor template.

Delivery of gRNA and Cas9 mRNA in vivo can be accomplished by known methods. In one method, the gRNA and Cas9 protein are expressed from an AAV viral vector. In this case, transcription of the gRNA is driven by the U6 promoter and Cas9 mRNA transcription is driven by a ubiquitous promoter such as EF1-alpha or a liver specific promoter/enhancer such as the transthyretin promoter/enhancer. The size of the spCas9 coding sequence (4.4 Kb) precludes inclusion of spCas9 and gRNA cassettes within a single AAV, thereby requiring separate AAVs to deliver gRNA and spCas9. In the second case, AAV vectors with sequence elements that promote self-inactivation of the viral genome are used. In this case, the inclusion of a cleavage site for the gRNA in the vector DNA results in cleavage of the vector DNA in vivo. Cas9 expression is restricted to a shorter period by including a cleavage site in a position that blocks expression of Cas9 when cleaved. In a third case, a non-viral delivery method, an alternative approach for delivering gRNA and Cas9 to cells in vivo, is used. In one example, LNP is used as a non-viral delivery method. Several different ionizable cationic lipids are available for use in LNPs. These include, among others, C12-200, MC3, LN16 and MD1. In one type of LNP, a GalNac moiety is attached to the outside of the LNP and acts as a ligand for uptake into the liver via the asialoglycoprotein receptor. Either of these cationic lipids is used to formulate LNPs for delivery of gRNA and Cas9 mRNA to the liver.

Example 9 : Targeted Integration of Therapeutic Coding Sequences in Mouse Fibrinogen Alpha Intron 1

To test integration into and expression from the fibrinogen alpha locus, as an alternative to the albumin or transferrin loci, an AAV8 virus (AAV8-pCB1010, SEQ ID NO: 361) was constructed with a cassette with the following elements: gRNA Target site for mFGA-T6, 18 bp spacer, FIX splice acceptor, mature human FVIII coding sequence in which the B domain is replaced by 6 N-glycan motifs (FGA signal peptide after splicing to endogenous FGA exon 1) (with the N-terminus modified to complete

Hemophilia A mice were injected with AAV8-pCB1010, followed by injection of LNP encapsulating T6 gRNA (targeting mouse fibrinogen alpha intron 1) and Cas9 mRNA 28 days later. Ten days after administration of LNP, blood samples were taken into capillaries containing sodium citrate by retroorbital bleed (sodium citrate to blood in a 1:9 ratio), and plasma was collected by centrifugation. Plasma samples were then assayed for FVIII as described above. Assay results were reported as a percentage of normal human FVIII activity (normal is defined as 1 IU/mL). FVIII activity averaged 1124% (± 527%) of normal human FVIII levels, which is equivalent to 11.24 IU/mL or 11-fold greater than the mean level in humans without hemophilia. Naïve hemophilia A mice had undetectable FVIII activity (less than 0.5% of normal). Since the AAV8-pCB1010 virus contains the FVIII cassette, in which the coding sequence lacks a signal peptide and also lacks a promoter, this virus alone cannot give rise to a secreted FVIII protein.

These data show the suitability of fibrinogen as a site for insertion of a coding sequence. Additionally, they show that using the B domain substituted FVIII sequence, useful amounts of FVIII can be expressed. Accordingly, such constructs and methods can be used to treat disorders associated with defective FVIII.

Example 10 : Identification and Selection of Guide RNAs that Efficiently Cleave Human Albumin Intron 1 in Primary Human Hepatocytes in Culture

To demonstrate the operation of the system of the present invention in human hepatocytes, based on screening for cleavage efficiency in HuH7 and HepG2 cells, with perfect identity between humans and non-human primates for evaluation of cleavage efficiency in primary human hepatocytes. Thus, four gRNAs (T4 - SEQ ID NO: 357, T5 - SEQ ID NO: 358, T11 - SEQ ID NO: 359 and T13 - SEQ ID NO: 360) were prepared. Primary human hepatocytes (obtained from BioIVT) were thawed, transferred to cryoprotected hepatocyte recovery medium (CHRM) (Gibco), pelleted at low speed, and then pre-coated with collagen IV (Corning). In 24-well plates, plated at a density of 0.7x10 ⁶ cells/mL in InVitro GRO™ CP medium (BioIVT) + Torpedo ™ antibiotic mix (BioIVT). Plates were incubated at 37° C. in 5% CO ₂ . After the cells adhered (3 to 4 hours after plating), the apoptotic cells that did not adhere to the plate are washed with fresh warm complete medium, additional medium is added, and the cells are incubated at 37° C. in 5% CO ₂ . made it To transfect cells, Cas9 mRNA (Trilink) and guide RNA were thawed on ice and then added to 30 μL of Opti-Mem™ medium (Zipco) at 0.6 μg mRNA and 0.2 μg guide RNA per well. . MessengerMax™ (Thermo Fisher) diluted in 30 μL of Opti-Mem™ at a volume of 2:1 relative to total nucleic acid weight was incubated with the Cas9 mRNA/gRNA Opti-Mem™ solution for 20 minutes at room temperature. This mixture was added dropwise to 500 μL of hepatocyte plating medium per well of cultured hepatocytes in a 24-well plate, and the cells were incubated at 37° C. in 5% CO ₂ . The next morning the cells were washed and re-fed. Cells were collected 48 hours post-transfection for genomic DNA extraction by adding 200 μL of warm 0.25% trypsin-EDTA (Zipco) to each well and incubating at 37° C. for 5-10 minutes. Once cells were removed, trypsin was inactivated by adding 200 μL of FBS (Zipco). After addition of 1 mL of PBS (Zipco), cells were pelleted at 1200 rpm for 3 min and then resuspended in 50 μL of PBS. Genomic DNA was extracted using the MagMAX™ DNA Multi-Sample Ultra 2.0 kit (Applied Biosytems) according to the kit instructions. Genomic DNA quality and concentration was analyzed using a spectrophotometer. For TIDE analysis, genomic DNA was subjected to Platinum ® PCR SuperMix High Fidelity (Invitrogen™) and predicted on-target cleavage sites using 35 cycles of PCR and an annealing time of 55°C. PCR amplification was performed using flanking primers (AlbF: CCCTCCGTTTGTCCTAGCTTTTC, SEQ ID NO: 353 and AlbR: CCAGATACAGAATATCTTCCTCAACGCAGA, SEQ ID NO: 354). The PCR product was analyzed by agarose gel electrophoresis to confirm that a product of the correct size (1053 bp) was produced, then purified and primers (forward: CCTTTGGCACAATGAAGTGG, SEQ ID NO: 355; reverse: GAATCTGAACCCTGATGACAAG, SEQ ID NO: 356) was used for sequencing. Sequence data were analyzed using a modified version of the TIDES algorithm referred to as Tsunami (EK Brinkman et al., Nuc Acids Res (2014) 42 (22):e168), whereby the gRNA/Cas9 complex The frequency of insertions and deletions present at the predicted cleavage site for the cleavage is determined.

20 nucleotide target sequence of T4 (SEQ ID NO: 357), T5 (SEQ ID NO: 358), T11 (SEQ ID NO: 359) and T13 (SEQ ID NO: 360) guides or (1 bp at the 5' end) Guide RNAs containing any of the shorter) 19 nucleotide target sequences were tested. A 19 nucleotide gRNA may be more sequence specific, but shorter guides may have lower potency (efficiency of double-stranded cleavage measured as insertions and deletions). Control guides targeting human complement factor and human AAVS1 locus were included for comparison between donors. The frequency of insertions and deletions at target sites in albumin intron 1 was determined 48 hours after transfection using the TIDES method. 7 summarizes the results from transfection of primary hepatocytes from four different human donors.

The results demonstrate cutting efficiencies ranging from 20% to 80% for different guides. The 20 nucleotide version of each albumin gRNA was consistently more potent than the 19 nucleotide variant. The superior potency of a 20 nucleotide gRNA could counteract any possible benefit that a 19 nucleotide gRNA might have with respect to lower off-target cleavage. Guide RNA T4 exhibited the most persistent cleavage among the four cell donors, with insertion and deletion frequencies of approximately 60%.

Example 11 : FVIII expression from a single LNP dose with an AAV8 virus encapsulating a codon-optimized FVIII coding sequence (without CpG) with B-domain substitutions composed of a different number of N-glycans followed by a gRNA targeting the transferrin locus evaluation of

This study evaluated FVIII expression from AAV8 virus encoding FVIII in which the B-domain substitutions contained 0, 1, 3, 5 or 6 glycans. The FVIII coding sequence was codon optimized and then CpG was removed manually. The construct used in this study is shown in FIG. 9 .

On day 0, mice with hemophilia A (8-10 weeks old) were administered each virus by tail vein injection. On day 28, hemophilia A mice were retroorbitally injected with lipid nanoparticles (LNPs) encapsulating Cas9 mRNA (411 μg/ml) and guide RNA mTF-T2 (379 μg/ml). Study groups and doses are shown in Table 7.

[Table 7] Study group and dose

After 11 days of LNP administration, blood samples were obtained and assayed as described above. Then, 18 days after LNP dosing, blood samples were obtained via a final cardiac draw and assayed as described above.

FVIII activity levels measured on day 11 are shown in FIG. 10 . FVIII activity levels measured on day 18 are shown in FIG. 11 . FVIII activity levels are provided in Tables 8 and 9.

Table 8: FVIII activity level at day 11

Table 9 FVIII activity level at day 18

After sacrificing the mice, whole livers were homogenized and whole genomic DNA was extracted from a portion of liver lysates. The frequency of targeted integration into albumin intron 1 in forward orientation was quantified using the DD-PCR assay described in Example 1. The results are shown in Figure 12 and Table 10.

Table 10: FVIII Targeted Integration Frequency

These data show that FVIII coding sequences containing 0, 1, 3, 5 or 6 glycans can result in high levels of FVIII expression and activity, which is a disease with defective FVIII, such as hemophilia A shows the usefulness of this method for treating

Although the present disclosure has been described in some length and with some detail in connection with several described embodiments, it is not intended to be limited to any such specific point or embodiment or to any particular embodiment, and is, in view of the prior art, provides the broadest possible interpretation of these claims, and therefore should be construed with reference to the appended claims so as to effectively encompass the intended scope of the present disclosure.

sequence list

In addition to sequences disclosed elsewhere in this disclosure, the following sequences are provided as they are referred to or used in exemplary embodiments of the present disclosure, and are provided for purposes of illustration.

SEQUENCE LISTING <110> CRISPR THERAPEUTICS AG BAYER HEALTHCARE LLC <120> GENE EDITING FOR HEMOPHILIA A WITH IMPROVED FACTOR VIII EXPRESSION <130> 105965-655734-021US1 <140> 16/849,796 <141> 2020-04-15 <150> 62/806,702 <151> 2019-02-15 <150> 62/857,782 <151> 2019-06-05 <160> 373 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T12 gRNA spacer <400> 1 aaggaagcgg tgccatcgag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T168 gRNA spacer <400> 2 aacttctgcc tgccattcat 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T73 gRNA spacer <400> 3 agcaaagggt tttgataacc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T99 gRNA spacer <400> 4 ttgcctggga gggtcaaatg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T26 gRNA spacer <400> 5 ggcttggcca acgacaagca 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T111 gRNA spacer <400> 6 ccttgtgggc caccacagca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T76 gRNA spacer <400> 7 gggcccactc cctatgctga 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T128 gRNA spacer <400> 8 tctgagtctg agccaataga 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T188 gRNA spacer <400> 9 cctgcctcca gagttcccat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T151 gRNA spacer <400> 10 acagctctcc aggatgcatg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T67 gRNA spacer <400> 11 ggcccatggg aaatcctagg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T138 gRNA spacer <400> 12 agggtggtca gtaggaaact 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T115 gRNA spacer <400> 13 ccttgctgtg gtggcccaca 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T45 gRNA spacer <400> 14 ggtagcaagc caatgtgttg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T180 gRNA spacer <400> 15 gcagattgtc atctccagct 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T148 gRNA spacer <400> 16 ccacagcaag gctgactcac 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T100 gRNA spacer <400> 17 actgaggctt atgttccat 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T66 gRNA spacer <400> 18 gggcaaaagc tcatgtgata 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T162 gRNA spacer <400> 19 atactgaggc ttatgttcca 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T175 gRNA spacer <400> 20 ccagtgagtc agccttgctg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T172 gRNA spacer <400> 21 ggatttccca tgggccaaga 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T104 gRNA spacer <400> 22 gggtcaaatg agggtcagcg 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T19 gRNA spacer <400> 23 tcaactatgg aaaaccagcg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T77 gRNA spacer <400> 24 cataagcctc agtatgcaca 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T62 gRNA spacer <400> 25 tatgttccat ggggggccag 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T106 gRNA spacer <400> 26 agggcccact ccctatgctg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T163 gRNA spacer <400> 27 gctgtgggcc tcctctccac 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T134 gRNA spacer <400> 28 acaaatgccc catgaatggc 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T167 gRNA spacer <400> 29 gtggctgtca aggcctttct 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T61 gRNA spacer <400> 30 tcctgtccat gaacactaca 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T6 gRNA spacer <400> 31 agacagcatc gcccctagaa 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T44 gRNA spacer <400> 32 ccttcttggc cagtagttga 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T3 gRNA spacer <400> 33 aaggtcaccc tgcttgtcgt 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T68 gRNA spacer <400> 34 gagggaaaat gggggtcgct 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T103 gRNA spacer <400> 35 taggaggcaa cataagcctg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T81 gRNA spacer <400> 36 aaaacgccct gtgcatactg 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T146 gRNA spacer <400> 37 gtgagtcagc cttgctgtgg 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T63 gRNA spacer <400> 38 ggctgtcaag gcctttctag 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T87 gRNA spacer <400> 39 aggtagcaag ccaatgtgtt 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T184 gRNA spacer <400> 40 gattgtcatc tccagctggg 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T116 gRNA spacer <400> 41 tcctggccgg ctcctcacca 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T24 gRNA spacer <400> 42 attctcgcct atgggaactc 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T21 gRNA spacer <400> 43 tggcttggcc aacgacaagc 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T41 gRNA spacer <400> 44 ttggcttgct acctcaacta 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T55 gRNA spacer <400> 45 gaggtagcaa gccaatgtgt 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T90 gRNA spacer <400> 46 aggagacaag gcggatacag 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T101 gRNA spacer <400> 47 gactctgggt ctgctactca 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T39 gRNA spacer <400> 48 ccgctggttt tccatagttg 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T150 gRNA spacer <400> 49 cctcaactat ggaaaaccag 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T156 gRNA spacer <400> 50 tggattttaa tagttaccca 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T40 gRNA spacer <400> 51 ggggataaag gcaagtaacg 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T8 gRNA spacer <400> 52 ccgggttgca gggaacgcgc 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T53 gRNA spacer <400> 53 cgcgcgggcc agcgactctg 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T117 gRNA spacer <400> 54 ctgaggctta tgttccatgg 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T49 gRNA spacer <400> 55 cggagtgcat gcaggctgcg 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T83 gRNA spacer <400> 56 acaggcttat gttgcctcct 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T64 gRNA spacer <400> 57 gggcatttgt cacactgttg 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T120 gRNA spacer <400> 58 tggcccctcc tcatgcatcc 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T161 gRNA spacer <400> 59 aaaatggagg gatagttcag 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T183 gRNA spacer <400> 60 tgtgacaaat gccccatgaa 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T182 gRNA spacer <400> 61 gtggtcagta ggaaactggg 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T119 gRNA spacer <400> 62 tgaggcttat gttccatggg 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T18 gRNA spacer <400> 63 gggataaagg caagtaacgt 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T107 gRNA spacer <400> 64 agggcaaaag ctcatgtgat 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T20 gRNA spacer <400> 65 gccatcgagc ggtcagagca 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T80 gRNA spacer <400> 66 ccctcaacta ctggccaaga 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T133 gRNA spacer <400> 67 cctcaactac tggccaagaa 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T84 gRNA spacer <400> 68 gagggtggtc agtaggaaac 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T85 gRNA spacer <400> 69 gtcgctgggg tggccatccc 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T143 gRNA spacer <400> 70 tggggagaga aaactaaacg 20 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T15 gRNA spacer <400> 71 cctgagcgcg gagtgcatgc 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T96 gRNA spacer <400> 72 gcgaccccca ttttccctct 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T118 gRNA spacer <400> 73 ctcaactatg gaaaaccagc 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T152 gRNA spacer <400> 74 gatccacaaa gcctgtggag 20 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T38 gRNA spacer <400> 75 ccccgcacag agcacttcac 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T132 gRNA spacer <400> 76 tgcaaggtaa tgctccactg 20 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T149 gRNA spacer <400> 77 aggggacgtc agcctctgaa 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T171 gRNA spacer <400> 78 agggaaaatg ggggtcgctg 20 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T30 gRNA spacer <400> 79 tgaggacaca ttctcgccta 20 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T71 gRNA spacer <400> 80 tgcctcctag gatttcccat 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T158 gRNA spacer <400> 81 cttggcccat gggaaatcct 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T36 gRNA spacer <400> 82 aggagttcgg acttgacaag 20 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T27 gRNA spacer <400> 83 acataagcct cagtatgcac 20 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T130 gRNA spacer <400> 84 caggacatct acagctccca 20 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T124 gRNA spacer <400> 85 gggccccacc tcaggaggtc 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T185 gRNA spacer <400> 86 aacgacaagc agggtgacct 20 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T79 gRNA spacer <400> 87 gcaggacatc tacagctccc 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T72 gRNA spacer <400> 88 cctgtgaagt gctctgtgcg 20 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T179 gRNA spacer <400> 89 tgcctgggag ggtcaaatga 20 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T170 gRNA spacer <400> 90 tggccatgcc tgcacccctc 20 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T181 gRNA spacer <400> 91 gccagcagag ggtggtcagt 20 <210> 92 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T42 gRNA spacer <400> 92 ctcctgtcca tgaacactac 20 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T114 gRNA spacer <400> 93 ggagtgggcc cttccacctc 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T23 gRNA spacer <400> 94 caactatgga aaaccagcgg 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T144 gRNA spacer <400> 95 tactgaggct tatgttccat 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T1 gRNA spacer <400> 96 cccatgctct gaccgctcga 20 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T186 gRNA spacer <400> 97 ctccccgacc tcctgaggtg 20 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T58 gRNA spacer <400> 98 ggggaatggt cagaccgggg 20 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T113 gRNA spacer <400> 99 cttgtgccct gtagtgttca 20 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T29 gRNA spacer <400> 100 cccgcgcgtt ccctgcaacc 20 <210> 101 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T2 gRNA spacer <400> 101 ccatcgagcg gtcagagcat 20 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T48 gRNA spacer <400> 102 gccctgtagt gttcatggac 20 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T17 gRNA spacer <400> 103 aaatcagagc acgtctaacc 20 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T153 gRNA spacer <400> 104 gcctgtgaag tgctctgtgc 20 <210> 105 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T60 gRNA spacer <400> 105 ctcgcctatg ggaactctgg 20 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T164 gRNA spacer <400> 106 ggccccacct caggaggtcg 20 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T47 gRNA spacer <400> 107 ccgcgcgttc cctgcaaccc 20 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T110 gRNA spacer <400> 108 tggctgtcaa ggcctttcta 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T177 gRNA spacer <400> 109 tggcagatgc tgagtaccag 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T13 gRNA spacer <400> 110 gttaatttac cctcaactac 20 <210> 111 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T7 gRNA spacer <400> 111 cctgcatgca ctccgcgctc 20 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T89 gRNA spacer <400> 112 gaccctcatt tgaccctccc 20 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T16 gRNA spacer <400> 113 ccattagggc aaccttctat 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T155 gRNA spacer <400> 114 atgcatgagg aggggccacc 20 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T108 gRNA spacer <400> 115 gtcagccact gccccatagc 20 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T160 gRNA spacer <400> 116 cctatgggaa ctctggaggc 20 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T139 gRNA spacer <400> 117 acttctgcct gccattcatg 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T11 gRNA spacer <400> 118 cggtggccgc ccgggttgca 20 <210> 119 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T169 gRNA spacer <400> 119 ggggacgtca gcctctgaaa 20 <210> 120 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T5 gRNA spacer <400> 120 gaggacacat tctcgcctat 20 <210> 121 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T131 gRNA spacer <400> 121 gcatggcatt caaggcctcc 20 <210> 122 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T22 gRNA spacer <400> 122 catcgagcgg tcagagcatg 20 <210> 123 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T126 gRNA spacer <400> 123 ctcaactact ggccaagaag 20 <210> 124 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T145 gRNA spacer <400> 124 ctgtggtggc ccacaaggag 20 <210> 125 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T187 gRNA spacer <400> 125 tctgctggcc agaggggtgc 20 <210> 126 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T112 gRNA spacer <400> 126 aggcgagaat gtgtcctcag 20 <210> 127 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T14 gRNA spacer <400> 127 gctcgatggc accgcttcct 20 <210> 128 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T70 gRNA spacer <400> 128 gtcctggccg gctcctcacc 20 <210> 129 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T57 gRNA spacer <400> 129 tttcagctac cccaacacat 20 <210> 130 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T4 gRNA spacer <400> 130 gggtagcacc gcagagtcgc 20 <210> 131 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T92 gRNA spacer <400> 131 cccttcttgg ccagtagttg 20 <210> 132 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T102 gRNA spacer <400> 132 aaaggggaat ggtcagaccc 20 <210> 133 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T159 gRNA spacer <400> 133 agctagcaat tccttgagag 20 <210> 134 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T10 gRNA spacer <400> 134 catgcactcc gcgctcaggc 20 <210> 135 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T157 gRNA spacer <400> 135 ttgcctccta ggatttccca 20 <210> 136 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T173 gRNA spacer <400> 136 catcacagca cttgcctggg 20 <210> 137 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T121 gRNA spacer <400> 137 tgatgacccc ctccctggtg 20 <210> 138 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T137 gRNA spacer <400> 138 agcagattgt catctccagc 20 <210> 139 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T98 gRNA spacer <400> 139 tcaaatgagg gtcagcgagg 20 <210> 140 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T141 gRNA spacer <400> 140 tggccggctc ctcaccaggg 20 <210> 141 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T50 gRNA spacer <400> 141 gatggcaatt cctccccccgc 20 <210> 142 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T94 gRNA spacer <400> 142 caaggaattg ctagcttatg 20 <210> 143 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T86 gRNA spacer <400> 143 taacgtgggg tcctctctca 20 <210> 144 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T35 gRNA spacer <400> 144 agtgctctgt gcggggataa 20 <210> 145 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T174 gRNA spacer <400> 145 cattttccct cttggcccat 20 <210> 146 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T97 gRNA spacer <400> 146 ttcactgctg caagattac 20 <210> 147 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T127 gRNA spacer <400> 147 gtgaggagcc ggccaggact 20 <210> 148 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T56 gRNA spacer <400> 148 atgttgcaca catcctgcta 20 <210> 149 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T65 gRNA spacer <400> 149 tcaaggaatt gctagcttat 20 <210> 150 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T123 gRNA spacer <400> 150 tcttggatcc aagtcctggc 20 <210> 151 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T59 gRNA spacer <400> 151 ttctgagtta caccccttct 20 <210> 152 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T129 gRNA spacer <400> 152 ttcagaggct gacgtcccct 20 <210> 153 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T9 gRNA spacer <400> 153 ccaatagaag gttgccctaa 20 <210> 154 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T122 gRNA spacer <400> 154 cactccccga cctcctgagg 20 <210> 155 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T31 gRNA spacer <400> 155 cgcgttccct gcaacccggg 20 <210> 156 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T28 gRNA spacer <400> 156 gatggcaccg cttccttggc 20 <210> 157 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T43 gRNA spacer <400> 157 tatgaagggg gccccacctc 20 <210> 158 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T125 gRNA spacer <400> 158 tgctgtgatg accccctccc 20 <210> 159 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T165 gRNA spacer <400> 159 cacatcctgc tatggggcag 20 <210> 160 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T82 gRNA spacer <400> 160 aggctgcgcg gtggccgccc 20 <210> 161 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T109 gRNA spacer <400> 161 tggggcattt gtcacactgt 20 <210> 162 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T52 gRNA spacer <400> 162 ctcaaggaat tgctagctta 20 <210> 163 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T34 gRNA spacer <400> 163 ctatggaaaa ccagcggggg 20 <210> 164 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T88 gRNA spacer <400> 164 tgttgcacac atcctgctat 20 <210> 165 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T51 gRNA spacer <400> 165 agagggaaaa tgggggtcgc 20 <210> 166 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T46 gRNA spacer <400> 166 cttatgttcc atggggggcc 20 <210> 167 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T178 gRNA spacer <400> 167 tctgaccatt cccctttcag 20 <210> 168 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T74 gRNA spacer <400> 168 ggggcatttg tcacactgtt 20 <210> 169 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T176 gRNA spacer <400> 169 ccgcgctcag gctggaagcc 20 <210> 170 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T54 gRNA spacer <400> 170 gcggtggccg cccgggttgc 20 <210> 171 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T32 gRNA spacer <400> 171 tgcttgtcgt tggccaagcc 20 <210> 172 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T136 gRNA spacer <400> 172 tccctggtga ggagccggcc 20 <210> 173 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T78 gRNA spacer <400> 173 ttatgttcca tggggggcca 20 <210> 174 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T154 gRNA spacer <400> 174 ttttaatagt tacccatggc 20 <210> 175 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T140 gRNA spacer <400> 175 ccaggcttcc agcctgagcg 20 <210> 176 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T93 gRNA spacer <400> 176 caggctgcgc ggtggccgcc 20 <210> 177 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T95 gRNA spacer <400> 177 atgtgtgcaa catctgccac 20 <210> 178 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T37 gRNA spacer <400> 178 agtgcatgca ggctgcgcgg 20 <210> 179 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T91 gRNA spacer <400> 179 actccccgac ctcctgaggt 20 <210> 180 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T166 gRNA spacer <400> 180 gaaaggggaa tggtcagacc 20 <210> 181 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T105 gRNA spacer <400> 181 cgcgctcagg ctggaagcct 20 <210> 182 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T142 gRNA spacer <400> 182 gtgtctagaa gcccaagcaa 20 <210> 183 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T25 gRNA spacer <400> 183 cccgggttgc agggaacgcg 20 <210> 184 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T135 gRNA spacer <400> 184 tttcagaggc tgacgtcccc 20 <210> 185 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T69 gRNA spacer <400> 185 gagctgtaga tgtcctgcca 20 <210> 186 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T147 gRNA spacer <400> 186 gggtcatcac agcacttgcc 20 <210> 187 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T33 gRNA spacer <400> 187 ggataaaggc aagtaacgtg 20 <210> 188 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Transferrin_T75 gRNA spacer <400> 188 tctccctcag catagggagt 20 <210> 189 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> mTF-T1 gRNA spacer <400> 189 taacaagcaa gacccgtcgc 20 <210> 190 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> mTF-T2 gRNA spacer <400> 190 gagaacgcac cactttacga 20 <210> 191 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> n is a, t, c, or g <220> <221> misc_feature <223> r is g or a <220> <221> misc_feature <223> Example target seq. with S. pyogenes Cas9 PAM <220> <221> misc_feature <222> (1)..(21) <223> n is a, c, g, or t <400> 191 nnnnnnnnnn nnnnnnnnnn nrg 23 <210> 192 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T61 gRNA spacer <400> 192 gattaaggag agcagacaca 20 <210> 193 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T30 gRNA spacer <400> 193 gagagtgtac aaactcacaa 20 <210> 194 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T57 gRNA spacer <400> 194 tatcttcaaa tggaaatcct 20 <210> 195 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T11 gRNA spacer <400> 195 accaaggctt tataggtaca 20 <210> 196 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T26 gRNA spacer <400> 196 ggcctgggag gaaatttcct 20 <210> 197 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T33 gRNA spacer <400> 197 ttattccaca aagagcctgg 20 <210> 198 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T20 gRNA spacer <400> 198 cttgacacct caagaataca 20 <210> 199 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T24 gRNA spacer <400> 199 atctcttcct ggggacttgt 20 <210> 200 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T27 gRNA spacer <400> 200 cacccaggaa atttcctccc 20 <210> 201 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T48 gRNA spacer <400> 201 aggcctggga ggaaatttcc 20 <210> 202 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T8 gRNA spacer <400> 202 actagcatta taatgcacca 20 <210> 203 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T56 gRNA spacer <400> 203 tacaagtccc caggaagaga 20 <210> 204 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T19 gRNA spacer <400> 204 tggcactctc acagagatta 20 <210> 205 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T67 gRNA spacer <400> 205 ttagccagaa gaggagacag 20 <210> 206 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T41 gRNA spacer <400> 206 gagagtgcca tctcttcctg 20 <210> 207 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T18 gRNA spacer <400> 207 gtgagagtgc catctcttcc 20 <210> 208 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T45 gRNA spacer <400> 208 agattaagga gagcagacac 20 <210> 209 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T66 gRNA spacer <400> 209 ggagttgtta tgagaattaa 20 <210> 210 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T4 gRNA spacer <400> 210 tggcatgcct acaagtcccc 20 <210> 211 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T5 gRNA spacer <400> 211 ttgaggtgtc aagcccaccc 20 <210> 212 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T69 gRNA spacer <400> 212 tatgagaatt aaaggagaca 20 <210> 213 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T54 gRNA spacer <400> 213 ggagagcaga cacagggctt 20 <210> 214 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T42 gRNA spacer <400> 214 tctgacctcc aggctctttg 20 <210> 215 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T23 gRNA spacer <400> 215 gcaggtagac tctgacctcc 20 <210> 216 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T29 gRNA spacer <400> 216 accaagagga agatcttaga 20 <210> 217 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T13 gRNA spacer <400> 217 tctactgaag cagcaattac 20 <210> 218 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T25 gRNA spacer <400> 218 tgagagtgcc atctcttcct 20 <210> 219 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T16 gRNA spacer <400> 219 tcagaagaga ttagttagta 20 <210> 220 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T22 gRNA spacer <400> 220 agtgtgtcag gacatagagc 20 <210> 221 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T44 gRNA spacer <400> 221 acagcaatgt tagccagaag 20 <210> 222 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T14 gRNA spacer <400> 222 aggctttata aggtacaagga 20 <210> 223 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T28 gRNA spacer <400> 223 cagggtaata tgacaccaag 20 <210> 224 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T7 gRNA spacer <400> 224 ataatgcacc aaggctttat 20 <210> 225 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T40 gRNA spacer <400> 225 tccatctaag atcttcctct 20 <210> 226 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T36 gRNA spacer <400> 226 aaatcctagg acccatttta 20 <210> 227 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T15 gRNA spacer <400> 227 acatcagtt aagatagtct 20 <210> 228 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T58 gRNA spacer <400> 228 catgccactg tctcctcttc 20 <210> 229 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T63 gRNA spacer <400> 229 tcataacaac tccataaaat 20 <210> 230 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T55 gRNA spacer <400> 230 ttctatgtaa cctttagaga 20 <210> 231 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T50 gRNA spacer <400> 231 ttaaaagaat accattactg 20 <210> 232 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T21 gRNA spacer <400> 232 catattaccc tgtattcttg 20 <210> 233 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T2 gRNA spacer <400> 233 gcttgacacc tcaagaatac 20 <210> 234 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T60 gRNA spacer <400> 234 aaggttacat agaaacttga 20 <210> 235 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T77 gRNA spacer <400> 235 gcaagaagaa aaaatgaaaa 20 <210> 236 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T10 gRNA spacer <400> 236 actcttagct ttatgacccc 20 <210> 237 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T64 gRNA spacer <400> 237 ctcataacaa ctccataaaa 20 <210> 238 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T3 gRNA spacer <400> 238 aatacgcttt tccgcagtaa 20 <210> 239 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T49 gRNA spacer <400> 239 gaaatttcct cccaggcctg 20 <210> 240 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T46 gRNA spacer <400> 240 ctgggaggaa atttcctggg 20 <210> 241 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T1 gRNA spacer <400> 241 acagggcttc ggcaagcttc 20 <210> 242 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T6 gRNA spacer <400> 242 tccttgtacc tataaagcct 20 <210> 243 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T37 gRNA spacer <400> 243 tgggaggaaa tttcctgggt 20 <210> 244 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T52 gRNA spacer <400> 244 actaaaagtt ctgcttatta 20 <210> 245 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T71 gRNA spacer <400> 245 ataagcattt gataaatatt 20 <210> 246 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T12 gRNA spacer <400> 246 aactccataa aatgggtcct 20 <210> 247 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T47 gRNA spacer <400> 247 aattatgaat ccatctctaa 20 <210> 248 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T43 gRNA spacer <400> 248 gttagtacag ttttgctgaa 20 <210> 249 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T39 gRNA spacer <400> 249 tgagagtgta caaactcaca 20 <210> 250 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T76 gRNA spacer <400> 250 aaacaaaaca aaacaaaatg 20 <210> 251 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T17 gRNA spacer <400> 251 tagctttatg accccaggcc 20 <210> 252 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T38 gRNA spacer <400> 252 tttatgaccc caggcctggg 20 <210> 253 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T51 gRNA spacer <400> 253 aaaagcaaac gaattatctt 20 <210> 254 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T9 gRNA spacer <400> 254 cataaagcta agagtgtgtc 20 <210> 255 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T62 gRNA spacer <400> 255 catagaaact tgaaggagag 20 <210> 256 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T74 gRNA spacer <400> 256 attcaaataa ttttcctttt 20 <210> 257 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T34 gRNA spacer <400> 257 tgcattataa tgctagttaa 20 <210> 258 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T70 gRNA spacer <400> 258 agtcattagt aaaaatgaaa 20 <210> 259 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T31 gRNA spacer <400> 259 tgtttattcc acaaagagcc 20 <210> 260 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T59 gRNA spacer <400> 260 tttaaagaat ccatcctaaa 20 <210> 261 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T72 gRNA spacer <400> 261 taatggaata aaacatttta 20 <210> 262 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T65 gRNA spacer <400> 262 aaataatttt ccttttagga 20 <210> 263 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T79 gRNA spacer <400> 263 gttttgtttt gttttaaaaa 20 <210> 264 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T32 gRNA spacer <400> 264 agctttatga ccccaggcct 20 <210> 265 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T68 gRNA spacer <400> 265 tcaggtttct tatcttcaaa 20 <210> 266 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T75 gRNA spacer <400> 266 agcaagaaga aaaaatgaaa 20 <210> 267 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T78 gRNA spacer <400> 267 tgttttgttt tgttttaaaa 20 <210> 268 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T35 gRNA spacer <400> 268 ggaaatttcc tcccaggcct 20 <210> 269 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T53 gRNA spacer <400> 269 aggaaatttc ctcccaggcc 20 <210> 270 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA Intron 1_T73 gRNA spacer <400> 270 ttttcttctt gctttctctc 20 <210> 271 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T1 <400> 271 taattttctt ttgcgcacta agg 23 <210> 272 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T2 <400> 272 tagtgcaatg gataggtctt tgg 23 <210> 273 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T3 <400> 273 agtgcaatgg ataggtcttt ggg 23 <210> 274 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T4 <400> 274 taaagcatag tgcaatggat agg 23 <210> 275 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T5 <400> 275 atttatgaga tcaacagcac agg 23 <210> 276 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T6 <400> 276 tgattcctac agaaaaactc agg 23 <210> 277 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T7 <400> 277 tgtatttgtg aagtcttaca agg 23 <210> 278 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T8 <400> 278 gactgaaact tcacagaata ggg 23 <210> 279 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T9 <400> 279 aatgcataat ctaagtcaaa tgg 23 <210> 280 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T10 <400> 280 tgactgaaac ttcacagaat agg 23 <210> 281 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T11 <400> 281 ttaaataaag catagtgcaa tgg 23 <210> 282 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T12 <400> 282 gatcaacagc acaggttttg tgg 23 <210> 283 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T13 <400> 283 taataaaatt caaacatcct agg 23 <210> 284 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T14 <400> 284 ttcattttag tctgtcttct tgg 23 <210> 285 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T15 <400> 285 attatctaag tttgaatata agg 23 <210> 286 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T16 <400> 286 atcatcctga gtttttctgt agg 23 <210> 287 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T17 <400> 287 gcatctttaa agaattattt tgg 23 <210> 288 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T18 <400> 288 tactaaaact ttattttact ggg 23 <210> 289 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T19 <400> 289 tgaattattc ttctgtttaa agg 23 <210> 290 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T20 <400> 290 aatttttaaa atagtattct tgg 23 <210> 291 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T21 <400> 291 atgcatttgt ttcaaaatat tgg 23 <210> 292 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T22 <400> 292 tttggcattt atttctaaaa tgg 23 <210> 293 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T23 <400> 293 aaagttgaac aatagaaaaa tgg 23 <210> 294 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T24 <400> 294 ttactaaaac tttattttac tgg 23 <210> 295 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T26 <400> 295 tgcatttgtt tcaaaatatt ggg 23 <210> 296 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T27 <400> 296 tgggcaaggg aagaaaaaaa agg 23 <210> 297 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T28 <400> 297 tcctaggtaa aaaaaaaaaa agg 23 <210> 298 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Human Albumin Intron-1_T25 <400> 298 accttttttt ttttttacct agg 23 <210> 299 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Exemplary gRNA spacer <400> 299 uaauuuucuu uugcgcacua 20 <210> 300 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> N-terminal sequence <400> 300 Asp Ala His Ala Thr Arg Arg Tyr Tyr 1 5 <210> 301 <211> 4402 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> MAB8A <400> 301 aattgctgac ctcttctctt cctcccacag tggccaccag aagatactac ctcggagccg 60 tcgaattgag ctgggattac atgcaatccg acctgggaga actgcccgtg gatgccaggt 120 ttcctcctcg ggtccccaag tccttcccgt tcaacacctc agtcgtctac aagaaaaccc 180 tcttcgtgga gttcaccgac catctgttca acatcgccaa gccaagaccc ccgtggatgg 240 gactcctcgg tccgaccatc caagccgaag tgtacgacac tgtggtcatt accctgaaga 300 acatggcctc ccatcctgtg tccctgcatg cagtgggcgt gtcctactgg aaggcttccg 360 aaggggccga gtacgacgat caaaccagcc agcgggaaaa ggaggatgac aaagtgttcc 420 cgggtggttc gcacacctac gtgtggcaag tgctcaagga gaacggtcct atggcctctg 480 atcccctgtg tctgacctac tcctacctgt cccatgtcga cctcgtgaag gatctgaaca 540 gcgggctgat tggcgccctg ctcgtgtgcc gggaaggctc cctggccaag gaaaagaccc 600 agacactgca caagttcatc ttgctgttcg ccgtgtttga tgagggaaag tcctggcata 660 gcgagactaa gaactccctt atgcaagacc gggatgctgc ctccgctagg gcttggccta 720 agatgcatac tgtgaacgga tacgtgaaca gatccctgcc tggccttatc ggttgccacc 780 ggaagtccgt gtattggcat gtgatcggca tgggaaccac tccagaggtg cactccattt 840 tcttggaggg gcataccttc ttggtgcgca accacagaca ggcctccctg gaaatttctc 900 cgatcacttt cctgactgcc cagaccctcc ttatggacct gggtcagttc ctgctgttct 960 gccacatttc gtccccaccaa cacgatggca tggaagccta cgtgaaagtg gactcgtgcc 1020 cggaagaacc acagctgcgg atgaagaaca acgaagaggc agaggactac gatgatgatc 1080 ttaccgattc ggaaatggat gtggtccgat tcgacgacga taatagccca tccttcatcc 1140 aaattaggag cgtggccaag aagcacccca aaacttgggt gcattacatt gcggccgagg 1200 aagaggattg ggactacgca cccctcgtgc ttgcacccga tgatcggtcc tacaagtccc 1260 aatacctgaa caacggcccg cagaggatcg gtcggaagta taagaaagtg cgcttcatgg 1320 cctacaccga cgagactttc aagaccagag aggccattca gcacgaaagc ggcattctgg 1380 ggccgctgtt gtacggggag gtcggagata cactgctcat cattttcaag aaccaggcgt 1440 ccagacccta caacatctac ccgcacggaa tcactgacgt ccgccccctg tactcccgga 1500 gactcccgaa gggagtcaag cacttgaaag acttccccat cctgcctggg gaaatcttca 1560 agtacaagtg gaccgtgacc gtcgaggatg ggccgaccaa gtccgatcca agatgcctca 1620 ctagatacta ctcatccttc gtcaacatgg aacgggacct ggcctcagga ctgattggcc 1680 ccctgctcat ctgctacaag gagtccgtgg atcagcgcgg aaaccagatc atgtcggaca 1740 aacgcaacgt catcctcttc tccgtctttg acgagaaccg ctcatggtac cttacggaga 1800 acatccagcg gttcctcccc aaccctgccg gagtgcagct cgaggacccg gaattccagg 1860 catcaaacat tatgcactcc atcaacggtt acgtgttcga cagcctccag cttagcgtgt 1920 gcctccatga agtcgcatat tggtacatcc tgtccattgg agcacaaacc gactttctct 1980 ccgtgttctt ctccggatat accttcaagc acaagatggt gtacgaggat accctgaccc 2040 tcttcccctt ctccggagag actgtgttta tgtcgatgga aaacccaggc ctgtggattt 2100 tggggtgcca caactcggat ttccgaaacc ggggcatgac tgccttgctc aaggtgtcct 2160 cctgtgacaa gaacacggga gactactacg aggactccta cgaggatatt tccgcctacc 2220 tcctgtccaa gaacaacgcc atcgaaccca ggtccttcag ccagaaccct cctgtcctca 2280 agcgccatca gagagaaatc acccgcacga ccctgcagtc cgaccaggaa gagatcgatt 2340 acgacgacac tatctccgtc gaaatgaaga aggaggactt tgacatctac gacgaagatg 2400 aaaatcagtc ccctcgctcg ttccaaaaga aaacgagaca ctacttcatc gctgctgtgg 2460 agcggctctg ggactacggc atgtcctcat cgccccacgt gcttaggaac cgggctcaat 2520 ccgggagcgt ccctcagttc aagaaagtgg tgtttcaaga attcaccgat ggaagcttca 2580 cgcagccgtt gtacaggggc gaactgaacg agcaccttgg cctgctggga ccttacatca 2640 gagcagaggt cgaggacaac atcatggtga ccttccggaa ccaagcctcc cggccatatt 2700 cattctactc gagccttatc tcatacgagg aggatcagag acagggggct gaacctcgga 2760 agaacttcgt caagccgaac gagacaaaga cctacttttg gaaggtgcag caccacatgg 2820 ccccgaccaa ggatgagttc gactgcaagg cctgggcgta cttctccgac gtggatctcg 2880 aaaaggacgt gcattccggg ctgatcggac cgctgctcgt ctgccacact aacaccctca 2940 atcctgctca cggcagacaa gtgaccgtgc aggagttcgc cctgttcttc accatcttcg 3000 acgaaactaa gtcatggtac tttaccgaga acatggagcg gaattgtcgg gccccatgta 3060 acatccagat ggaggacccg acattcaagg agaactaccg gttccacgcc attaacggat 3120 acattatgga cactcttccg ggactcgtga tggcacagga ccaacgcatc agatggtatc 3180 ttctgtcgat ggggagcaac gaaaacatcc attcgatcca ctttagcggt cacgtgttca 3240 cagtgcgcaa gaaggaagag tacaagatgg cgctgtacaa cctgtaccct ggggtgttcg 3300 agactgtgga aatgctgccg tccaaggccg gaatttggcg cgtggaatgt ctgatcggtg 3360 aacatctgca tgccggaatg tccaccctgt tcctggtgta ctccaacaag tgccaaaccc 3420 cactgggaat ggcatcagga cacattagag acttccagat taccgcgagc ggacagtacg 3480 gacaatgggc ccccaagttg gccaggctgc actactctgg aagcattaac gcctggagca 3540 ccaaggagcc gttcagctgg atcaaggtgg accttctggc gccaatgatc atccacggaa 3600 ttaagactca gggagcccgc cagaagttct catcgctcta catctcccag tttatcatca 3660 tgtactcact ggatgggaag aagtggcaga cttaccgggg aaattccacc ggtactctga 3720 tggtgttctt cggaaacgtg gacagctccg gcatcaagca caatatcttt aacccgccta 3780 tcatcgcccg atacatccgg ctccacccga ctcactactc catccggtcg actctgcgga 3840 tggaactcat gggttgcgac ctcaactcct gctcaatgcc actgggcatg gagtccaagg 3900 ctatctcgga cgctcagatt actgcatcgt cgtactttac caacatgttc gctacctggt 3960 ccccgtccaa agcccggctg catctccaag gcagatcaaa cgcgtggagg cctcaggtca 4020 acaacccgaa ggaatggctt caggtcgact tccaaaagac catgaaagtc accggagtga 4080 ccacccaggg cgtgaaatcg ctgctgacct ctatgtacgt gaaggaattc ctgatctcat 4140 caagccagga cggccaccag tggacactgt tcttccaaaa tggaaaggtc aaggtctttc 4200 agggaaatca agactccttc acccccgtgg tgaactccct ggacccccct ctgcttaccc 4260 gctacttgcg cattcatccg caatcctggg tgcaccagat cgccctgcga atggaagtgc 4320 tgggctgtga agcgcaggac ctgtactaaa ataaaagatc tttattttca tagatctgt 4380 gtgttggttt tttgtgtgcc gc 4402 <210> 302 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> n = a, t, c, or g <220> <221> misc_feature <223> y = t or c <220> <221> misc_feature <223> r = a or g <220> <221> misc_feature <223> Branch site consensus sequence <220> <221> misc_feature <222> (2)..(2) <223> n is a, c, g, or t <400> 302 ynyyray 7 <210> 303 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> synthetic splice acceptor <400> 303 ctgacctctt ctcttcctcc cacag 25 <210> 304 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> native albumin intron 1/exon 2 splice acceptor, human <400> 304 ttaacaatcc ttttttttct tcccttgccc ag 32 <210> 305 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> native albumin intron 1/exon 2 splice acceptor, mouse <400> 305 ttaaatatgt tgtgtggttt ttctctccct gtttccacag 40 <210> 306 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> consensus synthetic poly A signal <400> 306 aataaaagat ctttattttc attagatctg tgtgttggtt ttttgtgtg 49 <210> 307 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Native splice acceptor sequence from human Factor IX gene intron 1/exon 2 boundary <400> 307 actaaagaat tattctttta catttcag 28 <210> 308 <211> 4502 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> MAB8B <400> 308 aattgaactt tgagtgtagc agagaggaac cattgccacc ttcagatttt aatgtctgac 60 ctcttctctt cctcccacag tggccaccag aagatactac ctcggagccg tcgaattgag 120 ctgggattac atgcaatccg acctgggaga actgcccgtg gatgccaggt ttcctcctcg 180 ggtccccaag tccttcccgt tcaacacctc agtcgtctac aagaaaaccc tcttcgtgga 240 gttcaccgac catctgttca acatcgccaa gccaagaccc ccgtggatgg gactcctcgg 300 tccgaccatc caagccgaag tgtacgacac tgtggtcatt accctgaaga acatggcctc 360 ccatcctgtg tccctgcatg cagtgggcgt gtcctactgg aaggcttccg aaggggccga 420 gtacgacgat caaaccagcc agcgggaaaa ggaggatgac aaagtgttcc cgggtggttc 480 gcacacctac gtgtggcaag tgctcaagga gaacggtcct atggcctctg atcccctgtg 540 tctgacctac tcctacctgt cccatgtcga cctcgtgaag gatctgaaca gcgggctgat 600 tggcgccctg ctcgtgtgcc gggaaggctc cctggccaag gaaaagaccc agacactgca 660 caagttcatc ttgctgttcg ccgtgtttga tgagggaaag tcctggcata gcgagactaa 720 gaactccctt atgcaagacc gggatgctgc ctccgctagg gcttggccta agatgcatac 780 tgtgaacgga tacgtgaaca gatccctgcc tggccttatc ggttgccacc ggaagtccgt 840 gtattggcat gtgatcggca tgggaaccac tccagaggtg cactccattt tcttggaggg 900 gcataccttc ttggtgcgca accacagaca ggcctccctg gaaatttctc cgatcacttt 960 cctgactgcc cagaccctcc ttatggacct gggtcagttc ctgctgttct gccacatttc 1020 gtcccaccaa cacgatggca tggaagccta cgtgaaagtg gactcgtgcc cggaagaacc 1080 acagctgcgg atgaagaaca acgaagaggc agaggactac gatgatgatc ttaccgattc 1140 ggaaatggat gtggtccgat tcgacgacga taatagccca tccttcatcc aaattaggag 1200 cgtggccaag aagcacccca aaacttgggt gcattacatt gcggccgagg aagaggattg 1260 ggactacgca cccctcgtgc ttgcacccga tgatcggtcc tacaagtccc aatacctgaa 1320 caacggcccg cagaggatcg gtcggaagta taagaaagtg cgcttcatgg cctacaccga 1380 cgagactttc aagaccagag aggccattca gcacgaaagc ggcattctgg ggccgctgtt 1440 gtacggggag gtcggagata cactgctcat cattttcaag aaccaggcgt ccagacccta 1500 caacatctac ccgcacggaa tcactgacgt ccgccccctg tactcccgga gactcccgaa 1560 gggagtcaag cacttgaaag acttccccat cctgcctggg gaaatcttca agtacaagtg 1620 gaccgtgacc gtcgaggatg ggccgaccaa gtccgatcca agatgcctca ctagatacta 1680 ctcatccttc gtcaacatgg aacgggacct ggcctcagga ctgattggcc ccctgctcat 1740 ctgctacaag gagtccgtgg atcagcgcgg aaaccagatc atgtcggaca aacgcaacgt 1800 catcctcttc tccgtctttg acgagaaccg ctcatggtac cttacggaga acatccagcg 1860 gttcctcccc aaccctgccg gagtgcagct cgaggacccg gaattccagg catcaaacat 1920 tatgcactcc atcaacggtt acgtgttcga cagcctccag cttagcgtgt gcctccatga 1980 agtcgcatat tggtacatcc tgtccattgg agcacaaacc gactttctct ccgtgttctt 2040 ctccggatat accttcaagc acaagatggt gtacgaggat accctgaccc tcttcccctt 2100 ctccggagag actgtgttta tgtcgatgga aaacccaggc ctgtggattt tggggtgcca 2160 caactcggat ttccgaaacc ggggcatgac tgccttgctc aaggtgtcct cctgtgacaa 2220 gaacacggga gactactacg aggactccta cgaggatatt tccgcctacc tcctgtccaa 2280 gaacaacgcc atcgaaccca ggtccttcag ccagaaccct cctgtcctca agcgccatca 2340 gagagaaatc acccgcacga ccctgcagtc cgaccaggaa gagatcgatt acgacgacac 2400 tatctccgtc gaaatgaaga aggaggactt tgacatctac gacgaagatg aaaatcagtc 2460 ccctcgctcg ttccaaaaga aaacgagaca ctacttcatc gctgctgtgg agcggctctg 2520 ggactacggc atgtcctcat cgccccacgt gcttaggaac cgggctcaat ccgggagcgt 2580 ccctcagttc aagaaagtgg tgtttcaaga attcaccgat ggaagcttca cgcagccgtt 2640 gtacaggggc gaactgaacg agcaccttgg cctgctggga ccttacatca gagcagaggt 2700 cgaggacaac atcatggtga ccttccggaa ccaagcctcc cggccatatt cattctactc 2760 gagccttatc tcatacgagg aggatcagag acagggggct gaacctcgga agaacttcgt 2820 caagccgaac gagacaaaga cctacttttg gaaggtgcag caccacatgg ccccgaccaa 2880 ggatgagttc gactgcaagg cctgggcgta cttctccgac gtggatctcg aaaaggacgt 2940 gcattccggg ctgatcggac cgctgctcgt ctgccacact aacaccctca atcctgctca 3000 cggcagacaa gtgaccgtgc aggagttcgc cctgttcttc accatcttcg acgaaactaa 3060 gtcatggtac tttaccgaga acatggagcg gaattgtcgg gccccatgta acatccagat 3120 ggaggacccg acatcaagg agaactaccg gttccacgcc attaacggat acattatgga 3180 cactcttccg ggactcgtga tggcacagga ccaacgcatc agatggtatc ttctgtcgat 3240 ggggagcaac gaaaacatcc attcgatcca ctttagcggt cacgtgttca cagtgcgcaa 3300 gaaggaagag tacaagatgg cgctgtacaa cctgtaccct ggggtgttcg agactgtgga 3360 aatgctgccg tccaaggccg gaatttggcg cgtggaatgt ctgatcggtg aacatctgca 3420 tgccggaatg tccaccctgt tcctggtgta ctccaacaag tgccaaaccc cactgggaat 3480 ggcatcagga cacattagag acttccagat taccgcgagc ggacagtacg gacaatgggc 3540 ccccaagttg gccaggctgc actactctgg aagcattaac gcctggagca ccaaggagcc 3600 gttcagctgg atcaaggtgg accttctggc gccaatgatc atccacggaa ttaagactca 3660 gggagcccgc cagaagttct catcgctcta catctcccag tttatcatca tgtactcact 3720 ggatgggaag aagtggcaga cttaccgggg aaattccacc ggtactctga tggtgttctt 3780 cggaaacgtg gacagctccg gcatcaagca caatatcttt aacccgccta tcatcgcccg 3840 atacatccgg ctccacccga ctcactactc catccggtcg actctgcgga tggaactcat 3900 gggttgcgac ctcaactcct gctcaatgcc actgggcatg gagtccaagg ctatctcgga 3960 cgctcagatt actgcatcgt cgtactttac caacatgttc gctacctggt ccccgtccaa 4020 agcccggctg catctccaag gcagatcaaa cgcgtggagg cctcaggtca acaacccgaa 4080 ggaatggctt caggtcgact tccaaaagac catgaaagtc accggagtga ccacccaggg 4140 cgtgaaatcg ctgctgacct ctatgtacgt gaaggaattc ctgatctcat caagccagga 4200 cggccaccag tggacactgt tcttccaaaa tggaaaggtc aaggtctttc agggaaatca 4260 agactccttc acccccgtgg tgaactccct ggacccccct ctgcttaccc gctacttgcg 4320 cattcatccg caatcctggg tgcaccagat cgccctgcga atggaagtgc tgggctgtga 4380 agcgcaggac ctgtactaaa ataaaagatc tttattttca tagatctgt gtgttggttt 4440 tttgtgtgcg atcgggaact ggcatcttca gggagtagct taggtcagtg aagagaagcc 4500 gc 4502 <210> 309 <211> 4567 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> MAB8C <400> 309 gcggcctaag gcaattgtgc cagttcccga tcgttacagg aactttgagt gtagcagaga 60 ggaaccattg ccaccttcag attttaatgt ctgacctctt ctcttcctcc cacagtggcc 120 accagaagat actacctcgg agccgtcgaa ttgagctggg attacatgca atccgacctg 180 ggagaactgc ccgtggatgc caggtttcct cctcgggtcc ccaagtcctt cccgttcaac 240 acctcagtcg tctacaagaa aaccctcttc gtggagttca ccgaccatct gttcaacatc 300 gccaagccaa gacccccgtg gatgggactc ctcggtccga ccatccaagc cgaagtgtac 360 gacactgtgg tcattaccct gaagaacatg gcctcccatc ctgtgtccct gcatgcagtg 420 ggcgtgtcct actggaaggc ttccgaaggg gccgagtacg acgatcaaac cagccagcgg 480 gaaaaggagg atgacaaagt gttcccgggt ggttcgcaca cctacgtgtg gcaagtgctc 540 aaggagaacg gtcctatggc ctctgatccc ctgtgtctga cctactccta cctgtcccat 600 gtcgacctcg tgaaggatct gaacagcggg ctgattggcg ccctgctcgt gtgccgggaa 660 ggctccctgg ccaaggaaaa gacccagaca ctgcacaagt tcatcttgct gttcgccgtg 720 tttgatgagg gaaagtcctg gcatagcgag actaagaact cccttatgca agaccgggat 780 gctgcctccg ctagggcttg gcctaagatg catactgtga acggatacgt gaacagatcc 840 ctgcctggcc ttatcggttg ccaccggaag tccgtgtatt ggcatgtgat cggcatggga 900 accactccag aggtgcactc cattttcttg gaggggcata ccttcttggt gcgcaaccac 960 agacaggcct ccctggaaat ttctccgatc actttcctga ctgcccagac cctccttatg 1020 gacctgggtc agttcctgct gttctgccac atttcgtccc accaacacga tggcatggaa 1080 gcctacgtga aagtggactc gtgcccggaa gaaccacagc tgcggatgaa gaacaacgaa 1140 gaggcagagg actacgatga tgatcttacc gattcggaaa tggatgtggt ccgattcgac 1200 gacgataata gcccatcctt catccaaatt aggagcgtgg ccaagaagca ccccaaaact 1260 tgggtgcatt acatgcggc cgaggaagag gattgggact acgcacccct cgtgcttgca 1320 cccgatgatc ggtcctacaa gtcccaatac ctgaacaacg gcccgcagag gatcggtcgg 1380 aagtataaga aagtgcgctt catggcctac accgacgaga ctttcaagac cagagaggcc 1440 attcagcacg aaagcggcat tctggggccg ctgttgtacg gggaggtcgg agatacactg 1500 ctcatcattt tcaagaacca ggcgtccaga ccctacaaca tctacccgca cggaatcact 1560 gacgtccgcc ccctgtactc ccggagactc ccgaagggag tcaagcactt gaaagacttc 1620 cccatcctgc ctggggaaat cttcaagtac aagtggaccg tgaccgtcga ggatgggccg 1680 accaagtccg atccaagatg cctcactaga tactactcat ccttcgtcaa catggaacgg 1740 gacctggcct caggactgat tggccccctg ctcatctgct acaaggagtc cgtggatcag 1800 cgcggaaacc agatcatgtc ggacaaacgc aacgtcatcc tcttctccgt ctttgacgag 1860 aaccgctcat ggtaccttac ggagaacatc cagcggttcc tccccaaccc tgccggagtg 1920 cagctcgagg acccggaatt ccaggcatca aacattatgc actccatcaa cggttacgtg 1980 ttcgacagcc tccagcttag cgtgtgcctc catgaagtcg catattggta catcctgtcc 2040 attggagcac aaaccgactt tctctccgtg ttcttctccg gatatacctt caagcacaag 2100 atggtgtacg aggataccct gaccctcttc cccttctccg gagagactgt gtttatgtcg 2160 atggaaaacc caggcctgtg gattttgggg tgccacaact cggatttccg aaaccggggc 2220 atgactgcct tgctcaaggt gtcctcctgt gacaagaaca cgggagacta ctacgaggac 2280 tcctacgagg atatttccgc ctacctcctg tccaagaaca acgccatcga acccaggtcc 2340 ttcagccaga accctcctgt cctcaagcgc catcagagag aaatcacccg cacgaccctg 2400 cagtccgacc aggaagagat cgattacgac gacactatct ccgtcgaaat gaagaaggag 2460 gactttgaca tctacgacga agatgaaaat cagtcccctc gctcgttcca aaagaaaacg 2520 agacactact tcatcgctgc tgtggagcgg ctctgggact acggcatgtc ctcatcgccc 2580 cacgtgctta ggaaccgggc tcaatccggg agcgtccctc agttcaagaa agtggtgttt 2640 caagaattca ccgatggaag cttcaggcag ccgttgtaca ggggcgaact gaacgagcac 2700 cttggcctgc tgggacctta catcagagca gaggtcgagg acaacatcat ggtgaccttc 2760 cggaaccaag cctcccggcc atattcattc tactcgagcc ttatctcata cgaggaggat 2820 cagagacagg gggctgaacc tcggaagaac ttcgtcaagc cgaacgagac aaagacctac 2880 ttttggaagg tgcagcacca catggccccg accaaggatg agttcgactg caaggcctgg 2940 gcgtacttct ccgacgtgga tctcgaaaag gacgtgcatt ccgggctgat cggaccgctg 3000 ctcgtctgcc acactaacac cctcaatcct gctcacggca gacaagtgac cgtgcaggag 3060 ttcgccctgt tcttcaccat cttcgacgaa actaagtcat ggtactttac cgagaacatg 3120 gagcggaatt gtcgggcccc atgtaacatc cagatggagg acccgacatt caaggagaac 3180 taccggttcc acgccattaa cggatacatt atggacactc ttccgggact cgtgatggca 3240 caggaccaac gcatcagatg gtatcttctg tcgatgggga gcaacgaaaa catccattcg 3300 atccacttta gcggtcacgt gttcacagtg cgcaagaagg aagagtacaa gatggcgctg 3360 tacaacctgt accctggggt gttcgagact gtggaaatgc tgccgtccaa ggccggaatt 3420 tggcgcgtgg aatgtctgat cggtgaacat ctgcatgccg gaatgtccac cctgttcctg 3480 gtgtactcca acaagtgcca aaccccactg ggaatggcat caggacacat tagagacttc 3540 cagattaccg cgagcggaca gtacggacaa tgggccccca agttggccag gctgcactac 3600 tctggaagca ttaacgcctg gagcaccaag gagccgttca gctggatcaa ggtggacctt 3660 ctggcgccaa tgatcatcca cggaattaag actcagggag cccgccagaa gttctcatcg 3720 ctctacatct cccagtttat catcatgtac tcactggatg ggaagaagtg gcagacttac 3780 cggggaaatt ccaccggtac tctgatggtg ttcttcggaa acgtggacag ctccggcatc 3840 aagcacaata tctttaaccc gcctatcatc gcccgataca tccggctcca cccgactcac 3900 tactccatcc ggtcgactct gcggatggaa ctcatgggtt gcgacctcaa ctcctgctca 3960 atgccactgg gcatggagtc caaggctatc tcggacgctc agattactgc atcgtcgtac 4020 tttaccaaca tgttcgctac ctggtccccg tccaaagccc ggctgcatct ccaaggcaga 4080 tcaaacgcgt ggaggcctca ggtcaacaac ccgaaggaat ggcttcaggt cgacttccaa 4140 aagaccatga aagtcaccgg agtgaccacc cagggcgtga aatcgctgct gacctctatg 4200 tacgtgaagg aattcctgat ctcatcaagc caggacggcc accagtggac actgttcttc 4260 caaaatggaa aggtcaaggt ctttcaggga aatcaagact ccttcacccc cgtggtgaac 4320 tccctggacc cccctctgct tacccgctac ttgcgcattc atccgcaatc ctgggtgcac 4380 cagatcgccc tgcgaatgga agtgctgggc tgtgaagcgc aggacctgta ctaaaataaa 4440 agatctttat tttcattaga tctgtgtgtt ggttttttgt gtgcgatcgg gaactggcat 4500 cttcagggag tagcttaggt cagtgaagag aagtgccagt tcccgatcgt tacaggccgc 4560 gggccgc 4567 <210> 310 <211> 4838 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1009 (FVIII donor for integration intro Transferrin intron 1) <400> 310 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag gggatggcca 120 actccatcac taggggttcc tgcggcccgc gggagaacgc accactttac gaaggcggta 180 ctcctcaaag cgtactaaag aattattctt ttacatttca gggctgtgtc tggctgccac 240 caggagatac tacctggggg ctgtggagct gagctgggac tacatgcagt ctgacctggg 300 ggagctgcct gtggatgcca ggttcccccc cagagtgccc aagagcttcc ccttcaacac 360 ctctgtggtg tacaagaaga ccctgtttgt ggagttcact gaccacctgt tcaacattgc 420 caagcccagg cccccctgga tgggcctgct gggccccacc atccaggctg aggtgtatga 480 cactgtggtg atcaccctga agaacatggc cagccaccct gtgagcctgc atgctgtggg 540 ggtgagctac tggaaggcct ctgagggggc tgagtatgat gaccagacca gccagaggga 600 gaaggaggat gacaaggtgt tccctggggg cagccacacc tatgtgtggc aggtgctgaa 660 ggagaatggc cccatggcct ctgaccccct gtgcctgacc tacagctacc tgagccatgt 720 ggacctggtg aaggacctga actctggcct gattggggcc ctgctggtgt gcagggaggg 780 cagcctggcc aaggagaaga cccagaccct gcacaagttc atcctgctgt ttgctgtgtt 840 tgatgagggc aagagctggc actctgaaac caagaacagc ctgatgcagg acagggatgc 900 tgcctctgcc agggcctggc ccaagatgca cactgtgaat ggctatgtga acaggagcct 960 gcctggcctg attggctgcc acaggaagtc tgtgtactgg catgtgattg gcatgggcac 1020 cacccctgag gtgcacagca tcttcctgga gggccacacc ttcctggtca ggaaccacag 1080 gcaggccagc ctggagatca gcccccatcac cttcctgact gcccagaccc tgctgatgga 1140 cctgggccag ttcctgctgt tctgccacat cagcagccac cagcatgatg gcatggaggc 1200 ctatgtgaag gtggacagct gccctgagga gccccagctg aggatgaaga acaatgagga 1260 ggctgaggac tatgatgatg acctgactga ctctgagatg gatgtggtga ggtttgatga 1320 tgacaacagc cccagcttca tccagatcag gtctgtggcc aagaagcacc ccaagacctg 1380 ggtgcactac attgctgctg aggaggagga ctgggactat gcccccctgg tgctggcccc 1440 tgatgacagg agctacaaga gccagtacct gaacaatggc ccccagagga ttggcaggaa 1500 gtacaagaag gtcaggttca tggcctacac tgatgaaacc ttcaagacca gggaggccat 1560 ccagcatgag tctggcatcc tgggccccct gctgtatggg gaggtggggg acaccctgct 1620 gatcatcttc aagaaccagg ccagcaggcc ctacaacatc tacccccatg gcatcactga 1680 tgtgaggccc ctgtacagca ggaggctgcc caagggggtg aagcacctga aggacttccc 1740 catcctgcct ggggagatct tcaagtacaa gtggactgtg actgtggagg atggccccac 1800 caagtctgac cccaggtgcc tgaccagata ctacagcagc tttgtgaaca tggagaggga 1860 cctggcctct ggcctgattg gccccctgct gatctgctac aaggagtctg tggaccagag 1920 gggcaaccag atcatgtctg acaagaggaa tgtgatcctg ttctctgtgt ttgatgagaa 1980 caggagctgg tacctgactg agaacatcca gaggttcctg cccaaccctg ctggggtgca 2040 gctggaggac cctgagttcc aggccagcaa catcatgcac agcatcaatg gctatgtgtt 2100 tgacagcctg cagctgtctg tgtgcctgca tgaggtggcc tactggtaca tcctgagcat 2160 tggggcccag actgacttcc tgtctgtgtt cttctctggc tacaccttca agcacaagat 2220 ggtgtatgag gacaccctga ccctgttccc cttctctggg gagactgtgt tcatgagcat 2280 ggagaaccct ggcctgtgga ttctgggctg ccacaactct gacttcagga acaggggcat 2340 gactgccctg ctgaaagtct ccagctgtga caagaacact ggggactact atgaggacag 2400 ctatgaggac atctctgcct acctgctgag caagaacaat gccattgagc ccaggagctt 2460 cagccagaat gccactaatg tgtctaacaa cagcaacacc agcaatgaca gcaatgtgtc 2520 tcccccagtg ctgaagaggc accagaggga gatcaccagg accaccctgc agtctgacca 2580 ggaggagatt gactatgatg acaccatctc tgtggagatg aagaaggagg actttgacat 2640 ctacgacgag gacgagaacc agagccccag gagcttccag aagaagacca ggcactactt 2700 cattgctgct gtggagaggc tgtgggacta tggcatgagc agcagccccc atgtgctgag 2760 gaacagggcc cagtctggct ctgtgcccca gttcaagaag gtggtgttcc aggagttcac 2820 tgatggcagc ttcacccagc ccctgtacag aggggagctg aatgagcacc tgggcctgct 2880 gggcccctac atcagggctg aggtggagga caacatcatg gtgaccttca ggaaccaggc 2940 cagcaggccc tacagcttct acagcagcct gatcagctat gaggaggacc agaggcaggg 3000 ggctgagccc aggaagaact ttgtgaagcc caatgaaacc aagacctact tctggaaggt 3060 gcagcaccac atggccccca ccaaggatga gtttgactgc aaggcctggg cctacttctc 3120 tgatgtggac ctggagaagg atgtgcactc tggcctgatt ggccccctgc tggtgtgcca 3180 caccaacacc ctgaaccctg cccatggcag gcaggtgact gtgcaggagt ttgccctgtt 3240 cttcaccatc tttgatgaaa ccaagagctg gtacttcact gagaacatgg agaggaactg 3300 cagggccccc tgcaacatcc agatggagga ccccaccttc aaggagaact acaggttcca 3360 tgccatcaat ggctacatca tggacaccct gcctggcctg gtgatggccc aggaccagag 3420 gatcaggtgg tacctgctga gcatgggcag caatgagaac atccacagca tccacttctc 3480 tggccatgtg ttcactgtga ggaagaagga ggagtacaag atggccctgt acaacctgta 3540 ccctggggtg tttgagactg tggagatgct gcccagcaag gctggcatct ggagggtgga 3600 gtgcctgatt ggggagcacc tgcatgctgg catgagcacc ctgttcctgg tgtacagcaa 3660 caagtgccag acccccctgg gcatggcctc tggccacatc agggacttcc agatcactgc 3720 ctctggccag tatggccagt gggcccccaa gctggccagg ctgcactact ctggcagcat 3780 caatgcctgg agcaccaagg agcccttcag ctggatcaag gtggacctgc tggcccccat 3840 gatcatccat ggcatcaaga cccagggggc caggcagaag ttcagcagcc tgtacatcag 3900 ccagttcatc atcatgtaca gcctggatgg caagaagtgg cagacctaca ggggcaacag 3960 cactggcacc ctgatggtgt tctttggcaa tgtggacagc tctggcatca agcacaacat 4020 cttcaacccc cccatcattg ccagatacat caggctgcac cccacccact acagcatcag 4080 gagcaccctg aggatggagc tgatgggctg tgacctgaac agctgcagca tgcccctggg 4140 catggagagc aaggccatct ctgatgccca gatcactgcc agcagctact tcaccaacat 4200 gtttgccacc tggagcccca gcaaggccag gctgcacctg cagggcagga gcaatgcctg 4260 gaggccccag gtcaacaacc ccaaggagtg gctgcaggtg gacttccaga agaccatgaa 4320 ggtgactggg gtgaccaccc agggggtgaa gagcctgctg accagcatgt atgtgaagga 4380 gttcctgatc agcagcagcc aggatggcca ccagtggacc ctgttcttcc agaatggcaa 4440 ggtgaaggtg ttccagggca accaggacag cttcacccct gtggtgaaca gcctggaccc 4500 ccccctgctg accagatacc tgaggattca cccccagagc tgggtgcacc agattgccct 4560 gaggatggag gtgctgggct gtgaggccca ggacctgtac tgatcgcgaa taaaagatct 4620 ttattttcat tagatctgtg tgttggtttt ttgtgtggag aacgcaccac tttacgaagg 4680 caattgcctt aggccgcagg aacccctagt gatggagttg gccactccct ctctgcgcgc 4740 tcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc 4800 ggcctcagtg agcgagcgag cgcgcagctg cctgcagg 4838 <210> 311 <211> 4830 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB099 (FVIII donor for integration into albumin intron 1) <400> 311 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag gggatggcca 120 actccatcac taggggttcc tgcggcctaa ggcaattgcc tgtaacgatc gggaactggc 180 agatccacac aaaaaaccaa cacacagatc taatgaaaat aaagatcttt tattcgcgat 240 cagtacaggt cctgggcctc acagcccagc acctccatcc tcagggcaat ctggtgcacc 300 cagctctggg ggtgaatcct caggtatctg gtcagcaggg gggggtccag gctgttcacc 360 acaggggtga agctgtcctg gttgccctgg aacaccttca ccttgccatt ctggaagaac 420 agggtccact ggtggccatc ctggctgctg ctgatcagga actccttcac atacatgctg 480 gtcagcaggc tcttcacccc ctgggtggtc accccagtca ccttcatggt cttctggaag 540 tccacctgca gccactcctt ggggttgttg acctggggcc tccaggcatt gctcctgccc 600 tgcaggtgca gcctggcctt gctggggctc caggtggcaa acatgttggt gaagtagctg 660 ctggcagtga tctgggcatc agagatggcc ttgctctcca tgcccagggg catgctgcag 720 ctgttcaggt cacagcccat cagctccatc ctcagggtgc tcctgatgct gtagtgggtg 780 gggtgcagcc tgatgtatct ggcaatgatg ggggggttga agatgttgtg cttgatgcca 840 gagctgtcca cattgccaaa gaacaccatc agggtgccag tgctgttgcc cctgtaggtc 900 tgccacttct tgccatccag gctgtacatg atgatgaact ggctgatgta caggctgctg 960 aacttctgcc tggccccctg ggtcttgatg ccatggatga tcatgggggc cagcaggtcc 1020 accttgatcc agctgaaggg ctccttggtg ctccaggcat tgatgctgcc agagtagtgc 1080 agcctggcca gcttgggggc ccactggcca tactggccag aggcagtgat ctggaagtcc 1140 ctgatgtggc cagaggccat gcccaggggg gtctggcact tgttgctgta caccaggaac 1200 agggtgctca tgccagcatg caggtgctcc ccaatcaggc actccaccct ccagatgcca 1260 gccttgctgg gcagcatctc cacagtctca aacaccccag ggtacaggtt gtacagggcc 1320 atcttgtact cctccttctt cctcacagtg aacacatggc cagagaagtg gatgctgtgg 1380 atgttctcat tgctgcccat gctcagcagg taccacctga tcctctggtc ctgggccatc 1440 accaggccag gcagggtgtc catgatgtag ccattgatgg catggaacct gtagttctcc 1500 ttgaaggtgg ggtcctccat ctggatgttg cagggggccc tgcagttcct ctccatgttc 1560 tcagtgaagt accagctctt ggtttcatca aagatggtga agaacagggc aaactcctgc 1620 acagtcacct gcctgccatg ggcagggttc agggtgttgg tgtggcacac cagcaggggg 1680 ccaatcaggc cagagtgcac atccttctcc aggtccacat cagagaagta ggcccaggcc 1740 ttgcagtcaa actcatcctt ggtgggggcc atgtggtgct gcaccttcca gaagtaggtc 1800 ttggtttcat tgggcttcac aaagttcttc ctgggctcag ccccctgcct ctggtcctcc 1860 tcatagctga tcaggctgct gtagaagctg tagggcctgc tggcctggtt cctgaaggtc 1920 accatgatgt tgtcctccac ctcagccctg atgtaggggc ccagcaggcc caggtgctca 1980 ttcagctccc ctctgtacag gggctgggtg aagctgccat cagtgaactc ctggaacacc 2040 accttcttga actggggcac agagccagac tgggccctgt tcctcagcac atgggggctg 2100 ctgctcatgc catagtccca cagcctctcc acagcagcaa tgaagtagtg cctggtcttc 2160 ttctggaagc tcctggggct ctggttctcg tcctcgtcgt agatgtcaaa gtcctccttc 2220 ttcatctcca cagagatggt gtcatcatag tcaatctcct cctggtcaga ctgcagggtg 2280 gtcctggtga tctccctctg gtgcctcttc agcactgggg gagacacatt gctgtcattg 2340 ctggtgttgc tgttgttaga cacattagtg gcattctggc tgaagctcct gggctcaatg 2400 gcattgttct tgctcagcag gtaggcagag atgtcctcat agctgtcctc atagtagtcc 2460 ccagtgttct tgtcacagct ggagactttc agcagggcag tcatgcccct gttcctgaag 2520 tcagagttgt ggcagcccag aatccacagg ccagggttct ccatgctcat gaacacagtc 2580 tccccagaga aggggaacag ggtcagggtg tcctcataca ccatcttgtg cttgaaggtg 2640 tagccagaga agaacacaga caggaagtca gtctgggccc caatgctcag gatgtaccag 2700 taggccacct catgcaggca cacagacagc tgcaggctgt caaacacata gccattgatg 2760 ctgtgcatga tgttgctggc ctggaactca gggtcctcca gctgcacccc agcagggttg 2820 ggcaggaacc tctggatgtt ctcagtcagg taccagctcc tgttctcatc aaacacagag 2880 aacaggatca cattcctctt gtcagacatg atctggttgc ccctctggtc cacagactcc 2940 ttgtagcaga tcagcagggg gccaatcagg ccagaggcca ggtccctctc catgttcaca 3000 aagctgctgt agtatctggt caggcacctg gggtcagact tggtggggcc atcctccaca 3060 gtcacagtcc acttgtactt gaagatctcc ccaggcagga tggggaagtc cttcaggtgc 3120 ttcaccccct tgggcagcct cctgctgtac aggggcctca catcagtgat gccatggggg 3180 tagatgttgt agggcctgct ggcctggttc ttgaagatga tcagcagggt gtccccccacc 3240 tccccataca gcagggggcc caggatgcca gactcatgct ggatggcctc cctggtcttg 3300 aaggtttcat cagtgtaggc catgaacctg accttcttgt acttcctgcc aatcctctgg 3360 gggccattgt tcaggtactg gctcttgtag ctcctgtcat caggggccag caccaggggg 3420 gcatagtccc agtcctcctc ctcagcagca atgtagtgca cccaggtctt ggggtgcttc 3480 ttggccacag acctgatctg gatgaagctg gggctgttgt catcatcaaa cctcaccaca 3540 tccatctcag agtcagtcag gtcatcatca tagtcctcag cctcctcatt gttcttcatc 3600 ctcagctggg gctcctcagg gcagctgtcc accttcacat aggcctccat gccatcatgc 3660 tggtggctgc tgatgtggca gaacagcagg aactggccca ggtccatcag cagggtctgg 3720 gcagtcagga aggtgatggg gctgatctcc aggctggcct gcctgtggtt cctgaccagg 3780 aaggtgtggc cctccaggaa gatgctgtgc acctcagggg tggtgcccat gccaatcaca 3840 tgccagtaca cagacttcct gtggcagcca atcaggccag gcaggctcct gttcacatag 3900 ccattcacag tgtgcatctt gggccaggcc ctggcagagg cagcatccct gtcctgcatc 3960 aggctgttct tggtttcaga gtgccagctc ttgccctcat caaacacagc aaacagcagg 4020 atgaacttgt gcagggtctg ggtcttctcc ttggccaggc tgccctccct gcacaccagc 4080 agggccccaa tcaggccaga gttcaggtcc ttcaccaggt ccacatggct caggtagctg 4140 taggtcaggc acagggggtc agaggccatg gggccattct ccttcagcac ctgccacaca 4200 taggtgtggc tgcccccagg gaacaccttg tcatcctcct tctccctctg gctggtctgg 4260 tcatcatact cagccccctc agaggccttc cagtagctca cccccacagc atgcaggctc 4320 acagggtggc tggccatgtt cttcagggtg atcaccacag tgtcatacac ctcagcctgg 4380 atggtggggc ccagcaggcc catccagggg ggcctgggct tggcaatgtt gaacaggtgg 4440 tcagtgaact ccacaaacag ggtcttcttg tacaccacag aggtgttgaa ggggaagctc 4500 ttgggcactc tgggggggaa cctggcatcc acaggcagct cccccaggtc agactgcatg 4560 tagtcccagc tcagctccac agcccccagg tagtatctcc tggtggccac tgaaatgtaa 4620 aagaataatt ctttagtacg ctttgaggag taccgcctgt aacgatcggg aactggcacc 4680 gcgggccgca ggaaccccta gtgatggagt tggccactcc ctctctgcgc gctcgctcgc 4740 tcactgaggc cgggcgacca aaggtcgccc gacgcccggg ctttgcccgg gcggcctcag 4800 tgagcgagcg agcgcgcagc tgcctgcagg 4830 <210> 312 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> n = a, t, c, or g <220> <221> misc_feature <223> Neisseria meningitidis PAM <220> <221> misc_feature <222> (1)..(4) <223> n is a, c, g, or t <400> 312 nnnngatt 8 <210> 313 <211> 9 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> n = a, t, c, or g <220> <221> misc_feature <223> Neisseria meningitidis PAM <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g, or t <400> 313 nnnnngttt 9 <210> 314 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> n = a, t, c, or g <220> <221> misc_feature <223> Neisseria meningitidis PAM <220> <221> misc_feature <222> (1)..(4) <223> n is a, c, g, or t <400> 314 nnnnngctt 8 <210> 315 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> Structural classification for homing endonuclease (HE) <400> 315 Leu Ala Gly Leu Ile Asp Ala Asp Gly 1 5 <210> 316 <211> 4488 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB076 <400> 316 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacagcaa tgtgtctccc ccagtgctga agaggcacca gagggagatc accaggacca 2400 ccctgcagtc tgaccaggag gagattgact atgatgacac catctctgtg gagatgaaga 2460 aggaggactt tgacatctac gacgaggacg agaaccagag ccccaggagc ttccagaaga 2520 agaccaggca ctacttcatt gctgctgtgg agaggctgtg ggactatggc atgagcagca 2580 gcccccatgt gctgaggaac agggcccagt ctggctctgt gccccagttc aagaaggtgg 2640 tgttccagga gttcactgat ggcagcttca cccagcccct gtacagaggg gagctgaatg 2700 agcacctggg cctgctgggc ccctacatca gggctgaggt ggaggacaac atcatggtga 2760 ccttcaggaa ccaggccagc aggccctaca gcttctacag cagcctgatc agctatgagg 2820 aggaccagag gcagggggct gagcccagga agaactttgt gaagcccaat gaaaccaaga 2880 cctacttctg gaaggtgcag caccacatgg cccccaccaa ggatgagttt gactgcaagg 2940 cctgggccta cttctctgat gtggacctgg agaaggatgt gcactctggc ctgattggcc 3000 ccctgctggt gtgccacacc aacaccctga accctgccca tggcaggcag gtgactgtgc 3060 aggagtttgc cctgttcttc accatctttg atgaaaccaa gagctggtac ttcactgaga 3120 acatggagag gaactgcagg gccccctgca acatccagat ggaggacccc accttcaagg 3180 agaactacag gttccatgcc atcaatggct acatcatgga caccctgcct ggcctggtga 3240 tggcccagga ccagaggatc aggtggtacc tgctgagcat gggcagcaat gagaacatcc 3300 acagcatcca cttctctggc catgtgttca ctgtgaggaa gaaggaggag tacaagatgg 3360 ccctgtacaa cctgtaccct ggggtgtttg agactgtgga gatgctgccc agcaaggctg 3420 gcatctggag ggtggagtgc ctgattgggg agcacctgca tgctggcatg agcaccctgt 3480 tcctggtgta cagcaacaag tgccagaccc ccctgggcat ggcctctggc cacatcaggg 3540 acttccagat cactgcctct ggccagtatg gccagtgggc ccccaagctg gccaggctgc 3600 actactctgg cagcatcaat gcctggagca ccaaggagcc cttcagctgg atcaaggtgg 3660 acctgctggc ccccatgatc atccatggca tcaagaccca gggggccagg cagaagttca 3720 gcagcctgta catcagccag ttcatcatca tgtacagcct ggatggcaag aagtggcaga 3780 cctacagggg caacagcact ggcaccctga tggtgttctt tggcaatgtg gacagctctg 3840 gcatcaagca caacatcttc aaccccccca tcattgccag atacatcagg ctgcacccca 3900 cccactacag catcaggagc accctgagga tggagctgat gggctgtgac ctgaacagct 3960 gcagcatgcc cctgggcatg gagagcaagg ccatctctga tgcccagatc actgccagca 4020 gctacttcac caacatgttt gccacctgga gccccagcaa ggccaggctg cacctgcagg 4080 gcaggagcaa tgcctggagg ccccaggtca acaaccccaa ggagtggctg caggtggact 4140 tccagaagac catgaaggtg actggggtga ccacccaggg ggtgaagagc ctgctgacca 4200 gcatgtatgt gaaggagttc ctgatcagca gcagccagga tggccaccag tggaccctgt 4260 tcttccagaa tggcaaggtg aaggtgttcc agggcaacca ggacagcttc acccctgtgg 4320 tgaacagcct ggaccccccc ctgctgacca gatacctgag gattcacccc cagagctggg 4380 tgcaccagat tgccctgagg atggaggtgc tgggctgtga ggcccaggac ctgtactgaa 4440 ataaaagatc tttattttca tagatctgt gtgttggttt tttgtgtg 4488 <210> 317 <211> 4493 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB077 <400> 317 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacagcaa tgtgtctccc ccagtgctga agaggcacca gagggagatc accaggacca 2400 ccctgcagtc tgaccaggag gagattgact atgatgacac catctctgtg gagatgaaga 2460 aggaggactt tgacatctac gacgaggacg agaaccagag ccccaggagc ttccagaaga 2520 agaccaggca ctacttcatt gctgctgtgg agaggctgtg ggactatggc atgagcagca 2580 gcccccatgt gctgaggaac agggcccagt ctggctctgt gccccagttc aagaaggtgg 2640 tgttccagga gttcactgat ggcagcttca cccagcccct gtacagaggg gagctgaatg 2700 agcacctggg cctgctgggc ccctacatca gggctgaggt ggaggacaac atcatggtga 2760 ccttcaggaa ccaggccagc aggccctaca gcttctacag cagcctgatc agctatgagg 2820 aggaccagag gcagggggct gagcccagga agaactttgt gaagcccaat gaaaccaaga 2880 cctacttctg gaaggtgcag caccacatgg cccccaccaa ggatgagttt gactgcaagg 2940 cctgggccta cttctctgat gtggacctgg agaaggatgt gcactctggc ctgattggcc 3000 ccctgctggt gtgccacacc aacaccctga accctgccca tggcaggcag gtgactgtgc 3060 aggagtttgc cctgttcttc accatctttg atgaaaccaa gagctggtac ttcactgaga 3120 acatggagag gaactgcagg gccccctgca acatccagat ggaggacccc accttcaagg 3180 agaactacag gttccatgcc atcaatggct acatcatgga caccctgcct ggcctggtga 3240 tggcccagga ccagaggatc aggtggtacc tgctgagcat gggcagcaat gagaacatcc 3300 acagcatcca cttctctggc catgtgttca ctgtgaggaa gaaggaggag tacaagatgg 3360 ccctgtacaa cctgtaccct ggggtgtttg agactgtgga gatgctgccc agcaaggctg 3420 gcatctggag ggtggagtgc ctgattgggg agcacctgca tgctggcatg agcaccctgt 3480 tcctggtgta cagcaacaag tgccagaccc ccctgggcat ggcctctggc cacatcaggg 3540 acttccagat cactgcctct ggccagtatg gccagtgggc ccccaagctg gccaggctgc 3600 actactctgg cagcatcaat gcctggagca ccaaggagcc cttcagctgg atcaaggtgg 3660 acctgctggc ccccatgatc atccatggca tcaagaccca gggggccagg cagaagttca 3720 gcagcctgta catcagccag ttcatcatca tgtacagcct ggatggcaag aagtggcaga 3780 cctacagggg caacagcact ggcaccctga tggtgttctt tggcaatgtg gacagctctg 3840 gcatcaagca caacatcttc aaccccccca tcattgccag atacatcagg ctgcacccca 3900 cccactacag catcaggagc accctgagga tggagctgat gggctgtgac ctgaacagct 3960 gcagcatgcc cctgggcatg gagagcaagg ccatctctga tgcccagatc actgccagca 4020 gctacttcac caacatgttt gccacctgga gccccagcaa ggccaggctg cacctgcagg 4080 gcaggagcaa tgcctggagg ccccaggtca acaaccccaa ggagtggctg caggtggact 4140 tccagaagac catgaaggtg actggggtga ccacccaggg ggtgaagagc ctgctgacca 4200 gcatgtatgt gaaggagttc ctgatcagca gcagccagga tggccaccag tggaccctgt 4260 tcttccagaa tggcaaggtg aaggtgttcc agggcaacca ggacagcttc acccctgtgg 4320 tgaacagcct ggaccccccc ctgctgacca gatacctgag gattcacccc cagagctggg 4380 tgcaccagat tgccctgagg atggaggtgc tgggctgtga ggcccaggac ctgtactgat 4440 cgcgaataaa agatctttat tttcattaga tctgtgtgtt ggttttttgt gtg 4493 <210> 318 <211> 4437 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB080 <400> 318 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccaga aggtactacc tgggagctgt ggaactgagc tgggactaca 120 tgcagtctga cctgggagag ctgcctgtgg atgctagatt tcctccaaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaaaaccct gtttgtggaa ttcacagacc 240 acctgttcaa tattgccaag cctagacctc cttggatggg cctgctgggc cctacaattc 300 aggctgaggt gtatgacaca gtggtcatca ccctgaagaa catggccagc catcctgtgt 360 ctctgcatgc tgtgggagtg tcttactgga aggcttctga gggggctgag tatgatgacc 420 agacaagcca gagagagaaa gaggatgaca aggttttccc tgggggcagc cacacctatg 480 tctggcaggt cctgaaagaa aatggcccta tggcctctga tcctctgtgc ctgacataca 540 gctacctgag ccatgtggac ctggtcaagg acctgaactc tggcctgatt ggggctctgc 600 tggtgtgtag agaaggcagc ctggccaaag aaaagaccca gacactgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgagacaaag aacagcctga 720 tgcaggacag agatgctgcc tctgctagag cttggcccaa gatgcacaca gtgaatggct 780 atgtgaacag aagcctgcct ggactgattg gatgccacag aaagtctgtg tactggcatg 840 tgattggcat gggcaccaca cctgaggtgc acagcatctt tctggaagga cacaccttcc 900 tggtgaggaa ccacagacag gccagcctgg aaatcagccc tatcaccttc ctgacagctc 960 agaccctgct gatggatctg ggccagtttc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaagcctat gtgaaggtgg acagctgccc tgaagaaccc cagctgagaa 1080 tgaagaacaa tgaggaagct gaggactatg atgatgacct gacagactct gagatggatg 1140 tggtcagatt tgatgatgat aacagcccca gcttcatcca gatcagatct gtggccaaga 1200 agcaccccaa gacctgggtg cactatattg ctgctgagga agaggactgg gattatgctc 1260 ctctggtgct ggcccctgat gacagaagct acaagagcca gtacctgaac aatggccctc 1320 agagaattgg caggaagtat aagaaagtga ggttcatggc ctacacagat gagacattca 1380 agaccagaga ggctatccag catgagtctg gcattctggg acctctgctg tatggggaag 1440 tgggggacac actgctgatc atcttcaaga accaggccag cagaccctac aacatctacc 1500 ctcatggcat cacagatgtg aggcctctgt actctagaag gctgcccaag ggggtgaagc 1560 acctgaagga cttccctatc ctgcctgggg agatcttcaa gtacaagtgg acagtgacag 1620 tggaggatgg ccctaccaag tctgatccta gatgcctgac aaggtactac agcagctttg 1680 tgaacatgga aagggacctg gcctctggcc tgattggtcc tctgctgatc tgctacaaag 1740 aatctgtgga ccagaggggc aaccagatca tgagtgacaa gagaaatgtg atcctgttct 1800 ctgtctttga tgagaacagg tcctggtatc tgacagagaa catccagagg tttctgccca 1860 atcctgctgg ggtgcagctg gaagatcctg agttccaggc ctccaacatc atgcactcca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgaa gtggcctact 1980 ggtacatcct gtctattggg gcccagacag acttcctgtc tgtgttcttt tctggctaca 2040 ccttcaagca caagatggtg tatgaggata ccctgacact gttcccattc tctggggaga 2100 cagtgttcat gagcatggaa aaccctggcc tgtggatcct gggctgtcac aacagtgact 2160 tcagaaacag aggcatgaca gccctgctga aggtgtccag ctgtgacaag aacactgggg 2220 actactatga ggactcttat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcctag gagcttctct cagaaccctc ctgtgctgaa gagacaccag agggagatca 2340 ccagaaccac actgcagtct gaccaagagg aaattgatta tgatgacacc atctctgtgg 2400 agatgaagaa agaagatttt gacatctatg atgaggatga gaatcagagc cccagatctt 2460 tccagaagaa aacaaggcac tacttcattg ctgctgtgga aagactgtgg gactatggca 2520 tgagcagcag cccccatgtg ctgagaaaca gggcccagtc tggaagtgtg ccccagttca 2580 agaaagtggt gttccaagag ttcacagatg gcagcttcac ccagcctctg tatagagggg 2640 agctgaatga gcacctggga ctgctgggac cttacatcag agctgaggtg gaggataaca 2700 tcatggtcac ctttagaaac caggcctcta ggccctactc cttctacagc tccctgatca 2760 gctatgaaga ggaccagaga cagggggctg agcccagaaa gaactttgtg aagcccaatg 2820 agactaagac ctacttttgg aaggtgcagc accacatggc ccctacaaag gatgagtttg 2880 actgcaaggc ctgggcctac ttctctgatg tggacctgga gaaggatgtg cactctggac 2940 tcattggacc cctgcttgtg tgccacacca acacactgaa tcctgctcat ggcaggcaag 3000 tgacagtgca agagtttgcc ctgttcttca ccatctttga tgagacaaag tcctggtact 3060 tcacaaaaa catggaaaga aactgcaggg ccccttgcaa catccagatg gaagatccca 3120 ccttcaaaga gaactacagg ttccatgcca tcaatggcta catcatggac actctgcctg 3180 gcctggttat ggcacaggat cagaggatca gatggtatct gctgtccatg ggctccaatg 3240 agaatatcca cagcatccac ttctctggcc atgtgttcac agtgaggaaa aaagaagagt 3300 acaagatggc cctgtacaat ctgtaccctg gggtgtttga gactgtggaa atgctgccta 3360 gcaaggctgg aatctggagg gtggaatgtc tgattggaga gcatctgcat gctggaatgt 3420 ctaccctgtt cctggtgtac agcaacaagt gtcagacccc tctgggcatg gcctctggac 3480 acatcagaga cttccagatc acagcctctg gccagtatgg acagtgggct cctaaactgg 3540 ctagactgca ctactctggc agcatcaatg cctggtccac caaagagccc ttcagctgga 3600 tcaaggtgga cctgctggct cccatgatca tccatggaat caagacccag ggggccagac 3660 agaagttcag cagcctgtac atcagccagt tcatcatcat gtacagcctg gatggcaaga 3720 agtggcagac ctacagaggc aacagcacag gcacactcat ggtgttcttt ggcaatgtgg 3780 actcttctgg cattaagcac aacatcttca accctccaat cattgccagg tacatcaggc 3840 tgcaccccac acactacagc atcagatcta ccctgaggat ggaactgatg ggctgtgacc 3900 tgaacagctg ctctatgccc ctgggaatgg aaagcaaggc catctctgat gcccagatca 3960 cagccagcag ctacttcacc aacatgtttg ccacatggtc cccatctaag gccaggctgc 4020 atctgcaggg cagatctaat gcttggaggc cccaagtgaa caaccccaaa gagtggctgc 4080 aggtggactt tcagaaaacc atgaaagtga caggagtgac cacacagggg gtcaagtctc 4140 tgctgacctc tatgtatgtg aaagagttcc tgatctccag cagccaggat ggccaccagt 4200 ggaccctgtt tttccagaat ggcaaagtca aggtgttcca gggaaaccag gacagcttca 4260 cacctgtggt caactccctg gatcctccac tgctgaccag atacctgaga attcaccctc 4320 agtcttgggt gcaccagatt gctctgagaa tggaagtgct gggatgtgaa gctcaggacc 4380 tctactaaaa taaaagatct ttattttcat tagatctgtg tgttggtttt ttgtgtg 4437 <210> 319 <211> 4437 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB085 <400> 319 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccaga aggtactacc taggagccgt ggaactgagc tgggactaca 120 tgcagtctga cctgggagag ctgcccgtgg acgctagatt tcctccaaga gtgcccaaga 180 gcttcccctt caacacctcc gtggtgtaca agaaaaccct gttcgtggaa ttcaccgacc 240 acctgttcaa tatcgccaag cctagacctc cttggatggg cctgctgggc cctacaattc 300 aggccgaggt gtacgacacc gtggtcatca ccctgaagaa catggccagc catcctgtgt 360 ctctgcacgc cgtgggagtg tcttactgga aggcttctga gggcgccgag tacgacgacc 420 agacaagcca gagagagaaa gaggacgaca aggttttccc tggcggcagc cacacctatg 480 tctggcaggt cctgaaagaa aacggcccta tggcctccga tcctctgtgc ctgacataca 540 gctacctgag ccatgtggac ctggtcaagg acctgaactc tggcctgatc ggcgctctgc 600 tcgtgtgtag agaaggcagc ctggccaaag aaaagaccca gacactgcac aagttcatcc 660 tgctgttcgc cgtgttcgac gagggcaaga gctggcacag cgagacaaag aacagcctga 720 tgcaggacag agatgccgcc tctgctagag cttggcccaa gatgcacacc gtgaacggct 780 acgtgaacag aagcctgcct ggactgatcg gatgccacag aaagtccgtg tactggcatg 840 tgatcggcat gggcaccaca cctgaggtgc acagcatctt tctggaagga cacaccttcc 900 tcgtgcggaa ccacagacag gccagcctgg aaatcagccc tatcaccttc ctgaccgctc 960 agaccctgct gatggatctg ggccagtttc tgctgttctg ccacatcagc agccaccagc 1020 acgatggcat ggaagcctac gtgaaggtgg acagctgccc cgaagaaccc cagctgagaa 1080 tgaagaacaa cgaggaagcc gaggactacg acgacgacct gaccgactct gagatggacg 1140 tcgtcagatt cgacgacgat aacagcccca gcttcatcca gatcagaagc gtggccaaga 1200 agcaccccaa gacctgggtg cactatatcg ccgccgagga agaggactgg gattacgctc 1260 ctctggtgct ggcccctgac gacagaagct acaagagcca gtacctgaac aacggccctc 1320 agagaatcgg ccggaagtat aagaaagtgc ggttcatggc ctacaccgac gagacattca 1380 agaccagaga ggctatccag cacgagagcg gcattctggg acctctgctg tatggcgaag 1440 tgggcgacac actgctgatc atcttcaaga accaggccag cagaccctac aacatctacc 1500 ctcacggcat caccgatgtg cggcctctgt actctagaag gctgcccaag ggcgtgaagc 1560 acctgaagga cttccctatc ctgcctggcg agatcttcaa gtacaagtgg accgtgaccg 1620 tcgaggacgg ccctaccaag agcgatccta gatgcctgac acggtactac agcagcttcg 1680 tgaacatgga acgcgacctg gccagcggcc tgattggtcc tctgctgatc tgctacaaag 1740 aaagcgtgga ccagaggggc aaccagatca tgagcgacaa gagaaacgtg atcctgttct 1800 ccgtctttga cgagaacagg tcctggtatc tgaccgagaa catccagcgg tttctgccca 1860 atcctgctgg cgtgcagctg gaagatcctg agttccaggc ctccaacatc atgcactcca 1920 tcaacggcta tgtgttcgac agcctgcagc tgagcgtgtg cctgcacgaa gtggcctact 1980 ggtacatcct gtctatcggc gcccagaccg acttcctgtc cgtgttcttt agcggctaca 2040 ccttcaagca caagatggtg tacgaggata ccctgacact gttcccattc agcggcgaga 2100 cagtgttcat gagcatggaa aaccccggcc tgtggatcct gggctgtcac aacagcgact 2160 tcagaaacag aggcatgaca gccctgctga aggtgtccag ctgcgacaag aacaccggcg 2220 actactacga ggactcttac gaggacatca gcgcctacct gctgagcaag aacaatgcca 2280 tcgagcctcg gagcttctct cagaaccctc ctgtgctgaa gagacaccag cgcgagatca 2340 ccagaaccac actgcagagc gaccaagagg aaatcgatta cgacgacacc atcagcgtcg 2400 agatgaagaa agaagatttc gacatctacg acgaggacga gaatcagagc cccagatctt 2460 tccagaagaa aacgcggcac tacttcattg ccgccgtgga aagactgtgg gactacggca 2520 tgagcagcag cccacatgtg ctgagaaaca gggcccagag cggaagcgtg ccccagttca 2580 agaaagtggt gttccaagag ttcaccgacg gcagcttcac ccagcctctg tatagaggcg 2640 agctgaacga gcacctggga ctgctgggac cttacatcag agctgaggtc gaggataaca 2700 tcatggtcac ctttagaaac caggcctcta ggccctactc cttctacagc tccctgatca 2760 gctacgaaga ggaccagaga cagggcgctg agcccagaaa gaacttcgtg aagcccaacg 2820 agactaagac ctacttttgg aaggtgcagc accacatggc ccctacaaag gacgagttcg 2880 actgcaaggc ctgggcctac ttctctgacg tggacctcga gaaggatgtg cacagcggac 2940 tcatcggacc cctgcttgtg tgccacacca acacactgaa tcccgctcac ggcaggcaag 3000 tgaccgtgca agagttcgcc ctgttcttca ccatcttcga tgagacaaag tcctggtact 3060 tcaccgaaaa catggaaaga aactgcaggg ccccttgcaa catccagatg gaagatccca 3120 ccttcaaaga gaactaccgg ttccacgcca tcaatggcta catcatggac actctgcccg 3180 gcctggttat ggcacaggat cagaggatca gatggtatct gctgtccatg ggctccaacg 3240 agaatatcca cagcatccac ttcagcggcc atgtgttcac cgtgcggaaa aaagaagagt 3300 acaagatggc cctgtacaat ctgtaccccg gcgtgttcga gactgtggaa atgctgccta 3360 gcaaggccgg aatctggcgc gtggaatgtc tgatcggaga gcatctgcat gccggaatgt 3420 ctaccctgtt cctggtgtac agcaacaagt gtcagacccc tctcggcatg gcctctggac 3480 acatcagaga cttccagatc accgcctctg gccagtacgg acagtgggct cctaaactgg 3540 ctagactgca ctacagcggc agcatcaacg cctggtccac caaagagccc ttcagctgga 3600 tcaaggtgga cctgctggct cccatgatca tccacggaat caagacccag ggcgccagac 3660 agaagttcag cagcctgtac atcagccagt tcatcatcat gtacagcctg gacggcaaga 3720 agtggcagac ctacagaggc aacagcaccg gcacactcat ggtgttcttc ggcaacgtgg 3780 actccagcgg cattaagcac aacatcttca accctccaat cattgcccgg tacatccggc 3840 tgcaccccac acactacagc atcagatcta ccctgaggat ggaactgatg ggctgcgacc 3900 tgaacagctg ctctatgccc ctcggaatgg aaagcaaggc catcagcgac gcccagatca 3960 cagccagcag ctacttcacc aacatgttcg ccacatggtc cccatctaag gcccggctgc 4020 atctgcaggg cagatctaac gcttggaggc cccaagtgaa caaccccaaa gagtggctgc 4080 aggtcgactt tcagaaaacc atgaaagtga ccggcgtgac cacacagggc gtcaagtctc 4140 tgctgacctc tatgtacgtg aaagagttcc tgatctccag cagccaggac ggccaccagt 4200 ggaccctgtt tttccagaac ggcaaagtca aggtgttcca gggaaaccag gacagcttca 4260 cacccgtggt caactccctg gatcctccac tgctgaccag atacctgaga attcaccctc 4320 agtcttgggt gcaccagatc gctctgagaa tggaagtgct gggatgtgaa gctcaggacc 4380 tctactaaaa taaaagatct ttattttcat tagatctgtg tgttggtttt ttgtgtg 4437 <210> 320 <211> 4437 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB100 <400> 320 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatcccc cagtgctgaa gaggcaccag agggagatca 2340 ccaggaccac cctgcagtct gaccaggagg agattgacta tgatgacacc atctctgtgg 2400 agatgaagaa ggaggacttt gacatctacg acgaggacga gaaccagagc cccaggagct 2460 tccagaagaa gaccaggcac tacttcattg ctgctgtgga gaggctgtgg gactatggca 2520 tgagcagcag cccccatgtg ctgaggaaca gggcccagtc tggctctgtg ccccagttca 2580 agaaggtggt gttccaggag ttcactgatg gcagcttcac ccagcccctg tacagagggg 2640 agctgaatga gcacctgggc ctgctgggcc cctacatcag ggctgaggtg gaggacaaca 2700 tcatggtgac cttcaggaac caggccagca ggccctacag cttctacagc agcctgatca 2760 gctatgagga ggaccagagg cagggggctg agcccaggaa gaactttgtg aagcccaatg 2820 aaaccaagac ctacttctgg aaggtgcagc accacatggc ccccaccaag gatgagtttg 2880 actgcaaggc ctgggcctac ttctctgatg tggacctgga gaaggatgtg cactctggcc 2940 tgattggccc cctgctggtg tgccacacca acaccctgaa ccctgcccat ggcaggcagg 3000 tgactgtgca ggagtttgcc ctgttcttca ccatctttga tgaaaccaag agctggtact 3060 tcactgagaa catggagagg aactgcaggg ccccctgcaa catccagatg gaggacccca 3120 ccttcaagga gaactacagg ttccatgcca tcaatggcta catcatggac accctgcctg 3180 gcctggtgat ggcccaggac cagaggatca ggtggtacct gctgagcatg ggcagcaatg 3240 agaacatcca cagcatccac ttctctggcc atgtgttcac tgtgaggaag aaggaggagt 3300 acaagatggc cctgtacaac ctgtaccctg gggtgtttga gactgtggag atgctgccca 3360 gcaaggctgg catctggagg gtggagtgcc tgattgggga gcacctgcat gctggcatga 3420 gcaccctgtt cctggtgtac agcaacaagt gccagacccc cctgggcatg gcctctggcc 3480 acatcaggga cttccagatc actgcctctg gccagtatgg ccagtgggcc cccaagctgg 3540 ccaggctgca ctactctggc agcatcaatg cctggagcac caaggagccc ttcagctgga 3600 tcaaggtgga cctgctggcc cccatgatca tccatggcat caagacccag ggggccaggc 3660 agaagttcag cagcctgtac atcagccagt tcatcatcat gtacagcctg gatggcaaga 3720 agtggcagac ctacaggggc aacagcactg gcaccctgat ggtgttcttt ggcaatgtgg 3780 acagctctgg catcaagcac aacatcttca acccccccat cattgccaga tacatcaggc 3840 tgcaccccac ccactacagc atcaggagca ccctgaggat ggagctgatg ggctgtgacc 3900 tgaacagctg cagcatgccc ctgggcatgg agagcaaggc catctctgat gcccagatca 3960 ctgccagcag ctacttcacc aacatgtttg ccacctggag ccccagcaag gccaggctgc 4020 acctgcaggg caggagcaat gcctggaggc cccaggtcaa caaccccaag gagtggctgc 4080 aggtggactt ccagaagacc atgaaggtga ctggggtgac cacccagggg gtgaagagcc 4140 tgctgaccag catgtatgtg aaggagttcc tgatcagcag cagccaggat ggccaccagt 4200 ggaccctgtt cttccagaat ggcaaggtga aggtgttcca gggcaaccag gacagcttca 4260 cccctgtggt gaacagcctg gacccccccc tgctgaccag atacctgagg attcaccccc 4320 agagctgggt gcaccagatt gccctgagga tggaggtgct gggctgtgag gcccaggacc 4380 tgtactgaaa taaaagatct ttattttcat tagatctgtg tgttggtttt ttgtgtg 4437 <210> 321 <211> 4775 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1000 <400> 321 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag gggatggcca 120 actccatcac taggggttcc tgcggcctaa ggcaattgtg ccagttcccg atcgttacag 180 gcggtactcc tcaaagcgta ctaaagaatt attcttttac atttcagtgg ccaccagaag 240 gtactacctg ggagctgtgg aactgagctg ggactacatg cagtctgacc tgggagagct 300 gcctgtggat gctagatttc ctccaagagt gcccaagagc ttccccttca acacctctgt 360 ggtgtacaag aaaaccctgt ttgtggaatt cacagaccac ctgttcaata ttgccaagcc 420 tagacctcct tggatgggcc tgctgggccc tacaattcag gctgaggtgt atgacacagt 480 ggtcatcacc ctgaagaaca tggccagcca tcctgtgtct ctgcatgctg tgggagtgtc 540 ttactggaag gcttctgagg gggctgagta tgatgaccag acaagccaga gagagaaaga 600 ggatgacaag gttttccctg ggggcagcca cacctatgtc tggcaggtcc tgaaagaaaa 660 tggccctatg gcctctgatc ctctgtgcct gacatacagc tacctgagcc atgtggacct 720 ggtcaaggac ctgaactctg gcctgattgg ggctctgctg gtgtgtagag aaggcagcct 780 ggccaaagaa aagacccaga cactgcacaa gttcatcctg ctgtttgctg tgtttgatga 840 gggcaagagc tggcactctg agacaaagaa cagcctgatg caggacagag atgctgcctc 900 tgctagagct tggcccaaga tgcacacagt gaatggctat gtgaacagaa gcctgcctgg 960 actgattgga tgccacagaa agtctgtgta ctggcatgtg attggcatgg gcaccacacc 1020 tgaggtgcac agcatctttc tggaaggaca caccttcctg gtgaggaacc acagacaggc 1080 cagcctggaa atcagcccta tcaccttcct gacagctcag accctgctga tggatctggg 1140 ccagtttctg ctgttctgcc acatcagcag ccaccagcat gatggcatgg aagcctatgt 1200 gaaggtggac agctgccctg aagaacccca gctgagaatg aagaacaatg aggaagctga 1260 ggactatgat gatgacctga cagactctga gatggatgtg gtcagatttg atgatgataa 1320 cagccccagc ttcatccaga tcagatctgt ggccaagaag caccccaaga cctgggtgca 1380 ctatattgct gctgaggaag aggactggga ttatgctcct ctggtgctgg cccctgatga 1440 cagaagctac aagagccagt acctgaacaa tggccctcag agaattggca ggaagtataa 1500 gaaagtgagg ttcatggcct acacagatga gacattcaag accagagagg ctatccagca 1560 tgagtctggc attctgggac ctctgctgta tggggaagtg ggggacacac tgctgatcat 1620 cttcaagaac caggccagca gaccctacaa catctaccct catggcatca cagatgtgag 1680 gcctctgtac tctagaaggc tgcccaaggg ggtgaagcac ctgaaggact tccctatcct 1740 gcctggggag atcttcaagt acaagtggac agtgacagtg gaggatggcc ctaccaagtc 1800 tgatcctaga tgcctgacaa ggtactacag cagctttgtg aacatggaaa gggacctggc 1860 ctctggcctg attggtcctc tgctgatctg ctacaaagaa tctgtggacc agaggggcaa 1920 ccagatcatg agtgacaaga gaaatgtgat cctgttctct gtctttgatg agaacaggtc 1980 ctggtatctg acagagaaca tccagaggtt tctgcccaat cctgctgggg tgcagctgga 2040 agatcctgag ttccaggcct ccaacatcat gcactccatc aatggctatg tgtttgacag 2100 cctgcagctg tctgtgtgcc tgcatgaagt ggcctactgg tacatcctgt ctattggggc 2160 ccagacagac ttcctgtctg tgttcttttc tggctacacc ttcaagcaca agatggtgta 2220 tgaggatacc ctgacactgt tcccattctc tggggagaca gtgttcatga gcatggaaaa 2280 ccctggcctg tggatcctgg gctgtcacaa cagtgacttc agaaacagag gcatgacagc 2340 cctgctgaag gtgtccagct gtgacaagaa cactggggac tactatgagg actcttatga 2400 ggacatctct gcctacctgc tgagcaagaa caatgccatt gagcctagga gcttctctca 2460 gaaccctcct gtgctgaaga gacaccagag ggagatcacc agaaccacac tgcagtctga 2520 ccaagaggaa attgattatg atgacaccat ctctgtggag atgaagaaag aagattttga 2580 catctatgat gaggatgaga atcagagccc cagatctttc cagaagaaaa caaggcacta 2640 cttcattgct gctgtggaaa gactgtggga ctatggcatg agcagcagcc cccatgtgct 2700 gagaaacagg gcccagtctg gaagtgtgcc ccagttcaag aaagtggtgt tccaagagtt 2760 cacagatggc agcttcaccc agcctctgta tagaggggag ctgaatgagc acctgggact 2820 gctgggacct tacatcagag ctgaggtgga ggataacatc atggtcacct ttagaaacca 2880 ggcctctagg ccctactcct tctacagctc cctgatcagc tatgaagagg accagagaca 2940 gggggctgag cccagaaaga actttgtgaa gcccaatgag actaagacct acttttggaa 3000 ggtgcagcac cacatggccc ctacaaagga tgagtttgac tgcaaggcct gggcctactt 3060 ctctgatgtg gacctggaga aggatgtgca ctctggactc attggacccc tgcttgtgtg 3120 ccacaccaac acactgaatc ctgctcatgg caggcaagtg acagtgcaag agtttgccct 3180 gttcttcacc atctttgatg agacaaagtc ctggtacttc acagaaaaca tggaaagaaa 3240 ctgcagggcc ccttgcaaca tccagatgga agatcccacc ttcaaagaga actacaggtt 3300 ccatgccatc aatggctaca tcatggacac tctgcctggc ctggttatgg cacaggatca 3360 gaggatcaga tggtatctgc tgtccatggg ctccaatgag aatatccaca gcatccactt 3420 ctctggccat gtgttcacag tgaggaaaaa agaagagtac aagatggccc tgtacaatct 3480 gtaccctggg gtgtttgaga ctgtggaaat gctgcctagc aaggctggaa tctggagggt 3540 ggaatgtctg attggagagc atctgcatgc tggaatgtct accctgttcc tggtgtacag 3600 caacaagtgt cagacccctc tgggcatggc ctctggacac atcagagact tccagatcac 3660 agcctctggc cagtatggac agtgggctcc taaactggct agactgcact actctggcag 3720 catcaatgcc tggtccacca aagagccctt cagctggatc aaggtggacc tgctggctcc 3780 catgatcatc catggaatca agacccaggg ggccagacag aagttcagca gcctgtacat 3840 cagccagttc atcatcatgt acagcctgga tggcaagaag tggcagacct acagaggcaa 3900 cagcacaggc acactcatgg tgttctttgg caatgtggac tcttctggca ttaagcacaa 3960 catcttcaac cctccaatca ttgccaggta catcaggctg caccccacac actacagcat 4020 cagatctacc ctgaggatgg aactgatggg ctgtgacctg aacagctgct ctatgcccct 4080 gggaatggaa agcaaggcca tctctgatgc ccagatcaca gccagcagct acttcaccaa 4140 catgtttgcc acatggtccc catctaaggc caggctgcat ctgcagggca gatctaatgc 4200 ttggaggccc caagtgaaca accccaaaga gtggctgcag gtggactttc agaaaaccat 4260 gaaagtgaca ggagtgacca cacagggggt caagtctctg ctgacctcta tgtatgtgaa 4320 agagttcctg atctccagca gccaggatgg ccaccagtgg accctgtttt tccagaatgg 4380 caaagtcaag gtgttccagg gaaaccagga cagcttcaca cctgtggtca actccctgga 4440 tcctccactg ctgaccagat acctgagaat tcaccctcag tcttgggtgc accagattgc 4500 tctgagaatg gaagtgctgg gatgtgaagc tcaggacctc tactgatcgc gaataaaaga 4560 tctttatttt cattagatct gtgtgttggt tttttgtgtg tgccagttcc cgatcgttac 4620 aggccgcggg ccgcaggaac ccctagtgat ggagttggcc actccctctc tgcgcgctcg 4680 ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc ccgggctttg cccgggcggc 4740 ctcagtgagc gagcgagcgc gcagctgcct gcagg 4775 <210> 322 <211> 4775 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1001 <400> 322 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag gggatggcca 120 actccatcac taggggttcc tgcggcctaa ggcaattgtg ccagttcccg atcgttacag 180 gcggtactcc tcaaagcgta ctaaagaatt attcttttac atttcagtgg ccaccagaag 240 gtactaccta ggagccgtgg aactgagctg ggactacatg cagtctgacc tgggagagct 300 gcccgtggac gctagatttc ctccaagagt gcccaagagc ttccccttca acacctccgt 360 ggtgtacaag aaaaccctgt tcgtggaatt caccgaccac ctgttcaata tcgccaagcc 420 tagacctcct tggatgggcc tgctgggccc tacaattcag gccgaggtgt acgacaccgt 480 ggtcatcacc ctgaagaaca tggccagcca tcctgtgtct ctgcacgccg tgggagtgtc 540 ttactggaag gcttctgagg gcgccgagta cgacgaccag acaagccaga gagagaaaga 600 ggacgacaag gttttccctg gcggcagcca cacctatgtc tggcaggtcc tgaaagaaaa 660 cggccctatg gcctccgatc ctctgtgcct gacatacagc tacctgagcc atgtggacct 720 ggtcaaggac ctgaactctg gcctgatcgg cgctctgctc gtgtgtagag aaggcagcct 780 ggccaaagaa aagacccaga cactgcacaa gttcatcctg ctgttcgccg tgttcgacga 840 gggcaagagc tggcacagcg agacaaagaa cagcctgatg caggacagag atgccgcctc 900 tgctagagct tggcccaaga tgcacaccgt gaacggctac gtgaacagaa gcctgcctgg 960 actgatcgga tgccacagaa agtccgtgta ctggcatgtg atcggcatgg gcaccacacc 1020 tgaggtgcac agcatctttc tggaaggaca caccttcctc gtgcggaacc acagacaggc 1080 cagcctggaa atcagcccta tcaccttcct gaccgctcag accctgctga tggatctggg 1140 ccagtttctg ctgttctgcc acatcagcag ccaccagcac gatggcatgg aagcctacgt 1200 gaaggtggac agctgccccg aagaacccca gctgagaatg aagaacaacg aggaagccga 1260 ggactacgac gacgacctga ccgactctga gatggacgtc gtcagattcg acgacgataa 1320 cagccccagc ttcatccaga tcagaagcgt ggccaagaag caccccaaga cctgggtgca 1380 ctatatcgcc gccgaggaag aggactggga tacgctcct ctggtgctgg cccctgacga 1440 cagaagctac aagagccagt acctgaacaa cggccctcag agaatcggcc ggaagtataa 1500 gaaagtgcgg ttcatggcct acaccgacga gacattcaag accagagagg ctatccagca 1560 cgagagcggc attctgggac ctctgctgta tggcgaagtg ggcgacacac tgctgatcat 1620 cttcaagaac caggccagca gaccctacaa catctaccct cacggcatca ccgatgtgcg 1680 gcctctgtac tctagaaggc tgcccaaggg cgtgaagcac ctgaaggact tccctatcct 1740 gcctggcgag atcttcaagt acaagtggac cgtgaccgtc gaggacggcc ctaccaagag 1800 cgatcctaga tgcctgacac ggtactacag cagcttcgtg aacatggaac gcgacctggc 1860 cagcggcctg attggtcctc tgctgatctg ctacaaagaa agcgtggacc agaggggcaa 1920 ccagatcatg agcgacaaga gaaacgtgat cctgttctcc gtctttgacg agaacaggtc 1980 ctggtatctg accgagaaca tccagcggtt tctgcccaat cctgctggcg tgcagctgga 2040 agatcctgag ttccaggcct ccaacatcat gcactccatc aacggctatg tgttcgacag 2100 cctgcagctg agcgtgtgcc tgcacgaagt ggcctactgg tacatcctgt ctatcggcgc 2160 ccagaccgac ttcctgtccg tgttctttag cggctacacc ttcaagcaca agatggtgta 2220 cgaggatacc ctgacactgt tcccattcag cggcgagaca gtgttcatga gcatggaaaa 2280 ccccggcctg tggatcctgg gctgtcacaa cagcgacttc agaaacagag gcatgacagc 2340 cctgctgaag gtgtccagct gcgacaagaa caccggcgac tactacgagg actcttacga 2400 ggacatcagc gcctacctgc tgagcaagaa caatgccatc gagcctcgga gcttctctca 2460 gaaccctcct gtgctgaaga gacaccagcg cgagatcacc agaaccacac tgcagagcga 2520 ccaagaggaa atcgattacg acgacaccat cagcgtcgag atgaagaaag aagatttcga 2580 catctacgac gaggacgaga atcagagccc cagatctttc cagaagaaaa cgcggcacta 2640 cttcattgcc gccgtggaaa gactgtggga ctacggcatg agcagcagcc cacatgtgct 2700 gagaaacagg gcccagagcg gaagcgtgcc ccagttcaag aaagtggtgt tccaagagtt 2760 caccgacggc agcttcaccc agcctctgta tagaggcgag ctgaacgagc acctgggact 2820 gctgggacct tacatcagag ctgaggtcga ggataacatc atggtcacct ttagaaacca 2880 ggcctctagg ccctactcct tctacagctc cctgatcagc tacgaagagg accagagaca 2940 gggcgctgag cccagaaaga acttcgtgaa gcccaacgag actaagacct acttttggaa 3000 ggtgcagcac cacatggccc ctacaaagga cgagttcgac tgcaaggcct gggcctactt 3060 ctctgacgtg gacctcgaga aggatgtgca cagcggactc atcggacccc tgcttgtgtg 3120 ccacaccaac acactgaatc ccgctcacgg caggcaagtg accgtgcaag agttcgccct 3180 gttcttcacc atcttcgatg agacaaagtc ctggtacttc accgaaaaca tggaaagaaa 3240 ctgcagggcc ccttgcaaca tccagatgga agatcccacc ttcaaagaga actaccggtt 3300 ccacgccatc aatggctaca tcatggacac tctgcccggc ctggttatgg cacaggatca 3360 gaggatcaga tggtatctgc tgtccatggg ctccaacgag aatatccaca gcatccactt 3420 cagcggccat gtgttcaccg tgcggaaaaa agaagagtac aagatggccc tgtacaatct 3480 gtaccccggc gtgttcgaga ctgtggaaat gctgcctagc aaggccggaa tctggcgcgt 3540 ggaatgtctg atcggagagc atctgcatgc cggaatgtct accctgttcc tggtgtacag 3600 caacaagtgt cagacccctc tcggcatggc ctctggacac atcagagact tccagatcac 3660 cgcctctggc cagtacggac agtgggctcc taaactggct agactgcact acagcggcag 3720 catcaacgcc tggtccacca aagagccctt cagctggatc aaggtggacc tgctggctcc 3780 catgatcatc cacggaatca agacccaggg cgccagacag aagttcagca gcctgtacat 3840 cagccagttc atcatcatgt acagcctgga cggcaagaag tggcagacct acagaggcaa 3900 cagcaccggc acactcatgg tgttcttcgg caacgtggac tccagcggca ttaagcacaa 3960 catcttcaac cctccaatca ttgcccggta catccggctg caccccacac actacagcat 4020 cagatctacc ctgaggatgg aactgatggg ctgcgacctg aacagctgct ctatgcccct 4080 cggaatggaa agcaaggcca tcagcgacgc ccagatcaca gccagcagct acttcaccaa 4140 catgttcgcc acatggtccc catctaaggc ccggctgcat ctgcagggca gatctaacgc 4200 ttggaggccc caagtgaaca accccaaaga gtggctgcag gtcgactttc agaaaaccat 4260 gaaagtgacc ggcgtgacca cacagggcgt caagtctctg ctgacctcta tgtacgtgaa 4320 agagttcctg atctccagca gccaggacgg ccaccagtgg accctgtttt tccagaacgg 4380 caaagtcaag gtgttccagg gaaaccagga cagcttcaca cccgtggtca actccctgga 4440 tcctccactg ctgaccagat acctgagaat tcaccctcag tcttgggtgc accagatcgc 4500 tctgagaatg gaagtgctgg gatgtgaagc tcaggacctc tactgatcgc gaataaaaga 4560 tctttatttt cattagatct gtgtgttggt tttttgtgtg tgccagttcc cgatcgttac 4620 aggccgcggg ccgcaggaac ccctagtgat ggagttggcc actccctctc tgcgcgctcg 4680 ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc ccgggctttg cccgggcggc 4740 ctcagtgagc gagcgagcgc gcagctgcct gcagg 4775 <210> 323 <211> 4780 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1002 <400> 323 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag gggatggcca 120 actccatcac taggggttcc tgcggccctc gagtgccagt tcccgatcgt tacaggcggt 180 actcctcaaa gcgtactaaa gaattattct tttacatttc agtggctacc agaagatact 240 acctgggagc cgtcgaactg agctgggatt acatgcagtc tgacctggga gagctgcccg 300 tggacgctag attcccacct agagtcccta agtccttccc cttcaacacc agcgtggtct 360 acaagaaaac cctgttcgtg gagtttaccg accacctgtt caacatcgct aagcctagac 420 caccatggat gggactgctg ggaccaacca tccaggccga ggtgtacgac accgtggtca 480 tcaccctgaa aaacatggct tctcaccccg tgtccctgca tgctgtgggc gtctcctact 540 ggaaggccag cgaaggggct gagtatgacg atcagaccag ccagcgggaa aaagaggacg 600 ataaggtgtt ccctggcggg tcccatacct acgtgtggca ggtcctgaag gagaatggac 660 caatggcttc cgaccctctg tgcctgacct actcttatct gtcccacgtg gacctggtca 720 aggatctgaa cagcggcctg atcggggctc tgctggtgtg tcgcgaaggg tccctggcca 780 aggagaaaac ccagaccctg cataagttca tcctgctgtt cgccgtgttt gacgaaggaa 840 aaagctggca ctctgagacc aagaactctc tgatgcagga cagggatgcc gcttccgcca 900 gagcttggcc caagatgcac accgtgaacg gctacgtcaa taggagcctg cctggactga 960 tcggctgcca cagaaagtcc gtgtattggc atgtcatcgg aatgggcacc acccctgaag 1020 tgcacagcat cttcctggag gggcatacct ttctggtccg caaccaccgg caggctagcc 1080 tggagatctc tccaatcacc ttcctgaccg cccagaccct gctgatggac ctgggacagt 1140 tcctgctgtt ttgccacatc tccagccacc agcatgatgg catggaggct tacgtgaaag 1200 tcgactcctg tcccgaggaa cctcagctga ggatgaagaa caatgaggaa gccgaagact 1260 atgacgatga cctgaccgac agcgagatgg atgtggtccg cttcgatgac gataactctc 1320 cctcctttat ccagatccgg tccgtggcca agaaacaccc taagacctgg gtccattaca 1380 tcgccgctga ggaagaggac tgggattatg ctccactggt gctggccccc gacgatagat 1440 cctacaaaag ccagtatctg aacaatggac cccagaggat cggcagaaag tacaagaaag 1500 tgaggttcat ggcttatacc gatgagacct ttaagaccag agaagccatc cagcacgagt 1560 ccgggatcct gggacctctg ctgtacggcg aagtggggga caccctgctg atcatcttca 1620 agaaccaggc cagcaggcct tacaatatct atccacatgg catcaccgat gtgagacctc 1680 tgtactcccg ccggctgcca aagggcgtga aacacctgaa ggacttccca atcctgcccg 1740 gggaaatctt taagtataaa tggaccgtca ccgtcgagga tgggcccacc aagagcgacc 1800 ctaggtgcct gaccagatac tattcttcct tcgtgaatat ggagagagac ctggcttccg 1860 gactgatcgg acccctgctg atctgttaca aagagagcgt ggatcagcgc ggcaaccaga 1920 tcatgtctga caagcggaat gtgatcctgt tcagcgtctt tgacgaaaac cgctcttggt 1980 acctgaccga gaacatccag cggttcctgc ctaatccagc tggagtgcag ctggaagatc 2040 ccgagttcca ggcctctaac atcatgcatt ccatcaatgg ctacgtgttc gactccctgc 2100 agctgagcgt gtgcctgcac gaggtcgctt actggtatat cctgagcatc ggagcccaga 2160 ccgatttcct gtctgtgttc ttttccggct acacctttaa gcataaaatg gtgtatgagg 2220 acaccctgac cctgttccca ttttccggcg aaaccgtgtt catgagcatg gagaatcccg 2280 ggctgtggat cctgggatgc cacaactccg atttcaggaa tagagggatg accgccctgc 2340 tgaaagtgag ctcttgtgac aagaacaccg gagactacta tgaagatagc tacgaggaca 2400 tctctgctta tctgctgtcc aaaaacaatg ccatcgagcc caggagcttc tctcagaacc 2460 ctccagtgct gaagcgccac cagcgggaga tcaccagaac caccctgcag agcgatcagg 2520 aagagatcga ctacgacgat accatctccg tggaaatgaa gaaagaggac ttcgatatct 2580 atgacgaaga tgagaaccag tctcccaggt ccttccagaa gaaaaccaga cattacttta 2640 tcgccgctgt ggagcggctg tgggactatg gcatgtccag ctctcctcac gtgctgagaa 2700 atagagctca gtccggaagc gtcccacagt tcaagaaagt ggtcttccag gagtttaccg 2760 acggaagctt tacccagcca ctgtaccgcg gcgaactgaa cgagcacctg gggctgctgg 2820 gaccctatat ccgggctgaa gtggaggata acatcatggt caccttcagg aatcaggcca 2880 gcagacccta ctctttttat tccagcctga tctcctacga agaggaccag agacagggag 2940 ctgaaccaag aaaaaacttc gtgaagccta atgagaccaa aacctacttt tggaaggtgc 3000 agcaccatat ggcccctacc aaagacgagt tcgattgcaa ggcctgggct tattttagcg 3060 acgtggatct ggagaaggac gtccactccg gcctgatcgg gccactgctg gtgtgtcata 3120 ccaacaccct gaatccagct cacggaaggc aggtgaccgt ccaggaattc gccctgttct 3180 ttaccatctt tgatgagacc aagagctggt acttcaccga aaacatggag aggaattgca 3240 gagccccatg taacatccag atggaagacc ccaccttcaa ggagaactac agatttcatg 3300 ctatcaatgg gtatatcatg gataccctgc caggactggt catggctcag gaccagagga 3360 tcagatggta cctgctgagc atggggtcta acgagaatat ccactccatc catttcagcg 3420 gacacgtgtt taccgtccgc aagaaagaag agtacaagat ggccctgtac aacctgtatc 3480 ccggcgtgtt cgaaaccgtc gagatgctgc cttccaaggc tgggatctgg cgggtggaat 3540 gcctgatcgg ggagcacctg catgccggaa tgtctaccct gttcctggtg tactccaata 3600 agtgtcagac ccccctgggg atggctagcg gacatatccg cgacttccag atcaccgctt 3660 ccggacagta cggacagtgg gctcctaagc tggctagact gcactattct ggctccatca 3720 acgcttggtc taccaaagag cctttctcct ggatcaaggt ggacctgctg gctccaatga 3780 tcatccatgg catcaaaacc cagggggcca ggcagaagtt ctcttccctg tacatcagcc 3840 agtttatcat catgtattct ctggatggga agaaatggca gacctacaga ggcaattcca 3900 ccgggaccct gatggtgttc tttggcaacg tcgacagctc tgggatcaag cacaacatct 3960 tcaatccccc tatcatcgcc cgctacatcc ggctgcaccc aacccattat tccatccgca 4020 gcaccctgcg gatggagctg atggggtgcg atctgaacag ctgttctatg cccctgggaa 4080 tggagtctaa ggccatctcc gacgctcaga tcaccgcctc cagctacttc accaatatgt 4140 ttgctacctg gtccccaagc aaggctagac tgcatctgca gggaagaagc aacgcttgga 4200 gaccacaggt gaacaatccc aaggagtggc tgcaggtcga cttccagaaa accatgaagg 4260 tgaccggagt caccacccag ggcgtgaaaa gcctgctgac ctctatgtac gtcaaggagt 4320 tcctgatctc ttccagccag gacgggcacc agtggaccct gttctttcag aacggaaagg 4380 tgaaagtctt ccagggcaat caggattcct ttacccctgt ggtcaacagc ctggacccac 4440 ccctgctgac caggtacctg agaatccacc cacagtcctg ggtgcatcag atcgctctga 4500 ggatggaagt cctgggctgc gaggcccagg acctgtattg atcgcgaata aaagatcttt 4560 attttcatta gatctgtgtg ttggtttttt gtgtggatct gccagttccc gatcgttaca 4620 ggcaattgcc ttaggccgca ggaaccccta gtgatggagt tggccactcc ctctctgcgc 4680 gctcgctcgc tcactgaggc cgggcgacca aaggtcgccc gacgcccggg ctttgcccgg 4740 gcggcctcag tgagcgagcg agcgcgcagc tgcctgcagg 4780 <210> 324 <211> 4442 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1003 <400> 324 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acattcagt ggctaccaga agatactacc tgggagccgt cgaactgagc tgggattaca 120 tgcagtctga cctgggagag ctgcccgtgg acgctagatt cccacctaga gtccctaagt 180 ccttcccctt caacaccagc gtggtctaca agaaaaccct gttcgtggag tttaccgacc 240 acctgttcaa catcgctaag cctagaccac catggatggg actgctggga ccaaccatcc 300 aggccgaggt gtacgacacc gtggtcatca ccctgaaaaa catggcttct caccccgtgt 360 ccctgcatgc tgtgggcgtc tcctactgga aggccagcga aggggctgag tatgacgatc 420 agaccagcca gcgggaaaaa gaggacgata aggtgttccc tggcgggtcc catacctacg 480 tgtggcaggt cctgaaggag aatggaccaa tggcttccga ccctctgtgc ctgacctact 540 cttatctgtc ccacgtggac ctggtcaagg atctgaacag cggcctgatc ggggctctgc 600 tggtgtgtcg cgaagggtcc ctggccaagg agaaaaccca gaccctgcat aagttcatcc 660 tgctgttcgc cgtgtttgac gaaggaaaaa gctggcactc tgagaccaag aactctctga 720 tgcaggacag ggatgccgct tccgccagag cttggcccaa gatgcacacc gtgaacggct 780 acgtcaatag gagcctgcct ggactgatcg gctgccacag aaagtccgtg tattggcatg 840 tcatcggaat gggcaccacc cctgaagtgc acagcatctt cctggagggg catacctttc 900 tggtccgcaa ccaccggcag gctagcctgg agatctctcc aatcaccttc ctgaccgccc 960 agaccctgct gatggacctg ggacagttcc tgctgttttg ccacatctcc agccaccagc 1020 atgatggcat ggaggcttac gtgaaagtcg actcctgtcc cgaggaacct cagctgagga 1080 tgaagaacaa tgaggaagcc gaagactatg acgatgacct gaccgacagc gagatggatg 1140 tggtccgctt cgatgacgat aactctccct cctttatcca gatccggtcc gtggccaaga 1200 aacaccctaa gacctgggtc cattacatcg ccgctgagga agaggactgg gattatgctc 1260 cactggtgct ggcccccgac gatagatcct acaaaagcca gtatctgaac aatggacccc 1320 agaggatcgg cagaaagtac aagaaagtga ggttcatggc ttataccgat gagaccttta 1380 agaccagaga agccatccag cacgagtccg ggatcctggg acctctgctg tacggcgaag 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccttac aatatctatc 1500 cacatggcat caccgatgtg agacctctgt actcccgccg gctgccaaag ggcgtgaaac 1560 acctgaagga cttcccaatc ctgcccgggg aaatctttaa gtataaatgg accgtcaccg 1620 tcgaggatgg gcccaccaag agcgacccta ggtgcctgac cagatactat tcttccttcg 1680 tgaatatgga gagagacctg gcttccggac tgatcggacc cctgctgatc tgttacaaag 1740 agagcgtgga tcagcgcggc aaccagatca tgtctgacaa gcggaatgtg atcctgttca 1800 gcgtctttga cgaaaaccgc tcttggtacc tgaccgagaa catccagcgg ttcctgccta 1860 atccagctgg agtgcagctg gaagatcccg agttccaggc ctctaacatc atgcattcca 1920 tcaatggcta cgtgttcgac tccctgcagc tgagcgtgtg cctgcacgag gtcgcttact 1980 ggtatatcct gagcatcgga gcccagaccg atttcctgtc tgtgttcttt tccggctaca 2040 cctttaagca taaaatggtg tatgaggaca ccctgaccct gttcccattt tccggcgaaa 2100 ccgtgttcat gagcatggag aatcccgggc tgtggatcct gggatgccac aactccgatt 2160 tcaggaatag agggatgacc gccctgctga aagtgagctc ttgtgacaag aacaccggag 2220 actactatga agatagctac gaggacatct ctgcttatct gctgtccaaa aacaatgcca 2280 tcgagcccag gagcttctct cagaaccctc cagtgctgaa gcgccaccag cgggagatca 2340 ccagaaccac cctgcagagc gatcaggaag agatcgacta cgacgatacc atctccgtgg 2400 aaatgaagaa agaggacttc gatatctatg acgaagatga gaaccagtct cccaggtcct 2460 tccagaagaa aaccagacat tactttatcg ccgctgtgga gcggctgtgg gactatggca 2520 tgtccagctc tcctcacgtg ctgagaaata gagctcagtc cggaagcgtc ccacagttca 2580 agaaagtggt cttccaggag tttaccgacg gaagctttac ccagccactg taccgcggcg 2640 aactgaacga gcacctgggg ctgctgggac cctatatccg ggctgaagtg gaggataaca 2700 tcatggtcac cttcaggaat caggccagca gaccctactc tttttattcc agcctgatct 2760 cctacgaaga ggaccagaga cagggagctg aaccaagaaa aaacttcgtg aagcctaatg 2820 agaccaaaac ctacttttgg aaggtgcagc accatatggc ccctaccaaa gacgagttcg 2880 attgcaaggc ctgggcttat tttagcgacg tggatctgga gaaggacgtc cactccggcc 2940 tgatcgggcc actgctggtg tgtcatacca acaccctgaa tccagctcac ggaaggcagg 3000 tgaccgtcca ggaattcgcc ctgttcttta ccatctttga tgagaccaag agctggtact 3060 tcaccgaaaa catggagagg aattgcagag ccccatgtaa catccagatg gaagacccca 3120 ccttcaagga gaactacaga tttcatgcta tcaatgggta tatcatggat accctgccag 3180 gactggtcat ggctcaggac cagaggatca gatggtacct gctgagcatg gggtctaacg 3240 agaatatcca ctccatccat ttcagcggac acgtgtttac cgtccgcaag aaagaagagt 3300 acaagatggc cctgtacaac ctgtatcccg gcgtgttcga aaccgtcgag atgctgcctt 3360 ccaaggctgg gatctggcgg gtggaatgcc tgatcgggga gcacctgcat gccggaatgt 3420 ctaccctgtt cctggtgtac tccaataagt gtcagacccc cctggggatg gctagcggac 3480 atatccgcga cttccagatc accgcttccg gacagtacgg acagtgggct cctaagctgg 3540 ctagactgca ctattctggc tccatcaacg cttggtctac caaagagcct ttctcctgga 3600 tcaaggtgga cctgctggct ccaatgatca tccatggcat caaaacccag ggggccaggc 3660 agaagttctc ttccctgtac atcagccagt ttatcatcat gtattctctg gatgggaaga 3720 aatggcagac ctacagaggc aattccaccg ggaccctgat ggtgttcttt ggcaacgtcg 3780 acagctctgg gatcaagcac aacatcttca atccccctat catcgcccgc tacatccggc 3840 tgcacccaac ccattattcc atccgcagca ccctgcggat ggagctgatg gggtgcgatc 3900 tgaacagctg ttctatgccc ctgggaatgg agtctaaggc catctccgac gctcagatca 3960 ccgcctccag ctacttcacc aatatgtttg ctacctggtc cccaagcaag gctagactgc 4020 atctgcaggg aagaagcaac gcttggagac cacaggtgaa caatcccaag gagtggctgc 4080 aggtcgactt ccagaaaacc atgaaggtga ccggagtcac cacccagggc gtgaaaagcc 4140 tgctgacctc tatgtacgtc aaggagttcc tgatctcttc cagccaggac gggcaccagt 4200 ggaccctgtt ctttcagaac ggaaaggtga aagtcttcca gggcaatcag gattccttta 4260 cccctgtggt caacagcctg gacccacccc tgctgaccag gtacctgaga atccacccac 4320 agtcctgggt gcatcagatc gctctgagga tggaagtcct gggctgcgag gcccaggacc 4380 tgtattgatc gcgaataaaa gatctttatt ttcattagat ctgtgtgttg gttttttgtg 4440 tg 4442 <210> 325 <211> 4493 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1006 <400> 325 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacaccaa tgtgtctccc ccagtgctga agaggcacca gagggagatc accaggacca 2400 ccctgcagtc tgaccaggag gagattgact atgatgacac catctctgtg gagatgaaga 2460 aggaggactt tgacatctac gacgaggacg agaaccagag ccccaggagc ttccagaaga 2520 agaccaggca ctacttcatt gctgctgtgg agaggctgtg ggactatggc atgagcagca 2580 gcccccatgt gctgaggaac agggcccagt ctggctctgt gccccagttc aagaaggtgg 2640 tgttccagga gttcactgat ggcagcttca cccagcccct gtacagaggg gagctgaatg 2700 agcacctggg cctgctgggc ccctacatca gggctgaggt ggaggacaac atcatggtga 2760 ccttcaggaa ccaggccagc aggccctaca gcttctacag cagcctgatc agctatgagg 2820 aggaccagag gcagggggct gagcccagga agaactttgt gaagcccaat gaaaccaaga 2880 cctacttctg gaaggtgcag caccacatgg cccccaccaa ggatgagttt gactgcaagg 2940 cctgggccta cttctctgat gtggacctgg agaaggatgt gcactctggc ctgattggcc 3000 ccctgctggt gtgccacacc aacaccctga accctgccca tggcaggcag gtgactgtgc 3060 aggagtttgc cctgttcttc accatctttg atgaaaccaa gagctggtac ttcactgaga 3120 acatggagag gaactgcagg gccccctgca acatccagat ggaggacccc accttcaagg 3180 agaactacag gttccatgcc atcaatggct acatcatgga caccctgcct ggcctggtga 3240 tggcccagga ccagaggatc aggtggtacc tgctgagcat gggcagcaat gagaacatcc 3300 acagcatcca cttctctggc catgtgttca ctgtgaggaa gaaggaggag tacaagatgg 3360 ccctgtacaa cctgtaccct ggggtgtttg agactgtgga gatgctgccc agcaaggctg 3420 gcatctggag ggtggagtgc ctgattgggg agcacctgca tgctggcatg agcaccctgt 3480 tcctggtgta cagcaacaag tgccagaccc ccctgggcat ggcctctggc cacatcaggg 3540 acttccagat cactgcctct ggccagtatg gccagtgggc ccccaagctg gccaggctgc 3600 actactctgg cagcatcaat gcctggagca ccaaggagcc cttcagctgg atcaaggtgg 3660 acctgctggc ccccatgatc atccatggca tcaagaccca gggggccagg cagaagttca 3720 gcagcctgta catcagccag ttcatcatca tgtacagcct ggatggcaag aagtggcaga 3780 cctacagggg caacagcact ggcaccctga tggtgttctt tggcaatgtg gacagctctg 3840 gcatcaagca caacatcttc aaccccccca tcattgccag atacatcagg ctgcacccca 3900 cccactacag catcaggagc accctgagga tggagctgat gggctgtgac ctgaacagct 3960 gcagcatgcc cctgggcatg gagagcaagg ccatctctga tgcccagatc actgccagca 4020 gctacttcac caacatgttt gccacctgga gccccagcaa ggccaggctg cacctgcagg 4080 gcaggagcaa tgcctggagg ccccaggtca acaaccccaa ggagtggctg caggtggact 4140 tccagaagac catgaaggtg actggggtga ccacccaggg ggtgaagagc ctgctgacca 4200 gcatgtatgt gaaggagttc ctgatcagca gcagccagga tggccaccag tggaccctgt 4260 tcttccagaa tggcaaggtg aaggtgttcc agggcaacca ggacagcttc acccctgtgg 4320 tgaacagcct ggaccccccc ctgctgacca gatacctgag gattcacccc cagagctggg 4380 tgcaccagat tgccctgagg atggaggtgc tgggctgtga ggcccaggac ctgtactgat 4440 cgcgaataaa agatctttat tttcattaga tctgtgtgtt ggttttttgt gtg 4493 <210> 326 <211> 4484 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1007 <400> 326 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacagccc cccagtgctg aagaggcacc agagggagat caccaggacc accctgcagt 2400 ctgaccagga ggagattgac tatgatgaca ccatctctgt ggagatgaag aaggaggact 2460 ttgacatcta cgacgaggac gagaaccaga gccccaggag cttccagaag aagaccaggc 2520 actacttcat tgctgctgtg gagaggctgt gggactatgg catgagcagc agcccccatg 2580 tgctgaggaa cagggcccag tctggctctg tgccccagtt caagaaggtg gtgttccagg 2640 agttcactga tggcagcttc acccagcccc tgtacagagg ggagctgaat gagcacctgg 2700 gcctgctggg cccctacat agggctgagg tggaggacaa catcatggtg accttcagga 2760 accaggccag caggccctac agcttctaca gcagcctgat cagctatgag gaggaccaga 2820 ggcagggggc tgagcccagg aagaactttg tgaagcccaa tgaaaccaag acctacttct 2880 ggaaggtgca gcaccacatg gccccccacca aggatgagtt tgactgcaag gcctgggcct 2940 acttctctga tgtggacctg gagaaggatg tgcactctgg cctgattggc cccctgctgg 3000 tgtgccacac caacaccctg aaccctgccc atggcaggca ggtgactgtg caggagtttg 3060 ccctgttctt caccatcttt gatgaaacca agagctggta cttcactgag aacatggaga 3120 ggaactgcag ggccccctgc aacatccaga tggaggaccc caccttcaag gagaactaca 3180 ggttccatgc catcaatggc tacatcatgg acaccctgcc tggcctggtg atggcccagg 3240 accagaggat caggtggtac ctgctgagca tgggcagcaa tgagaacatc cacagcatcc 3300 acttctctgg ccatgtgttc actgtgagga agaaggagga gtacaagatg gccctgtaca 3360 acctgtaccc tggggtgttt gagactgtgg agatgctgcc cagcaaggct ggcatctgga 3420 gggtggagtg cctgattggg gagcacctgc atgctggcat gagcaccctg ttcctggtgt 3480 acagcaacaa gtgccagacc cccctgggca tggcctctgg ccacatcagg gacttccaga 3540 tcactgcctc tggccagtat ggccagtggg cccccaagct ggccaggctg cactactctg 3600 gcagcatcaa tgcctggagc accaaggagc ccttcagctg gatcaaggtg gacctgctgg 3660 cccccatgat catccatggc atcaagaccc agggggccag gcagaagttc agcagcctgt 3720 acatcagcca gttcatcatc atgtacagcc tggatggcaa gaagtggcag acctacaggg 3780 gcaacagcac tggcaccctg atggtgttct ttggcaatgt ggacagctct ggcatcaagc 3840 acaacatctt caaccccccc atcattgcca gatacatcag gctgcacccc acccactaca 3900 gcatcaggag caccctgagg atggagctga tgggctgtga cctgaacagc tgcagcatgc 3960 ccctgggcat ggagagcaag gccatctctg atgcccagat cactgccagc agctacttca 4020 ccaacatgtt tgccacctgg agccccagca aggccaggct gcacctgcag ggcaggagca 4080 atgcctggag gccccaggtc aacaacccca aggagtggct gcaggtggac ttccagaaga 4140 ccatgaaggt gactggggtg accacccagg gggtgaagag cctgctgacc agcatgtatg 4200 tgaaggagtt cctgatcagc agcagccagg atggccacca gtggaccctg ttcttccaga 4260 atggcaaggt gaaggtgttc cagggcaacc aggacagctt cacccctgtg gtgaacagcc 4320 tggacccccc cctgctgacc agatacctga ggattcaccc ccagagctgg gtgcaccaga 4380 ttgccctgag gatggaggtg ctgggctgtg aggcccagga cctgtactga tcgcgaataa 4440 aagatcttta ttttcattag atctgtgtgt tggttttttg tgtg 4484 <210> 327 <211> 4502 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1008 <400> 327 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacagcaa tgtgtctaac aagactcccc cagtgctgaa gaggcaccag agggagatca 2400 ccaggaccac cctgcagtct gaccaggagg agattgacta tgatgacacc atctctgtgg 2460 agatgaagaa ggaggacttt gacatctacg acgaggacga gaaccagagc cccaggagct 2520 tccagaagaa gaccaggcac tacttcattg ctgctgtgga gaggctgtgg gactatggca 2580 tgagcagcag cccccatgtg ctgaggaaca gggcccagtc tggctctgtg ccccagttca 2640 agaaggtggt gttccaggag ttcactgatg gcagcttcac ccagcccctg tacagagggg 2700 agctgaatga gcacctgggc ctgctgggcc cctacatcag ggctgaggtg gaggacaaca 2760 tcatggtgac cttcaggaac caggccagca ggccctacag cttctacagc agcctgatca 2820 gctatgagga ggaccagagg cagggggctg agcccaggaa gaactttgtg aagcccaatg 2880 aaaccaagac ctacttctgg aaggtgcagc accacatggc ccccaccaag gatgagtttg 2940 actgcaaggc ctgggcctac ttctctgatg tggacctgga gaaggatgtg cactctggcc 3000 tgattggccc cctgctggtg tgccacacca acaccctgaa ccctgcccat ggcaggcagg 3060 tgactgtgca ggagtttgcc ctgttcttca ccatctttga tgaaaccaag agctggtact 3120 tcactgagaa catggagagg aactgcaggg ccccctgcaa catccagatg gaggacccca 3180 ccttcaagga gaactacagg ttccatgcca tcaatggcta catcatggac accctgcctg 3240 gcctggtgat ggcccaggac cagaggatca ggtggtacct gctgagcatg ggcagcaatg 3300 agaacatcca cagcatccac ttctctggcc atgtgttcac tgtgaggaag aaggaggagt 3360 acaagatggc cctgtacaac ctgtaccctg gggtgtttga gactgtggag atgctgccca 3420 gcaaggctgg catctggagg gtggagtgcc tgattgggga gcacctgcat gctggcatga 3480 gcaccctgtt cctggtgtac agcaacaagt gccagacccc cctgggcatg gcctctggcc 3540 acatcaggga cttccagatc actgcctctg gccagtatgg ccagtgggcc cccaagctgg 3600 ccaggctgca ctactctggc agcatcaatg cctggagcac caaggagccc ttcagctgga 3660 tcaaggtgga cctgctggcc cccatgatca tccatggcat caagacccag ggggccaggc 3720 agaagttcag cagcctgtac atcagccagt tcatcatcat gtacagcctg gatggcaaga 3780 agtggcagac ctacaggggc aacagcactg gcaccctgat ggtgttcttt ggcaatgtgg 3840 acagctctgg catcaagcac aacatcttca acccccccat cattgccaga tacatcaggc 3900 tgcaccccac ccactacagc atcaggagca ccctgaggat ggagctgatg ggctgtgacc 3960 tgaacagctg cagcatgccc ctgggcatgg agagcaaggc catctctgat gcccagatca 4020 ctgccagcag ctacttcacc aacatgtttg ccacctggag ccccagcaag gccaggctgc 4080 acctgcaggg caggagcaat gcctggaggc cccaggtcaa caaccccaag gagtggctgc 4140 aggtggactt ccagaagacc atgaaggtga ctggggtgac cacccagggg gtgaagagcc 4200 tgctgaccag catgtatgtg aaggagttcc tgatcagcag cagccaggat ggccaccagt 4260 ggaccctgtt cttccagaat ggcaaggtga aggtgttcca gggcaaccag gacagcttca 4320 cccctgtggt gaacagcctg gacccccccc tgctgaccag atacctgagg attcaccccc 4380 agagctgggt gcaccagatt gccctgagga tggaggtgct gggctgtgag gcccaggacc 4440 tgtactgatc gcgaataaaa gatctttatt ttcattagat ctgtgtgttg gttttttgtg 4500 tg 4502 <210> 328 <211> 4511 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1015 <400> 328 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacagcaa tgtgtctaac aagactaaca atagcccccc agtgctgaag aggcaccaga 2400 gggagatcac caggaccacc ctgcagtctg accaggagga gattgactat gatgacacca 2460 tctctgtgga gatgaagaag gaggactttg acatctacga cgaggacgag aaccagagcc 2520 ccaggagctt ccagaagaag accaggcact acttcattgc tgctgtggag aggctgtggg 2580 actatggcat gagcagcagc ccccatgtgc tgaggaacag ggcccagtct ggctctgtgc 2640 cccagttcaa gaaggtggtg ttccaggagt tcactgatgg cagcttcacc cagcccctgt 2700 acagagggga gctgaatgag cacctgggcc tgctgggccc ctacatcagg gctgaggtgg 2760 aggacaacat catggtgacc ttcaggaacc aggccagcag gccctacagc ttctacagca 2820 gcctgatcag ctatgaggag gaccagaggc agggggctga gcccaggaag aactttgtga 2880 agcccaatga aaccaagacc tacttctgga aggtgcagca ccacatggcc cccaccaagg 2940 atgagtttga ctgcaaggcc tgggcctact tctctgatgt ggacctggag aaggatgtgc 3000 actctggcct gattggcccc ctgctggtgt gccacaccaa caccctgaac cctgcccatg 3060 gcaggcaggt gactgtgcag gagtttgccc tgttcttcac catctttgat gaaaccaaga 3120 gctggtactt cactgagaac atggagagga actgcagggc cccctgcaac atccagatgg 3180 aggaccccac cttcaaggag aactacaggt tccatgccat caatggctac atcatggaca 3240 ccctgcctgg cctggtgatg gcccaggacc agaggatcag gtggtacctg ctgagcatgg 3300 gcagcaatga gaacatccac agcatccact tctctggcca tgtgttcact gtgaggaaga 3360 aggaggagta caagatggcc ctgtacaacc tgtaccctgg ggtgtttgag actgtggaga 3420 tgctgcccag caaggctggc atctggaggg tggagtgcct gattggggag cacctgcatg 3480 ctggcatgag caccctgttc ctggtgtaca gcaacaagtg ccagaccccc ctgggcatgg 3540 cctctggcca catcagggac ttccagatca ctgcctctgg ccagtatggc cagtgggccc 3600 ccaagctggc caggctgcac tactctggca gcatcaatgc ctggagcacc aaggagccct 3660 tcagctggat caaggtggac ctgctggccc ccatgatcat ccatggcatc aagacccagg 3720 gggccaggca gaagttcagc agcctgtaca tcagccagtt catcatcatg tacagcctgg 3780 atggcaagaa gtggcagacc tacaggggca acagcactgg caccctgatg gtgttctttg 3840 gcaatgtgga cagctctggc atcaagcaca acatcttcaa cccccccatc attgccagat 3900 acatcaggct gcaccccacc cactacagca tcaggagcac cctgaggatg gagctgatgg 3960 gctgtgacct gaacagctgc agcatgcccc tgggcatgga gagcaaggcc atctctgatg 4020 cccagatcac tgccagcagc tacttcacca acatgtttgc cacctggagc cccagcaagg 4080 ccaggctgca cctgcagggc aggagcaatg cctggaggcc ccaggtcaac aaccccaagg 4140 agtggctgca ggtggacttc cagaagacca tgaaggtgac tggggtgacc acccaggggg 4200 tgaagagcct gctgaccagc atgtatgtga aggagttcct gatcagcagc agccaggatg 4260 gccaccagtg gaccctgttc ttccagaatg gcaaggtgaa ggtgttccag ggcaaccagg 4320 acagcttcac ccctgtggtg aacagcctgg acccccccct gctgaccaga tacctgagga 4380 ttcaccccca gagctgggtg caccagattg ccctgaggat ggaggtgctg ggctgtgagg 4440 cccaggacct gtactgatcg cgaataaaag atctttattt tcattagatc tgtgtgttgg 4500 ttttttgtgt g 4511 <210> 329 <211> 4520 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1016 <400> 329 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacagcaa tgtgtctaac aagactaaca atagcaatgc caccccccca gtgctgaaga 2400 ggcaccagag ggagatcacc aggaccaccc tgcagtctga ccaggaggag attgactatg 2460 atgacaccat ctctgtggag atgaagaagg aggactttga catctacgac gaggacgaga 2520 accagagccc caggagcttc cagaagaaga ccaggcacta cttcattgct gctgtggaga 2580 ggctgtggga ctatggcatg agcagcagcc cccatgtgct gaggaacagg gcccagtctg 2640 gctctgtgcc ccagttcaag aaggtggtgt tccaggagtt cactgatggc agcttcaccc 2700 agcccctgta cagaggggag ctgaatgagc acctgggcct gctgggcccc tacatcaggg 2760 ctgaggtgga ggacaacatc atggtgacct tcaggaacca ggccagcagg ccctacagct 2820 tctacagcag cctgatcagc tatgaggagg accagaggca gggggctgag cccaggaaga 2880 actttgtgaa gcccaatgaa accaagacct acttctggaa ggtgcagcac cacatggccc 2940 ccaccaagga tgagtttgac tgcaaggcct gggcctactt ctctgatgtg gacctggaga 3000 aggatgtgca ctctggcctg attggccccc tgctggtgtg ccacaccaac accctgaacc 3060 ctgcccatgg caggcaggtg actgtgcagg agtttgccct gttcttcacc atctttgatg 3120 aaaccaagag ctggtacttc actgagaaca tggagaggaa ctgcagggcc ccctgcaaca 3180 tccagatgga ggaccccacc ttcaaggaga actacaggtt ccatgccatc aatggctaca 3240 tcatggacac cctgcctggc ctggtgatgg cccaggacca gaggatcagg tggtacctgc 3300 tgagcatggg cagcaatgag aacatccaca gcatccactt ctctggccat gtgttcactg 3360 tgaggaagaa ggaggagtac aagatggccc tgtacaacct gtaccctggg gtgtttgaga 3420 ctgtggagat gctgcccagc aaggctggca tctggagggt ggagtgcctg attggggagc 3480 acctgcatgc tggcatgagc accctgttcc tggtgtacag caacaagtgc cagacccccc 3540 tgggcatggc ctctggccac atcagggact tccagatcac tgcctctggc cagtatggcc 3600 agtgggcccc caagctggcc aggctgcact actctggcag catcaatgcc tggagcacca 3660 aggagccctt cagctggatc aaggtggacc tgctggcccc catgatcatc catggcatca 3720 agacccaggg ggccaggcag aagttcagca gcctgtacat cagccagttc atcatcatgt 3780 acagcctgga tggcaagaag tggcagacct acaggggcaa cagcactggc accctgatgg 3840 tgttctttgg caatgtggac agctctggca tcaagcacaa catcttcaac ccccccatca 3900 ttgccagata catcaggctg caccccaccc actacagcat caggagcacc ctgaggatgg 3960 agctgatggg ctgtgacctg aacagctgca gcatgcccct gggcatggag agcaaggcca 4020 tctctgatgc ccagatcact gccagcagct acttcaccaa catgtttgcc acctggagcc 4080 ccagcaaggc caggctgcac ctgcagggca ggagcaatgc ctggaggccc caggtcaaca 4140 accccaagga gtggctgcag gtggacttcc agaagaccat gaaggtgact ggggtgacca 4200 cccagggggt gaagagcctg ctgaccagca tgtatgtgaa ggagttcctg atcagcagca 4260 gccaggatgg ccaccagtgg accctgttct tccagaatgg caaggtgaag gtgttccagg 4320 gcaaccagga cagcttcacc cctgtggtga acagcctgga cccccccctg ctgaccagat 4380 acctgaggat tcacccccag agctgggtgc accagattgc cctgaggatg gaggtgctgg 4440 gctgtgaggc ccaggacctg tactgatcgc gaataaaaga tctttatttt cattagatct 4500 gtgtgttggt tttttgtgtg 4520 <210> 330 <211> 4475 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1017 <400> 330 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctaatgtgtc taacaacagc aacaccagcc 2340 ccccagtgct gaagaggcac cagagggaga tcaccaggac caccctgcag tctgaccagg 2400 aggagattga ctatgatgac accatctctg tggagatgaa gaaggaggac tttgacatct 2460 acgacgagga cgagaaccag agccccagga gcttccagaa gaagaccagg cactacttca 2520 ttgctgctgt ggagaggctg tgggactatg gcatgagcag cagcccccat gtgctgagga 2580 acagggccca gtctggctct gtgccccagt tcaagaaggt ggtgttccag gagttcactg 2640 atggcagctt cacccagccc ctgtacagag gggagctgaa tgagcacctg ggcctgctgg 2700 gcccctacat cagggctgag gtggaggaca acatcatggt gaccttcagg aaccaggcca 2760 gcaggcccta cagcttctac agcagcctga tcagctatga ggaggaccag aggcaggggg 2820 ctgagcccag gaagaacttt gtgaagccca atgaaaccaa gacctacttc tggaaggtgc 2880 agcaccacat ggcccccacc aaggatgagt ttgactgcaa ggcctgggcc tacttctctg 2940 atgtggacct ggagaaggat gtgcactctg gcctgattgg ccccctgctg gtgtgccaca 3000 ccaacaccct gaaccctgcc catggcaggc aggtgactgt gcaggagttt gccctgttct 3060 tcaccatctt tgatgaaacc aagagctggt acttcactga gaacatggag aggaactgca 3120 gggccccctg caacatccag atggaggacc ccaccttcaa ggagaactac aggttccatg 3180 ccatcaatgg ctacatcatg gacaccctgc ctggcctggt gatggcccag gaccagagga 3240 tcaggtggta cctgctgagc atgggcagca atgagaacat ccacagcatc cacttctctg 3300 gccatgtgtt cactgtgagg aagaaggagg agtacaagat ggccctgtac aacctgtacc 3360 ctggggtgtt tgagactgtg gagatgctgc ccagcaaggc tggcatctgg agggtggagt 3420 gcctgattgg ggagcacctg catgctggca tgagcaccct gttcctggtg tacagcaaca 3480 agtgccagac ccccctgggc atggcctctg gccacatcag ggacttccag atcactgcct 3540 ctggccagta tggccagtgg gcccccaagc tggccaggct gcactactct ggcagcatca 3600 atgcctggag caccaaggag cccttcagct ggatcaaggt ggacctgctg gcccccatga 3660 tcatccatgg catcaagacc cagggggcca ggcagaagtt cagcagcctg tacatcagcc 3720 agttcatcat catgtacagc ctggatggca agaagtggca gacctacagg ggcaacagca 3780 ctggcaccct gatggtgttc tttggcaatg tggacagctc tggcatcaag cacaacatct 3840 tcaacccccc catcattgcc agatacatca ggctgcaccc cacccactac agcatcagga 3900 gcaccctgag gatggagctg atgggctgtg acctgaacag ctgcagcatg cccctgggca 3960 tggagagcaa ggccatctct gatgcccaga tcactgccag cagctacttc accaacatgt 4020 ttgccacctg gagccccagc aaggccaggc tgcacctgca gggcaggagc aatgcctgga 4080 ggccccaggt caacaacccc aaggagtggc tgcaggtgga cttccagaag accatgaagg 4140 tgactggggt gaccacccag ggggtgaaga gcctgctgac cagcatgtat gtgaaggagt 4200 tcctgatcag cagcagccag gatggccacc agtggaccct gttcttccag aatggcaagg 4260 tgaaggtgtt ccagggcaac caggacagct tcacccctgt ggtgaacagc ctggaccccc 4320 ccctgctgac cagatacctg aggattcacc cccagagctg ggtgcaccag attgccctga 4380 ggatggaggt gctgggctgt gaggcccagg acctgtactg atcgcgaata aaagatcttt 4440 attttcatta gatctgtgtg ttggtttttt gtgtg 4475 <210> 331 <211> 4466 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1018 <400> 331 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctaatgtgtc taacaacagc cccccagtgc 2340 tgaagaggca ccagagggag atcaccagga ccaccctgca gtctgaccag gaggagattg 2400 actatgatga caccatctct gtggagatga agaaggagga ctttgacatc tacgacgagg 2460 acgagaacca gagccccagg agcttccaga agaagaccag gcactacttc attgctgctg 2520 tggagaggct gtgggactat ggcatgagca gcagccccca tgtgctgagg aacagggccc 2580 agtctggctc tgtgccccag ttcaagaagg tggtgttcca ggagttcact gatggcagct 2640 tcacccagcc cctgtacaga ggggagctga atgagcacct gggcctgctg ggcccctaca 2700 tcagggctga ggtggaggac aacatcatgg tgaccttcag gaaccaggcc agcaggccct 2760 acagcttcta cagcagcctg atcagctatg aggaggacca gaggcagggg gctgagccca 2820 ggaagaactt tgtgaagccc aatgaaacca agacctactt ctggaaggtg cagcaccaca 2880 tggccccccac caaggatgag tttgactgca aggcctgggc ctacttctct gatgtggacc 2940 tggagaagga tgtgcactct ggcctgattg gccccctgct ggtgtgccac accaacaccc 3000 tgaaccctgc ccatggcagg caggtgactg tgcaggagtt tgccctgttc ttcaccatct 3060 ttgatgaaac caagagctgg tacttcactg agaacatgga gaggaactgc agggccccct 3120 gcaacatcca gatggaggac cccaccttca aggagaacta caggttccat gccatcaatg 3180 gctacatcat ggacaccctg cctggcctgg tgatggccca ggaccagagg atcaggtggt 3240 acctgctgag catgggcagc aatgagaaca tccacagcat ccacttctct ggccatgtgt 3300 tcactgtgag gaagaaggag gagtacaaga tggccctgta caacctgtac cctggggtgt 3360 ttgagactgt ggagatgctg cccagcaagg ctggcatctg gagggtggag tgcctgattg 3420 gggagcacct gcatgctggc atgagcaccc tgttcctggt gtacagcaac aagtgccaga 3480 cccccctggg catggcctct ggccacatca gggacttcca gatcactgcc tctggccagt 3540 atggccagtg ggcccccaag ctggccaggc tgcactactc tggcagcatc aatgcctgga 3600 gcaccaagga gcccttcagc tggatcaagg tggacctgct ggcccccatg atcatccatg 3660 gcatcaagac ccagggggcc aggcagaagt tcagcagcct gtacatcagc cagttcatca 3720 tcatgtacag cctggatggc aagaagtggc agacctacag gggcaacagc actggcaccc 3780 tgatggtgtt ctttggcaat gtggacagct ctggcatcaa gcacaacatc ttcaaccccc 3840 ccatcattgc cagatacatc aggctgcacc ccacccacta cagcatcagg agcaccctga 3900 ggatggagct gatgggctgt gacctgaaca gctgcagcat gcccctgggc atggagagca 3960 aggccatctc tgatgcccag atcactgcca gcagctactt caccaacatg tttgccacct 4020 ggagccccag caaggccagg ctgcacctgc agggcaggag caatgcctgg aggccccagg 4080 tcaacaaccc caaggagtgg ctgcaggtgg acttccagaa gaccatgaag gtgactgggg 4140 tgaccaccca gggggtgaag agcctgctga ccagcatgta tgtgaaggag ttcctgatca 4200 gcagcagcca ggatggccac cagtggaccc tgttcttcca gaatggcaag gtgaaggtgt 4260 tccagggcaa ccaggacagc ttcacccctg tggtgaacag cctggacccc cccctgctga 4320 ccagatacct gaggattcac ccccagagct gggtgcacca gattgccctg aggatggagg 4380 tgctgggctg tgaggcccag gacctgtact gatcgcgaat aaaagatctt tattttcatt 4440 agatctgtgt gttggttttt tgtgtg 4466 <210> 332 <211> 4484 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1019 <400> 332 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccaga aggtactacc tgggagctgt ggaactgagc tgggactaca 120 tgcagtctga cctgggagag ctgcctgtgg atgctagatt tcctccaaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaaaaccct gtttgtggaa ttcacagacc 240 acctgttcaa tattgccaag cctagacctc cttggatggg cctgctgggc cctacaattc 300 aggctgaggt gtatgacaca gtggtcatca ccctgaagaa catggccagc catcctgtgt 360 ctctgcatgc tgtgggagtg tcttactgga aggcttctga gggggctgag tatgatgacc 420 agacaagcca gagagagaaa gaggatgaca aggttttccc tgggggcagc cacacctatg 480 tctggcaggt cctgaaagaa aatggcccta tggcctctga tcctctgtgc ctgacataca 540 gctacctgag ccatgtggac ctggtcaagg acctgaactc tggcctgatt ggggctctgc 600 tggtgtgtag agaaggcagc ctggccaaag aaaagaccca gacactgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgagacaaag aacagcctga 720 tgcaggacag agatgctgcc tctgctagag cttggcccaa gatgcacaca gtgaatggct 780 atgtgaacag aagcctgcct ggactgattg gatgccacag aaagtctgtg tactggcatg 840 tgattggcat gggcaccaca cctgaggtgc acagcatctt tctggaagga cacaccttcc 900 tggtgaggaa ccacagacag gccagcctgg aaatcagccc tatcaccttc ctgacagctc 960 agaccctgct gatggatctg ggccagtttc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaagcctat gtgaaggtgg acagctgccc tgaagaaccc cagctgagaa 1080 tgaagaacaa tgaggaagct gaggactatg atgatgacct gacagactct gagatggatg 1140 tggtcagatt tgatgatgat aacagcccca gcttcatcca gatcagatct gtggccaaga 1200 agcaccccaa gacctgggtg cactatattg ctgctgagga agaggactgg gattatgctc 1260 ctctggtgct ggcccctgat gacagaagct acaagagcca gtacctgaac aatggccctc 1320 agagaattgg caggaagtat aagaaagtga ggttcatggc ctacacagat gagacattca 1380 agaccagaga ggctatccag catgagtctg gcattctggg acctctgctg tatggggaag 1440 tgggggacac actgctgatc atcttcaaga accaggccag cagaccctac aacatctacc 1500 ctcatggcat cacagatgtg aggcctctgt actctagaag gctgcccaag ggggtgaagc 1560 acctgaagga cttccctatc ctgcctgggg agatcttcaa gtacaagtgg acagtgacag 1620 tggaggatgg ccctaccaag tctgatccta gatgcctgac aaggtactac agcagctttg 1680 tgaacatgga aagggacctg gcctctggcc tgattggtcc tctgctgatc tgctacaaag 1740 aatctgtgga ccagaggggc aaccagatca tgagtgacaa gagaaatgtg atcctgttct 1800 ctgtctttga tgagaacagg tcctggtatc tgacagagaa catccagagg tttctgccca 1860 atcctgctgg ggtgcagctg gaagatcctg agttccaggc ctccaacatc atgcactcca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgaa gtggcctact 1980 ggtacatcct gtctattggg gcccagacag acttcctgtc tgtgttcttt tctggctaca 2040 ccttcaagca caagatggtg tatgaggata ccctgacact gttcccattc tctggggaga 2100 cagtgttcat gagcatggaa aaccctggcc tgtggatcct gggctgtcac aacagtgact 2160 tcagaaacag aggcatgaca gccctgctga aggtgtccag ctgtgacaag aacactgggg 2220 actactatga ggactcttat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcctag gagcttctct cagaacgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacagccc tcctgtgctg aagagacacc agagggagat caccagaacc acactgcagt 2400 ctgaccaaga ggaaattgat tatgatgaca ccatctctgt ggagatgaag aaagaagatt 2460 ttgacatcta tgatgaggat gagaatcaga gccccagatc tttccagaag aaaacaaggc 2520 actacttcat tgctgctgtg gaaagactgt gggactatgg catgagcagc agcccccatg 2580 tgctgagaaa cagggcccag tctggaagtg tgccccagtt caagaaagtg gtgttccaag 2640 agttcacaga tggcagcttc acccagcctc tgtatagagg ggagctgaat gagcacctgg 2700 gactgctggg accttacatc agagctgagg tggaggataa catcatggtc acctttagaa 2760 accaggcctc taggccctac tccttctaca gctccctgat cagctatgaa gaggaccaga 2820 gacagggggc tgagcccaga aagaactttg tgaagcccaa tgagactaag acctactttt 2880 ggaaggtgca gcaccacatg gcccctacaa aggatgagtt tgactgcaag gcctgggcct 2940 acttctctga tgtggacctg gagaaggatg tgcactctgg actcattgga cccctgcttg 3000 tgtgccacac caacacactg aatcctgctc atggcaggca agtgacagtg caagagtttg 3060 ccctgttctt caccatcttt gatgagacaa agtcctggta cttcacagaa aacatggaaa 3120 gaaactgcag ggccccttgc aacatccaga tggaagatcc caccttcaaa gagaactaca 3180 ggttccatgc catcaatggc tacatcatgg acactctgcc tggcctggtt atggcacagg 3240 atcagaggat cagatggtat ctgctgtcca tgggctccaa tgagaatatc cacagcatcc 3300 acttctctgg ccatgtgttc acagtgagga aaaaagaaga gtacaagatg gccctgtaca 3360 atctgtaccc tggggtgttt gagactgtgg aaatgctgcc tagcaaggct ggaatctgga 3420 gggtggaatg tctgattgga gagcatctgc atgctggaat gtctaccctg ttcctggtgt 3480 acagcaacaa gtgtcagacc cctctgggca tggcctctgg acacatcaga gacttccaga 3540 tcacagcctc tggccagtat ggacagtggg ctcctaaact ggctagactg cactactctg 3600 gcagcatcaa tgcctggtcc accaaagagc ccttcagctg gatcaaggtg gacctgctgg 3660 ctcccatgat catccatgga atcaagaccc agggggccag acagaagttc agcagcctgt 3720 acatcagcca gttcatcatc atgtacagcc tggatggcaa gaagtggcag acctacagag 3780 gcaacagcac aggcacactc atggtgttct ttggcaatgt ggactcttct ggcattaagc 3840 acaacatctt caaccctcca atcattgcca ggtacatcag gctgcacccc acacactaca 3900 gcatcagatc taccctgagg atggaactga tgggctgtga cctgaacagc tgctctatgc 3960 ccctgggaat ggaaagcaag gccatctctg atgcccagat cacagccagc agctacttca 4020 ccaacatgtt tgccacatgg tccccatcta aggccaggct gcatctgcag ggcagatcta 4080 atgcttggag gccccaagtg aacaacccca aagagtggct gcaggtggac tttcagaaaa 4140 ccatgaaagt gacaggagtg accacacagg gggtcaagtc tctgctgacc tctatgtatg 4200 tgaaagagtt cctgatctcc agcagccagg atggccacca gtggaccctg tttttccaga 4260 atggcaaagt caaggtgttc cagggaaacc aggacagctt cacacctgtg gtcaactccc 4320 tggatcctcc actgctgacc agatacctga gaattcaccc tcagtcttgg gtgcaccaga 4380 ttgctctgag aatggaagtg ctgggatgtg aagctcagga cctctactaa tcgcgaataa 4440 aagatcttta ttttcattag atctgtgtgt tggttttttg tgtg 4484 <210> 333 <211> 4484 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1020 <400> 333 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggctaccaga agatactacc tgggagctgt ggaactgagc tgggattaca 120 tgcagtctga cctgggagag ctgcctgtgg atgctagatt cccacctaga gtccctaagt 180 ccttcccctt caacacctct gtggtctaca agaaaaccct gtttgtggag tttacagacc 240 acctgttcaa cattgctaag cctagaccac catggatggg actgctggga ccaaccatcc 300 aggcagaggt gtatgacaca gtggtcatca ccctgaaaaa catggcttct caccctgtgt 360 ccctgcatgc tgtgggagtc tcctactgga aggcctctga aggggctgag tatgatgatc 420 agaccagcca gagggaaaaa gaggatgata aggtgttccc tggagggtcc catacctatg 480 tgtggcaggt cctgaaggag aatggaccaa tggcttctga ccctctgtgc ctgacctact 540 cttatctgtc ccatgtggac ctggtcaagg atctgaactc tggcctgatt ggggctctgc 600 tggtgtgtag ggaagggtcc ctggccaagg agaaaaccca gaccctgcat aagttcatcc 660 tgctgtttgc tgtgtttgat gaaggaaaaa gctggcactc tgagaccaag aactctctga 720 tgcaggacag ggatgctgct tctgccagag cttggcccaa gatgcacaca gtgaatggct 780 atgtcaatag gagcctgcct ggactgattg gctgccacag aaagtctgtg tattggcatg 840 tcattggaat gggcaccacc cctgaagtgc acagcatctt cctggagggg catacctttc 900 tggtcaggaa ccacaggcag gctagcctgg agatctctcc aatcaccttc ctgacagccc 960 agaccctgct gatggacctg ggacagttcc tgctgttttg ccacatctcc agccaccagc 1020 atgatggcat ggaggcttat gtgaaagtgg actcctgtcc tgaggaacct cagctgagga 1080 tgaagaacaa tgaggaagct gaagactatg atgatgacct gacagactct gagatggatg 1140 tggtcaggtt tgatgatgat aactctccct cctttatcca gatcaggtct gtggccaaga 1200 aacaccctaa gacctgggtc cattacattg ctgctgagga agaggactgg gattatgctc 1260 cactggtgct ggcccctgat gatagatcct acaaaagcca gtatctgaac aatggacccc 1320 agaggattgg cagaaagtac aagaaagtga ggttcatggc ttatacagat gagaccttta 1380 agaccagaga agccatccag catgagtctg ggatcctggg acctctgctg tatggggaag 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccttac aatatctatc 1500 cacatggcat cacagatgtg agacctctgt actccaggag gctgccaaag ggggtgaaac 1560 acctgaagga cttcccaatc ctgcctgggg aaatctttaa gtataaatgg acagtcacag 1620 tggaggatgg gcccaccaag tctgacccta ggtgcctgac cagatactat tcttcctttg 1680 tgaatatgga gagagacctg gcttctggac tgattggacc cctgctgatc tgttacaaag 1740 agtctgtgga tcagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtctttga tgaaaacagg tcttggtacc tgacagagaa catccagagg ttcctgccta 1860 atccagctgg agtgcagctg gaagatcctg agttccaggc ctctaacatc atgcattcca 1920 tcaatggcta tgtgtttgac tccctgcagc tgtctgtgtg cctgcatgag gtggcttact 1980 ggtatatcct gagcattgga gcccagacag atttcctgtc tgtgttcttt tctggctaca 2040 cctttaagca taaaatggtg tatgaggaca ccctgaccct gttcccattt tctggagaaa 2100 ctgtgttcat gagcatggag aatcctgggc tgtggatcct gggatgccac aactctgatt 2160 tcaggaatag agggatgaca gccctgctga aagtgagctc ttgtgacaag aacacaggag 2220 actactatga agatagctat gaggacatct ctgcttatct gctgtccaaa aacaatgcca 2280 ttgagcccag gagcttctct cagaacgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacagccc tccagtgctg aagaggcacc agagggagat caccagaacc accctgcagt 2400 ctgatcagga agagattgac tatgatgata ccatctctgt ggaaatgaag aaagaggact 2460 ttgatatcta tgatgaagat gagaaccagt ctcccaggtc cttccagaag aaaaccagac 2520 attactttat tgctgctgtg gagaggctgt gggactatgg catgtccagc tctcctcatg 2580 tgctgagaaa tagagctcag tctggatctg tcccacagtt caagaaagtg gtcttccagg 2640 agtttacaga tggaagcttt acccagccac tgtacagggg agaactgaat gagcacctgg 2700 ggctgctggg accctatatc agggctgaag tggaggataa catcatggtc accttcagga 2760 atcaggccag cagaccctac tctttttatt ccagcctgat ctcctatgaa gaggaccaga 2820 gacagggagc tgaaccaaga aaaaactttg tgaagcctaa tgagaccaaa acctactttt 2880 ggaaggtgca gcaccatatg gcccctacca aagatgagtt tgattgcaag gcctgggctt 2940 atttttctga tgtggatctg gagaaggatg tccactctgg cctgattggg ccactgctgg 3000 tgtgtcatac caacaccctg aatccagctc atggaaggca ggtgacagtc caggaatttg 3060 ccctgttctt taccatcttt gatgagacca agagctggta cttcacagaa aacatggaga 3120 ggaattgcag agccccatgt aacatccaga tggaagaccc caccttcaag gagaactaca 3180 gatttcatgc tatcaatggg tatatcatgg ataccctgcc aggactggtc atggctcagg 3240 accagaggat cagatggtac ctgctgagca tggggtctaa tgagaatatc cactccatcc 3300 atttctctgg acatgtgttt acagtaagga agaaagaaga gtacaagatg gccctgtaca 3360 acctgtatcc tggggtgttt gaaacagtgg agatgctgcc ttccaaggct gggatctgga 3420 gggtggaatg cctgattggg gagcacctgc atgctggaat gtctaccctg ttcctggtgt 3480 actccaataa gtgtcagacc cccctgggga tggcttctgg acatatcagg gacttccaga 3540 tcacagcttc tggacagtat ggacagtggg ctcctaagct ggctagactg cactattctg 3600 gctccatcaa tgcttggtct accaaagagc ctttctcctg gatcaaggtg gacctgctgg 3660 ctccaatgat catccatggc atcaaaaccc agggggccag gcagaagttc tcttccctgt 3720 acatcagcca gtttatcatc atgtattctc tggatgggaa gaaatggcag acctacagag 3780 gcaattccac agggaccctg atggtgttct ttggcaatgt ggacagctct gggatcaagc 3840 acaacatctt caatccccct atcattgcca ggtacatcag actgcaccca acccattatt 3900 ccatcaggag caccctgaga atggagctga tggggtgtga tctgaacagc tgttctatgc 3960 ccctgggaat ggagtctaag gccatctctg atgctcagat cacagcctcc agctacttca 4020 ccaatatgtt tgctacctgg tccccaagca aggctagact gcatctgcag ggaagaagca 4080 atgcttggag accacaggtg aacaatccca aggagtggct gcaggtggac ttccagaaaa 4140 ccatgaaggt gacaggagtc accacccagg gagtgaaaag cctgctgacc tctatgtatg 4200 tcaaggagtt cctgatctct tccagccagg atgggcacca gtggaccctg ttctttcaga 4260 atggaaaggt gaaagtcttc cagggcaatc aggattcctt tacccctgtg gtcaacagcc 4320 tggacccacc cctgctgacc aggtacctga gaatccaccc acagtcctgg gtgcatcaga 4380 ttgctctgag gatggaagtc ctgggctgtg aggcccagga cctgtattga tcgcgaataa 4440 aagatcttta ttttcattag atctgtgtgt tggttttttg tgtg 4484 <210> 334 <211> 4484 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1025 <400> 334 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccaga aggtactacc tgggagctgt ggaactgagc tgggactaca 120 tgcagtctga cctgggagag ctgcctgtgg atgctagatt tcctccaaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaaaaccct gtttgtggaa ttcacagacc 240 acctgttcaa tattgccaag cctagacctc cttggatggg cctgctgggc cctacaattc 300 aggctgaggt gtatgacaca gtggtcatca ccctgaagaa catggccagc catcctgtgt 360 ctctgcatgc tgtgggagtg tcttactgga aggcttctga gggggctgag tatgatgacc 420 agacaagcca gagagagaaa gaggatgaca aggttttccc tgggggcagc cacacctatg 480 tctggcaggt cctgaaagaa aatggcccta tggcctctga tcctctgtgc ctgacataca 540 gctacctgag ccatgtggac ctggtcaagg acctgaactc tggcctgatt ggggctctgc 600 tggtgtgtag agaaggcagc ctggccaaag aaaagaccca gacactgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgagacaaag aacagcctga 720 tgcaggacag agatgctgcc tctgctagag cttggcccaa gatgcacaca gtgaatggct 780 atgtgaacag aagcctgcct ggactgattg gatgccacag aaagtctgtg tactggcatg 840 tgattggcat gggcaccaca cctgaggtgc acagcatctt tctggaagga cacaccttcc 900 tggtgaggaa ccacagacag gccagcctgg aaatcagccc tatcaccttc ctgacagctc 960 agaccctgct gatggatctg ggccagtttc tgctggcctg ccacatcagc agccaccagc 1020 atgatggcat ggaagcctat gtgaaggtgg acagctgccc tgaagaaccc cagctgagaa 1080 tgaagaacaa tgaggaagct gaggactatg atgatgacct gacagactct gagatggatg 1140 tggtcagatt tgatgatgat aacagcccca gcttcatcca gatcagatct gtggccaaga 1200 agcaccccaa gacctgggtg cactatattg ctgctgagga agaggactgg gattatgctc 1260 ctctggtgct ggcccctgat gacagaagct acaagagcca gtacctgaac aatggccctc 1320 agagaattgg caggaagtat aagaaagtga ggttcatggc ctacacagat gagacattca 1380 agaccagaga ggctatccag catgagtctg gcattctggg acctctgctg tatggggaag 1440 tgggggacac actgctgatc atcttcaaga accaggccag cagaccctac aacatctacc 1500 ctcatggcat cacagatgtg aggcctctgt actctagaag gctgcccaag ggggtgaagc 1560 acctgaagga cttccctatc ctgcctgggg agatcttcaa gtacaagtgg acagtgacag 1620 tggaggatgg ccctaccaag tctgatccta gatgcctgac aaggtactac agcagctttg 1680 tgaacatgga aagggacctg gcctctggcc tgattggtcc tctgctgatc tgctacaaag 1740 aatctgtgga ccagaggggc aaccagatca tgagtgacaa gagaaatgtg atcctgttct 1800 ctgtctttga tgagaacagg tcctggtatc tgacagagaa catccagagg tttctgccca 1860 atcctgctgg ggtgcagctg gaagatcctg agttccaggc ctccaacatc atgcactcca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgaa gtggcctact 1980 ggtacatcct gtctattggg gcccagacag acttcctgtc tgtgttcttt tctggctaca 2040 ccttcaagca caagatggtg tatgaggata ccctgacact gttcccattc tctggggaga 2100 cagtgttcat gagcatggaa aaccctggcc tgtggatcct gggctgtcac aacagtgact 2160 tcagaaacag aggcatgaca gccctgctga aggtgtccag ctgtgacaag aacactgggg 2220 actactatga ggactcttat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcctag gagcttctct cagaacgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacagccc tcctgtgctg aagagacacc agagggagat caccagaacc acactgcagt 2400 ctgaccaaga ggaaattgat tatgatgaca ccatctctgt ggagatgaag aaagaagatt 2460 ttgacatcta tgatgaggat gagaatcaga gccccagatc tttccagaag aaaacaaggc 2520 actacttcat tgctgctgtg gaaagactgt gggactatgg catgagcagc agcccccatg 2580 tgctgagaaa cagggcccag tctggaagtg tgccccagtt caagaaagtg gtgttccaag 2640 agttcacaga tggcagcttc acccagcctc tgtatagagg ggagctgaat gagcacctgg 2700 gactgctggg accttacatc agagctgagg tggaggataa catcatggtc acctttagaa 2760 accaggcctc taggccctac tccttctaca gctccctgat cagctatgaa gaggaccaga 2820 gacagggggc tgagcccaga aagaactttg tgaagcccaa tgagactaag acctactttt 2880 ggaaggtgca gcaccacatg gcccctacaa aggatgagtt tgactgcaag gcctgggcct 2940 acttctctga tgtggacctg gagaaggatg tgcactctgg actcattgga cccctgcttg 3000 tgtgccacac caacacactg aatcctgctc atggcaggca agtgacagtg caagagtttg 3060 ccctgttctt caccatcttt gatgagacaa agtcctggta cttcacagaa aacatggaaa 3120 gaaactgcag ggccccttgc aacatccaga tggaagatcc caccttcaaa gagaactaca 3180 ggttccatgc catcaatggc tacatcatgg acactctgcc tggcctggtt atggcacagg 3240 atcagaggat cagatggtat ctgctgtcca tgggctccaa tgagaatatc cacagcatcc 3300 acttctctgg ccatgtgttc acagtgagga aaaaagaaga gtacaagatg gccctgtaca 3360 atctgtaccc tggggtgttt gagactgtgg aaatgctgcc tagcaaggct ggaatctgga 3420 gggtggaatg tctgattgga gagcatctgc atgctggaat gtctaccctg ttcctggtgt 3480 acagcaacaa gtgtcagacc cctctgggca tggcctctgg acacatcaga gacttccaga 3540 tcacagcctc tggccagtat ggacagtggg ctcctaaact ggctagactg cactactctg 3600 gcagcatcaa tgcctggtcc accaaagagc ccttcagctg gatcaaggtg gacctgctgg 3660 ctcccatgat catccatgga atcaagaccc agggggccag acagaagttc agcagcctgt 3720 acatcagcca gttcatcatc atgtacagcc tggatggcaa gaagtggcag acctacagag 3780 gcaacagcac aggcacactc atggtgttct ttggcaatgt ggactcttct ggcattaagc 3840 acaacatctt caaccctcca atcattgcca ggtacatcag gctgcacccc acacactaca 3900 gcatcagatc taccctgagg atggaactga tgggctgtga cctgaacagc tgctctatgc 3960 ccctgggaat ggaaagcaag gccatctctg atgcccagat cacagccagc agctacttca 4020 ccaacatgtt tgccacatgg tccccatcta aggccaggct gcatctgcag ggcagatcta 4080 atgcttggag gccccaagtg aacaacccca aagagtggct gcaggtggac tttcagaaaa 4140 ccatgaaagt gacaggagtg accacacagg gggtcaagtc tctgctgacc tctatgtatg 4200 tgaaagagtt cctgatctcc agcagccagg atggccacca gtggaccctg tttttccaga 4260 atggcaaagt caaggtgttc cagggaaacc aggacagctt cacacctgtg gtcaactccc 4320 tggatcctcc actgctgacc agatacctga gaattcaccc tcagtcttgg gtgcaccaga 4380 ttgctctgag aatggaagtg ctgggatgtg aagctcagga cctctactaa tcgcgaataa 4440 aagatcttta ttttcattag atctgtgtgt tggttttttg tgtg 4484 <210> 335 <211> 4484 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1026 <400> 335 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccaga aggtactacc tgggagctgt ggaactgagc tgggactaca 120 tgcagtctga cctgggagag ctgcctgtgg atgctagatt tcctccaaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaaaaccct gtttgtggaa ttcacagacc 240 acctgttcaa tattgccaag cctagacctc cttggatggg cctgctgggc cctacaattc 300 aggctgaggt gtatgacaca gtggtcatca ccctgaagaa catggccagc catcctgtgt 360 ctctgcatgc tgtgggagtg tcttactgga aggcttctga gggggctgag tatgatgacc 420 agacaagcca gagagagaaa gaggatgaca aggttttccc tgggggcagc cacacctatg 480 tctggcaggt cctgaaagaa aatggcccta tggcctctga tcctctgtgc ctgacataca 540 gctacctgag ccatgtggac ctggtcaagg acctgaactc tggcctgatt ggggctctgc 600 tggtgtgtag agaaggcagc ctggccaaag aaaagaccca gacactgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgagacaaag aacagcctga 720 tgcaggacag agatgctgcc tctgctagag cttggcccaa gatgcacaca gtgaatggct 780 atgtgaacag aagcctgcct ggactgattg gatgccacag aaagtctgtg tactggcatg 840 tgattggcat gggcaccaca cctgaggtgc acagcatctt tctggaagga cacaccttcc 900 tggtgaggaa ccacagacag gccagcctgg aaatcagccc tatcaccttc ctgacagctc 960 agaccctgct gatggatctg ggccagtttc tgctgagctg ccacatcagc agccaccagc 1020 atgatggcat ggaagcctat gtgaaggtgg acagctgccc tgaagaaccc cagctgagaa 1080 tgaagaacaa tgaggaagct gaggactatg atgatgacct gacagactct gagatggatg 1140 tggtcagatt tgatgatgat aacagcccca gcttcatcca gatcagatct gtggccaaga 1200 agcaccccaa gacctgggtg cactatattg ctgctgagga agaggactgg gattatgctc 1260 ctctggtgct ggcccctgat gacagaagct acaagagcca gtacctgaac aatggccctc 1320 agagaattgg caggaagtat aagaaagtga ggttcatggc ctacacagat gagacattca 1380 agaccagaga ggctatccag catgagtctg gcattctggg acctctgctg tatggggaag 1440 tgggggacac actgctgatc atcttcaaga accaggccag cagaccctac aacatctacc 1500 ctcatggcat cacagatgtg aggcctctgt actctagaag gctgcccaag ggggtgaagc 1560 acctgaagga cttccctatc ctgcctgggg agatcttcaa gtacaagtgg acagtgacag 1620 tggaggatgg ccctaccaag tctgatccta gatgcctgac aaggtactac agcagctttg 1680 tgaacatgga aagggacctg gcctctggcc tgattggtcc tctgctgatc tgctacaaag 1740 aatctgtgga ccagaggggc aaccagatca tgagtgacaa gagaaatgtg atcctgttct 1800 ctgtctttga tgagaacagg tcctggtatc tgacagagaa catccagagg tttctgccca 1860 atcctgctgg ggtgcagctg gaagatcctg agttccaggc ctccaacatc atgcactcca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgaa gtggcctact 1980 ggtacatcct gtctattggg gcccagacag acttcctgtc tgtgttcttt tctggctaca 2040 ccttcaagca caagatggtg tatgaggata ccctgacact gttcccattc tctggggaga 2100 cagtgttcat gagcatggaa aaccctggcc tgtggatcct gggctgtcac aacagtgact 2160 tcagaaacag aggcatgaca gccctgctga aggtgtccag ctgtgacaag aacactgggg 2220 actactatga ggactcttat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcctag gagcttctct cagaacgcca ctaatgtgtc taacaacagc aacaccagca 2340 atgacagccc tcctgtgctg aagagacacc agagggagat caccagaacc acactgcagt 2400 ctgaccaaga ggaaattgat tatgatgaca ccatctctgt ggagatgaag aaagaagatt 2460 ttgacatcta tgatgaggat gagaatcaga gccccagatc tttccagaag aaaacaaggc 2520 actacttcat tgctgctgtg gaaagactgt gggactatgg catgagcagc agcccccatg 2580 tgctgagaaa cagggcccag tctggaagtg tgccccagtt caagaaagtg gtgttccaag 2640 agttcacaga tggcagcttc acccagcctc tgtatagagg ggagctgaat gagcacctgg 2700 gactgctggg accttacatc agagctgagg tggaggataa catcatggtc acctttagaa 2760 accaggcctc taggccctac tccttctaca gctccctgat cagctatgaa gaggaccaga 2820 gacagggggc tgagcccaga aagaactttg tgaagcccaa tgagactaag acctactttt 2880 ggaaggtgca gcaccacatg gcccctacaa aggatgagtt tgactgcaag gcctgggcct 2940 acttctctga tgtggacctg gagaaggatg tgcactctgg actcattgga cccctgcttg 3000 tgtgccacac caacacactg aatcctgctc atggcaggca agtgacagtg caagagtttg 3060 ccctgttctt caccatcttt gatgagacaa agtcctggta cttcacagaa aacatggaaa 3120 gaaactgcag ggccccttgc aacatccaga tggaagatcc caccttcaaa gagaactaca 3180 ggttccatgc catcaatggc tacatcatgg acactctgcc tggcctggtt atggcacagg 3240 atcagaggat cagatggtat ctgctgtcca tgggctccaa tgagaatatc cacagcatcc 3300 acttctctgg ccatgtgttc acagtgagga aaaaagaaga gtacaagatg gccctgtaca 3360 atctgtaccc tggggtgttt gagactgtgg aaatgctgcc tagcaaggct ggaatctgga 3420 gggtggaatg tctgattgga gagcatctgc atgctggaat gtctaccctg ttcctggtgt 3480 acagcaacaa gtgtcagacc cctctgggca tggcctctgg acacatcaga gacttccaga 3540 tcacagcctc tggccagtat ggacagtggg ctcctaaact ggctagactg cactactctg 3600 gcagcatcaa tgcctggtcc accaaagagc ccttcagctg gatcaaggtg gacctgctgg 3660 ctcccatgat catccatgga atcaagaccc agggggccag acagaagttc agcagcctgt 3720 acatcagcca gttcatcatc atgtacagcc tggatggcaa gaagtggcag acctacagag 3780 gcaacagcac aggcacactc atggtgttct ttggcaatgt ggactcttct ggcattaagc 3840 acaacatctt caaccctcca atcattgcca ggtacatcag gctgcacccc acacactaca 3900 gcatcagatc taccctgagg atggaactga tgggctgtga cctgaacagc tgctctatgc 3960 ccctgggaat ggaaagcaag gccatctctg atgcccagat cacagccagc agctacttca 4020 ccaacatgtt tgccacatgg tccccatcta aggccaggct gcatctgcag ggcagatcta 4080 atgcttggag gccccaagtg aacaacccca aagagtggct gcaggtggac tttcagaaaa 4140 ccatgaaagt gacaggagtg accacacagg gggtcaagtc tctgctgacc tctatgtatg 4200 tgaaagagtt cctgatctcc agcagccagg atggccacca gtggaccctg tttttccaga 4260 atggcaaagt caaggtgttc cagggaaacc aggacagctt cacacctgtg gtcaactccc 4320 tggatcctcc actgctgacc agatacctga gaattcaccc tcagtcttgg gtgcaccaga 4380 ttgctctgag aatggaagtg ctgggatgtg aagctcagga cctctactaa tcgcgaataa 4440 aagatcttta ttttcattag atctgtgtgt tggttttttg tgtg 4484 <210> 336 <211> 4775 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB103 <400> 336 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag gggatggcca 120 actccatcac taggggttcc tgcggcccgc ggtgccagtt cccgatcgtt acaggcggta 180 ctcctcaaag cgtactaaag aattattctt ttacatttca gtggctacca gaagatacta 240 cctgggagct gtggaactga gctgggatta catgcagtct gacctgggag agctgcctgt 300 ggatgctaga ttcccaccta gagtccctaa gtccttcccc ttcaacacct ctgtggtcta 360 caagaaaacc ctgtttgtgg agtttacaga ccacctgttc aacattgcta agcctagacc 420 accatggatg ggactgctgg gaccaaccat ccaggcagag gtgtatgaca cagtggtcat 480 caccctgaaa aacatggctt ctcaccctgt gtccctgcat gctgtgggag tctcctactg 540 gaaggcctct gaaggggctg agtatgatga tcagaccagc cagagggaaa aagaggatga 600 taaggtgttc cctggagggt cccataccta tgtgtggcag gtcctgaagg agaatggacc 660 aatggcttct gaccctctgt gcctgaccta ctcttatctg tcccatgtgg acctggtcaa 720 ggatctgaac tctggcctga ttggggctct gctggtgtgt agggaagggt ccctggccaa 780 ggagaaaacc cagaccctgc ataagttcat cctgctgttt gctgtgtttg atgaaggaaa 840 aagctggcac tctgagacca agaactctct gatgcaggac agggatgctg cttctgccag 900 agcttggccc aagatgcaca cagtgaatgg ctatgtcaat aggagcctgc ctggactgat 960 tggctgccac agaaagtctg tgtattggca tgtcattgga atgggcacca cccctgaagt 1020 gcacagcatc ttcctggagg ggcatacctt tctggtcagg aaccacaggc aggctagcct 1080 ggagatctct ccaatcacct tcctgacagc ccagaccctg ctgatggacc tgggacagtt 1140 cctgctgttt tgccacatct ccagccacca gcatgatggc atggaggctt atgtgaaagt 1200 ggactcctgt cctgaggaac ctcagctgag gatgaagaac aatgaggaag ctgaagacta 1260 tgatgatgac ctgacagact ctgagatgga tgtggtcagg tttgatgatg ataactctcc 1320 ctcctttatc cagatcaggt ctgtggccaa gaaacaccct aagacctggg tccattacat 1380 tgctgctgag gaagaggact gggattatgc tccactggtg ctggcccctg atgatagatc 1440 ctacaaaagc cagtatctga acaatggacc ccagaggatt ggcagaaagt acaagaaagt 1500 gaggttcatg gcttatacag atgagacctt taagaccaga gaagccatcc agcatgagtc 1560 tgggatcctg ggacctctgc tgtatgggga agtgggggac accctgctga tcatcttcaa 1620 gaaccaggcc agcaggcctt acaatatcta tccacatggc atcacagatg tgagacctct 1680 gtactccagg aggctgccaa agggggtgaa acacctgaag gacttcccaa tcctgcctgg 1740 ggaaatcttt aagtataaat ggacagtcac agtggaggat gggcccacca agtctgaccc 1800 taggtgcctg accagatact attcttcctt tgtgaatatg gagagagacc tggcttctgg 1860 actgattgga cccctgctga tctgttacaa agagtctgtg gatcagaggg gcaaccagat 1920 catgtctgac aagaggaatg tgatcctgtt ctctgtcttt gatgaaaaca ggtcttggta 1980 cctgacagag aacatccaga ggttcctgcc taatccagct ggagtgcagc tggaagatcc 2040 tgagttccag gcctctaaca tcatgcattc catcaatggc tatgtgtttg actccctgca 2100 gctgtctgtg tgcctgcatg aggtggctta ctggtatatc ctgagcattg gagcccagac 2160 agatttcctg tctgtgttct tttctggcta cacctttaag cataaaatgg tgtatgagga 2220 caccctgacc ctgttcccat tttctggaga aactgtgttc atgagcatgg agaatcctgg 2280 gctgtggatc ctgggatgcc acaactctga tttcaggaat agagggatga cagccctgct 2340 gaaagtgagc tcttgtgaca agaacacagg agactactat gaagatagct atgaggacat 2400 ctctgcttat ctgctgtcca aaaacaatgc cattgagccc aggagcttct ctcagaaccc 2460 tccagtgctg aagaggcacc agagggagat caccagaacc accctgcagt ctgatcagga 2520 agagattgac tatgatgata ccatctctgt ggaaatgaag aaagaggact ttgatatcta 2580 tgatgaagat gagaaccagt ctcccaggtc cttccagaag aaaaccagac attactttat 2640 tgctgctgtg gagaggctgt gggactatgg catgtccagc tctcctcatg tgctgagaaa 2700 tagagctcag tctggatctg tcccacagtt caagaaagtg gtcttccagg agtttacaga 2760 tggaagcttt acccagccac tgtacagggg agaactgaat gagcacctgg ggctgctggg 2820 accctatatc agggctgaag tggaggataa catcatggtc accttcagga atcaggccag 2880 cagaccctac tctttttatt ccagcctgat ctcctatgaa gaggaccaga gacagggagc 2940 tgaaccaaga aaaaactttg tgaagcctaa tgagaccaaa acctactttt ggaaggtgca 3000 gcaccatatg gcccctacca aagatgagtt tgattgcaag gcctgggctt atttttctga 3060 tgtggatctg gagaaggatg tccactctgg cctgattggg ccactgctgg tgtgtcatac 3120 caacaccctg aatccagctc atggaaggca ggtgacagtc caggaatttg ccctgttctt 3180 taccatcttt gatgagacca agagctggta cttcacagaa aacatggaga ggaattgcag 3240 agccccatgt aacatccaga tggaagaccc caccttcaag gagaactaca gatttcatgc 3300 tatcaatggg tatatcatgg ataccctgcc aggactggtc atggctcagg accagaggat 3360 cagatggtac ctgctgagca tggggtctaa tgagaatatc cactccatcc atttctctgg 3420 acatgtgttt acagtaagga agaaagaaga gtacaagatg gccctgtaca acctgtatcc 3480 tggggtgttt gaaacagtgg agatgctgcc ttccaaggct gggatctgga gggtggaatg 3540 cctgattggg gagcacctgc atgctggaat gtctaccctg ttcctggtgt actccaataa 3600 gtgtcagacc cccctgggga tggcttctgg acatatcagg gacttccaga tcacagcttc 3660 tggacagtat ggacagtggg ctcctaagct ggctagactg cactattctg gctccatcaa 3720 tgcttggtct accaaagagc ctttctcctg gatcaaggtg gacctgctgg ctccaatgat 3780 catccatggc atcaaaaccc agggggccag gcagaagttc tcttccctgt acatcagcca 3840 gtttatcatc atgtattctc tggatgggaa gaaatggcag acctacagag gcaattccac 3900 agggaccctg atggtgttct ttggcaatgt ggacagctct gggatcaagc acaacatctt 3960 caatccccct atcattgcca ggtacatcag actgcaccca acccattatt ccatcaggag 4020 caccctgaga atggagctga tggggtgtga tctgaacagc tgttctatgc ccctgggaat 4080 ggagtctaag gccatctctg atgctcagat cacagcctcc agctacttca ccaatatgtt 4140 tgctacctgg tccccaagca aggctagact gcatctgcag ggaagaagca atgcttggag 4200 accacaggtg aacaatccca aggagtggct gcaggtggac ttccagaaaa ccatgaaggt 4260 gacaggagtc accacccagg gagtgaaaag cctgctgacc tctatgtatg tcaaggagtt 4320 cctgatctct tccagccagg atgggcacca gtggaccctg ttctttcaga atggaaaggt 4380 gaaagtcttc cagggcaatc aggattcctt tacccctgtg gtcaacagcc tggacccacc 4440 cctgctgacc aggtacctga gaatccaccc acagtcctgg gtgcatcaga ttgctctgag 4500 gatggaagtc ctgggctgtg aggcccagga cctgtattga tcgcgaataa aagatcttta 4560 ttttcattag atctgtgtgt tggttttttg tgtgtgccag ttcccgatcg ttacaggcaa 4620 ttgccttagg ccgcaggaac ccctagtgat ggagttggcc actccctctc tgcgcgctcg 4680 ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc ccgggctttg cccgggcggc 4740 ctcagtgagc gagcgagcgc gcagctgcct gcagg 4775 <210> 337 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> "SQ linker" <400> 337 Ser Phe Ser Gln Asn Pro Pro Val Leu Lys Arg His Gln Arg 1 5 10 <210> 338 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> gRNA mALbT1 <400> 338 tgccagttcc cgatcgttac 20 <210> 339 <211> 100 <212> RNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> gRNA <220> <221> misc_feature <222> (1)..(2) <223> phosphorothioate backbone <220> <221> misc_feature <222> (1)..(3) <223> 2'-O-methyl nucleotides <220> <221> misc_feature <222> (2)..(3) <223> phosphorothioate backbone <220> <221> misc_feature <222> (3)..(4) <223> phosphorothioate backbone <220> <221> misc_feature <222> (29)..(32) <223> 2'-O-methyl nucleotides <220> <221> misc_feature <222> (37)..(40) <223> 2'-O-methyl nucleotides <220> <221> misc_feature <222> (68)..(72) <223> 2'-O-methyl nucleotides <220> <221> misc_feature <222> (77)..(99) <223> 2'-O-methyl nucleotides <220> <221> misc_feature <222> (97)..(98) <223> phosphorothioate backbone <220> <221> misc_feature <222> (98)..(99) <223> phosphorothioate backbone <220> <221> misc_feature <222> (99)..(100) <223> phosphorothioate backbone <400> 339 ugccaguucc cgaucguuac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 340 <211> 4438 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> spCas9 mRNA with NLS sequences <400> 340 ggaaataaga gagaaaagaa gagtaagaag aaatataaga gccaccatgg ccccaaagaa 60 gaagcggaag gtcggtatcc acggagtccc agcagccgac aagaagtaca gcatcggcct 120 ggacatcggc accaactctg tgggctgggc cgtgatcacc gacgagtaca aggtgcccag 180 caagaaattc aaggtgctgg gcaacaccga ccggcacagc atcaagaaga acctgatcgg 240 agccctgctg ttcgacagcg gcgaaacagc cgaggccacc cggctgaaga gaaccgccag 300 aagaagatac accagacgga agaaccggat ctgctatctg caagagatct tcagcaacga 360 gatggccaag gtggacgaca gcttcttcca cagactggaa gagtccttcc tggtggaaga 420 ggacaagaag cacgagagac accccatctt cggcaacatc gtggacgagg tggcctacca 480 cgagaagtac cccaccatct accacctgag aaagaaactg gtggacagca ccgacaaggc 540 cgacctgaga ctgatctacc tggccctggc ccacatgatc aagttcagag gccacttcct 600 gatcgagggc gacctgaacc ccgacaacag cgacgtggac aagctgttca tccagctggt 660 gcagacctac aaccagctgt tcgaggaaaa ccccatcaac gccagcggcg tggacgccaa 720 ggctatcctg tctgccagac tgagcaagag cagaaggctg gaaaatctga tcgcccagct 780 gcccggcgag aagaagaacg gcctgttcgg caacctgatt gccctgagcc tgggcctgac 840 ccccaacttc aagagcaact tcgacctggc cgaggatgcc aaactgcagc tgagcaagga 900 cacctacgac gacgacctgg acaacctgct ggcccagatc ggcgaccagt acgccgacct 960 gttcctggcc gccaagaacc tgtctgacgc catcctgctg agcgacatcc tgagagtgaa 1020 caccgagatc accaaggccc ccctgagcgc ctctatgatc aagagatacg acgagcacca 1080 ccaggacctg accctgctga aagctctcgt gcggcagcag ctgcctgaga agtacaaaga 1140 aatcttcttc gaccagagca agaacggcta cgccggctac atcgatggcg gcgctagcca 1200 ggaagagttc tacaagttca tcaagcccat cctggaaaag atggacggca ccgaggaact 1260 gctcgtgaag ctgaacagag aggacctgct gagaaagcag agaaccttcg acaacggcag 1320 catccccccac cagatccacc tgggagagct gcacgctatc ctgagaaggc aggaagattt 1380 ttacccattc ctgaaggaca accgggaaaa gatcgagaag atcctgacct tcaggatccc 1440 ctactacgtg ggccccctgg ccagaggcaa cagcagattc gcctggatga ccagaaagag 1500 cgaggaaacc atcaccccct ggaacttcga ggaagtggtg gacaagggcg ccagcgccca 1560 gagcttcatc gagagaatga caaacttcga taagaacctg cccaacgaga aggtgctgcc 1620 caagcacagc ctgctgtacg agtacttcac cgtgtacaac gagctgacca aagtgaaata 1680 cgtgaccgag ggaatgagaa agcccgcctt cctgagcggc gagcagaaaa aggccatcgt 1740 ggacctgctg ttcaagacca acagaaaagt gaccgtgaag cagctgaaag aggactactt 1800 caagaaaatc gagtgcttcg actccgtgga aatctccggc gtggaagata gattcaacgc 1860 ctccctgggc acataccacg atctgctgaa aattatcaag gacaaggact tcctggataa 1920 cgaagagaac gaggacattc tggaagatat cgtgctgacc ctgacactgt ttgaggaccg 1980 cgagatgatc gaggaaaggc tgaaaaccta cgctcacctg ttcgacgaca aagtgatgaa 2040 gcagctgaag agaaggcggt acaccggctg gggcaggctg agcagaaagc tgatcaacgg 2100 catcagagac aagcagagcg gcaagacaat cctggatttc ctgaagtccg acggcttcgc 2160 caaccggaac ttcatgcagc tgatccacga cgacagcctg acattcaaag aggacatcca 2220 gaaagcccag gtgtccggcc agggcgactc tctgcacgag catatcgcta acctggccgg 2280 cagccccgct atcaagaagg gcatcctgca gacagtgaag gtggtggacg agctcgtgaa 2340 agtgatgggc agacacaagc ccgagaacat cgtgatcgag atggctagag agaaccagac 2400 cacccagaag ggacagaaga actcccgcga gaggatgaag agaatcgaag agggcatcaa 2460 agagctgggc agccagatcc tgaaagaaca ccccgtggaa aacacccagc tgcagaacga 2520 gaagctgtac ctgtactacc tgcagaatgg ccgggatatg tacgtggacc aggaactgga 2580 catcaacaga ctgtccgact acgatgtgga ccatatcgtg cctcagagct ttctgaagga 2640 cgactccatc gataacaaag tgctgactcg gagcgacaag aacagaggca agagcgacaa 2700 cgtgccctcc gaagaggtcg tgaagaagat gaagaactac tggcgacagc tgctgaacgc 2760 caagctgatt acccagagga agttcgataa cctgaccaag gccgagagag gcggcctgag 2820 cgagctggat aaggccggct tcatcaagag gcagctggtg gaaaccagac agatcacaaa 2880 gcacgtggca cagatcctgg actcccggat gaacactaag tacgacgaaa acgataagct 2940 gatccgggaa gtgaaagtga tcaccctgaa gtccaagctg gtgtccgatt tccggaagga 3000 tttccagttt tacaaagtgc gcgagatcaa caactaccac cacgcccacg acgcctacct 3060 gaacgccgtc gtgggaaccg ccctgatcaa aaagtaccct aagctggaaa gcgagttcgt 3120 gtacggcgac tacaaggtgt acgacgtgcg gaagatgatc gccaagagcg agcaggaaat 3180 cggcaaggct accgccaagt acttcttcta cagcaacatc atgaactttt tcaagaccga 3240 aatcaccctg gccaacggcg agatcagaaa gcgccctctg atcgagacaa acggcgaaac 3300 cggggagatc gtgtgggata agggcagaga cttcgccaca gtgcgaaagg tgctgagcat 3360 gccccaagtg aatatcgtga aaaagaccga ggtgcagaca ggcggcttca gcaaagagtc 3420 tatcctgccc aagaggaaca gcgacaagct gatcgccaga aagaaggact gggaccccaa 3480 gaagtacggc ggcttcgaca gccctaccgt ggcctactct gtgctggtgg tggctaaggt 3540 ggaaaagggc aagtccaaga aactgaagag tgtgaaagag ctgctgggga tcaccatcat 3600 ggaaagaagc agctttgaga agaaccctat cgactttctg gaagccaagg gctacaaaga 3660 agtgaaaaag gacctgatca tcaagctgcc taagtactcc ctgttcgagc tggaaaacgg 3720 cagaaagaga atgctggcct ctgccggcga actgcagaag ggaaacgagc tggccctgcc 3780 tagcaaatat gtgaacttcc tgtacctggc ctcccactat gagaagctga agggcagccc 3840 tgaggacaac gaacagaaac agctgtttgt ggaacagcat aagcactacc tggacgagat 3900 catcgagcag atcagcgagt tctccaagag agtgatcctg gccgacgcca atctggacaa 3960 ggtgctgtct gcctacaaca agcacaggga caagcctatc agagagcagg ccgagaatat 4020 catccacctg ttcaccctga caaacctggg cgctcctgcc gccttcaagt actttgacac 4080 caccatcgac cggaagaggt acaccagcac caaagaggtg ctggacgcca ccctgatcca 4140 ccagagcatc accggcctgt acgagacaag aatcgacctg tctcagctgg gaggcgacaa 4200 gagacctgcc gccactaaga aggccggaca ggccaaaaag aagaagtgag cggccgctta 4260 attaagctgc cttctgcggg gcttgccttc tggccatgcc cttcttctct cccttgcacc 4320 tgtacctctt ggtctttgaa taaagcctga gtaggaagaa aaaaaaaaaa aaaaaaaaaa 4380 aaaaaaaaaa aaaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaa 4438 <210> 341 <211> 4779 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB102 <400> 341 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag gggatggcca 120 actccatcac taggggttcc tgcggcccgc ggtgccagtt cccgatcgtt acaggcggta 180 ctcctcaaag cgtactaaag aattattctt ttacatttca gtggccacca ggagatacta 240 cctgggggct gtggagctga gctgggacta catgcagtct gacctggggg agctgcctgt 300 ggatgccagg ttccccccca gagtgcccaa gagcttcccc ttcaacacct ctgtggtgta 360 caagaagacc ctgtttgtgg agttcactga ccacctgttc aacattgcca agcccaggcc 420 cccctggatg ggcctgctgg gccccaccat ccaggctgag gtgtatgaca ctgtggtgat 480 caccctgaag aacatggcca gccaccctgt gagcctgcat gctgtggggg tgagctactg 540 gaaggcctct gagggggctg agtatgatga ccagaccagc cagagggaga aggaggatga 600 caaggtgttc cctgggggca gccacaccta tgtgtggcag gtgctgaagg agaatggccc 660 catggcctct gaccccctgt gcctgaccta cagctacctg agccatgtgg acctggtgaa 720 ggacctgaac tctggcctga ttggggccct gctggtgtgc agggagggca gcctggccaa 780 ggagaagacc cagaccctgc acaagttcat cctgctgttt gctgtgtttg atgagggcaa 840 gagctggcac tctgaaacca agaacagcct gatgcaggac agggatgctg cctctgccag 900 ggcctggccc aagatgcaca ctgtgaatgg ctatgtgaac aggagcctgc ctggcctgat 960 tggctgccac aggaagtctg tgtactggca tgtgattggc atgggcacca cccctgaggt 1020 gcacagcatc ttcctggagg gccacacctt cctggtcagg aaccacaggc aggccagcct 1080 ggagatcagc cccatcacct tcctgactgc ccagaccctg ctgatggacc tgggccagtt 1140 cctgctgttc tgccacatca gcagccacca gcatgatggc atggaggcct atgtgaaggt 1200 ggacagctgc cctgaggagc cccagctgag gatgaagaac aatgaggagg ctgaggacta 1260 tgatgatgac ctgactgact ctgagatgga tgtggtgagg tttgatgatg acaacagccc 1320 cagcttcatc cagatcaggt ctgtggccaa gaagcacccc aagacctggg tgcactacat 1380 tgctgctgag gaggaggact gggactatgc ccccctggtg ctggcccctg atgacaggag 1440 ctacaagagc cagtacctga acaatggccc ccagaggatt ggcaggaagt acaagaaggt 1500 caggttcatg gcctacactg atgaaacctt caagccagg gaggccatcc agcatgagtc 1560 tggcatcctg ggccccctgc tgtatgggga ggtgggggac accctgctga tcatcttcaa 1620 gaaccaggcc agcaggccct acaacatcta cccccatggc atcactgatg tgaggcccct 1680 gtacagcagg aggctgccca agggggtgaa gcacctgaag gacttcccca tcctgcctgg 1740 ggagatcttc aagtacaagt ggactgtgac tgtggaggat ggccccacca agtctgaccc 1800 caggtgcctg accagatact acagcagctt tgtgaacatg gagagggacc tggcctctgg 1860 cctgattggc cccctgctga tctgctacaa ggagtctgtg gaccagaggg gcaaccagat 1920 catgtctgac aagaggaatg tgatcctgtt ctctgtgttt gatgagaaca ggagctggta 1980 cctgactgag aacatccaga ggttcctgcc caaccctgct ggggtgcagc tggaggaccc 2040 tgagttccag gccagcaaca tcatgcacag catcaatggc tatgtgtttg acagcctgca 2100 gctgtctgtg tgcctgcatg aggtggccta ctggtacatc ctgagcattg gggcccagac 2160 tgacttcctg tctgtgttct tctctggcta caccttcaag cacaagatgg tgtatgagga 2220 caccctgacc ctgttcccct tctctgggga gactgtgttc atgagcatgg agaaccctgg 2280 cctgtggatt ctgggctgcc acaactctga cttcaggaac aggggcatga ctgccctgct 2340 gaaagtctcc agctgtgaca agaacactgg ggactactat gaggacagct atgaggacat 2400 ctctgcctac ctgctgagca agaacaatgc cattgagccc aggagcttca gccagaatcc 2460 cccagtgctg aagaggcacc agagggagat caccaggacc accctgcagt ctgaccagga 2520 ggagattgac tatgatgaca ccatctctgt ggagatgaag aaggaggact ttgacatcta 2580 cgacgaggac gagaaccaga gccccaggag cttccagaag aagaccaggc actacttcat 2640 tgctgctgtg gagaggctgt gggactatgg catgagcagc agcccccatg tgctgaggaa 2700 cagggcccag tctggctctg tgccccagtt caagaaggtg gtgttccagg agttcactga 2760 tggcagcttc acccagcccc tgtacagagg ggagctgaat gagcacctgg gcctgctggg 2820 cccctacatc agggctgagg tggaggacaa catcatggtg accttcagga accaggccag 2880 caggccctac agcttctaca gcagcctgat cagctatgag gaggaccaga ggcagggggc 2940 tgagcccagg aagaactttg tgaagcccaa tgaaaccaag acctacttct ggaaggtgca 3000 gcaccacatg gccccccacca aggatgagtt tgactgcaag gcctgggcct acttctctga 3060 tgtggacctg gagaaggatg tgcactctgg cctgattggc cccctgctgg tgtgccacac 3120 caacaccctg aaccctgccc atggcaggca ggtgactgtg caggagtttg ccctgttctt 3180 caccatcttt gatgaaacca agagctggta cttcactgag aacatggaga ggaactgcag 3240 ggccccctgc aacatccaga tggaggaccc caccttcaag gagaactaca ggttccatgc 3300 catcaatggc tacatcatgg acaccctgcc tggcctggtg atggcccagg accagaggat 3360 caggtggtac ctgctgagca tgggcagcaa tgagaacatc cacagcatcc acttctctgg 3420 ccatgtgttc actgtgagga agaaggagga gtacaagatg gccctgtaca acctgtaccc 3480 tggggtgttt gagactgtgg agatgctgcc cagcaaggct ggcatctgga gggtggagtg 3540 cctgattggg gagcacctgc atgctggcat gagcaccctg ttcctggtgt acagcaacaa 3600 gtgccagacc cccctgggca tggcctctgg ccacatcagg gacttccaga tcactgcctc 3660 tggccagtat ggccagtggg cccccaagct ggccaggctg cactactctg gcagcatcaa 3720 tgcctggagc accaaggagc ccttcagctg gatcaaggtg gacctgctgg cccccatgat 3780 catccatggc atcaagaccc aggggggccag gcagaagttc agcagcctgt acatcagcca 3840 gttcatcatc atgtacagcc tggatggcaa gaagtggcag acctacaggg gcaacagcac 3900 tggcaccctg atggtgttct ttggcaatgt ggacagctct ggcatcaagc acaacatctt 3960 caaccccccc atcattgcca gatacatcag gctgcacccc acccactaca gcatcaggag 4020 caccctgagg atggagctga tgggctgtga cctgaacagc tgcagcatgc ccctgggcat 4080 ggagagcaag gccatctctg atgcccagat cactgccagc agctacttca ccaacatgtt 4140 tgccacctgg agccccagca aggccaggct gcacctgcag ggcaggagca atgcctggag 4200 gccccaggtc aacaacccca aggagtggct gcaggtggac ttccagaaga ccatgaaggt 4260 gactggggtg accacccagg gggtgaagag cctgctgacc agcatgtatg tgaaggagtt 4320 cctgatcagc agcagccagg atggccacca gtggaccctg ttcttccaga atggcaaggt 4380 gaaggtgttc cagggcaacc aggacagctt cacccctgtg gtgaacagcc tggacccccc 4440 cctgctgacc agatacctga ggattcaccc ccagagctgg gtgcaccaga ttgccctgag 4500 gatggaggtg ctgggctgtg aggcccagga cctgtactga tcgcgaataa aagatcttta 4560 ttttcattag atctgtgtgt tggttttttg tgtggatctg ccagttcccg atcgttacag 4620 gcaattgcct taggccgcag gaacccctag tgatggagtt ggccactccc tctctgcgcg 4680 ctcgctcgct cactgaggcc gggcgaccaa aggtcgcccg acgcccgggc tttgcccggg 4740 cggcctcagt gagcgagcga gcgcgcagct gcctgcagg 4779 <210> 342 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> modified B domain linker <400> 342 Phe Asn Ala Thr Thr Ile Gln Asn Val Ser Ser Asn Asn Ser Leu Ser 1 5 10 15 Asp Asn Thr Ser Ser Asn Asp Ser Lys Asn Val Ser Ser Pro 20 25 30 <210> 343 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> B domain substitute <400> 343 Ala Thr Asn Val Ser Asn Asn Ser Asn Thr Ser Asn Asp Ser 1 5 10 <210> 344 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> Terminal portion of sequence encoding signal peptide from Transferrin Exon 2 <400> 344 ggctgtgtct ggct 14 <210> 345 <211> 31 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> Variant FVIII B domain <400> 345 Ser Phe Ser Gln Asn Ala Thr Asn Val Ser Asn Asn Ser Asn Thr Ser 1 5 10 15 Asn Asp Ser Asn Val Ser Pro Val Leu Lys Arg His Gln Arg 20 25 30 <210> 346 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGA2(DD) forward primer, mouse FGA intron <400> 346 ctggagtttc tgacacattc t 21 <210> 347 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> RSA56.R reverse primer <400> 347 gtgaactcca caaacagggt 20 <210> 348 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> TFR1(DD) reverse primer <400> 348 agtgaactcc acaaacaggg 20 <210> 349 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGAP2(DD) donor probe <400> 349 ccacagcccc caggtagtat 20 <210> 350 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGARefF2 (DD) forward primer <400> 350 gttgctgggg attgatccag 20 <210> 351 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGARefR2 (DD) reverse primer <400> 351 gttctcaacc tgtgggtcac 20 <210> 352 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> FGARefP2 (DD) probe <400> 352 tgttgtgatg acccgcaact 20 <210> 353 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> AlbF forward primer <400> 353 ccctccgttt gtcctagctt ttc 23 <210> 354 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> AlbR reverse primer <400> 354 ccagatacag aatatcttcc tcaacgcaga 30 <210> 355 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> forward primer <400> 355 cctttggcac aatgaagtgg 20 <210> 356 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> reverse primer <400> 356 gaatctgaac cctgatgaca ag 22 <210> 357 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> T4 <400> 357 taaagcatag tgcaatggat agg 23 <210> 358 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> T5 <400> 358 atttatgaga tcaacagcac agg 23 <210> 359 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> T11 <400> 359 ttaaataaag catagtgcaa tgg 23 <210> 360 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> T13 <400> 360 taataaaatt caaacatcct agg 23 <210> 361 <211> 4827 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> AAV8-pCB1010 <400> 361 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag gggatggcca 120 actccatcac taggggttcc tgcggcccgc ggcctgggta actaattagg atgtccggta 180 ctcctcaaag cgtactaaag aattattctt ttacatttca gaccgccacc aggagatact 240 acctgggggc tgtggagctg agctgggact acatgcagtc tgacctgggg gagctgcctg 300 tggatgccag gttccccccc agagtgccca agagcttccc cttcaacacc tctgtggtgt 360 acaagaagac cctgtttgtg gagttcactg accacctgtt caacattgcc aagcccaggc 420 ccccctggat gggcctgctg ggccccacca tccaggctga ggtgtatgac actgtggtga 480 tcaccctgaa gaacatggcc agccaccctg tgagcctgca tgctgtgggg gtgagctact 540 ggaaggcctc tgagggggct gagtatgatg accagaccag ccagagggag aaggaggatg 600 acaaggtgtt ccctgggggc agccacacct atgtgtggca ggtgctgaag gagaatggcc 660 ccatggcctc tgaccccctg tgcctgacct acagctacct gagccatgtg gacctggtga 720 aggacctgaa ctctggcctg attggggccc tgctggtgtg cagggagggc agcctggcca 780 aggagaagac ccagaccctg cacaagttca tcctgctgtt tgctgtgttt gatgagggca 840 agagctggca ctctgaaacc aagaacagcc tgatgcagga cagggatgct gcctctgcca 900 gggcctggcc caagatgcac actgtgaatg gctatgtgaa caggagcctg cctggcctga 960 ttggctgcca caggaagtct gtgtactggc atgtgattgg catgggcacc acccctgagg 1020 tgcacagcat cttcctggag ggccacacct tcctggtcag gaaccacagg caggccagcc 1080 tggagatcag ccccatcacc ttcctgactg cccagaccct gctgatggac ctgggccagt 1140 tcctgctgtt ctgccacatc agcagccacc agcatgatgg catggaggcc tatgtgaagg 1200 tggacagctg ccctgaggag ccccagctga ggatgaagaa caatgaggag gctgaggact 1260 atgatgatga cctgactgac tctgagatgg atgtggtgag gtttgatgat gacaacagcc 1320 ccagcttcat ccagatcagg tctgtggcca agaagcaccc caagacctgg gtgcactaca 1380 ttgctgctga ggaggaggac tgggactatg cccccctggt gctggcccct gatgacagga 1440 gctacaagag ccagtacctg aacaatggcc cccagaggat tggcaggaag tacaagaagg 1500 tcaggttcat ggcctacact gatgaaacct tcaagaccag ggaggccatc cagcatgagt 1560 ctggcatcct gggccccctg ctgtatgggg aggtggggga caccctgctg atcatcttca 1620 agaaccaggc cagcaggccc tacaacatct acccccatgg catcactgat gtgaggcccc 1680 tgtacagcag gaggctgccc aagggggtga agcacctgaa ggacttcccc atcctgcctg 1740 gggagatctt caagtacaag tggactgtga ctgtggagga tggccccacc aagtctgacc 1800 ccaggtgcct gaccagatac tacagcagct ttgtgaacat ggagagggac ctggcctctg 1860 gcctgattgg ccccctgctg atctgctaca aggagtctgt ggaccagagg ggcaaccaga 1920 tcatgtctga caagaggaat gtgatcctgt tctctgtgtt tgatgagaac aggagctggt 1980 acctgactga gaacatccag aggttcctgc ccaaccctgc tggggtgcag ctggaggacc 2040 ctgagttcca ggccagcaac atcatgcaca gcatcaatgg ctatgtgttt gacagcctgc 2100 agctgtctgt gtgcctgcat gaggtggcct actggtacat cctgagcatt ggggcccaga 2160 ctgacttcct gtctgtgttc ttctctggct acaccttcaa gcacaagatg gtgtatgagg 2220 acaccctgac cctgttcccc ttctctgggg agactgtgtt catgagcatg gagaaccctg 2280 gcctgtggat tctgggctgc cacaactctg acttcaggaa caggggcatg actgccctgc 2340 tgaaagtctc cagctgtgac aagaacactg gggactacta tgaggacagc tatgaggaca 2400 tctctgccta cctgctgagc aagaacaatg ccattgagcc caggagcttc agccagaatg 2460 ccactaatgt gtctaacaac agcaacacca gcaatgacag caatgtgtct cccccagtgc 2520 tgaagaggca ccagagggag atcaccagga ccaccctgca gtctgaccag gaggagattg 2580 actatgatga caccatctct gtggagatga agaaggagga ctttgacatc tacgacgagg 2640 acgagaacca gagccccagg agcttccaga agaagaccag gcactacttc attgctgctg 2700 tggagaggct gtgggactat ggcatgagca gcagccccca tgtgctgagg aacagggccc 2760 agtctggctc tgtgccccag ttcaagaagg tggtgttcca ggagttcact gatggcagct 2820 tcacccagcc cctgtacaga ggggagctga atgagcacct gggcctgctg ggcccctaca 2880 tcagggctga ggtggaggac aacatcatgg tgaccttcag gaaccaggcc agcaggccct 2940 acagcttcta cagcagcctg atcagctatg aggaggacca gaggcagggg gctgagccca 3000 ggaagaactt tgtgaagccc aatgaaacca agacctactt ctggaaggtg cagcaccaca 3060 tggccccccac caaggatgag tttgactgca aggcctgggc ctacttctct gatgtggacc 3120 tggagaagga tgtgcactct ggcctgattg gccccctgct ggtgtgccac accaacaccc 3180 tgaaccctgc ccatggcagg caggtgactg tgcaggagtt tgccctgttc ttcaccatct 3240 ttgatgaaac caagagctgg tacttcactg agaacatgga gaggaactgc agggccccct 3300 gcaacatcca gatggaggac cccaccttca aggagaacta caggttccat gccatcaatg 3360 gctacatcat ggacaccctg cctggcctgg tgatggccca ggaccagagg atcaggtggt 3420 acctgctgag catgggcagc aatgagaaca tccacagcat ccacttctct ggccatgtgt 3480 tcactgtgag gaagaaggag gagtacaaga tggccctgta caacctgtac cctggggtgt 3540 ttgagactgt ggagatgctg cccagcaagg ctggcatctg gagggtggag tgcctgattg 3600 gggagcacct gcatgctggc atgagcaccc tgttcctggt gtacagcaac aagtgccaga 3660 cccccctggg catggcctct ggccacatca gggacttcca gatcactgcc tctggccagt 3720 atggccagtg ggcccccaag ctggccaggc tgcactactc tggcagcatc aatgcctgga 3780 gcaccaagga gcccttcagc tggatcaagg tggacctgct ggcccccatg atcatccatg 3840 gcatcaagac ccagggggcc aggcagaagt tcagcagcct gtacatcagc cagttcatca 3900 tcatgtacag cctggatggc aagaagtggc agacctacag gggcaacagc actggcaccc 3960 tgatggtgtt ctttggcaat gtggacagct ctggcatcaa gcacaacatc ttcaaccccc 4020 ccatcattgc cagatacatc aggctgcacc ccacccacta cagcatcagg agcaccctga 4080 ggatggagct gatgggctgt gacctgaaca gctgcagcat gcccctgggc atggagagca 4140 aggccatctc tgatgcccag atcactgcca gcagctactt caccaacatg tttgccacct 4200 ggagccccag caaggccagg ctgcacctgc agggcaggag caatgcctgg aggccccagg 4260 tcaacaaccc caaggagtgg ctgcaggtgg acttccagaa gaccatgaag gtgactgggg 4320 tgaccaccca gggggtgaag agcctgctga ccagcatgta tgtgaaggag ttcctgatca 4380 gcagcagcca ggatggccac cagtggaccc tgttcttcca gaatggcaag gtgaaggtgt 4440 tccagggcaa ccaggacagc ttcacccctg tggtgaacag cctggacccc cccctgctga 4500 ccagatacct gaggattcac ccccagagct gggtgcacca gattgccctg aggatggagg 4560 tgctgggctg tgaggcccag gacctgtact gatcgcgaat aaaagatctt tattttcatt 4620 agatctgtgt gttggttttt tgtgtgcctg ggtaactaat taggatgtcc aattgcctta 4680 ggccgcagga acccctagtg atggagttgg ccactccctc tctgcgcgct cgctcgctca 4740 ctgaggccgg gcgaccaaag gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga 4800 gcgagcgagc gcgcagctgc ctgcagg 4827 <210> 362 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> 3 glycan B domain substitute <400> 362 Ser Phe Ser Gln Asn Ala Thr Asn Val Ser Asn Asn Ser Pro Pro Val 1 5 10 15 Leu Lys Arg His Gln Arg 20 <210> 363 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> 4 glycan B domain substitute <400> 363 Ser Phe Ser Gln Asn Ala Thr Asn Val Ser Asn Asn Ser Asn Thr Ser 1 5 10 15 Pro Pro Val Leu Lys Arg His Gln Arg 20 25 <210> 364 <211> 28 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> 5 glycan B domain substitute <400> 364 Ser Phe Ser Gln Asn Ala Thr Asn Val Ser Asn Asn Ser Asn Thr Ser 1 5 10 15 Asn Asp Ser Pro Val Leu Lys Arg His Gln Arg 20 25 <210> 365 <211> 31 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> 6 glycan B domain substitute <400> 365 Ser Phe Ser Gln Asn Ala Thr Asn Val Ser Asn Asn Ser Asn Thr Ser 1 5 10 15 Asn Asp Ser Asn Val Ser Pro Val Leu Lys Arg His Gln Arg 20 25 30 <210> 366 <211> 31 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> 6 glycan B domain substitute (S->T) <400> 366 Ser Phe Ser Gln Asn Ala Thr Asn Val Ser Asn Asn Ser Asn Thr Ser 1 5 10 15 Asn Asp Ser Asn Val Thr Pro Val Leu Lys Arg His Gln Arg 20 25 30 <210> 367 <211> 34 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> 7 glycan B domain substitute <400> 367 Ser Phe Ser Gln Asn Ala Thr Asn Val Ser Asn Asn Ser Asn Thr Ser 1 5 10 15 Asn Asp Ser Asn Val Ser Asn Lys Thr Pro Pro Val Leu Lys Arg His 20 25 30 Gln Arg <210> 368 <211> 37 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> 8 glycan B domain substitute <400> 368 Ser Phe Ser Gln Asn Ala Thr Asn Val Ser Asn Asn Ser Asn Thr Ser 1 5 10 15 Asn Asp Ser Asn Val Ser Asn Lys Thr Asn Asn Ser Pro Val Leu 20 25 30 Lys Arg His Gln Arg 35 <210> 369 <211> 40 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> 9 glycan B domain substitute <400> 369 Ser Phe Ser Gln Asn Ala Thr Asn Val Ser Asn Asn Ser Asn Thr Ser 1 5 10 15 Asn Asp Ser Asn Val Ser Asn Lys Thr Asn Asn Ser Asn Ala Thr Pro 20 25 30 Pro Val Leu Lys Arg His Gln Arg 35 40 <210> 370 <211> 4448 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1030 <400> 370 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctcccccagt gctgaagagg caccagaggg 2340 agatcaccag gaccaccctg cagtctgacc aggaggagat tgactatgat gacaccatct 2400 ctgtggagat gaagaaggag gactttgaca tctacgacga ggacgagaac cagagcccca 2460 ggagcttcca gaagaagacc aggcactact tcattgctgc tgtggagagg ctgtgggact 2520 atggcatgag cagcagcccc catgtgctga ggaacagggc ccagtctggc tctgtgcccc 2580 agttcaagaa ggtggtgttc caggagttca ctgatggcag cttcacccag cccctgtaca 2640 gaggggagct gaatgagcac ctgggcctgc tgggccccta catcagggct gaggtggagg 2700 acaacatcat ggtgaccttc aggaaccagg ccagcaggcc ctacagcttc tacagcagcc 2760 tgatcagcta tgaggaggac cagaggcagg gggctgagcc caggaagaac tttgtgaagc 2820 ccaatgaaac caagacctac ttctggaagg tgcagcacca catggccccc accaaggatg 2880 agtttgactg caaggcctgg gcctacttct ctgatgtgga cctggagaag gatgtgcact 2940 ctggcctgat tggccccctg ctggtgtgcc acaccaacac cctgaaccct gcccatggca 3000 ggcaggtgac tgtgcaggag tttgccctgt tcttcaccat ctttgatgaa accaagagct 3060 ggtacttcac tgagaacatg gagaggaact gcagggcccc ctgcaacatc cagatggagg 3120 accccacctt caaggagaac tacaggttcc atgccatcaa tggctacatc atggacaccc 3180 tgcctggcct ggtgatggcc caggaccaga ggatcaggtg gtacctgctg agcatgggca 3240 gcaatgagaa catccacagc atccacttct ctggccatgt gttcactgtg aggaagaagg 3300 aggagtacaa gatggccctg tacaacctgt accctggggt gtttgagact gtggagatgc 3360 tgcccagcaa ggctggcatc tggagggtgg agtgcctgat tggggagcac ctgcatgctg 3420 gcatgagcac cctgttcctg gtgtacagca acaagtgcca gacccccctg ggcatggcct 3480 ctggccacat cagggacttc cagatcactg cctctggcca gtatggccag tgggccccca 3540 agctggccag gctgcactac tctggcagca tcaatgcctg gagcaccaag gagcccttca 3600 gctggatcaa ggtggacctg ctggccccca tgatcatcca tggcatcaag acccaggggg 3660 ccaggcagaa gttcagcagc ctgtacatca gccagttcat catcatgtac agcctggatg 3720 gcaagaagtg gcagacctac aggggcaaca gcactggcac cctgatggtg ttctttggca 3780 atgtggacag ctctggcatc aagcacaaca tcttcaaccc ccccatcatt gccagataca 3840 tcaggctgca ccccacccac tacagcatca ggagcaccct gaggatggag ctgatgggct 3900 gtgacctgaa cagctgcagc atgcccctgg gcatggagag caaggccatc tctgatgccc 3960 agatcactgc cagcagctac ttcaccaaca tgtttgccac ctggagcccc agcaaggcca 4020 ggctgcacct gcagggcagg agcaatgcct ggaggcccca ggtcaacaac cccaaggagt 4080 ggctgcaggt ggacttccag aagaccatga aggtgactgg ggtgaccacc cagggggtga 4140 agagcctgct gaccagcatg tatgtgaagg agttcctgat cagcagcagc caggatggcc 4200 accagtggac cctgttcttc cagaatggca aggtgaaggt gttccagggc aaccaggaca 4260 gcttcacccc tgtggtgaac agcctggacc cccccctgct gaccagatac ctgaggattc 4320 acccccagag ctgggtgcac cagattgccc tgaggatgga ggtgctgggc tgtgaggccc 4380 aggacctgta ctgatcgcga ataaaagatc tttattttca tagatctgt gtgttggttt 4440 tttgtgtg 4448 <210> 371 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> 1-glycan B domain substitute <400> 371 Ser Phe Ser Gln Asn Ala Thr Pro Pro Val Leu Lys Arg His Gln Arg 1 5 10 15 <210> 372 <211> 4457 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <220> <221> misc_feature <223> pCB1029 <400> 372 tgccagttcc cgatcgttac aggcggtact cctcaaagcg tactaaagaa ttattctttt 60 acatttcagt ggccaccagg agatactacc tgggggctgt ggagctgagc tgggactaca 120 tgcagtctga cctgggggag ctgcctgtgg atgccaggtt cccccccaga gtgcccaaga 180 gcttcccctt caacacctct gtggtgtaca agaagaccct gtttgtggag ttcactgacc 240 acctgttcaa cattgccaag cccaggcccc cctggatggg cctgctgggc cccaccatcc 300 aggctgaggt gtatgacact gtggtgatca ccctgaagaa catggccagc caccctgtga 360 gcctgcatgc tgtgggggtg agctactgga aggcctctga gggggctgag tatgatgacc 420 agaccagcca gagggagaag gaggatgaca aggtgttccc tgggggcagc cacacctatg 480 tgtggcaggt gctgaaggag aatggcccca tggcctctga ccccctgtgc ctgacctaca 540 gctacctgag ccatgtggac ctggtgaagg acctgaactc tggcctgatt ggggccctgc 600 tggtgtgcag ggagggcagc ctggccaagg agaagaccca gaccctgcac aagttcatcc 660 tgctgtttgc tgtgtttgat gagggcaaga gctggcactc tgaaaccaag aacagcctga 720 tgcaggacag ggatgctgcc tctgccaggg cctggcccaa gatgcacact gtgaatggct 780 atgtgaacag gagcctgcct ggcctgattg gctgccacag gaagtctgtg tactggcatg 840 tgattggcat gggcaccacc cctgaggtgc acagcatctt cctggagggc cacaccttcc 900 tggtcaggaa ccacaggcag gccagcctgg agatcagccc catcaccttc ctgactgccc 960 agaccctgct gatggacctg ggccagttcc tgctgttctg ccacatcagc agccaccagc 1020 atgatggcat ggaggcctat gtgaaggtgg acagctgccc tgaggagccc cagctgagga 1080 tgaagaacaa tgaggaggct gaggactatg atgatgacct gactgactct gagatggatg 1140 tggtgaggtt tgatgatgac aacagcccca gcttcatcca gatcaggtct gtggccaaga 1200 agcaccccaa gacctgggtg cactacattg ctgctgagga ggaggactgg gactatgccc 1260 ccctggtgct ggcccctgat gacaggagct acaagagcca gtacctgaac aatggccccc 1320 agaggattgg caggaagtac aagaaggtca ggttcatggc ctacactgat gaaaccttca 1380 agaccaggga ggccatccag catgagtctg gcatcctggg ccccctgctg tatggggagg 1440 tgggggacac cctgctgatc atcttcaaga accaggccag caggccctac aacatctacc 1500 cccatggcat cactgatgtg aggcccctgt acagcaggag gctgcccaag ggggtgaagc 1560 acctgaagga cttccccatc ctgcctgggg agatcttcaa gtacaagtgg actgtgactg 1620 tggaggatgg ccccaccaag tctgacccca ggtgcctgac cagatactac agcagctttg 1680 tgaacatgga gagggacctg gcctctggcc tgattggccc cctgctgatc tgctacaagg 1740 agtctgtgga ccagaggggc aaccagatca tgtctgacaa gaggaatgtg atcctgttct 1800 ctgtgtttga tgagaacagg agctggtacc tgactgagaa catccagagg ttcctgccca 1860 accctgctgg ggtgcagctg gaggaccctg agttccaggc cagcaacatc atgcacagca 1920 tcaatggcta tgtgtttgac agcctgcagc tgtctgtgtg cctgcatgag gtggcctact 1980 ggtacatcct gagcattggg gcccagactg acttcctgtc tgtgttcttc tctggctaca 2040 ccttcaagca caagatggtg tatgaggaca ccctgaccct gttccccttc tctggggaga 2100 ctgtgttcat gagcatggag aaccctggcc tgtggattct gggctgccac aactctgact 2160 tcaggaacag gggcatgact gccctgctga aagtctccag ctgtgacaag aacactgggg 2220 actactatga ggacagctat gaggacatct ctgcctacct gctgagcaag aacaatgcca 2280 ttgagcccag gagcttcagc cagaatgcca ctaatgtgtc tcccccagtg ctgaagaggc 2340 accagaggga gatcaccagg accaccctgc agtctgacca ggaggagatt gactatgatg 2400 acaccatctc tgtggagatg aagaaggagg actttgacat ctacgacgag gacgagaacc 2460 agagccccag gagcttccag aagaagacca ggcactactt cattgctgct gtggagaggc 2520 tgtgggacta tggcatgagc agcagccccc atgtgctgag gaacagggcc cagtctggct 2580 ctgtgcccca gttcaagaag gtggtgttcc aggagttcac tgatggcagc ttcacccagc 2640 ccctgtacag aggggagctg aatgagcacc tgggcctgct gggcccctac atcagggctg 2700 aggtggagga caacatcatg gtgaccttca ggaaccaggc cagcaggccc tacagcttct 2760 acagcagcct gatcagctat gaggaggacc agaggcaggg ggctgagccc aggaagaact 2820 ttgtgaagcc caatgaaacc aagacctact tctggaaggt gcagcaccac atggccccca 2880 ccaaggatga gtttgactgc aaggcctggg cctacttctc tgatgtggac ctggagaagg 2940 atgtgcactc tggcctgatt ggccccctgc tggtgtgcca caccaacacc ctgaaccctg 3000 cccatggcag gcaggtgact gtgcaggagt ttgccctgtt cttcaccatc tttgatgaaa 3060 ccaagagctg gtacttcact gagaacatgg agaggaactg cagggccccc tgcaacatcc 3120 agatggagga ccccaccttc aaggagaact acaggttcca tgccatcaat ggctacatca 3180 tggacaccct gcctggcctg gtgatggccc aggaccagag gatcaggtgg tacctgctga 3240 gcatgggcag caatgagaac atccacagca tccacttctc tggccatgtg ttcactgtga 3300 ggaagaagga ggagtacaag atggccctgt acaacctgta ccctggggtg tttgagactg 3360 tggagatgct gcccagcaag gctggcatct ggagggtgga gtgcctgatt ggggagcacc 3420 tgcatgctgg catgagcacc ctgttcctgg tgtacagcaa caagtgccag acccccctgg 3480 gcatggcctc tggccacatc agggacttcc agatcactgc ctctggccag tatggccagt 3540 gggcccccaa gctggccagg ctgcactact ctggcagcat caatgcctgg agcaccaagg 3600 agcccttcag ctggatcaag gtggacctgc tggcccccat gatcatccat ggcatcaaga 3660 cccagggggc caggcagaag ttcagcagcc tgtacatcag ccagttcatc atcatgtaca 3720 gcctggatgg caagaagtgg cagacctaca ggggcaacag cactggcacc ctgatggtgt 3780 tctttggcaa tgtggacagc tctggcatca agcacaacat cttcaacccc cccatcattg 3840 ccagatacat caggctgcac cccacccact acagcatcag gagcaccctg aggatggagc 3900 tgatgggctg tgacctgaac agctgcagca tgcccctggg catggagagc aaggccatct 3960 ctgatgccca gatcactgcc agcagctact tcaccaacat gtttgccacc tggagcccca 4020 gcaaggccag gctgcacctg cagggcagga gcaatgcctg gaggccccag gtcaacaacc 4080 ccaaggagtg gctgcaggtg gacttccaga agaccatgaa ggtgactggg gtgaccaccc 4140 agggggtgaa gagcctgctg accagcatgt atgtgaagga gttcctgatc agcagcagcc 4200 aggatggcca ccagtggacc ctgttcttcc agaatggcaa ggtgaaggtg ttccagggca 4260 accaggacag cttcacccct gtggtgaaca gcctggaccc ccccctgctg accagatacc 4320 tgaggattca cccccagagc tgggtgcacc agattgccct gaggatggag gtgctgggct 4380 gtgaggccca ggacctgtac tgatcgcgaa taaaagatct ttattttcat tagatctgtg 4440 tgttggtttt ttgtgtg 4457 <210> 373 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <220> <221> MISC_FEATURE <223> 2-glycan B domain substitute <400> 373 Ser Phe Ser Gln Asn Ala Thr Asn Val Ser Pro Val Leu Lys Arg 1 5 10 15 His Gln Arg

Claims (136)

A system for altering a host cell DNA sequence comprising:
a deoxyribonucleic acid (DNA) endonuclease or a nucleic acid encoding a DNA endonuclease;
a guide RNA (gRNA) comprising a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA; and
A donor template comprising a nucleic acid sequence encoding a synthetic FVIII protein, said synthetic FVIII protein comprising a B domain substitution, said B domain substitution having 0 to 9 N-linked glycosylation sites and 3 to about 40 A donor template comprising an amino acid length. The system of claim 1 , wherein the B domain substitution comprises 0 to 6 N-linked glycosylation sites. 3. The system of claim 2, wherein the B domain substitution comprises 0 to 3 N-linked glycosylation sites. The system of claim 1 , wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362-369, 371 and 373. 5. The method of claim 4, wherein the B domain substitution has at least 80% identity to the amino acid sequence of any one of SEQ ID NOs: 362-366, 371 and 373 or any one of SEQ ID NOs: 362-366, 371 and 373. systems comprising variants thereof with 6. The system of claim 5, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362 to 364, 371 and 373. 7. The system according to any one of claims 1 to 6, wherein the host cell locus is a locus of a gene expressed in the liver. 8. The system according to any one of claims 1 to 7, wherein the host cell locus is the locus of a gene encoding an acute phase protein. 9. The system of claim 8, wherein the acute phase protein is albumin, transferrin or fibrinogen. 8. The system according to any one of claims 1 to 7, wherein the host cell locus is a safe harbor locus. 11. The method of any one of claims 1-10, wherein the DNA endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx17, Csx14, Csx17, Csx14, Csx A system selected from the group consisting of Csx15, Csf1, Csf2, Csf3, Csf4, or Cpf1 endonuclease, and functional derivatives thereof. The system of claim 11 , wherein the DNA endonuclease is Cas9. 12. The system of any one of claims 1-11, wherein the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a host cell. 14. The system of any one of claims 1-13, wherein the nucleic acid encoding the DNA endonuclease is deoxyribonucleic acid (DNA). 14. The system of any one of claims 1-13, wherein the nucleic acid encoding the DNA endonuclease is a ribonucleic acid (RNA). 16. The system of claim 15, wherein the RNA encoding the DNA endonuclease is mRNA. 17. The system of any one of claims 1 to 16, wherein the donor template nucleic acid sequence is codon optimized for expression in a host cell. 18. The system of any one of claims 1-17, wherein the donor template nucleic acid sequence comprises a reduced content of CpG di-nucleotides compared to a wild-type nucleic acid sequence encoding the FVIII protein. 19. The system of claim 18, wherein the donor template nucleic acid sequence does not comprise a CpG di-nucleotide. 20. The system of any one of claims 1-19, wherein the donor template is encoded in an adeno-associated virus (AAV) vector. 21. The system of any one of claims 1-20, wherein the donor template comprises a donor cassette comprising a nucleic acid sequence encoding a synthetic FVIII protein, the donor cassette flanked on one or both sides by the gRNA target site. . 22. The system of claim 21, wherein the donor cassette is flanked on both sides by the gRNA target site. 22. The system of claim 21, wherein the donor cassette flanks the gRNA target site on its 5' side. 24. The system of any one of claims 21-23, wherein the gRNA target site is a target site for a gRNA in the system. 25. The system of claim 24, wherein the gRNA target site of the donor template is the reverse complement of the genomic gRNA target site to the gRNA in the system. 26. The system according to any one of claims 1 to 25, wherein the DNA endonuclease or nucleic acid encoding the DNA endonuclease is contained in liposomes or lipid nanoparticles. 27. The system of claim 26, wherein the liposome or lipid nanoparticle also comprises a gRNA. 28. The system of any one of claims 1-27, wherein the DNA endonuclease is complexed with the gRNA to provide a ribonucleoprotein (RNP) complex. A method of editing a genome in a host cell comprising providing to the cell:
(a) a gRNA comprising a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA;
(b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and
(c) a donor template comprising a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein comprises a B domain substitution, wherein the B domain substitution has 0 to 9 N-linked glycosylation sites and 3 to A donor template comprising about 40 amino acids in length. 30. The method of claim 29, wherein the B domain substitution comprises 0 to 6 N-linked glycosylation sites. 31. The method of claim 30, wherein the B domain substitution comprises 0 to 3 N-linked glycosylation sites. 30. The method of claim 29, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362-369, 371 and 373. 33. The method of claim 32, wherein the B domain substitution has at least 80% identity to the amino acid sequence of any one of SEQ ID NOs: 362-366, 371 and 373 or any one of SEQ ID NOs: 362-366, 371 and 373. A method comprising a variant thereof having 34. The method of claim 33, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362 to 364, 371 and 373. 35. The method of any one of claims 29-34, wherein the host cell endogenous locus is a locus of a gene expressed in the liver. 36. The method of any one of claims 29-35, wherein the host cell endogenous locus is the locus of a gene encoding an acute phase protein. 37. The method of claim 36, wherein the acute phase protein is albumin, transferrin or fibrinogen. 35. The method of any one of claims 29-34, wherein the host cell endogenous locus is a Safe Harbor locus. 39. The method of any one of claims 29-38, wherein the DNA endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx17, Csx14, Csx17, Csx14, Csx Csx15, Csf1, Csf2, Csf3, Csf4, and Cpf1 endonucleases, and functional derivatives thereof. 40. The method of claim 39, wherein the DNA endonuclease is Cas9. 41. The method of any one of claims 29-40, wherein the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a host cell. 42. The method of any one of claims 29-41, wherein the nucleic acid encoding the DNA endonuclease is DNA. 42. The method of any one of claims 29-41, wherein the nucleic acid encoding the DNA endonuclease is ribonucleic acid (RNA). 44. The method of claim 43, wherein the RNA encoding the DNA endonuclease is mRNA. 30. The method of claim 29, wherein the donor template is encoded in an AAV vector. 46. The method of any one of claims 29-45, wherein the donor template nucleic acid sequence is codon optimized for expression in a host cell. 47. The method of any one of claims 29-46, wherein the donor template nucleic acid sequence comprises a reduced content of CpG di-nucleotides compared to a wild-type nucleic acid sequence encoding FVIII. 48. The method of claim 47, wherein the donor template nucleic acid sequence does not comprise a CpG di-nucleotide. 49. The method of any one of claims 29-48, wherein the donor template comprises a donor cassette comprising a nucleic acid sequence encoding a synthetic FVIII protein, wherein the donor cassette is flanked on one or both sides by the gRNA target site. . 50. The method of claim 49, wherein the donor cassette is flanked on both sides by the gRNA target site. 50. The method of claim 49, wherein the donor cassette flanks the gRNA target site on its 5' side. 52. The method of any one of claims 49-51, wherein the gRNA target site is a target site for the gRNA of (a). 53. The method of claim 52, wherein the gRNA target site of the donor template is the reverse complement of the gRNA target site in the genome of the cell to the gRNA of (a). 54. The method of any one of claims 29-53, wherein the DNA endonuclease or nucleic acid encoding the DNA endonuclease is formulated in liposomes or lipid nanoparticles. 55. The method of claim 54, wherein the liposome or lipid nanoparticle also comprises a gRNA. 56. The method of any one of claims 29-55, wherein the DNA endonuclease and the gRNA are provided to the host cell as an RNP complex comprising the DNA endonuclease pre-complexed with the gRNA. 57. The method according to any one of claims 29 to 56, wherein the gRNA or nucleic acid encoding the gRNA of (a) and the DNA endonuclease or the nucleic acid encoding the DNA endonuclease of (c) are A method in which the donor template is provided to the cells for a time greater than 4 days after the donor template is provided to the cells. 58. The method according to any one of claims 29 to 57, wherein the gRNA or nucleic acid encoding the gRNA of (a) and the DNA endonuclease or the nucleic acid encoding the DNA endonuclease of (c) are A method wherein the donor template is provided to the cells at least 14 days after providing the cells. 59. The method of claim 57 or 58, wherein the one or more additional doses of the gRNA or nucleic acid encoding the gRNA of (a), and the DNA endonuclease or the nucleic acid encoding the DNA endonuclease of (b) are second A method provided to a cell after one dose of (a) a gRNA or nucleic acid encoding a gRNA and (b) a DNA endonuclease or nucleic acid encoding a DNA endonuclease. 60. The method of claim 59, wherein at least one additional dose of (a) a gRNA or nucleic acid encoding a gRNA and (b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease comprises a first dose of (a) After the gRNA or nucleic acid encoding the gRNA of ) and the nucleic acid encoding the DNA endonuclease or DNA endonuclease of (b), the target level of targeted integration of the nucleic acid sequence encoding the synthetic FVIII protein is achieved or A method of providing a cell until a target level of expression of a nucleic acid sequence encoding a synthetic FVIII protein is achieved. 61. The method of any one of claims 29-60, wherein the cell is a hepatocyte. 62. The method of claim 61, wherein the cell is a human hepatocyte or a human allogeneic epithelial cell. A cell, wherein the genome of said cell comprises DNA encoding a synthetic FVIII protein, said synthetic FVIII protein comprising B domain substitutions, said B domain substitutions comprising 0 to 9 N-linked glycosylation sites and 3 to about 40 amino acids in length. 64. The cell of claim 63, wherein the synthetic FVIII protein is operably linked to an endogenous albumin promoter, an endogenous transferrin promoter or an endogenous fibrinogen alpha promoter. 64. The cell of claim 63, wherein the nucleic acid sequence encoding the synthetic FVIII protein is codon-optimized for expression in the cell. 64. The cell of claim 63, wherein the cell is a human liver cell. 67. The cell of claim 66, wherein the cell is a human hepatocyte or a human allogeneic epithelial cell. 68. The cell of claim 67, wherein the cell is produced by the method of any one of claims 29-62, or is a progeny of a cell produced by the method of any one of claims 29-62. A method of treating hemophilia A in a subject, said method comprising:
A method comprising providing to a cell of a subject:
(a) a gRNA comprising a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA;
(b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and
(c) a donor template comprising a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein comprises a B domain substitution, wherein the B domain substitution has 0 to 9 N-linked glycosylation sites and 3 to A donor template comprising about 40 amino acids in length. 70. The method of claim 69, wherein the B domain substitution comprises 0 to 6 N-linked glycosylation sites. 71. The method of claim 70, wherein the B domain substitution comprises 0 to 3 N-linked glycosylation sites. 70. The method of claim 69, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362-369, 371 and 373. 73. The method of claim 72, wherein the B domain substitution has at least 80% identity to the amino acid sequence of any one of SEQ ID NOs: 362-366, 371 and 373 or any one of SEQ ID NOs: 362-366, 371 and 373. A method comprising a variant thereof having 74. The method of claim 73, wherein the B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362 to 364, 371 and 373. 75. The method of any one of claims 69-74, wherein the host cell locus is a locus of a gene expressed in the liver. 76. The method of any one of claims 69-75, wherein the host cell locus is the locus of a gene encoding an acute phase protein. 77. The method of claim 76, wherein the acute phase protein is albumin, transferrin or fibrinogen. 75. The method of any one of claims 69-74, wherein the host cell locus is a Safe Harbor locus. 79. The method of any one of claims 69-78, wherein the DNA endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx17, Csx14, Csx17, Csx14, Csx Csx15, Csf1, Csf2, Csf3, Csf4, and Cpf1 endonucleases, and functional derivatives thereof. 80. The method of claim 79, wherein the DNA endonuclease is Cas9. 81. The method of claim 80, wherein the Cas9 is spCas9 or SluCas9. 82. The method of any one of claims 69-81, wherein the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a cell. 83. The method of any one of claims 69-82, wherein the nucleic acid encoding the DNA endonuclease is DNA. 83. The method of any one of claims 69-82, wherein the nucleic acid encoding the DNA endonuclease is RNA. 85. The method of claim 84, wherein the RNA encoding the DNA endonuclease is mRNA. 86. The method according to any one of claims 69 to 85, comprising (a) a gRNA or a nucleic acid encoding a gRNA, (b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease, and (c) A method wherein one or more of the donor templates are formulated in liposomes or LNPs. 87. The method of any one of claims 69-86, wherein the donor template is encoded in an AAV vector. 88. The method of any one of claims 69-87, wherein the donor template nucleic acid sequence is codon optimized for expression in a host cell. 89. The method of any one of claims 69-88, wherein the donor template nucleic acid sequence comprises a reduced content of CpG di-nucleotides compared to a wild-type nucleic acid sequence encoding FVIII. 91. The method of claim 89, wherein the donor template nucleic acid sequence does not comprise a CpG di-nucleotide. 91. The method of any one of claims 69-90, wherein the donor template comprises a donor cassette comprising a nucleic acid sequence encoding a synthetic FVIII protein, wherein the donor cassette is flanked on one or both sides by the gRNA target site. . 92. The method of claim 91, wherein the donor cassette is flanked on both sides by the gRNA target site. 92. The method of claim 91, wherein the donor cassette flanks the gRNA target site on its 5' side. 94. The method of any one of claims 91-93, wherein the gRNA target site is a target site for a gRNA. 95. The method of claim 94, wherein the gRNA target site of the donor template is the reverse complement of the gRNA target site in the genome of the cell to the gRNA of (a). 96. The method of any one of claims 69-95, wherein providing the donor template to the cells comprises administering the donor template intravenously to the subject. 97. The method of any one of claims 69-96, wherein the DNA endonuclease or nucleic acid encoding the DNA endonuclease is formulated in a liposome or LNP. 98. The method of claim 97, wherein the liposome or LNP also comprises a gRNA. 99. The method of claim 98, wherein providing the gRNA or nucleic acid encoding the gRNA and the DNA endonuclease or nucleic acid encoding the DNA endonuclease to the cell comprises intravenously administering the liposome or lipid nanoparticle to the subject. How to. 101. The method of any one of claims 69-99, wherein the DNA endonuclease and the gRNA are provided to the host cell as a ribonucleoprotein (RNP) complex, and the RNP complex produces a DNA endonuclease complexed with the gRNA. How to include. 101. The method according to any one of claims 69 to 100, wherein the gRNA or nucleic acid encoding the gRNA of (a) and the DNA endonuclease or the nucleic acid encoding the DNA endonuclease of (c) are A method in which the donor template is provided to the cells for a time greater than 4 days after the donor template is provided to the cells. 102. The method of any one of claims 69-101, wherein the gRNA or nucleic acid encoding the gRNA of (a) and the DNA endonuclease or the nucleic acid encoding the DNA endonuclease of (c) are A method wherein the donor template is provided to the cells at least 14 days after providing the cells. 103. The method of claim 101 or 102, wherein at least one additional dose of the gRNA or nucleic acid encoding the gRNA of (a) and the DNA endonuclease or the nucleic acid encoding the DNA endonuclease of (b) the first A method provided to the cell after a dose of (a) the gRNA or nucleic acid encoding the gRNA and (b) the DNA endonuclease or nucleic acid encoding the DNA endonuclease. 104. The method of claim 103, wherein at least one additional dose of (a) a gRNA or nucleic acid encoding a gRNA and (b) a DNA endonuclease or nucleic acid encoding a DNA endonuclease comprises a first dose of (a) ) after the gRNA or nucleic acid encoding the gRNA and the nucleic acid encoding the DNA endonuclease or DNA endonuclease of (b) followed by targeted integration of the nucleic acid sequence encoding the synthetic FVIII protein and/or A method of providing a cell until a target level of expression of a nucleic acid sequence encoding a synthetic FVIII protein is achieved. 105. The method of any one of claims 101-104, wherein the step of providing the gRNA of (a) and the DNA endonuclease of (b) or a nucleic acid encoding the DNA endonuclease to the cell comprises a DNA endonuclease. A method comprising administering to a subject a lipid nanoparticle comprising a nucleic acid encoding the agent and a gRNA. 106. The method of any one of claims 101-105, wherein providing the donor template of (c) to the cell comprises administering to the subject a donor template encoded in an AAV vector. 107. The method of any one of claims 69-106, wherein the cell is a hepatocyte. 108. The method of any one of claims 69-107, wherein the nucleic acid sequence encoding the synthetic FVIII protein is expressed in the liver of the subject. 69. A method of treating hemophilia A in a subject comprising administering to the subject the cell of any one of claims 63-68. 110. The method of claim 109, wherein the cell is autologous to the subject. 112. The method of claim 110, further comprising obtaining a biological sample from the subject, wherein the biological sample comprises liver cells, wherein the cells are prepared from liver cells. 29. A kit comprising one or more elements of the system of any one of claims 1-28, further comprising instructions for use. A nucleic acid comprising a polynucleotide sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein comprises a B domain substitution, wherein the B domain substitution has 0 to 9 N-linked glycosylation sites and 3 to about 40 A nucleic acid comprising an amino acid length. 114. The nucleic acid of claim 113, wherein the B domain substitution comprises 0 to 6 N-linked glycosylation sites. 114. The nucleic acid of claim 113, wherein the B domain substitution comprises 0-3 N-linked glycosylation sites. 114. The nucleic acid of claim 113, wherein said B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362-369, 371 and 373. 117. The method of claim 116, wherein the B domain substitution has at least 80% identity to the amino acid sequence of any one of SEQ ID NOs: 362 to 364, 371 and 373 or any one of SEQ ID NOs: 362 to 364, 371 and 373. A nucleic acid comprising a variant thereof with 117. The nucleic acid of claim 116, wherein said B domain substitution comprises the amino acid sequence of any one of SEQ ID NOs: 362-363, 371 and 373. 119. The nucleic acid of any one of claims 113-118, wherein the polynucleotide sequence encoding the synthetic FVIII protein is codon optimized for expression in a host cell. 120. The nucleic acid of any one of claims 113-119, wherein the polynucleotide sequence encoding the synthetic FVIII protein comprises a reduced content of CpG di-nucleotides compared to a wild-type nucleic acid sequence encoding FVIII. 121. The nucleic acid of claim 120, wherein the polynucleotide sequence encoding the synthetic FVIII protein does not comprise a CpG dinucleotide. 122. The nucleic acid according to any one of claims 113 to 121, wherein said nucleic acid is a viral vector. 123. The nucleic acid of claim 122, wherein said viral vector is an AAV vector. A method of increasing the amount of FVIII in a subject, said method comprising:
A method comprising providing a cell in a subject, wherein the subject has a first serum level of FVIII:
(a) a gRNA comprising a spacer sequence complementary to a host cell locus or a nucleic acid encoding the gRNA;
(b) a DNA endonuclease or a nucleic acid encoding a DNA endonuclease; and
(c) a donor template comprising a nucleic acid sequence encoding a synthetic FVIII protein, wherein the synthetic FVIII protein comprises a B domain substitution, wherein the B domain substitution has 0 to 9 N-linked glycosylation sites and 3 to A donor template comprising about 40 amino acids in length. 125. The method of claim 124, wherein the first serum level of FVIII is less than about 0.40 IU/mL. 126. The method of claim 125, wherein the first serum level of FVIII is less than about 0.05 IU/mL. 126. The method of claim 125, wherein the first serum level of FVIII is less than about 0.01 IU/mL. 29. Use of the system of any one of claims 1-28 for the treatment of hemophilia A. 29. Use of the system of any one of claims 1-28 for the manufacture of a medicament for the treatment of hemophilia A. 69. Use of a cell according to any one of claims 63 to 68 for the treatment of hemophilia A. 69. Use of a cell according to any one of claims 63 to 68 for the manufacture of a medicament for the treatment of hemophilia A. 112. Use of the kit of claim 112 for the treatment of hemophilia A. 112. Use of the kit of claim 112 for the manufacture of a medicament for the treatment of hemophilia A. 124. Use of a nucleic acid according to any one of claims 113 to 123 for the treatment of hemophilia A. 124. Use of a nucleic acid according to any one of claims 113 to 123 for the manufacture of a medicament for the treatment of hemophilia A. A synthetic FVIII protein, wherein the synthetic FVIII protein comprises a B domain substitution, wherein the B domain substitution comprises 0 to 9 N-linked glycosylation sites and 3 to about 40 amino acids in length.

Images