KR20220018727A - Composition for preventing or treating of obesity comprising pazopanib or pharmaceutically acceptable salts thereof - Google Patents

Abstract

The present invention relates to a novel use of pazopanib, which is known to have anticancer activity. More specifically, the present invention provides a pharmaceutical composition for preventing or treating obesity, and a health functional food composition for preventing or alleviating obesity, containing pazopanib or a pharmaceutically or sitologically acceptable salt thereof as an active ingredient. The pazopanib or a salt thereof has an excellent effect of inhibiting adipogenesis by inhibiting lipid accumulation and reducing triglyceride content in a process of differentiation of preadipocytes into adipocytes, so that it is possible to more effectively prevent, alleviate or treat obesity by utilizing the same.

Description

A composition for preventing or treating obesity, comprising pazopanib or a pharmaceutically acceptable salt thereof as an active ingredient

The present invention relates to a composition for preventing or treating obesity comprising pazopanib or a pharmaceutically acceptable salt thereof as an active ingredient.

Obesity is defined as an abnormal accumulation of fat in the body. Based on the fact that obesity is highly associated with the pathogenesis of many human chronic diseases, such as type 2 diabetes, hypertension and cancer, it has now become a global epidemic. Numerous data show that excessive differentiation of preadipocytes leads to excessive accumulation of fat, mainly in the form of triglycerides (TG), in adipocytes, resulting in obesity. Lipolysis is a biological process in which excess TG is hydrolyzed into glycerol and free fatty acids in differentiated (or mature) adipocytes, and is considered as a treatment regimen for obesity and related diseases. Therefore, any substance that reduces lipid accumulation or increases lipolysis in adipocytes can be considered as a potential anti-obesity agent.

Differentiation of preadipocytes is a multi-step process that occurs in the form of cellular, morphological, and biochemical changes, in which fibroblast-like preadipocytes are filled with many lipid droplets (LDs), differentiated (or mature) into adipocytes. CCAAT/enhancer-binding proteins (C/EBPs), peroxisome proliferator-activated receptors (PPARs) and signal transducer and activator of transcription, A number of adipogenic transcription factors, including STAT) proteins, play pivotal roles in preadipocyte differentiation.

Preadipocyte differentiation also involves adipogenesis and maturation/stabilization of LDs, which include fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), and perilipin A ( perlipin A) is required. cAMP-activated protein kinase (AMPK), protein kinase A (PKA), extracellular signal-regulated protein kinase-1/2 , ERK-1/2), a number of protein kinases, including p38 mitogen-activated protein kinase (MAPK), and protein kinase C (PKC), are expressed in preadipocytes. It can be seen from the growing evidence that it participates in the differentiation of In addition, it has been demonstrated that hormone-sensitive lipase (HSL), PKA, AMPK, and ERK-1/2 are activated, and that their activation is important for induction of lipolysis in differentiated adipocytes. became

Drug repositioning is defined as the investigation of existing drugs for new therapeutic purposes. Recently, by testing the modulating effect of 86 protein kinase inhibitors (PKIs) on lipid accumulation during the differentiation of 3T3-L1 preadipocytes and adipocytes, pazopanib, including The inhibitory effect was confirmed in several PKIs. Pazopanib is a multi-kinase inhibitor with anticancer activity, and so far, its anti-obesity effect and its mechanism are not known.

Republic of Korea Patent Publication No. 10-2014-0129164 (published on November 6, 2014)

It is an object of the present invention to provide a novel use of pazopanib having an excellent effect in preventing, improving or treating obesity.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating obesity comprising pazopanib or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a health functional food composition for preventing or improving obesity comprising pazopanib or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention relates to a novel use of pazopanib, which is known to have anticancer activity, and the pazopanib according to the present invention or a pharmaceutically or pharmaceutically acceptable salt thereof is converted into adipocytes of preadipocytes. It has an excellent effect in suppressing lipogenesis, such as inhibiting lipid accumulation in the differentiation process and reducing triglyceride content, and can more effectively prevent, improve or treat obesity by using a pharmaceutical composition or a health functional food composition containing the same.

1 shows the effect of pazopanib on lipid accumulation, triglyceride (TG) content and cell survival during differentiation of 3T3-L1 preadipocytes according to an experimental example of the present invention, specifically (A ) shows the experimental schedule for 3T3-L1 preadipocyte differentiation, the upper part of (B) is an Oil Red O staining image, and the lower part is a phase-contrast image, in the absence of pazopanib at the experimentally designed concentration ( Measurement of lipid droplets (LDs) accumulated in 3T3-L1 preadipocytes or adipocytes at day 8 (D8) of differentiation in the presence or presence of 0.1% DMSO, (C) is a control group at D8 by AdipoRed assay or pazopanib-exposed cellular TG content of 3T3-L1 cells, the data are the mean ± SE of three independent experiments performed in triplicate each (*P < 0.05 vs. control), (D ) is a measure of the number of viable cells in control or pazopanib-exposed 3T3-L1 cells of D8 by trypan blue dye exclusion, and the data are the mean ± SE of three independent experiments performed in triplicate each ( *P < 0.05 vs. control), (E) shows the chemical structure of pazopanib.
Figure 2 shows the effect of pazopanib on the expression or phosphorylation level of C/EBP-α, PPAR-γ, and STAT-3 during the differentiation of 3T3-L1 preadipocytes according to an experimental example of the present invention; Specifically, (A) is a hormonal cocktail comprising MDI (IBMX (M), dexamethasone (D), insulin (I) in the absence (control; 0.1% DMSO) or presence (10 μM pazopanib) of pazopanib) ), 3T3-L1 preadipocytes were differentiated with an induction medium containing insulin and FBS, harvested on days 2 (D2), 5 (D5) and 8 (D8), respectively, and whole at each time point. Cell lysates were prepared and immunoblot analysis was performed with each antibody (p-STAT-3: phosphorylated STAT-3, T-STAT-3: total STAT-3), (B) is (A) As a result of extracting total cellular RNA at each time point and analyzing through real-time qPCR using each primer, the data are the mean ± SE of three independent experiments repeated twice (*P < 0.05 vs. control).
3 is a diagram illustrating the expression or To show the effect of pazopanib on phosphorylation level, specifically (A) is an induction medium containing MDI, insulin and FBS in the absence (control; 0.1% DMSO) or presence (10 μM pazopanib) of pazopanib 3T3-L1 preadipocytes were differentiated into 3T3-L1 preadipocytes and harvested on days 2 (D2), 5 (D5) and 8 (D8), respectively, and whole cell lysates were prepared at each time point and analyzed by immunoblot with each antibody. (p-ACC: phosphorylated ACC, T-ACC: total ACC, p-AMPK: phosphorylated AMPK, T-AMPK: total AMPK), (B) is the total at each time point as in (A). As a result of extracting cellular RNA and analyzing it through real-time qPCR using each primer, the data are the mean ± SE of three independent experiments repeated twice (*P < 0.05 vs. control).
Figure 4 shows the effect of pazopanib on the phosphorylation level of glycerol and HSL in 3T3-L1 cells differentiated according to an experimental example of the present invention, specifically (A) in the differentiated 3T3-L1 cells The experimental schedule for measuring glycerol content and phosphorylation of HSL is shown, (B) is the absence of pazopanib or ISO (isoproterenol) after serum depletion of differentiated 3T3-L1 cells on D8 (0 h) for 2 hours. (control; 0.1% DMSO) or in the presence (10 μM pazopanib or 10 μM ISO) for an additional 3 hours and 24 hours, respectively, followed by glycerol content in the culture medium of control or drug (pazopanib or ISO)-treated cells Analyzed three times, the data are the mean ± SE values of three independent experiments (*P < 0.05 vs. control), (C) is the total cell lysate prepared at each time point as in (B), and each These are the results of immunoblot analysis with antibodies (p-HSL: phosphorylated HSL, T-HSL: total HSL).

Hereinafter, the present invention will be described in detail.

The present inventors investigated the effects of pazopanib on lipid accumulation and lipolysis in differentiated or differentiated 3T3-L1 cells and murine preadipocytes. This anti-adipogenic effect was mediated through the control of expression and phosphorylation levels of C/EBP-α, PPAR-γ, STAT-3, ACC, perilipin A and AMPK, thereby completing the present invention.

The present invention provides a pharmaceutical composition for preventing or treating obesity comprising pazopanib or a pharmaceutically acceptable salt thereof as an active ingredient.

The pazopanib is 5-({4-[(2,3-dimethyl-2H-indazol-6-yl)methylamino]pyrimidine-2, represented by the following Chemical Formula 1, as shown in FIG. 1(E). -yl}amino)-2-methylbenzenesulfonamide [ 5-({4-[(2,3-Dimethyl-2H-indazol-6-yl)methylamino]pyrimidin-2-yl}amino)-2-methylbenzenesulfonamide ] It is a tyrosine kinase inhibitor with angiogenesis inhibitory effect and anticancer activity.

<Formula 1>

In the present invention, the pazopanib can be used in the form of a pharmaceutically or food-acceptable salt within the range having the same efficacy.

As used herein, "pharmaceutically or food acceptable" means that there is no toxicity to cells or humans exposed to the composition.

The salt may be used in the form of any one of pharmaceutically or food-acceptable basic salt or acid salt. The basic salt can be used in the form of any one of an organic basic salt and an inorganic basic salt, and includes a sodium salt, a potassium salt, a calcium salt, a lithium salt, a magnesium salt, a cesium salt, an aminium salt, an ammonium salt, a triethylaminium salt, and pyrithyl. It may be selected from the group consisting of dinium salts.

As the acid salt, an acid addition salt formed by a free acid is useful. As the free acid, an inorganic acid and an organic acid can be used. As the inorganic acid, hydrochloric acid, hydrobromic acid, sulfuric acid, sulfurous acid, phosphoric acid, double phosphoric acid, nitric acid, etc. can be used. As the organic acid, citric acid, acetic acid, maleic acid, malic acid, and fumaric acid can be used. , gluconic acid, methanesulfonic acid, benzenesulfonic acid, camphorsulfonic acid, oxalic acid, malonic acid, glutaric acid, acetic acid, glycolic acid, succinic acid, tartaric acid, 4-toluenesulfonic acid, galacturonic acid, embonic acid, Glutamic acid, citric acid, aspartan acid, stearic acid, etc. may be used, but is not limited thereto, and salts formed using various inorganic and organic acids commonly used in the art may be included.

In addition, the pazopanib may include all salts, hydrates, solvates, derivatives, etc. that can be prepared by a conventional method as well as pharmaceutically or food acceptable salts. The addition salt can be prepared by a conventional method, and is dissolved in a water-miscible organic solvent, for example, acetone, methanol, ethanol, or acetonitrile, and an excess of an organic base is added or an aqueous base of an inorganic base is added, followed by precipitation or crystallization. It can be manufactured by Alternatively, an addition salt may be obtained by evaporating the solvent or excess base from the mixture and drying, or it may be prepared by suction filtration of the precipitated salt.

In the present invention, the pazopanib or a pharmaceutically acceptable salt thereof may inhibit lipogenesis.

Preferably, the pazopanib or a salt thereof can inhibit lipid accumulation and reduce triglyceride content in the process of differentiation of preadipocytes into adipocytes.

More specifically, the pazopanib or salt thereof is involved in the differentiation process CCAAT / enhancer-binding proteins (CCAAT / enhancer-binding proteins, C / EBPs, C / EBP-α), peroxisome proliferator- Any one or more preadipocyte differentiation-related factors selected from the group consisting of peroxisome proliferator-activated receptors (PPARs, PPAR-γ) and signal transducer and activator of transcription (STAT, STAT-3) By reducing the expression or phosphorylation level of , it is possible to exhibit the effect of inhibiting lipogenesis as described above.

In addition, the pazopanib or a salt thereof is perilipin A (perilipin A), fatty acid synthase (fatty acid synthase, FAS), any one or more expression level selected from the group consisting of leptin (leptin) and resistin (resistin) By reducing and increasing phosphorylation of acetyl-CoA carboxylase (acetyl-CoA carboxylase, ACC) or cAMP-activated protein kinase (AMPK), the adipogenesis inhibitory effect can be exhibited. have.

According to an experimental example of the present invention, pazopanib significantly down-regulated both C/EBP-α and PPAR-γ protein and mRNA expression in 3T3-L1 cells, and phosphorylation of STAT-3 By inhibiting it, it could be confirmed that it mediates the inhibitory effect of adipogenesis.

In addition, it was confirmed that pazopanib down-regulates perilipin A and increases the level of phosphorylated ACC (p-ACC), an inactive form of ACC, through activation of AMPK, etc., thereby contributing to the adipogenesis inhibitory effect. , it was confirmed that the transcriptional levels of adipokines such as leptin and lecystin, which are involved in the pathogenesis of obesity or type 2 diabetes, were significantly reduced.

Accordingly, the pazopanib or a salt thereof may be utilized as a pharmaceutical composition capable of effectively preventing or treating obesity, in addition to related diseases caused by overproduction of leptin and lecystin, for example, second diabetes, etc. It may be used for prophylactic or therapeutic purposes.

In the present invention, the pazopanib or a salt thereof may be contained in an amount of 0.001 to 50 parts by weight based on 100 parts by weight of the total composition, but is not limited thereto.

The pharmaceutical composition according to the present invention may be prepared according to a conventional method in the pharmaceutical field. The pharmaceutical composition may be combined with a suitable pharmaceutically acceptable carrier according to the formulation, and if necessary, excipients, diluents, dispersants, emulsifiers, buffers, stabilizers, binders, disintegrants, solvents, etc. may be prepared further comprising have. The appropriate carrier and the like do not inhibit the activity and properties of pazopanib or a pharmaceutically acceptable salt thereof according to the present invention, and may be selected differently depending on the dosage form and formulation.

The pharmaceutical composition according to the present invention can be applied in any dosage form, and more specifically, it can be used by formulating oral dosage forms, external preparations, suppositories, and parenteral dosage forms of sterile injection solutions according to conventional methods.

The solid dosage form among the oral dosage forms is in the form of tablets, pills, powders, granules, gels, capsules, etc., and at least one or more excipients, for example, starch, calcium carbonate, sucrose, lactose, sorbitol, mannitol, cellulose, It can be prepared by mixing gelatin, etc., and lubricants such as magnesium stearate and talc in addition to simple excipients may be included. In addition, the capsule formulation may further include a liquid carrier such as fatty oil in addition to the above-mentioned substances.

Among the oral dosage forms, liquid formulations include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, preservatives, etc. may be included. have.

The parenteral formulation may include a sterile aqueous solution, a non-aqueous solution, a suspension, an emulsion, a freeze-dried formulation, and a suppository. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, Tween 61, cacao butter, laurin fat, glycerogelatin, and the like can be used. It is not limited thereto, and any suitable agent known in the art may be used.

In addition, the pharmaceutical composition according to the present invention may further add calcium or vitamins to enhance therapeutic efficacy.

In the pharmaceutical composition according to the present invention, the pharmaceutical composition may be administered in a pharmaceutically effective amount.

As used herein, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not to cause side effects.

The effective dose level of the pharmaceutical composition may be determined according to the purpose of use, the age, sex, weight and health status of the patient, the type of disease, the severity, the activity of the drug, the sensitivity to the drug, the administration method, the administration time, the administration route and the excretion rate, the treatment The duration, formulation or concomitant use may be determined differently depending on factors including drugs and other factors well known in the medical field. For example, although not constant, generally 0.001 to 100 mg/kg, preferably 0.01 to 10 mg/kg, may be administered once to several times a day. The above dosage does not limit the scope of the present invention in any way.

The pharmaceutical composition according to the present invention can be administered to any animal capable of developing obesity or obesity-related disease, and the animal includes, for example, not only humans and primates, but also livestock such as cattle, pigs, horses, and dogs. can do.

The pharmaceutical composition according to the present invention may be administered by an appropriate administration route according to the form of the formulation, and may be administered via various routes, either oral or parenteral, as long as it can reach the target tissue. The administration method is not particularly limited, and for example, oral, rectal or intravenous, muscle, skin application, respiratory inhalation, intrauterine dural or intracerebroventricular injection, etc. can be administered in a conventional manner. have.

The pharmaceutical composition according to the present invention may be used alone for the prevention or treatment of obesity, or may be used in combination with surgery or other drug treatment.

The present invention provides a health functional food composition for preventing or improving obesity, comprising pazopanib or a pharmaceutically acceptable salt thereof as an active ingredient.

Corresponding features may be substituted for the above-mentioned parts.

The pazopanib or a pharmaceutically acceptable salt thereof can inhibit fat production, and thus can be used as a health functional food composition for the prevention or improvement of obesity.

The health functional food according to the present invention may be prepared in the form of powder, granules, tablets, capsules, syrups or beverages for the purpose of preventing or improving obesity. There is no limitation in the form that the health functional food can take, and it can be formulated in the same manner as the pharmaceutical composition and used as a functional food or added to various foods.

The health functional food may include any food in a conventional sense. For example, beverages and various drinks, fruits and their processed foods (canned fruit, jam, etc.), fish, meat and their processed foods (ham, bacon, etc.), breads and noodles, cookies and snacks, dairy products (butter, cheese, etc.) ), etc. are possible, and may include all functional foods in a conventional sense. It may also include food used as feed for animals.

The health functional food composition according to the present invention may be prepared by further including pharmaceutically acceptable food additives (food additives) and other suitable auxiliary ingredients commonly used in the art. Whether or not it is suitable as a food additive can be judged according to the standards and standards for the relevant item in accordance with the general rules and general test methods of the Food Additives Code approved by the Ministry of Food and Drug Safety, unless otherwise specified. The items listed in the 'Food Additives Codex' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as dark pigment, licorice extract, crystalline cellulose, high pigment, and guar gum; Mixed preparations, such as a sodium L-glutamate preparation, a noodle-added alkali agent, a preservative preparation, and a tar color preparation, etc. are mentioned.

The other auxiliary ingredients include, for example, flavoring agents, natural carbohydrates, sweeteners, vitamins, electrolytes, coloring agents, pectic acid, alginic acid, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonation agents, etc. may further contain. In particular, as the natural carbohydrate, monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol can be used. , As the sweetener, natural sweeteners such as taumatine and stevia extract, or synthetic sweeteners such as saccharin and aspartame can be used.

The effective dose of pazopanib or a pharmaceutically acceptable salt thereof contained in the health functional food according to the present invention may be appropriately adjusted according to the purpose of use, such as prevention or improvement of obesity.

The health functional food composition has the advantage that there are no side effects that may occur during long-term administration of general drugs by using food as a raw material, and has excellent portability, and can be taken as an adjuvant for the prevention or improvement of obesity.

In addition, the present invention provides a reagent composition for inhibiting the differentiation of preadipocytes into adipocytes, which contains pazopanib or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a method for inhibiting the differentiation of preadipocytes into adipocytes, comprising the step of treating an animal other than a human with pazopanib or a pharmaceutically acceptable salt thereof.

Corresponding features may be substituted for the above-mentioned parts.

Hereinafter, examples will be described in detail to help the understanding of the present invention. However, the following examples are merely illustrative of the content of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

<Experimental Example 1> Confirmation of the effect of pazopanib in pre-adipocytes

1. Experimental method

1-1. Chemicals and Antibodies

Pazopanib was purchased from Selleckchem (Houston, TX, USA). 3-isobutyl-1-methylxanthine (IBMX), dexamethasone and insulin were purchased from Sigma (St. Louis, MO, USA).

Table 1 below lists the antibodies used in this experiment.

1-2. 3T3-L1 Cell Culture and Differentiation

3T3-L1 preadipocytes (ATCC, Manassas, VA, USA) were prepared with 10% heat inactivated fetal calf serum (FCS, Gibco, Grand Island, NY, USA) and 1% penicillin/streptomycin (penicillin/streptomycin). Streptomycin, Welgene, Daegu, South Korea) supplemented, 37 ℃, 5% CO ₂ Dulbecco's Modified Eagle's Medium in a humid atmosphere (Dulbecco's Modified Eagle's Medium, DMEM, Welgene, Daegu, Korea) was cultured.

3T3-L1 preadipocytes were grown to the contact inhibition stage and maintained at the post-confluent stage for 2 days (D0). Differentiation was achieved by adding 0.5 mM IBMX (M), 0.5 μM dexamethasone (D), and 5 μg/ml insulin (I) in 10% FBS (Welgene, Daegu) in the absence or presence of pazopanib DHA at the indicated concentrations for 2 days. It was induced by change to DMEM medium supplemented with the containing hormone cocktail (MDI) (D2). Cells were converted to DMEM supplemented with 10% FBS and 5 μg/mL I in the absence or presence of pazopanib for an additional 3 days (D5). Cells were then fed every other day with DMEM supplemented with 10% FBS in the absence or presence of pazopanib at the indicated concentrations for an additional 3 days (D8).

1-3. Oil Red O dyeing

On differentiation of D8, control or pazopanib-treated 3T3-L1 cells were washed with phosphate-buffered saline (PBS) and fixed with 10% formaldehyde for 2 hours at room temperature (RT). Then, it was washed with 60% isopropanol and dried.

Then, the cells were stained with Oil Red O working solution (Sigma; St. Louis, MO, USA) for 1 hour at room temperature, and then washed with deionized water. Stained lipid droplets (LDs) of 3T3-L1 cells treated with control and pazopanib were visualized under a light microscope (Nikon, TS100, Japan).

1-4. Cell viability assay

3T3-L1 preadipocytes were seeded in 24-well plates and grown according to the above differentiation conditions in the presence or absence of pazopanib at the indicated concentrations.

On the differentiation phase of D8, control or pazopanib-treated 3T3-L1 cells that could not be stained with 0.4% trypan blue dye were counted under an optical microscope. Cell counting analysis was performed in triplicate, and data are presented as mean±standard error (SE) of three independent experiments.

1-5. Intracellular triglyceride (TG) measurement

In the differentiation of D8, the intracellular TG content of 3T3-L1 cells treated with control or pazopanib was quantified using the AdipoRed assay reagent kit (Lonza, Basel, Switzerland) according to the manufacturer's instructions. Fluorescence intensity was quantified with excitation and emission wavelengths of 485 nm and 572 nm, respectively, using Victor3 (Perkin Elmer).

1-6. Quantification of glycerol content

Differentiated 3T3-L1 adipocytes were serum-depleted for 2 hours, and incubated with pazopanib (10 μM) or isoproterenol (ISO, 20 μM) known as a lipolysis inducer for 3 hours and 24 hours, respectively. At each time point, the culture medium was stored and the glycerol content was measured using a free glycerol reagent (Sigma, St. Louis, MO, USA) according to the manufacturer's instructions. Absorbance was measured at a wavelength of 540 nm using a micro plate reader.

1-7. Preparation of whole cell lysates

At the designed time point, 3T3-L1 cells were lysed in RIPA buffer (Sigma) supplemented with a proteinase inhibitor cocktail (1×). Cell lysates were centrifuged at 12,074×g for 20 min at 4°C. The supernatant was stored, and its protein concentration was measured using a bicinchoninic acid (BCA) protein assay kit (Thermo scientific, Rockford, IL, USA).

1-8. Immunoblot analysis

Protein (50 μg) was loaded and 10% SDS-PAGE was performed. After separation of the protein, it was transferred to a polyvinylidene difluoride membrane (PVDF, Millipore, Bedford, MA, USA) and TBST containing 5% (w/v) skim milk was used for 1 hour. Blocked at room temperature. The membrane was incubated with the specific antibodies listed in Table 1 at 4°C, rinsed with TBST buffer, and further incubated with anti-goat IgG or anti-mouse IgG or anti-rabbit IgG conjugated with horseradish peroxidase at room temperature for 2 hours. . Afterwards, the membranes were rinsed three times with TBST and developed with enhanced chemiluminescence (ECL) reagent. Actin expression level was used as the same protein loading control.

1-9. Quantitative real-time RT-PCR

Total RNA was obtained from 3T3-L1 cells treated with control or pazopanib using RNAiso Plus (TaKaRa, Kusatsu, Shiga, Japan). 3 μg of total RNA was used to prepare cDNA using random hexadeoxynucleotide primers and reverse transcriptase. SYBR green (TaKaRa, Kusatsu, Shiga, Japan) was used to quantitatively determine the transcriptional level of a gene with the LightCyclera96 Machine (Roche, Mannheim, Germany). PCR reaction was performed twice for each sample, and the transcription level of each gene was normalized to the 18 S level.

Primer sequences are shown in Table 2 below.

Gene Forward Reverse C/EBP-α TTACAACAGGCCAGGTTTCC
(SEQ ID NO: 1) CTCTGGGATGGATCGATTGT
(SEQ ID NO: 2) PPAR-γ GGTGAAACTCTGGGAGATTC
(SEQ ID NO: 3) CAACCATTGGGTCAGCTCTC
(SEQ ID NO: 4) FAS TTGCTGGCACTACAGAATGC
(SEQ ID NO: 5) AACAGCCTCAGAGGCGACAAT
(SEQ ID NO: 6) Perilipin A CTTTCTCGACACACCATGGAAAC
(SEQ ID NO: 7) CCACGTTATCCGTAACACCCTTCA
(SEQ ID NO: 8) Leptin CCAAAACCCTCATCAAGACC
(SEQ ID NO: 9) CTCAAAGCCACCACCTCTGT
(SEQ ID NO: 10) Resistin CCGATGAGCAGTCA CCTCCA
(SEQ ID NO: 11) CAGCTGCTTCGCCTCGTCCTCCT
(SEQ ID NO: 12) 18S rRNA GGTGAAGGTCGGTGTGAACG
(SEQ ID NO: 13) GGTAGGAACACGGAAGGCCA
(SEQ ID NO: 14)

1-10. statistical analysis

Cell count analysis was performed three times and repeated three times. Data were expressed as mean±standard error of the mean. One-way ANOVA performed by Dunnett's post hoc test was performed using SPSS 11.5 software (SPSS, Inc). P < 0.05 was considered to indicate a statistically significant difference. All significance tests were based on P < 0.05.

2. Experimental results

2-1. Confirmation of the effect of pazopanib treatment on lipid accumulation and reduction of TG content in differentiated 3T3-L1 preadipocytes

Whether pazopanib can inhibit lipid accumulation during 3T3-L1 preadipocyte differentiation was investigated using Oil Red O staining or the like.

1 shows the effect of pazopanib on lipid accumulation, TG content and cell survival during differentiation of 3T3-L1 preadipocytes according to an experimental example of the present invention. Referring to this, first, FIG. 1 (B ) As shown in the upper Oil Red O staining image, in the absence of pazopanib (control), the accumulation of lipid droplets (LDs) was higher in 3T3-L1 cells on D8 differentiation compared to undifferentiated cells, and pazopanib was When present, it was shown that the accumulation of LDs in 3T3-L1 cells on D8 differentiation was inhibited in a concentration-dependent manner. The inhibitory effect of pazopanib on LDs in 3T3-L1 cells on D8 differentiation was confirmed by phase contrast microscopy as shown in the lower image of FIG. 1(B).

Next, as shown in Figure 1 (C) through AdipoRed assay, it was confirmed that 10 μM or 15 μM of pazopanib significantly reduced the cellular TG content in 3T3-L1 cells on D8 differentiation, and Figure 1 (D) Referring to , data from cell counting analysis showed that the applied dose of pazopanib did not significantly affect the survival of 3T3-L1 cells on D8 differentiation. Additional experiments were carried out by selecting pazopanib at a concentration of 10 μM as a strong reduction effect on the accumulation of LDs and TG content without significant cytotoxicity.

2-2. Confirmation of the effect of pazopanib on the expression or phosphorylation level reduction of C/EBP-α, PPAR-γ, and STAT-3 in differentiated 3T3-L1 preadipocytes

To define the molecular mechanism underlying the reducing effect of pazopanib on LDs accumulation and TG content, C/EBP-α, PPAR-γ, and The effect of pazopanib on the expression or phosphorylation level of STAT-3 was investigated using immunoblot analysis.

Figure 2 shows the effect of pazopanib on the expression or phosphorylation level of C/EBP-α, PPAR-γ, and STAT-3 during differentiation of 3T3-L1 preadipocytes according to an experimental example of the present invention; Referring to this, as shown in FIG. 2(A), pazopanib significantly reduced the expression levels of C/EBP-α and PPAR-γ in 3T3-L1 cells on D5 and D8 differentiation. In addition, pazopanib significantly reduced the phosphorylation level of STAT-3 on D2 differentiation. Expression levels of total STAT-3 and control actin did not change significantly at test time points.

Next, during the differentiation of 3T3-L1 preadipocytes, real-time qPCR was performed to measure the effect of 10 μM pazopanib on the mRNA expression level of C/EBP-α and PPAR-γ, FIG. 2(B) As shown, pazopanib was shown to significantly reduce the transcriptional levels of C/EBP-α and PPAR-γ in 3T3-L1 preadipocytes differentiated at D2, D5 and D8.

Through this, it can be confirmed that pazopanib down-regulates the expression of C/EBP-α and PPAR-γ both at the protein and mRNA levels in differentiated 3T3-L1 cells, and pazopanib-mediated C/EBP-α and Downregulation of PPAR-γ can be judged to be due to transcriptional repression.

In addition, pazopanib significantly inhibited STAT-3 without affecting the total STAT-3 protein level in the early stage of differentiation (D2), thereby inhibiting the phosphorylation of conventional STAT-3 without de novo protein synthesis. can be checked STAT-3 can be activated at an early stage of 3T3-L1 preadipocyte differentiation, which is important for C/EBP-α and PPAR-γ transcriptional upregulation at intermediate or later stages of differentiation, leading to 3T3-L1 differentiation It can be seen that pazopanib-mediated downregulation of C/EBP-α and PPAR-γ in cells is mediated in part through inhibition of early STAT-3.

That is, the anti-adipogenic effect of pazopanib in 3T3-L1 preadipocyte differentiation is highly related to its ability to reduce the expression or phosphorylation level of C/EBP-α, PPAR-γ, and STAT-3 transcription factors.

2-3. Confirmation of the effect of pazopanib on the expression or phosphorylation level change of FAS, ACC, perilipin A, AMPK, leptin, and resistin in differentiated 3T3-L1 preadipocytes

Adipocyte differentiation includes adipogenesis and LD stabilization processes. FAS and ACC are major adipogenic enzymes for fatty acid synthesis, and perilipin A is a protein that binds to and stabilizes newly synthesized LD, and is important for lipid storage and accumulation. It is important. AMPK is a metabolic protein that plays an essential role in regulating cellular energy homeostasis. Activation of AMPK inhibits the differentiation of 3T3-L1 preadipocytes. We investigated whether pazopanib could regulate the expression and phosphorylation levels of perilipin A, FAS, ACC, and AMPK during 3T3-L1 preadipocyte differentiation.

Figure 3 shows the effect of pazopanib on the expression or phosphorylation level of perilipin A, FAS, ACC, AMPK, leptin and lecystin during the differentiation of 3T3-L1 preadipocytes according to an experimental example of the present invention; Therefore, referring to this, as shown in FIG. 3(A), pazopanib significantly reduced the protein expression level of perilipin A in 3T3-L1 cells on D5 and D8 differentiation. Obviously, pazopanib did not affect the protein expression level of FAS, but significantly increased the phosphorylation level of ACC in 3T3-L1 preadipocytes on D2, D5 and D8 differentiation. Additionally, pazopanib increased AMPK phosphorylation without affecting total AMPK protein levels in 3T3-L1 preadipocytes on D8 differentiation. The total expression level of control actin remained constant at this test time point.

Next, as a result of performing real-time qPCR, as shown in FIG. 3(B) , pazopanib was used in 3T3-L1 preadipocytes on D5 and D8 differentiation of perilipin A as well as the adipokines leptin and lecystin. It was confirmed that the transcription level was significantly down-regulated.

Through this, pazopanib does not affect the cellular level of FAS, but down-regulates perilipin A and increases the level of phosphorylated ACC (p-ACC), an inactive form of ACC, contributing to the adipogenesis inhibitory effect. was able to confirm

Pazopanib induces AMPK phosphorylation on T172, an activated form of AMPK, in differentiated 3T3-L1 cells, supporting pazopanib-induced activation of AMPK. Activation of AMPK is known to induce phosphorylation of a number of downstream targets such as ACC involved in energy metabolism. That is, pazopanib can induce activation of AMPK phosphorylation of ACC in differentiated 3T3-L1 cells, which may be part of the anti-adipogenic effect of pazopanib.

In addition, pazopanib significantly reduces the transcriptional levels of adipokines, such as leptin and lecystin, which are involved in the pathogenesis of obesity or type 2 diabetes, thereby reducing the therapeutic effect of related diseases caused by overproduction of leptin and lecystin. can have

2-4. Confirmation of the effect of pazopanib on stimulation of glycerol release and HSL phosphorylation in differentiated 3T3-L1 cells

It was investigated whether pazopanib induces lipolysis in differentiated 3T3-L1 cells. The lipolytic effect of pazopanib was evaluated by the release of glycerol in S563 and S660 and the ability to enhance phosphorylation of hormone-sensitive lipase (HSL). In comparison, isoproterenol (ISO), a lipolytic agent, was used as a positive control.

Figure 4 shows the effect of pazopanib on the release of glycerol and phosphorylation level of HSL in 3T3-L1 cells differentiated according to an experimental example of the present invention. Referring to this, as shown in Figure 4(B), differentiation When 20 μM of ISO was treated in the culture medium of 3T3-L1 cells for 3 hours or 24 hours, the content of glycerol was significantly increased. However, when tested for the same time in the culture medium of differentiated 3T3-L1 cells, the content of glycerol did not change when 10 μM pazopanib was treated.

Moreover, referring to Fig. 4(C), the HSL phosphorylation levels of S563 and S660 in differentiated 3T3-L1 adipocytes significantly increased when 20 μM of ISO was treated for 3 or 24 hours, whereas 10 μM was increased for the same time. There was almost no change when treated with pazopanib. The expression level of total HSL did not change under these experimental conditions.

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> INDUSTRY ACADEMIC COOPERATION FOUNDATION KEIMYUNG UNIVERSITY <120> COMPOSITION FOR PREVENTING OR TREATING OF OBESITY COMPRISING PAZOPANIB OR PHARMACEUTICALLY ACCEPTABLE SALTS THEREOF <130> ADP-2020-0211 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C/EBP-alpha-F <400> 1 ggtgaaactc tgggagattc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C/EBP-alpha-R <400> 2 ctctgggatg gatcgattgt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPAR-gamma-F <400> 3 ggtgaaactc tgggagattc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPAR-gamma-R <400> 4 caaccattgg gtcagctctc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FAS-F <400> 5 ttgctggcac tacagaatgc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FAS-R <400> 6 aacagcctca gagcgacaat 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Perilipin A-F <400> 7 ctttctcgac acaccatgga aac 23 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Perilipin A-R <400> 8 ccacgttatc cgtaacaccc ttca 24 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Leptin-F <400> 9 ccaaaaccct catcaagacc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Leptin-R <400> 10 ctcaaagcca ccacctctgt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Resistin-F <400> 11 ccgatgagca gtcacctcca 20 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Resistin-R <400> 12 cagctgcttc gcctcgtcct cct 23 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18S rRNA-F <400> 13 ggtgaaggtc ggtgtgaacg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18S rRNA-R <400> 14 ggtaggaaca cggaaggcca 20

Claims (7)

A pharmaceutical composition for preventing or treating obesity, comprising pazopanib or a pharmaceutically acceptable salt thereof as an active ingredient. The method of claim 1,
The pazopanib or a salt thereof,
A pharmaceutical composition for preventing or treating obesity, characterized in that it suppresses lipid accumulation and reduces triglyceride content in the process of differentiation of preadipocytes into adipocytes. The method of claim 1,
The pazopanib or a salt thereof,
A pharmaceutical composition for preventing or treating obesity, characterized in that it inhibits fat production. The method of claim 1,
The pazopanib or a salt thereof,
Any one or more fats selected from the group consisting of C/EBP-α (CCAAT/enhancer-binding protein α), PPAR-γ ((peroxisome proliferator-activated receptor γ), and STAT-3 (signal transducer and activator of transcription 3) A pharmaceutical composition for preventing or treating obesity, characterized in that it reduces the expression or phosphorylation level of progenitor cell differentiation-related factors. The method of claim 1,
The pazopanib or a salt thereof,
Reduces the expression level of any one or more selected from the group consisting of perilipin A, FAS, leptin and resistin,
A pharmaceutical composition for preventing or treating obesity, characterized in that it increases phosphorylation of acetyl-CoA carboxylase (ACC) or cAMP-activated protein kinase (AMPK). The method of claim 1,
The pazopanib or a salt thereof,
Based on 100 parts by weight of the total composition, a pharmaceutical composition for preventing or treating obesity, characterized in that it is contained in an amount of 0.001 to 50 parts by weight. A health functional food composition for preventing or improving obesity, comprising pazopanib or a pharmaceutically acceptable salt thereof as an active ingredient.

Images