KR20210149366A - A pharmaceutical composition for preventing or treating metabolic disease comprising icam-2 binding material as active ingredient - Google Patents

Abstract

The present invention identifies ICAM-2, which is a novel target capable of inducing secretion of GLP-1. A material capable of binding to the molecule can promote the secretion of GLP-1 through ICAM-2. GLP-1 is an appetite regulating hormone known to alleviate metabolic disorders. Conventionally, GLP-1 is known to be secreted by G protein coupled receptor (GPCR) of intestinal endothelial cells. In the present invention, a novel molecule capable of promoting secretion of GLP-1 was identified. Therefore, the present invention identified a screening method for promoting secretion of GLP-1 by screening an ICAM-2 binding material. In addition, a material binding specifically to ICAM-2 can be utilized as a therapeutic agent for diabetes mellitus and metabolic disorders.

Description

A pharmaceutical composition for preventing or treating metabolic diseases comprising a substance that binds to ICAM-2 as an active ingredient {A PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING METABOLIC DISEASE COMPRISING ICAM-2 BINDING MATERIAL AS ACTIVE INGREDIENT}

The present invention relates to a method for screening a substance capable of inducing the expression of GLP-1, an appetite control hormone, and specifically relates to a method for obtaining a substance capable of increasing the expression of GLP-1 by binding to an ICAM-2 molecule. it's about In addition, it relates to a pharmaceutical composition for preventing or treating metabolic diseases comprising a substance capable of regulating GLP-1 as an active ingredient.

Recently, in Korea, the amount of fat intake from food has increased due to economic growth and westernization of diet. In particular, metabolic diseases such as obesity, diabetes, fatty liver, arteriosclerosis, hyperlipidemia or cardiovascular disease due to lack of exercise are increasing.

Diabetes mellitus is a type of metabolic disease in which insulin secretion is insufficient or normal function is not achieved. Diabetes mellitus is characterized by hyperglycemia in which the concentration of glucose in the blood rises, which causes various symptoms and signs and glucose is detected in the urine. In particular, the incidence of diabetes is increasing explosively due to the increase in abdominal obesity.

On the other hand, if it is not properly treated in a chronic hyperglycemic state, various pathological symptoms accompany the body. Representative of these symptoms are retinopathy, renal dysfunction, neuropathy, stroke due to vascular disorders, kidney, heart disease or diabetic foot ulcer, and cardiovascular disease. These complications reduce the quality of life and ultimately shorten the lifespan of diabetic patients. Therefore, effective blood sugar management is essential to prevent complications caused by diabetes.

Currently, lifestyle modification (diet therapy, exercise therapy) and drug therapy are used as methods to control blood sugar. However, strict management and implementation of diet or exercise therapy is difficult, and there is a limit in its therapeutic effect. Therefore, most diabetic patients control their blood sugar by using drugs such as insulin, insulin secretagogue, insulin sensitivity improving agent, and blood sugar lowering agent in addition to lifestyle modification.

Recently developed drugs include GLP-1 agonist developed using the action of glucagon-like peptide-1, a hormone that promotes insulin secretion, and Exenatide. ) and Victoza (Liraglutide). However, side effects have been reported for all of these drugs.

Meanwhile, GLP-1 is known to be useful in the treatment of various metabolic diseases such as diabetes, obesity, heart disease, cerebrovascular disease, and arteriosclerosis. In addition, GLP-1 is involved in the treatment of diabetes by stimulating glucose-dependent insulin secretion in the pancreas, enhancing insulin gene expression, enhancing pancreatic beta cell proliferation, enhancing pancreatic beta cell survival, inhibiting glucagon secretion, and lowering blood sugar. In addition, GLP-1 is involved in slowing the rate of gastric emptying, suppressing appetite, enhancing satiety, and suppressing food intake, thereby exhibiting an anti-obesity effect. In addition, it has been reported that GLP-1 exhibits a therapeutic effect on heart disease through the protective effect of Cardiomyocytes from ischemia and the improvement of cardiac function in patients at risk of heart attack (Sokos, GG et al., Glucagon-like peptide-1 infusion improves left ventricular ejection fraction and functional status in patients with chronic heart failure).

The present inventors have identified the Akkermansia muciniphila standard strain (Akkermansia muciniphila, Akk; U.S. strain bank, accession number: ATCC BAA-835) and the Akkermansia muciniphila SNUG-61027 strain isolated from healthy Korean feces (accession number: KCTC13530) was used to confirm that Acermansia muciniphila increased the UCP-1 factor affecting brown fat activity and induced the expression of the appetite control hormone GLP-1 in the small intestine. In addition, the present inventors found that the B2UM07 protein (Gene: Amuc° C.1631, Carboxyl-terminal protease) derived from the Acermansia muciniphila strain SNUG-61027 promotes the induction of GLP-1 secretion (Korean Patent Application No. 2019 -0125670).

KR 10-2019-0125670 A

Sokos, G. G. et al., Glucagon-like peptide-1 infusion improves left ventricular ejection fraction and functional status in patients with chronic heart failure.

Accordingly, the present inventors have researched to develop novel substances for the treatment of diabetes and metabolic diseases, and as a result, they found a target that can effectively induce the secretion of GLP-1, and the substance binding to this target is a therapeutic agent for diabetes and metabolic diseases It was confirmed that it can be used as Based on this, the present invention was completed by establishing a screening system for a substance capable of promoting the secretion of GLP-1.

In order to achieve the above object, one aspect of the present invention, (a) secreting GLP-1, contacting a test substance with a cell line expressing ICAM-2 on the cell surface; (b) measuring the expression level of GLP-1; (c) when the expression level of GLP-1 in cells contacted with the test substance is increased compared to a control not contacted with the test substance, selecting the test substance as a GLP-1 inducer; A method for screening an inducer is provided.

Another aspect of the present invention provides a pharmaceutical composition for preventing or treating metabolic diseases comprising a substance that specifically binds to ICAM-2 as an active ingredient.

It was confirmed that ICAM-2 was involved in the process in which P9, a protein derived from Akkermansia muciniphila, induces the appetite-regulating hormone, GLP-1. Therefore, by screening a substance that specifically binds to ICAM-2, a substance capable of increasing the expression of GLP-1 can be obtained. The material thus obtained can be used as a pharmaceutical composition for preventing or treating metabolic diseases by increasing the expression of GLP-1.

Figure 1a shows the result of measuring the GLP-1 expression level of human-derived enterocytes (NCI-H716) treated with P9.
Figure 1b shows the results of RNA sequencing analysis in human enterocytes (NCI-H716) treated with P9.
Figure 2 shows the results of confirming the calcium influx of human-derived enterocytes (NCI-H716) and mouse-derived enterocytes (GLUTag) treated with P9.
Figure 3 shows the result of confirming the increase in protein in a dot blot format compared to the control after P9 was treated with NCI-H716 (left) and the result (right) showing the dot blot result in pixel density (Pixel density).
Figure 4 shows the results of confirming whether P9 binds to GLP-1R through a beta arrest activity test (left) and various GPCRs after treatment with the GLP-1 receptor (GLP-1R)-transfected HEK293 cell line. (G-protein coupled receptor) Relative GLP-1 expression level (right) of NCI-H716 treated with P9 after antagonist treatment.
5 shows the relative GLP-1 expression level of NCI-H716 treated with P9 after treatment with various calcium inhibitors.
FIG. 6 shows the results of LC/MS-MS analysis by treating P9 bound to LRC-TriCEPS with NCI-H716, and then separating the receptor interacting with P9 on the surface of the cell line.
7 shows that P9 binds to ICAM-2 when ICAM-2 with a GST tag is immobilized on Glutathione sepharose resin and then P9 is flowed.
Figure 8 shows the result of measuring the GLP-1 expression level of GLUTag treated with P9 after treatment with ICAM-2 peptide (left) and GLP-1 of NCI-H716 treated with P9 after treatment with ICAM-2 neutralizing antibody. The result of measuring the expression level (right) is shown.

Novel GLP-1 inducer screening method

One aspect of the present invention, (a) secreting GLP-1 and contacting a test substance with a cell line expressing ICAM-2 on the cell surface; (b) measuring the expression level of GLP-1; (c) when the expression level of GLP-1 in cells contacted with the test substance is increased compared to a control not contacted with the test substance, selecting the test substance as a GLP-1 inducer; A method for screening an inducer is provided.

As used herein, the term “ICAM-2” is an abbreviation for Intercellular adhesion molecule 2. The substance is known to bind to Leukocyte function antigen (LFA-1) of immune cells as a mediator used when macrophages migrate to blood vessels or tissues.

In this case, the cell line may be an intestinal-derived cell. Specifically, it may be a human-derived or mouse-derived intestinal-derived cell. In one embodiment, the cell line may be NCI-H716 or GLUTag. In addition, the expression level of GLP-1 can be confirmed at the protein level. In addition, the expression level of GLP-1 can be confirmed through the expression level of mRNA.

Additionally, the method may further include treating a cell line with an antibody that specifically binds to ICAM-2 to select a test substance in which the expression of GLP-1 is reduced. When an antibody that specifically binds to ICAM-2 is treated, the test substance and the antibody are competitively bound to ICAM-2. Therefore, it can be confirmed whether the test substance specifically binds to ICAM-2 through these steps.

In this case, the test substance may be any one selected from the group consisting of proteins, peptides and compounds.

In addition, the selected material may exhibit ICAM-2 binding ability that is equivalent to or superior to P9 derived from Akkermansia muciniphila (Akk). In addition, the selected material may have a GLP-1 secretory ability that is equal to or superior to that of P9.

As used herein, the term “P9” may be a wild-type full-length B2UM07 protein. In this case, the B2UM07 may have the amino acid sequence of SEQ ID NO: 1 below.

[SEQ ID NO: 1]

MEKNAPFSVMNMHSFRWIRLTAFSALAAAAITSCASAATDFNQVGKQMSLLLQNFHFSRKEFSDELSTKFLETYLRKVDPNKIFFTQQDVDALKRKYGKELDDYLMSGQMMDAAQAMHALYRQRAMQRISYARDLLKKGGFTFDKDKSIERSRRKTAAWPKDEAEMQQVWKDMVEEQLLSEILRRETVARLAKEQNKPDPLANEKPAEEKLLMRYERIQRNIQETDLEDVAETLLSAVALTYDPHTDYMGARQVDRFKISMGTELTGIGALLGSEDDGSTKITGIVVGGPADKSGELKLNDRIVAIDSDNSGEMVDILFMKLDKVVDMIRGAENTQMRLKVEPADAPGQAKIITLTRSKVPLKDELAKGEIIELTGAPEGRNRIGVLSLPSFYADMEGGDRRCAKDVKKILERMNKENVDGLVIDLRSNGGGSLEEVRLMTGFFTGNGPVVQIKDTRGNVDIKSAHNRQKLFNGPIVVLINKLSASASEILAAALQDYGRAVIVGDESTFGKGSVQQPVDIGQYLPFFAARDRAGLLKVTTQKFYRVAGGSTQLKGVESDIQLPTATAAFELGEDILDYAMPYDQITPCTNYKKDSSIAAMLPVLKDASAKRVEKDRDLQIAREDIAMMKQRIKDNKLSLNKKIREQENSALEERRKSINKERKIRFAEMAKEDATKYKIYRLTLDDVNAKELPLADPEKDNEQFMHLAEDPTAELDDSPEYPSGLDPELREGINIVQDMLKLESSGK

Pharmaceutical composition comprising a substance that specifically binds to ICAM-2 as an active ingredient

Another aspect of the present invention is to provide a pharmaceutical composition for preventing or treating metabolic diseases comprising a substance that binds to ICAM-2 as an active ingredient. In this case, the material may be selected by the above-described screening method, but is not limited thereto. In this case, the metabolic disease may be obesity, diabetes, dyslipidemia, fatty liver, impaired glucose tolerance, arteriosclerosis, hyperlipidemia, hypercholesterolemia, or cardiovascular disease.

The pharmaceutical composition of the present invention contains, as an active ingredient, from about 0.1 wt% to about 90 wt%, specifically from about 0.5 wt% to about 75 wt%, more specifically from about 0.1 wt% to about 90 wt%, based on the total weight of the composition, the ICAM-2 binding substance. It may contain from about 1% by weight to about 50% by weight.

The pharmaceutical composition of the present invention may include conventional and non-toxic pharmaceutically acceptable additives formulated into a formulation according to a conventional method. For example, the pharmaceutical composition may further include a pharmaceutically acceptable carrier, diluent or excipient.

Examples of additives used in the composition of the present invention include sweeteners, binders, solvents, solubilizers, wetting agents, emulsifiers, isotonic agents, absorbents, disintegrants, antioxidants, preservatives, lubricants, glidants, fillers, flavoring agents, and the like. can For example, the additive may be lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, silica, talc, stearic acid, stearin, magnesium stearate, magnesium aluminosilicate, starch, gelatin, gum tragacanth, alginic acid, sodium alginate, methylcellulose, sodium carboxymethylcellulose, agar, water, ethanol, polyethylene glycol, polyvinylpyrrolidone, sodium chloride, calcium chloride, orange essence, strawberry essence, vanilla flavor, and the like.

The composition of the present invention may be formulated in the form of various formulations for oral administration (eg, tablets, pills, powders, capsules, syrups or emulsions) or parenteral administration (eg, intramuscular, intravenous or subcutaneous injection).

Preferably, the composition of the present invention may be formulated as a formulation for oral administration, and the additives used in this case include cellulose, calcium silicate, corn starch, lactose, sucrose, dextrose, calcium phosphate, stearic acid, magnesium stearate, Calcium stearate, gelatin, talc, surfactants, suspending agents, emulsifying agents, diluents and the like may be included. Specifically, examples of the glidant include colloidal silicon dioxide, magnesium silicate, and the like; Examples of the diluent include Microcrystalline Cellulose, Lactose Fast Flo lactose Anhydrous, Lactose Monohydrate, Silicified MCC HD 90, etc., and the disintegrant Examples include Croscarmellose Sodium, Crospovidone and the like; Examples of lubricants include Magnesium Stearate, Sodium Lauryl Sulfate, Stearic Acid, and the like.

In addition, liquid formulations for oral administration may be exemplified by suspensions, emulsions, syrups, etc., and various excipients, for example, wetting agents, sweeteners, fragrances, preservatives, etc. in addition to water and liquid paraffin, which are commonly used simple diluents. may be included.

In addition, preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. The suppositories are Witepsol, Macrogol, and Twin61. Cacao butter, laurin fat, glycerogelatin, etc. may be used. On the other hand, the injection may contain conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifiers, stabilizers, preservatives, and the like.

The compound or composition of the present invention may be administered to a patient in a therapeutically or pharmaceutically effective amount.

Herein, "therapeutically effective amount" or "pharmaceutically effective amount" refers to an amount of a compound or composition effective for preventing or treating a target disease, which is sufficient to treat the disease at a reasonable benefit/risk ratio applicable to medical treatment, and It means an amount that does not cause side effects. The level of the effective amount may be determined by the patient's health condition, disease type, severity, drug activity, drug sensitivity, administration method, administration time, administration route and excretion rate, treatment period, factors including the combination or concurrently used drugs; It may be determined according to factors well known in the medical field.

The compound or composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, or may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount capable of obtaining the maximum effect with the minimum amount of side effects or without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the compound in the composition of the present invention may vary depending on the age, sex, and weight of the patient, and in general, from about 0.1 mg to about 1,000 mg, or from about 5 mg to about 200 mg per kg of body weight daily or It can be administered every other day or divided into 1 to 3 times a day. However, the scope of the present invention is not limited thereto since it may increase or decrease depending on the route of administration, disease severity, sex, weight, age, etc.

Functional food containing a substance that specifically binds to ICAM-2 as an active ingredient

Another aspect of the present invention is to provide a functional food composition for preventing or improving metabolic diseases comprising a substance that binds to ICAM-2 as an active ingredient. In this case, the material may be selected by the above-described screening method, but is not limited thereto.

The composition is preferably prepared in any one formulation selected from powder, granules, pills, tablets, capsules, candy, syrup, and beverages, but is not limited thereto.

The health functional food composition of the present invention may be prepared by adding a substance that binds to ICAM-2 as it is or by mixing it with other foods or food ingredients, and may be appropriately prepared according to a conventional method. Examples of foods to which a substance binding to ICAM-2 can be added include dairy products including caramel, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, and ice cream, various It may be in any one form selected from soup, beverage, tea, drink, alcoholic beverage, and vitamin complex, and includes all health functional foods in a conventional sense.

That is, there is no particular limitation on the type of the food. The health functional food composition includes various nutrients, vitamins, minerals (electrolytes), synthetic and natural flavorants, colorants and enhancers (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners , a pH adjuster, a stabilizer, a preservative, glycerin, alcohol, a carbonation agent used in carbonated beverages, and the like. It may also contain pulp for the production of natural fruit juices and vegetable beverages. The above components may be used independently or in combination.

In addition, the health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, and the natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, dextrin, and cyclo polysaccharides such as dextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. The proportion of the natural carbohydrate is not very important, but with respect to 100 g of the composition of the present invention, it is preferably 0.01 g to 0.04 g, more preferably 0.02 g to 0.03 g, but is not limited thereto. As the sweetener, natural sweeteners such as taumatine and stevia extract, and synthetic sweeteners such as saccharin and aspartame may be used.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited thereto.

Preparation Example 1. Materials used in the experiment

The information of the materials used for the following experiments is as follows:

ICAM-2 blocking peptide (#MBS823225) (MyBioSource Inc, San Diego, CA, USA), anti-ICAM-2 (BD Pharmigen), 3C4 (mIC2/4) (#553326), anti-ICAM-2 antibody (# MBS820389) (MyBioSource), anti-KTN1 (#A44072) (Antibodies.com Inc. Cambridge, UK) and negative antibody (mouse anti-β tubulin (Thermo)).

Example 1. Confirmation of GLP-1 expression ability by material derived from Akermansia muciniphila strain (hereinafter, P9)

To determine whether Akermansia muciniphila has direct efficacy in inducing GLP-1, human intestinal endocrine L cells (NCI-H716) were treated with live Akermansia muciniphila and cell-free supernatant (CFS). After that, the expression level of GLP-1 was confirmed.

Example 1.1. Expression and purification of P9 protein

Acermansia muciniphila (SNUG-61027) used in this example is a strain isolated from a fecal sample of healthy Koreans deposited with the Korea Research Institute of Bioscience and Biotechnology under the accession number KCTC13530. DNA (SEQ ID NO: 15) encoding amino acids 10 to 748 of the B2UM07 protein (SEQ ID NO: 1) was PCR amplified from the DNA of SNUG-61027 with a pair of primers including NdeI and XhoI restriction enzyme sequences.

The pET26b(+) vector to be used as an expression vector (Novogene, USA) and the amplified PCR product were treated with NdeI and XhoI restriction enzymes and purified. After ligation, the cells were transformed into DH5α competent cells and plated on LB plates. A plasmid was extracted from a single colony, and mutation was confirmed through sequencing, and transformed into E. coli for expression. Single or multiple colonies of transformed E. coli carrying the above expression plasmid were inoculated into 25 ml LB medium (supplemented with 100 μg/ml kanamycin). Incubated at 37°C with shaking at 200 rpm until OD _{600 reached 1.0.}

The 25 ml LB medium inoculated with the bacteria was transferred to a 1 L flask containing 500 ml LB medium. Incubated at 37°C with shaking at 200 rpm until OD _{600 reached 0.7-0.8.} To induce protein expression, 250 μL of 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) stock was added and incubated at 30° C. with shaking at 200 rpm for 4 hours. Thereafter, the cells were harvested by centrifugation (6,000xg, 20 minutes). Cell pellets were stored at -80°C until use.

For the preparation of E. coli cell lysates for Ni-NTA chromatography, harvest the harvested cell pellets in 40 ml of lysis buffer (1X PBS (20X PBS dilution, BioWorld) supplemented with 2 mM 2-mercaptoethanol). It was resuspended and transferred to a 100 ml glass beaker. The probe of the sonicator was placed 1 cm above the bottom of the beaker. Cell suspensions were sonicated on ice for 8 min with short pulses of 20 kHz per 1 s (pulse on, 45 μm amplitude) followed by 1 s intervals (pulse off) (i.e., pulse ON: OFF = 1 s: 1 s). , 45 μm amplitude, 8 min treatment; suspension is always kept on ice). Then, it was cooled on ice for 8 minutes, and the sonication was repeated. Then, cell debris was removed by centrifugation at 36,000xg for 20 minutes at 4°C.

In order to perform Ni-NTA chromatography, 0.5 ml of settled Ni-NTA resin (HisPur Ni-NTA resin, Thermo Fisher) was added to a 60 ml open column (manufactured by Bio-Rad). Wash the resin with 1 column volume (CV) of DW and equilibrate the resin with 2 CV of 1X PBS. The prepared cell lysate was loaded onto the column and the column was rotated at 4° C. for 30 minutes. The resin was washed with 200 ml of wash buffer containing 20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 20 mM imidazole and 2 mM 2-mercaptoethanol. The His-tagged protein was then eluted with 1 ml of elution buffer containing 20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 200 mM imidazole and 2 mM 2-mercaptoethanol. This step was repeated 10 times and each fraction was collected in a separate tube. The fractions were analyzed by SDS-PAGE.

For dialysis of protein samples, 1-5 fractions containing the target protein were collected. Hydrate the dialysis cassette (Thermo Fisher Scientific Slide-A-Lyzer Dialysis Cassette (10K MWCO)) with 1xPBS for 5-10 min. The collected protein was injected into a hydrated dialysis cassette using a 10 ml syringe (Syringe). A beaker was filled with cold 1xPBS buffer to at least 100 times the sample volume, and a magnetic bar for stirring was added. A dialysis cassette containing a protein sample was added to this beaker, followed by stirring at 4° C. for 2 hours. The beaker was refilled with fresh 1xPBS buffer and stirred overnight at 4°C. Samples were obtained using a 10 ml syringe. The dialyzed protein samples were kept frozen at -80°C in aliquots of 100 μL.

[SEQ ID NO: 15]

ATGAACATGCACTCATTCCGTTGGATTAGACTCACCGCATTCTCGGCCCTGGCCGCAGCCGCCATTACTTCCTGCGCCTCTGCGGCTACGGACTTCAACCAGGTGGGCAAGCAAATGTCCCTGCTGCTCCAGAATTTCCACTTCTCCCGCAAAGAATTCAGCGATGAACTATCCACTAAATTCCTGGAAACCTACCTGCGCAAGGTAGACCCCAACAAAATATTCTTCACCCAGCAGGACGTAGACGCCCTCAAAAGAAAATACGGTAAGGAGCTGGACGACTACCTTATGTCCGGCCAGATGATGGATGCGGCCCAGGCCATGCACGCCCTTTACCGCCAGCGCGCCATGCAGCGCATCTCCTATGCGCGGGATTTGCTGAAAAAGGGAGGCTTCACCTTTGACAAAGACAAGTCTATCGAACGTTCCCGCCGCAAAACAGCCGCGTGGCCCAAGGATGAGGCGGAAATGCAGCAGGTCTGGAAAGACATGGTGGAGGAACAGCTCCTGTCCGAAATCCTGCGCCGTGAAACCGTAGCGCGCCTGGCCAAGGAACAGAACAAGCCCGATCCCCTGGCCAATGAAAAACCCGCGGAGGAAAAACTGCTTATGCGTTATGAACGCATTCAGCGCAATATTCAGGAAACGGATCTGGAAGACGTAGCGGAAACACTGCTCAGCGCCGTAGCCTTGACGTATGACCCGCATACGGATTACATGGGTGCGCGCCAAGTGGACCGTTTCAAAATCTCCATGGGTACGGAACTCACCGGCATCGGCGCCCTGTTGGGCAGTGAAGACGACGGTTCCACCAAAATTACCGGTATCGTTGTGGGAGGGCCGGCTGACAAATCCGGAGAATTGAAGCTGAACGACCGCATCGTTGCCATTGACTCCGACAACTCTGGAGAAATGGTGGATATCCTGTTCATGAAGCTGGACAAAGTGGTGGATATGATCCGCGGAGCCGAAAATACCCAGATGCGCCTGAAAGTAGAGC CGGCAGACGCCCCTGGACAGGCCAAAATCATTACGCTGACCCGCTCCAAGGTACCTCTGAAGGATGAACTTGCCAAAGGTGAAATCATTGAACTTACCGGAGCTCCGGAAGGCAGGAACCGCATTGGCGTGCTGAGCCTTCCCTCCTTCTACGCAGACATGGAAGGCGGAGACCGCCGCTGTGCCAAGGATGTCAAAAAAATCCTGGAACGGATGAACAAGGAAAATGTGGATGGCCTGGTAATTGACCTGCGCAGCAACGGCGGCGGTTCCCTGGAGGAAGTGCGCCTGATGACGGGCTTCTTTACCGGAAACGGCCCCGTGGTGCAAATCAAGGACACCCGCGGCAACGTGGATATCAAATCCGCCCACAACCGCCAGAAACTCTTCAATGGCCCCATTGTGGTGCTCATCAATAAACTCAGCGCATCCGCCTCTGAAATTCTGGCTGCGGCCCTTCAGGATTACGGCCGCGCCGTGATTGTGGGGGATGAATCCACCTTCGGGAAGGGGTCTGTGCAGCAGCCTGTGGACATCGGCCAATACCTGCCTTTCTTCGCGGCCAGAGACCGTGCGGGCCTGCTGAAAGTCACTACCCAGAAATTTTACCGTGTGGCGGGCGGCTCCACCCAGCTCAAAGGCGTGGAAAGCGATATCCAGCTTCCCACCGCTACGGCGGCATTCGAACTGGGAGAAGACATTCTGGACTACGCGATGCCCTATGACCAGATTACGCCCTGCACCAACTACAAAAAGGACTCCTCCATCGCGGCCATGCTGCCCGTGCTGAAAGATGCCAGCGCGAAGCGCGTGGAAAAAGACCGCGACCTCCAGATTGCCAGGGAAGATATCGCCATGATGAAACAGCGCATCAAGGACAACAAGCTTTCCCTGAACAAGAAAATCCGGGAACAGGAAAACTCCGCCCTGGAAGAACGCCGCAAATCCATCAACAAGGAACGTAAAATCCGCTTCGCGGAAATGGCCAAGGAAGACGCTAC CAAATACAAAATTTACCGCCTGACGCTGGACGACGTCAACGCCAAGGAGCTGCCCCTGGCGGATCCGGAAAAAGACAATGAACAATTCATGCACCTGGCGGAAGACCCCACGGCAGAACTGGACGACTCCCCGGAATACCCCTCCGGCCTTGATCCGGAACTCCGCGAAGGCATCAAAACATCGTCCAGGAATCCTCCGAAGCTGG

Example 1.2. NCI-H716 cell culture and GLP-1 secretion confirmation

NCI-H716 human intestinal cell line (ATCC ^® CCL-251 ^TM ) was grown in RPMI 1640 supplemented with 10% FBS and 1% penicillin-streptomycin and then incubated at _{37° C., 5% CO 2 .} For GLP-1 secretion assay, cells ^{were seeded in a collagen-coated 96-well plate at a concentration of 6x10 4} cells/well, treated with P9 at a concentration of 100 μg/ml for 2 hours, and then the cell supernatant was analyzed for GLP-1 secretion. harvested for

After P9 treatment in NCI-H716 cells, the expression level of GLP-1 was measured by ELISA (Enzyme-linked immunosorbent assay). As a result, compared to the control group (Con), it was confirmed that GLP-1 secretion was significantly increased during P9 treatment (FIG. 1a).

Example 1.3. RNA sequencing analysis of the NCI-H716 cell line

Finally, in order to elucidate the mechanism of action of P9 inducing GLP-1 at the cellular level, NCI-H716 cell line was treated with P9 at a concentration of 50 μg/ml for 2 hours, intracellular RNA was extracted, and Macrogen Inc. ( RNA sequencing was performed in Seoul, Korea). As a result of dot plot, the results of enrichment analysis through Gene ontology DB for genes that were significantly changed compared to the control group were compared to the control group. Cellular response to calcium ion, response to cAMP, response to calcium in P9-treated cells ion, transport, and calcium-related signaling pathways such as plasma membrane to Golgi were confirmed to increase the expression level of genes involved in (Calcium pathway) (Fig. 1b).

Example 2. Confirmation of increase in calcium flux in human-derived enterocytes (NCI-H716) and mouse-derived enterocytes (GLUTag) treated with P9

Calcium influx into human-derived enterocytes (NCI-H716) and mouse-derived enterocytes (GLUTag) treated with P9 was confirmed in vitro. Intestinal cells (NCI-H716, GLUTag) were seeded in 96-well black-wall plates coated with Poly L-lysine (Sigma) at ^{2×10 4 cells/well overnight.} The next day, the growth medium was replaced with 100 μl/well probenecid using the Fluo-4 NW Assay kit (Thermo) to prevent extrusion of the dye from the cells, then added at 37°C for 30 min, then at room temperature. Incubated for 30 min.

Then, immediately after treating P9 by concentration (50 μg/ml, 100 μg/ml), excitation/emission was performed in real-time at 485/535 nm conditions through the FlexStation3 microplate reader (Molecular Devices). Calcium influx was measured. As a result, P9 induced GLP-1 within a short time of less than 10 minutes after treatment, and it was confirmed that calcium influx was significantly increased according to the treatment concentration of P9 ( FIG. 2 ).

Example 3. Confirmation of mechanism of action by P9 using phosphokinies array

To determine whether the expression of molecules in the CREB (cAMP response element binding) signaling pathway by P9 is increased, 50 μg of P9 using a Proteome profile phosphokinase array kit (R&D systems) NCI-H716 cell line was treated at a concentration of /ml. After 10 minutes, the increasing protein compared to the control was confirmed in the form of Dot blot (Fig. 3 left). The dot blot results were expressed as pixel density through ImageJ software, and the relative increase compared to the control was measured ( FIG. 3 right ). As a result, it was confirmed that Phospho-CREB (cAMP response element-binding protein) and phopho-HSP (heat shock protein) 27 were significantly increased.

Example 4. Confirmation of binding of P9 and GLP-1 receptor and confirmation of the effect of GPCR antagonist on the activity of P9

By treating the HEK293 cell line transfected with the GLP-1 receptor (GLP-1R) with P9 at a concentration of 50 μg/ml, binding to GLP-1R was confirmed. As a result of performing the beta arrest activity test, in the case of Exendin-4 (Ex4), which is known as an agonist of GLP-1R, the GLP-1R beta arrest activity significantly increased, but did not increase during P9 treatment (Fig. 4 left). Through this, it was confirmed that P9 did not respond to GLP-1R similarly to the GLP-1 analogue.

In addition, various G-protein coupled receptor (GPCR) antagonists (Histamine H1 receptor (HRH1) antagonist, Anti-alpha 1 adrenergic receptor antagonists, Muscarinic acetylcholine receptor M1 (CHRM) antagonists) (10 μM) or vehicle (DMSO) were administered to P9 ( 50 μg/ml) for 15 min before treatment. After that, incubated for 2 hours and the relative GLP-1 expression level of NCI-H716 was measured by ELISA. As a result, there was no significant change in the expression of GLP-1 by P9 (Fig. 4 right).

From Examples 3 and 4, it was confirmed that P9 is related to the CREB signaling pathway but does not react with GPCR.

Example 5. Confirmation of inhibition of GLP-1 expression induction of P9 by CREB inhibitor and PLC inhibitor

NCI-H716 cell line was treated with calcium inhibitors (666-15 (CREB inhibitor), U-73122 (PLC inhibitor), EGTA-Ringer (Ion Chelator)) (10 μM) for 15 min before P9 (100 μg/ml) treatment. did Then, it was cultured for 2 hours and the expression level of GLP-1 in NCI-H716 was confirmed by ELISA. As a result, when P9 was treated after treatment with a calcium inhibitor, the expression of GLP-1 was greatly reduced ( FIG. 5 ). Through this, it was confirmed that P9 induces GLP-1 through the calcium signaling pathway, particularly CREB and PLC expression.

Example 6. Identification of receptors that interact with P9

To confirm the mechanism by which P9 interacts with the host at the molecular level, protein binding analysis was performed in NCI-H716 using the LRC-TriCEPs technology (Dualsystems Biotech AG, Switzerland). That is, by treating the NCI-H716 cell line with P9 bound to LRC-TriCEPS, it was attempted to secure a molecular target on the cell surface that interacts with P9. TriCEPS was coupled to the ligand in a 25 mM HEPES solution at pH 8.2 at room temperature with gentle shaking for 90 minutes, followed by incubation with oxidized NCI-H716 cells at 4° C. in the dark on a rotator for 90 minutes. After centrifugation, the cell pellet was collected and then sent to ice-cold conditions for LC-MS/MS analysis.

As a result of purification and LC/MS-MS analysis of the cell line-derived protein confirmed to bind to P9 through TriCEPS, as a result, KTN-1 (Kinectin-1) and ICAM-2 (Intercellular adhesion molecule-2) was identified (FIG. 6).

Example 7. Confirmation of direct binding between ICAM-2 and P9

Among the receptors that interact with P9 identified as a result of LC-MS/MS, the GST-pull down assay test method was applied to confirm the direct binding of ICAM-2 to P9. A GST tag was attached to the N-terminus of Human ICAM-2 (NP°C000864.2) and binding to P9 protein was checked while immobilized on Glutathione resin. In this case, in order to prevent non-specific disulfide bonds between ICAM-2 and P9, a protein in which Cys403 and Cys589 of P9 were substituted with alanine (P9 C403A/C589A) (SEQ ID NO: 16) was used.

[SEQ ID NO: 16]

MNMHSFRWIRLTAFSALAAAAITSCASAHHHHHHATDFNQVGKQMSLLLQNFHFSRKEFSDELSTKFLETYLRKVDPNKIFFTQQDVDALKRKYGKELDDYLMSGQMMDAAQAMHALYRQRAMQRISYARDLLKKGGFTFDKDKSIERSRRKTAAWPKDEAEMQQVWKDMVEEQLLSEILRRETVARLAKEQNKPDPLANEKPAEEKLLMRYERIQRNIQETDLEDVAETLLSAVALTYDPHTDYMGARQVDRFKISMGTELTGIGALLGSEDDGSTKITGIVVGGPADKSGELKLNDRIVAIDSDNSGEMVDILFMKLDKVVDMIRGAENTQMRLKVEPADAPGQAKIITLTRSKVPLKDELAKGEIIELTGAPEGRNRIGVLSLPSFYADMEGGDRRAAKDVKKILERMNKENVDGLVIDLRSNGGGSLEEVRLMTGFFTGNGPVVQIKDTRGNVDIKSAHNRQKLFNGPIVVLINKLSASASEILAAALQDYGRAVIVGDESTFGKGSVQQPVDIGQYLPFFAARDRAGLLKVTTQKFYRVAGGSTQLKGVESDIQLPTATAAFELGEDILDYAMPYDQITPATNYKKDSSIAAMLPVLKDASAKRVEKDRDLQIAREDIAMMKQRIKDNKLSLNKKIREQENSALEERRKSINKERKIRFAEMAKEDATKYKIYRLTLDDVNAKELPLADPEKDNEQFMHLAEDPTAELDDSPEYPSGLDPELREGINIVQDMLKLESSGK

Example 7.1. P9 C403A/C589A mutant expression plasmid construction and purification

To construct the P9(10-37)-His-(38-748) C403A/C589A expression plasmid, pET26b::P9(10-37)-His-(38-748), pET26b::P9(10-37) )-His-(38-748) C403A, pET26b::P9(10-37)-His-(38-748) C403A/C589A were sequentially prepared.

To construct pET26b::P9(10-37)-His-(38-748), pET26b::P9-01(10-748-His) was amplified using the primers of SEQ ID NO: 2 and SEQ ID NO: 5 The first intermediate (5 Kb) and the second intermediate (2 Kb) amplified using the primers of SEQ ID NO: 3 and SEQ ID NO: 4 were treated with DpnI enzyme (FastDigest DpnI, Thermo Fisher Scientific), and then Gibson It was synthesized as a single plasmid using Assembly Master Mix (E2611S, New England Biolab). After synthesis, DH5α soluble cells were transformed and plated on LB plates. Plasmids were extracted from a single colony, and mutations were confirmed through sequencing, and stored at -20°C until use.

pET26b::P9(10-37)-His-(38-748) To construct C403A, pET26b::P9(10-37)-His-(38-748) was used with primers corresponding to SEQ ID NOs: 6 and 7 The entire plasmid was amplified in pairs. After the amplified PCR product was treated with DpnI enzyme (FastDigest DpnI, Thermo Fisher Scientific), DH5α-soluble cells were transformed and plated on LB plates. Plasmids were extracted from a single colony, and mutations were confirmed through sequencing, and stored at -20°C until use.

To construct pET26b::P9(10-37)-His-(38-748) C403A/C589A, pET26b::P9(10-37)-His-(38-748) C403A was combined with SEQ ID NO: 8 and SEQ ID NO: The entire plasmid was amplified with the primer pair corresponding to 9, and sequencing was performed in the same manner.

The primer sequences corresponding to SEQ ID NO: 2 to SEQ ID NO: 9 are shown in Table 1 below.

pET_P9_△His_F 5'-agctggaatcctccggaaaatgagatccggctgctaacaaagccc-3' (SEQ ID NO: 2) pET_P9_△His_R 5'-ttgttagcagccggatctcattttccggaggattccagcttcagca-3' (SEQ ID NO: 3) pET_P9(His-38)_F 5'-caccaccaccaccaccacgctacggacttcaaccaggtgggc-3' (SEQ ID NO: 4) pET_P9(His-38)_R 5'-gtggtggtggtggtggtgcgcagaggcgcaggaagtaatggc-3' (SEQ ID NO: 5) P9-C403A-F 5'-cCggagaccgccgcgctgccaaggatgtc -3' (SEQ ID NO: 6) P9-C403A-R 5'-gGacatccttggcagcgcggcggtctccg-3' (SEQ ID NO: 7) P9-C589A-F 5'-ctatgaccagattacgcccgccaccaactacaaaaaggact-3' (SEQ ID NO: 8) P9-C589A-R 5'-aAgtcctttttgtagttggtggcgggcgtaatctggtcatag-3' (SEQ ID NO: 9)

Expression and purification of the P9 C403A/C589A protein was performed in the same manner as in Example 1.1.

Example 7.2. Preparation of GST-ICAM-2 expression vector and preparation of immobilized GST-ICAM-2

To construct a plasmid pGEX-kg::ICAM-2 (25-223) encoding GST-ICAM-2 (SEQ ID NO: 10) linked to an N-terminal GST-tag, the primers of SEQ ID NO: 11 and SEQ ID NO: 12 were used. to amplify the pGEX-kg plasmid as a vector (first product). In addition, using the primers of SEQ ID NO: 13 and SEQ ID NO: 14, a DNA fragment (second product) encoding human ICAM-2 (25-223) from AddGene cat #51758 plasmid was prepared by DNA polymerase (pfu, SPD16-R250), respectively. , solvent) was used for amplification. The amplified first and second products were treated with DpnI enzyme (FastDigest DpnI, Thermo Fisher Scientific), and then synthesized as a single plasmid using Gibson Assembly Master Mix (E2611S, New England Biolab). After synthesis, DH5α soluble cells were transformed and plated on LB plates. Plasmids were extracted from a single colony, and mutations were confirmed through sequencing, and stored at -20°C until use. The primer sequences corresponding to SEQ ID NO: 11 to SEQ ID NO: 14 are shown in Table 2.

pGEX_gb(ICAM2)_F3 5'-CCGTGTCCGACAGCCAGTGACTGACGATCTGCCTCGCG-3' (SEQ ID NO: 11) pGEX_gb(ICAM2)_R3 5'-GCCGCACGTGCACCTCGAACACCTTGGATCCACGCGGAACCAGAT-3' (SEQ ID NO: 12) ICAM2_gb(GST)_F3 5'-TCTGGTTCCGCGTGGATCCAAGGTGTTCGAGGTGCACGTG -3' (SEQ ID NO: 13) ICAM2_gb(GST)_R3 5'- GCGCGAGGCAGATCGTCAGTCACTGGCTGTCGGACACGGG-3' (SEQ ID NO: 14)

[SEQ ID NO: 10]

MSPILGYWKIKGLVQPTRLLLEYLEEKYEEHLYERDEGDKWRNKKFELGLEFPNLPYYIDGDVKLTQSMAIIRYIADKHNMLGGCPKERAEISMLEGAVLDIRYGVSRIAYSKDFETLKVDFLSKLPEMLKMFEDRLCHKTYLNGDHVTHPDFMLYDALDVVLYMDPMCLDAFPKLVCFKKRIEAIPQIDKYLKSSKYIAWPLQGWQATFGGGDHPPKSDLVPRGSKVFEVHVRPKKLAVEPKGSLEVNCSTTCNQPEVGGLETSLDKILLDEQAQWKHYLVSNISHDTVLQCHFTCSGKQESMNSNVSVYQPPRQVILTLQPTLVAVGKSFTIECRVPTVEPLDSLTLFLFRGNETLHYETFGKAAPAPQEATATFNSTADREDGHRNFSCLAVLDLMSRGGNIFHKHSAPKMLEIYEPVSDSQ

For the preparation of immobilized GST-ICAM-2, pGEX-kg::ICAM-2(25-223) (SEQ ID NO: 13) was transformed into E. coli BL21(DE3) codon plus RIL strain. Single or multiple colonies of transformed E. coli carrying the above expression plasmid were inoculated into 25 ml LB medium (supplemented with 100 μg/ml ampicillin). Incubation was carried out at 37° C. with shaking at 200 rpm until OD _{600 reached about 1.0.}

25 ml LB medium inoculated with the above bacteria was inoculated into a 2 L flask containing 1 L LB medium. Incubation was carried out at 37° C. with shaking at 200 rpm until OD _{600 reached 0.7-0.8.} To induce protein expression, 500 μL of 1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) stock was added and incubated at 16° C. with shaking at 200 rpm for 18 hours. Then, the cells were harvested by centrifugation (6000xg, 20 minutes). Cell pellets were stored at -80°C until use.

To obtain a cell lysate containing GSH-ICAM-2, the harvested cell pellet was resuspended in 50 ml of lysis buffer (1X PBS (20X PBS dilution, BioWorld)) and transferred to a 100 ml glass beaker. The probe of the sonicator was placed 1 cm above the bottom of the beaker. Cell suspensions were sonicated on ice for 8 min with short pulses at 20 kHz per 1 s (pulse on, 45 μm amplitude) followed by 1 s intervals (pulse off) (i.e., pulse ON: OFF = 1 s: 1 s, 45 μm amplitude, 8 min treatment; suspension is always kept on ice). Then, it was cooled on ice for 8 minutes, and the sonication was repeated. Then, cell debris was removed by centrifugation at 36,000×g for 20 minutes at 4°C.

In order to immobilize GST-ICAM-2 on glutathione sepharose resin (GE healthcare, USA), 0.5 ml of settled glutathione sepharose resin (GE healthcare) was added to a 60 ml open column (Bio-Rad company). Wash the resin with 1 column volume (CV) of DW and equilibrate the resin with 2 CV of 1X PBS. The prepared cell lysate was loaded onto the column and the column was rotated at 4° C. for 30 minutes. By washing the resin with 200 ml of a wash buffer containing 50 mM Tris-HCl (pH 8.0) and 150 mM NaCl, a GST-ICAM-2 immobilized resin (Resin) was prepared and stored at 4° C. until pull-down assay was performed. .

Example 7.3. Pull-down assay

In each 1.7 ml tube, 20 ul of GST-ICAM2 fixed resin and non-fixed resin (based on Settled resin) were dispensed each. Buffer (50 mM Tris-HCl (pH 8.0), 150 mM NaCl), 1 mg/ml BSA (sigma Aldrich, Cat#A2153) dissolved in the same buffer, and 1 mg/ml P9 dissolved in the same buffer, respectively, in the tube 200 μl of C403A/C589A protein (diluted protein prepared in Example 7.1.) was added, and the tube was inverted every 15 minutes at room temperature for 1 hour to mix.

After centrifugation at 1xg for 30 seconds, the supernatant was removed. After adding 1 ml of the same buffer and mixing, the supernatant was removed by centrifugation (1 g). Repeat this process two more times. After adding 20 μL of the same buffer, 10 μL was taken and analyzed by SDS electrophoresis (FIG. 7).

Example 8. ICAM-2 and P9 binding affinity confirmation using an ICAM-2 neutralizing antibody

In order to confirm the binding of P9 to GLP-1, ICAM-2 peptide, anti-KTN1 antibody, anti-ICAM-2 antibody, and negative antibody were administered in GLUTag and NCI-H716 for 1 hour before P9 (50 ug/ml) administration. processed. Thereafter, ELISA was performed to analyze the expression level of GLP-1 according to the administration of each substance. As a result, it was found that the level of GLP-1 was significantly reduced by the ICAM-2 peptide in a dose-dependent manner ( FIG. 8 left ).

In addition, in order to check whether ICAM-2 interacts with the ligand, LFA-1 (Leukocyte adhesion protein 1) or anti-ICAM-2 antibody was administered, and then P9 was treated in NCI-H716. As a result, GLP-1 secretion was significantly reduced, but not inhibited as much as ICAM-2 peptide. From these results, it was confirmed that P9 can bind to a specific region of ICAM-2 (right side of FIG. 8).

From the results of Examples 1 to 8, it was confirmed that P9 induces the secretion of GLP-1 ^{through a Ca 2+-dependent pathway through ICAM-2.}

Claims (8)

(a) contacting the test substance with a cell line that secretes GLP-1 and expresses ICAM-2 on the cell surface;
(b) measuring the expression level of GLP-1;
(c) when the expression level of GLP-1 in cells contacted with the test substance is increased compared to a control not contacted with the test substance, selecting the test substance as a GLP-1 inducer; Methods for screening inducers. According to claim 1,
The method for screening a GLP-1 inducer, which further comprises the step of treating a cell line with an antibody that specifically binds to ICAM-2 to select a test substance in which the expression of GLP-1 is reduced. According to claim 1,
The cell line is an intestinal-derived cell, the GLP-1 inducer screening method. 4. The method of claim 3,
The cell line is NCI-H716, GLP-1 inducer screening method. A pharmaceutical composition for preventing or treating metabolic diseases comprising a substance that binds to ICAM-2 as an active ingredient. 6. The method of claim 5,
A pharmaceutical composition for preventing or treating metabolic diseases, wherein the substance binding to ICAM-2 is selected by the screening method of claim 1. 6. The method of claim 5,
The metabolic disease is obesity, diabetes, dyslipidemia (Dyslipidemia), fatty liver, impaired glucose tolerance, arteriosclerosis, hyperlipidemia, hypercholesterolemia, or cardiovascular disease, metabolic disease prevention or treatment pharmaceutical composition. A functional food composition for preventing or improving metabolic diseases comprising a substance that binds to ICAM-2 as an active ingredient.

Images