KR20220018788A - Composition for alleviating or treating obesity comprising peptide fragment of SOCS6 - Google Patents

Abstract

The present invention relates to a composition for treating obesity comprising a polypeptide fragment of SOCS6. The polypeptide fragment of SOCS6 of the present invention promotes the expression of genes related to lipolysis, suppresses the accumulation of lipids in adipocytes, and has excellent effects of decomposing triglycerides, so it can be usefully used as a preventive or therapeutic agent for obesity.

Description

Composition for alleviating or treating obesity comprising peptide fragment of SOCS6

The present invention relates to a composition for treating obesity comprising a polypeptide fragment of SOCS6.

Recently, in Korea, due to economic growth and westernization of diet, the intake of fat from food has greatly increased, and accordingly, metabolic diseases such as obesity, diabetes, hyperlipidemia, hypertension, arteriosclerosis, and fatty liver are increasing. In particular, obesity has a very high correlation with the above-described metabolic disease, and thus is a target of treatment.

Currently, the treatment for obesity can be divided into drugs that affect appetite by acting on the central nervous system and drugs that inhibit absorption by acting on the gastrointestinal tract. Drugs acting on the central nervous system include drugs such as fenfluramine and dexfenfluramine that inhibit the serotonin (5-HT) nervous system according to each mechanism, drugs such as ephedrine and caffeine via the noradrenergic nervous system, and recently serotonin and noradrenergic nervous system Drugs such as sibutramine, which act simultaneously to inhibit obesity, are on the market. In addition, orlistat, which is a drug that inhibits obesity by acting on the stomach/intestine, inhibits intestinal lipase to reduce fat absorption, and the like, is used as a representative drug. However, among previously used drugs, drugs such as fenfluramine were recently banned because they caused primary pulmonary hypertension or heart valve lesions due to side effects. of patients, there is a problem that it cannot be used.

Therefore, there is an urgent need to develop a new drug as a safe and effective substitute for inhibiting fat accumulation or decomposing already accumulated fat.

Numerous papers and patent documents are referenced throughout this specification and their citations are indicated. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly describe the level of the technical field to which the present invention pertains and the content of the present invention.

Republic of Korea Patent Publication No. 10-2017-0119009 (published on October 26, 2017)

An object of the present invention is to provide a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 and a pharmaceutical composition and a food composition for preventing, improving, or treating obesity comprising the same as an active ingredient.

Another object of the present invention is to provide a nucleic acid molecule encoding the polypeptide.

Another object of the present invention is to provide a recombinant vector comprising the nucleic acid molecule.

Another object of the present invention is to provide a host cell containing the recombinant vector.

The present inventors have tried to develop a polypeptide that inhibits the accumulation of fat and has an excellent decomposition effect of the accumulated fat. As a result, a polypeptide having an amino acid sequence of “TRSSREH” was derived from the suppressor of cytokine signaling 6 (SOCS6) protein, and the present invention was completed after confirming that the polypeptide had an excellent fat accumulation inhibitory effect and lipolytic effect. Information on the SOCS6 protein and the mRNA sequence encoding the same can be found in GenBank Access No. It can be confirmed in NM_004232.4.

According to one aspect of the present invention, the present invention provides a polypeptide comprising the amino acid sequence of SEQ ID NO: 1.

In one embodiment of the present invention, the polypeptide comprising the amino acid sequence of SEQ ID NO: 1 of the present invention suppresses the accumulation of fat, AMPK1alpha, PPAR-gamma, and HSL (hormone-sensitive lipase) which are genes related to lipolysis ) to promote the expression of

In the present invention, the AMPK is an enzyme that serves as a sensor in maintaining energy homeostasis in cells. When the energy in cells is reduced due to metabolic stress or exercise, it is activated to consume ATP (for example, fatty acid synthesis and cholesterol synthesis) and promotes ATP production (eg fatty acid oxidation and glycolysis) (Hardie DG: AMP activated/SNF1 protein kinases: conserved guardians of cellular energy. Nat Rev Mol Cell Biol 8:774- 785, 2007). The effect on activation of AMPK is implicated in target organs (liver, muscle, fat, pancreas) that are closely related to the regulation of energy metabolism (Zhang BB, Zhou G, Li C: AMPK: an emerging drug target for diabetes and the metabolic syndrome. Cell Metab 9:407-416, 2009). When AMPK is activated in the liver, it inhibits the synthesis of fatty acids and cholesterol and promotes the oxidation of fatty acids. When AMPK is activated in skeletal muscle, it promotes the oxidation of fatty acids and absorption of sugar, and inhibits lipolysis and lipogenesis in adipocytes. In addition, increased activation and expression of AMPK induces hypoglycemia through inhibition of hepatic glucose production (Foretz M, et al., Diabetes 54:1331-1339, 2005, Lochhead PA, et al., Diabetes 49:896-903) , 2000).

As used herein, the term “polypeptide” refers to a linear molecule formed by bonding amino acid residues to each other by peptide bonds. Polypeptides of the present invention can be prepared by chemical synthesis methods known in the art, particularly solid-phase synthesis techniques; Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al. , Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid phase synthesis technology (US Patent No. 5,516,891).

The polypeptide of the present invention may select a portion of the amino acid sequence and induce modifications at the N-terminus or C-terminus to increase its activity. Through this modification, the polypeptide of the present invention can have a high half-life with increased half-life upon in vivo administration.

In another embodiment of the present invention, the C-terminus of the polypeptide of the present invention may be modified with a hydroxyl group (-OH), an amino group (-NH ₂ ), an azide group (-NHNH ₂ ), etc., of the polypeptide A protecting group selected from the group consisting of an acetyl group, a fluorenyl methoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG) may be bonded to the N-terminus.

Modification of the above-described amino acids acts to greatly improve the stability of the polypeptide of the present invention. As used herein, the term “stability” refers to storage stability (eg, room temperature storage stability) as well as in vivo stability. The above-mentioned protecting group functions to protect the polypeptide of the present invention from attack by proteolytic enzymes in vivo.

According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating obesity comprising a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

In one embodiment of the present invention, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier. The pharmaceutical composition of the present invention contains a pharmaceutically effective amount of the polypeptide.

As used herein, the term “obesity” means excessive accumulation of body fat in the body and/or excessive increase in body weight than the standard.

As used herein, the term “pharmaceutically effective amount” refers to an amount sufficient to achieve therapeutic or preventive efficacy of the above-described polypeptide for obesity.

As used herein, the term “prevention” refers to any action that inhibits the onset of a disease or pathological condition by administration of the composition of the present invention.

As used herein, the term “treatment” refers to inhibiting the development of a disease or pathological condition; alleviation of disease; and elimination of the disease.

When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers are those commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like, in addition to the above components. Suitable pharmaceutically acceptable carriers and agents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, intravenous administration, subcutaneous administration, intradermal administration, transdermal administration, skin administration, intramuscular administration, intranasal administration, intramucosal administration, It may be administered by intrathecal administration, intraperitoneal administration, intraocular administration, etc., and specifically, oral administration.

A suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and response sensitivity of the patient, An ordinarily skilled physician can readily determine and prescribe a dosage effective for the desired treatment or prophylaxis. According to a specific embodiment of the present invention, the daily dose of the pharmaceutical composition of the present invention is 0.001-100 mg/kg. The daily dose of the pharmaceutical composition of the present invention is, for example, 0.1-100 mg/kg, 0.1-90 mg/kg, 0.1-80 mg/kg, 0.1-70 mg/kg, 0.1-60 mg/kg, 0.1 -50 mg/kg, 0.1-400 mg/kg, 0.1-30 mg/kg, 0.1-20 mg/kg, 0.1-10 mg/kg, 0.1-50 mg/kg, 0.1-30 mg/kg, 0.1- 20 mg/kg, 0.1-10 mg/kg, 0.1-7 mg/kg, 0.1-5 mg/kg, 1-100 mg/kg, 1-90 mg/kg, 1-80 mg/kg, 1-70 mg/kg, 1-60 mg/kg, 1-50 mg/kg, 1-40 mg/kg, 1-30 mg/kg, 1-20 mg/kg, 1-10 mg/kg, 1 -7 mg/kg, 1-5 mg/kg, 1-3 mg/kg, 1-2 mg/kg, more specifically 1, 2, 3, 4, 5, 6, 7, 8, It may be 9, or 10 mg/kg, but is not limited thereto.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains. or it may be prepared by incorporation into a multi-dose container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant or stabilizer.

The pharmaceutical composition of the present invention may be administered in combination with a known compound or pharmaceutical composition having an effect of preventing and treating obesity.

According to another aspect of the present invention, the present invention provides a food composition for preventing or improving obesity comprising a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

The food composition may be used as a health functional food or added to various foods.

As used herein, the term “improvement” refers to delaying progression to a disease or pathological condition by administration of the composition of the present invention; and any action that alleviates a disease or pathological condition.

The present invention also provides a health functional food comprising the food composition. The health functional food may be beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gums, ice cream, alcoholic beverages, vitamin complexes, or health supplements.

The content of the polypeptide of the present invention contained in the food composition may be appropriately adjusted according to the type of food, desired use, etc., and there is no particular limitation. For example, the content of the polypeptide may be 0.001 to 30% by weight or 0.01 to 20% by weight of the total food weight, and in the case of a health beverage composition, 0.001 to 15 g, 0.02 to 10 g, or 0.3 to 1 based on 100 ml g, but is not limited thereto.

When the composition comprising the polypeptide of the present invention is prepared as a food composition, it may include not only the polypeptide as an active ingredient, but also ingredients commonly added during food production. The additional ingredients include, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents. Examples of the above-mentioned carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose, oligosaccharides and the like; and polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agent, natural flavoring agents [taumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)] and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is prepared as a drink, citric acid, high fructose, sugar, glucose, acetic acid, malic acid, fruit juice, bean extract, jujube extract, licorice extract, etc. may be additionally included in addition to the polypeptide of the present invention. can

Since the food composition for preventing or improving obesity of the present invention contains a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient in the same manner as the above-described "pharmaceutical composition for preventing or treating obesity", the amount In order to avoid undue redundancy in the present specification, descriptions of matters common among the inventions are omitted.

According to another aspect of the present invention, the present invention provides a nucleic acid molecule encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 described above.

As used herein, the term "nucleic acid molecule" has a meaning comprehensively including DNA (gDNA and cDNA) and RNA molecules. Analogs are also included (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90:543-584 (1990)).

The nucleotide sequence encoding the polypeptide of the present invention suffices to be a nucleotide sequence encoding an amino acid sequence constituting the polypeptide, and it is apparent to those skilled in the art that it is not limited to any specific nucleotide sequence. This is because, even if a nucleotide sequence mutation occurs, the protein sequence does not change when the mutated nucleotide sequence is expressed as a protein in some cases. This is called codon degeneracy. Thus, the nucleotide sequence is a functionally equivalent codon or codon encoding the same amino acid (eg, due to codon degeneracy, there are six codons for arginine or serine), or a codon encoding a biologically equivalent amino acid It contains a nucleotide sequence comprising a.

The nucleic acid molecule of the present invention encoding the polypeptide is construed to include a nucleotide sequence exhibiting substantial identity to the nucleotide sequence described above. The substantial identity is at least 80% when the above-described nucleotide sequence of the present invention and any other sequences are aligned as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art. , more preferably at least 90% homology, and most preferably at least 95%, 97%, 98%, or 99% homology.

Considering the above-described variation having biological equivalent activity, it is construed that the nucleic acid molecule encoding the polypeptide of the present invention includes a sequence exhibiting substantial identity to the sequence described in the sequence listing. The substantial identity is at least 61% when the above-described sequence of the present invention and any other sequences are aligned as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art. means a sequence that exhibits homology, more preferably 70% homology, even more preferably 80% homology, and most preferably 90% homology. Alignment methods for sequence comparison are known in the art. Various methods and algorithms for alignment are described in Smith and Waterman, Adv . Appl . Math. 2:482 (1981) ; Needleman and Wunsch, J. Mol . Bio. 48:443 (1970); Pearson and Lipman, Methods in Mol . Biol . 24: 307-31 (1988); Higgins and Sharp, Gene 73:237-44 (1988); Higgins and Sharp, CABIOS 5:151-3 (1989); Corpet et al., Nuc . Acids Res. 16:10881-90 (1988); Huang et al., Comp. Appl . BioSci . 8:155-65 (1992) and Pearson et al., Meth . Mol . Biol . 24:307-31 (1994). The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol . Biol . 215:403-10(1990)) is accessible from the National Center for Biological Information (NBCI), etc. It can be used in conjunction with sequencing programs such as blastx, tblastn and tblastx. BLAST can be accessed through the BLAST page of the ncbi website. A method for comparing sequence homology using this program can be found on the BLAST help page of the ncbi website.

According to another aspect of the present invention, the present invention provides a recombinant vector comprising a nucleic acid molecule encoding the above-described polypeptide.

According to one embodiment of the present invention, the expression vector is a vector into which a nucleic acid molecule encoding the polypeptide is inserted, is operatively linked to a nucleotide sequence of the nucleic acid molecule, and is an RNA molecule in a host cell. It is a recombinant vector for host cell expression comprising a promoter that forms it and a poly A signal sequence that acts in the host cell to cause polyadenylation of the 3'-end of the RNA molecule.

As used herein, the term "operatively linked" refers to a functional linkage between a nucleic acid expression control sequence (eg, a promoter, signal sequence, or an array of transcriptional regulator binding sites) and another nucleic acid sequence, and By this, the regulatory sequence controls the transcription and/or translation of the other nucleic acid sequence.

The vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are disclosed in Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001). , this document is incorporated herein by reference.

The vectors of the present invention can typically be constructed as vectors for cloning or as vectors for expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host.

For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of propagating transcription (eg, ^pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.) , a ribosome binding site for initiation of translation and a transcription/translation termination sequence.

When E. coli is used as a host cell, the promoter and operator site of the E. coli tryptophan biosynthesis pathway (Yanofsky, C., J. Bacteriol., 158:1018-1024 (1984)) and the left-handed promoter of phage λ (pL) The ^λ promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet., 14:399-445 (1980)) can be used as a regulatory region.

On the other hand, vectors that can be used in the present invention include plasmids (eg, pSK349, pSC101, ColE1, pBR322, pUC8/9, pHC79, pGEX series, pET series and pUC19, etc.), phage (eg, λgt ·λ4B, λ-Charon, λΔz1 and M13, etc.) or viruses (eg, SV40, etc.) can be manufactured.

The vector of the present invention may be fused with other sequences to facilitate purification of the polypeptide expressed therefrom. The sequence to be fused includes, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA). Because of the additional sequences for purification, the protein expressed in the host is rapidly and easily purified via affinity chromatography.

The vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and a gene for resistance to tetracycline.

On the other hand, when the vector of the present invention is an expression vector and a eukaryotic cell is a host, a promoter derived from the genome of a mammalian cell (eg, a metallotionine promoter) or a promoter derived from a mammalian virus (eg, adeno viral late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence. Optionally, the vector may additionally carry genes encoding reporter molecules (eg, luciferase and -glucuronidase).

According to another aspect of the present invention, the present invention provides a host cell transformed with the recombinant vector.

As a host cell capable of stably and continuously cloning and expressing the vector of the present invention, any host cell known in the art may be used, for example, E. coli Origami2, E. coli JM109, E. coli BL21 (DE3). ), E. coli strains such as E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus genus strains such as Bacillus subtilis, Bacillus thuringiensis, and Enterobacteriaceae and strains such as Salmonella typhimurium, Serratia marcesens, and various Pseudomonas species.

In addition, when the vector of the present invention is transformed into eukaryotic cells, as host cells, yeast (Saccharomyce cerevisiae), insect cells and animal cells (eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293) , HepG2, 3T3, RIN and MDCK cell lines) can be used.

The method of delivering the vector of the present invention into a host cell is, when the host cell is a prokaryotic cell, the CaCl ₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973)) ), Hanahan method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973); and Hanahan, D., J. Mol. Biol., 166:557-580). (1983)) and electroporation methods (Dower, WJ et al., Nucleic. Acids Res., 16:6127-6145 (1988)). In addition, when the host cell is a eukaryotic cell, the microinjection method (Capecchi, MR, Cell, 22:479 (1980)), the calcium phosphate precipitation method (Graham, FL et al., Virology, 52:456 (1973)), electroporation (Neumann, E. et al., EMBO J., 1:841 (1982)), liposome-mediated transfection (Wong, TK et al., Gene, 10:87 (1980)), DEAE- Dextran treatment (Gopal, Mol. Cell Biol., 5:1188-1190 (1985)), and gene bambadment (Yang et al., Proc. Natl. Acad. Sci., 87:9568-9572 (1990)) ), and the like, to inject the vector into the host cell.

In the present invention, the recombinant vector injected into the host cell can express the above-recombined polypeptide in the host cell, and in this case, a large amount of the polypeptide is obtained. For example, when the expression vector includes the lac promoter, the host cell may be treated with IPTG to induce gene expression.

The transformed host cell can be cultured by a known host cell culture method or a modified method thereof. For example, if the host cell is E. coli , a natural medium or a synthetic medium may be used as the medium for culturing the transformed host cell if it contains a carbon source, nitrogen source, inorganic salt, etc. that E. coli can efficiently use. have. Carbon sources that can be used include carbohydrates such as glucose, fructose, sucrose; starch, a hydrolyzate of starch; organic acids such as acetic acid and propionic acid; alcohols such as ethanol, propanol, glycerol, and the like. The nitrogen source is ammonia; ammonium salts of inorganic or organic acids such as ammonium chloride, ammonium sulfate, ammonium acetate and ammonium phosphate; peptone, meat extract, yeast extract, corn steep liquor, casein hydrolyzate, soybean extract, soybean hydrolyzate; various fermented cells and their lysates; and the like. Inorganic salts include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, manganese sulfate, copper sulfate, calcium carbonate, and the like.

The culture is usually carried out under aerobic conditions, such as by shaking culture or rotation by a rotary machine. The culture temperature is preferably in the range of 10 to 40° C., and the culture time is generally 5 hours to 7 days. The pH of the medium is preferably maintained in the range of 3.0 to 9.0 during culture. The pH of the medium can be adjusted with inorganic or organic acids, alkaline solutions, urea, calcium carbonate, ammonia, and the like. During culture, if necessary, antibiotics such as ampicillin, streptomycin, chloramphenicol, kanamycin and tetracycline may be added for maintenance and expression of the recombinant vector. When culturing a host cell transformed with a recombinant expression vector having an inducible promoter, if necessary, a suitable inducer may be added to the medium. For example, if the expression vector contains the lac promoter, IPTG (isopropyl-beta-D-thiogalactopyranoside) may be added, and if the expression vector contains a trp promoter, indoleacrylic acid may be added to the medium.

The present invention provides a composition for preventing, improving, or treating obesity comprising a SOCS6 polypeptide comprising the amino acid sequence of SEQ ID NO: 1 and the same. The polypeptide fragment of SOCS6 of the present invention promotes the expression of genes related to lipolysis, suppresses the accumulation of lipids in adipocytes, and has excellent effects of decomposing triglycerides, so it can be usefully used as a preventive or therapeutic agent for obesity. can

1 is a diagram showing the cytotoxicity test results of the polypeptide fragment of the present invention.
2 is a diagram showing the effect of a polypeptide fragment of the present invention on the expression of a lipolytic factor through RT-PCR results.
3 is a diagram showing the fat accumulation inhibitory effect of the polypeptide fragment of the present invention through H&E staining results for adipose tissue.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Throughout this specification, "%" used to indicate the concentration of a specific substance is (weight/weight) % for solid/solid, (weight/volume) % for solid/liquid, and Liquid/liquid is (volume/volume) %.

production example 1: of the present invention Poly peptide production of short stories

A polypeptide fragment for improving or treating obesity of the present invention consisting of the amino acid sequence of SEQ ID NO: 1 was prepared. The amino acid sequence of the polypeptide fragment of the present invention consists of “TRSSREH”. The polypeptide of the present invention was synthesized by Fmoc SPPS (solid phase peptide synthesis) method using ASP48S (Peptron, Inc., Korea), and Vydac Everest C18 column (250 mm × 22 mm, 10 μm, USA) was used. Separation was performed using high-performance reverse-phase HPLC (Shimadzu Prominence HPLC, Japan). Water-Acetonitrile linear gradient (Acetonitrile concentration: 10 to 75% (v/v)) containing 0.1% (v/v) trifluoroacetic acid was separated, and the molecular weight of the purified polypeptide was determined by LC/MS (Shimadzu LC/ MS-2020 series, Japan) was used. For freeze-drying, FDT-12012 (Operon, Korea) was used. The molecular weight (MW) of the polypeptide fragment of the present invention prepared as described above was 871.43 Da, and the purity was 99%. The polypeptide fragment was named AM-LIPOCUT-02 and used in the following experiments.

Experimental example 1: of the present invention Poly peptide Cytotoxicity test of fragments

The following test was performed to confirm the cytotoxicity of the polypeptide fragment of the present invention.

The 3T3-L1 cell line was placed in a 96-well plate with 1×10 ⁴ cells in Dulbecco's modified Eagle's media (DMEM) containing 10% bovine calf serum (BCS) and 1% penicillin streptomycin at 37°C, 5% CO ₂ condition. cultured in an incubator of After culturing for 12 hours, samples were treated at 1, 5, and 10 ug/ml, and after 24 hours of incubation, 10 μl of EZ-Cytox (DoGen, Korea, Cat. No. EZ-1000) was added to each well. . The reaction was carried out in an incubator for about 0.5 to 4 hours. Before measuring the absorbance of each sample, the absorbance was measured at 450 nm using a spectrophotometer after shaking gently for about 1 minute.

The results are shown in FIG. 1 .

As shown in FIG. 1, as a result of treating the polypeptide fragment (AM-LIPOCUT-02) of the present invention at concentrations of 0, 1, 5, and 10 ug/ml, cell viability of 80% or more was exhibited at all concentrations. From the above results, it was determined that the polypeptide fragment of the present invention has no toxicity of the polypeptide material itself, but the decrease in cell viability is because the polypeptide fragment of the present invention inhibits adipocyte differentiation or induces cell death. was judged to be

Experimental example 2: of the present invention Poly peptide Expression of fragments of lipolytic factors

In order to check the effect of the polypeptide fragment of the present invention on the expression of the lipolytic factor, RNA was extracted from adipocytes after treatment of the polypeptide fragment of the present invention at 1, 5, and 10 ug/ml, respectively, and factors related to lipolysis ( ATGL, PPAR-gamma, AMPK1a, and HSL) expression levels were measured as follows. As a positive control, 50 uM/ml of TNF-alpha was used.

First, total RNA was extracted from adipocytes using the Qiagen RNeasy kit. To synthesize single-stranded DNA from RNA, 3 mg RNA, 2 mg of random hexamer, and DEPC-treated water were added and reacted at 65° C. for 5 minutes. 5 x first strand buffer, 0.1M DTT, 10 mM dNTP, and reverse transcriptase were added to make a total of 20 ml and reacted at 42°C for 1 hour. After heating again at 95°C for 5 minutes, 20 ml of distilled water was added to make a final 40 ml of cDNA. PCR was performed by mixing 3 ml cDNA, 10 pmole primers specific for each lipolysis-related gene (ATGL, PPAR-gamma, AMPK1a, and HSL), 10x Tag buffer, 10 mM dNTP, and i-Tag DNA synthetase. did PCR conditions were 30 seconds at 95°C, 30 seconds at 55-59°C, and 30 seconds at 72°C. Genes were analyzed under conditions in which PCR results can be amplified exponentially. 5-10 ul of the PCR product was obtained, electrophoresed on a 1% agarose gel, and stained with ethidium bromide to confirm. The results are shown in FIG. 2 .

gene name F/R Sequence (5' to 3') SEQ ID NO: ATGL Forward CAACGCCACTCACATCTACG 2 Reverse GAGGGTAGGAGGAATGAGGC 3 AMPK1a Forward CTCAACCGGCAGAAGATTCG 4 Reverse GCCTGCGTACAATCTTCCTG 5 PPAR-gamma Forward AACTCCCTCATGGCCATTGA 6 Reverse TTTCCTGTCAAGATCGCCCT 7 HSL Forward CAGCATGGATTTACGCACGA 8 Reverse GCGTGACATACTCTTGCAGG 9 GAPDH Forward GGCATCTTGGGCTACACTGAG 10 Reverse GGAGAGTGGGAGTTGCTGTTG 11

As shown in Figure 2, the polypeptide fragment (AM-LIPOCUT-02) of the present invention increases the expression of HSL and AMPK1-alpha, which are lipolytic factors, in a concentration-dependent manner, thereby decomposing the accumulated fat, thereby exhibiting an excellent anti-obesity effect. can

Experimental example 3: of the present invention Poly peptide Inhibitory effect on fat accumulation of fragments

In order to measure the fat accumulation inhibitory effect of the polypeptide fragment of the present invention, 3T3-L1 cells were seeded and cultured in a 24-well plate at 2x10 ⁴ cells/well, and 10 μg/ml insulin, 0.1 μM dexamethasone and 0.5 μM IBMX were included. It was exchanged with the prepared differentiation medium and the polypeptide was treated at each concentration (1, 5, 10 ug/ml). After that, the medium containing 10 μg/ml insulin was exchanged every 2 days, and H&E staining was performed on the 9th day of differentiation induction. As for the staining method, 3T3-L1 cells treated by each experimental group were washed with PBS, fixed by treatment with 4% paraformaldehyde for 10 minutes, washed with distilled water, and incubated with 60% isopropanol for 5-10 minutes. Stained cells were observed under a light microscope. The results are shown in FIG. 3 .

As shown in FIG. 3, it was confirmed through H&E staining that the degree of intracellular fat accumulation decreased in a concentration-dependent manner when the polypeptide of the present invention was treated.

From the above results, it was confirmed that the polypeptide fragment consisting of the amino acid sequence of SEQ ID NO: 1 of the present invention is excellent in the effect of decomposing triglycerides.

<110> AMMEDICS Co., Ltd. <120> Composition for alleviating or treating obesity comprising peptide fragment of SOCS6 <130> AM2-1020200043 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> AM-LIPOCUT-02 <400> 1 Thr Arg Ser Ser Arg Glu His 1 5 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ATGL Forward primer <400> 2 caacgccact cacatctacg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ATGL Reverse primer <400> 3 gagggtagga ggaatgaggc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AMPK1alpha Forward primer <400> 4 ctcaaccggc agaagatcg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AMPK1alpha Reverse primer <400> 5 gcctgcgtac aatcttcctg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPAR-gamma Forward primer <400> 6 aactccctca tggccattga 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPAR-gamma Reverse primer <400> 7 tttcctgtca agatcgccct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HSL Forward primer <400> 8 cagcatggat ttacgcacga 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HSL Reverse primer <400> 9 gcgtgacata ctcttgcagg 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Forward primer <400> 10 ggcatcttgg gctacactga g 21 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Reverse primer <400> 11 ggaagagtgg gagttgctgt tg 22

Claims (5)

A polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.
A pharmaceutical composition for preventing or treating obesity comprising the polypeptide of claim 1 as an active ingredient.
A food composition for preventing or improving obesity comprising the polypeptide of claim 1 as an active ingredient.
A nucleic acid molecule encoding the polypeptide of claim 1 .
A recombinant vector comprising the nucleic acid molecule of claim 4 .

Images