KR20210148987A - Targeting combination of anticancer drugs based on aptamers - Google Patents

Abstract

According to the present invention, disclosed is an aptamer-based targeting complex anticancer drug that can be administered in combination by including two or more types of anticancer drugs in combination and can reduce the side effects of the anticancer drugs by selectively acting only on target cancer cells.

Description

Targeting combination of anticancer drugs based on aptamers

The present invention relates to an aptamer-based targeting complex anticancer agent.

In modern society, with the development of economy and medical technology, infectious diseases and acute diseases are decreasing, but the incidence of chronic diseases such as cancer, liver disease, diabetes, and high blood pressure is increasing. Among them, cancer is a disease whose mortality rate is continuously increasing every year due to aging, westernized eating habits, and lack of exercise. According to statistics on the cause of death in Korea in 2019, the death rate from cancer, the number one cause of death (158.2 per 100,000 population), is 2.5 times higher than the death rate from heart disease, the second most common cause (60.4 per 100,000 population). There is a need to develop effective anticancer therapies for

Cancer refers to a disease that occurs when a cell mass is formed by indiscriminate cell proliferation due to an abnormal physiological environment, which invades surrounding tissues or metastasizes to other tissues of the body through blood vessels. Methods for treating such cancer include surgery, radiation therapy, chemotherapy, and the like, and chemotherapy is basically used to prevent cancer recurrence and metastasis. Unlike other topical treatments, chemotherapy is a systemic treatment in which a cytotoxic anticancer agent is administered orally or by injection to act on cancer cells that have spread throughout the body.

Cytotoxic anticancer drugs show cytotoxicity to cancer cells by directly or indirectly blocking DNA replication, transcription, or translation, interfering with the metabolic pathway of nucleic acid synthesis, interfering with nucleic acid synthesis, or inhibiting cell division by acting on microtubules. drugs collectively.

Since most cytotoxic anticancer drugs were developed using the characteristic that cancer cells grow faster than normal cells, they act not only on cancer cells but also on normal cells such as bone marrow tissue cells, which are actively dividing cells, epithelial cells of the gastrointestinal tract, and hair follicle epithelial cells. It causes side effects such as decreased immune function, loss of appetite, vomiting, diarrhea, and alopecia.

In addition, as the number of administration of cytotoxic anticancer drugs increases, cancer cells acquire resistance to anticancer drugs.

Therefore, it is required to develop a drug that can be administered in combination to overcome the resistance to anticancer drugs while reducing the side effects of cytotoxic anticancer drugs.

The present invention discloses an aptamer-based targeting complex anticancer agent capable of complex administration of anticancer agents and reducing its side effects.

When nucleoside analog drugs are incorporated into an aptamer, it is known that the aptamer can be targeted by the aptamer and exhibits anticancer activity. (Molecular Therapy: Nucleic Acids, 2008, 12:543-553; Mol Ther Nucleic Acids. 2017 Mar 17; 6: 80-88).

An object of the present invention is to enable complex administration by including (or loading, capturing) two or more types of anticancer agents in combination, and by selectively (or specifically) acting only on target cancer cells, aptamer-based targeting that can reduce the side effects of anticancer drugs It is to provide a combination anticancer drug.

Other objects or specific objects of the present invention will be set forth below.

As confirmed in the Examples below, the present inventors have found that the aptamer-based targeting complex anticancer agent according to the present invention selectively acts only on cancer cells expressing the target molecule, thereby reducing the side effects of anticancer drugs and loading two or more kinds of anticancer agents in combination. In order to evaluate whether the effect can be increased, the target molecule is HER2 (Human epidermal growth factor receptor 2) or EpCAM (Epithelial cell adhesion molecule) to an aptamer with specific binding ability, nucleoside analog drugs ) to be incorporated in the form of monophoshpate, and mertansine (DM1), another anticancer drug, was combined with the aptamer to prepare an aptamer-based targeting complex anticancer drug (specifically The aptamer-based targeting complex anticancer drug of Example 1 below), the MDA-MB-453 breast cancer cell line overexpressing both HER2 and EpCAM, and the MCF-7 breast cancer cell line overexpressing only EpCAM but not HER2 , when treated with the MDA-MB-231 breast cancer cell line that does not express both HER2 and EpCAM, it showed distinct cytotoxicity to the cell line expressing the target molecule while not showing cytotoxicity to the cell line not expressing the target molecule. was confirmed (see items A and B in FIG. 12 of the attached drawings).

In addition, the present inventors developed a stem-loop structure in order to prepare an aptamer-based targeting complex anticancer drug loaded with one other anticancer agent to the aptamer-based targeting complex anticancer drug loaded with the two anticancer drugs. A single-stranded nucleic acid to form is introduced by binding to the aptamer, and doxorubicin (DOX), an intercalators as anticaner drug, is additionally loaded in the double-stranded stem region formed from the single-stranded nucleic acid. A tamer-based targeting complex anticancer drug was prepared (aptamer-based targeted complex anticancer drug of Example 1 below), and as a result of treatment with a breast cancer cell line expressing or not expressing the target molecule as described above, as above It was confirmed that, while showing no cytotoxicity to the breast cancer cell line not expressing the target molecule, it showed distinct cytotoxicity to the breast cancer cell line expressing the target molecule (refer to items D and E in FIG. 12 of the accompanying drawings).

In addition, the present inventors simultaneously target two types of target molecules, HER2 and EpCAM, and prepare an aptamer-based targeting complex anticancer drug loaded with four types of anticancer drugs. A single-stranded nucleic acid having a stem-loop structure and an aptamer to EpCAM in which 5-fluorouracil, a nucleoside-like anticancer drug, is integrated in the form of monophosphate, is bound, and mertansine (Mertansine, DM1), paclitaxel (Paclitaxel, PTX), monoethyl auristatin E (Monomethyl auristatin E, MMAE) or monoethyl auristatin F (Monomethyl auristatin F, MMAF) combined aptamer-based targeting complex anticancer drug preparation and (aptamer-based targeting complex anticancer drug of Example 1 below), MDA-MB-453 breast cancer cell line expressing both target molecules as described above, one target molecule As a result of treatment with the MCF-7 breast cancer cell line expressing only the MCF-7 breast cancer cell line and the MDA-MB-231 breast cancer cell line not expressing both types of target molecules, as above, MDA-MB-231 breast cancer which does not express both types of target molecules It was confirmed that the MDA-MB-453 breast cancer cell line expressing both target molecules and the MCF-7 breast cancer cell line expressing only one target molecule showed cytotoxicity while not showing any cytotoxicity to the cell line. . In addition, this cytotoxicity was higher than that of the aptamer-based targeting complex anticancer drug loaded with the two or three kinds of anticancer drugs (see items G, H, I and J in FIG. 13 of the attached drawings). These results show that, in particular, when the aptamer-based targeting complex anticancer agent of the present invention has multiple target functions, it acts only on cancer cell lines having multiple target molecules, thereby lowering side effects and showing more effective cytotoxicity to the cancer cells. can see. As described above, the examples below show that the aptamer-based targeting complex anticancer agent of the present invention enables complex administration of anticancer drugs, and the side effects of anticancer drugs can be reduced by acting only on cancer cells having the corresponding target molecule by the targeting function by the aptamer. means

In consideration of the above, the aptamer-based targeting complex anticancer agent of the present invention specifically targets (i) a target molecule expressed on the surface of cancer cells (which may be referred to as a "first target molecule" depending on the context below) By recognizing and binding, targeting to cancer cells is possible, and nucleoside-like anti-cancer agents (which may be referred to as “first nucleoside-like anti-cancer agents” depending on context below) are integrated into one or more molecules. (incorporated) an aptamer (which may be referred to as a "first aptamer" depending on the context below) capable of exhibiting anticancer activity by itself and (ii) a second anticancer agent different from the nucleoside-like anticancer agent It has a configuration coupled to the aptamer.

In the present specification, the anticancer agent refers to all cytotoxic anticancer agents, including nucleoside-like anticancer agents, intercalator anticancer agents, groove binding anticancer agents, and second anticancer agents, except when used with a different meaning. This cytotoxic anticancer agent is a generic term for anticancer agents that exhibit cytotoxicity to cancer cells by inhibiting cell division of cancer cells as well known in the art and as mentioned above.

In the aptamer-based targeting complex anticancer agent of the present invention, a single-stranded nucleic acid forming a stem-loop structure is introduced by binding to the 5' or 3' end of the aptamer and/or the second anticancer agent, and , one or more molecules of the intercalator anticancer agent or groove-binding anticancer agent may be inserted into the stem region, which is the double-stranded region of the single-stranded nucleic acid, to be loaded (or captured). The meaning of being loaded here is that when the intercalator anticancer agent or the groove-binding anticancer agent is an anticancer agent that forms a covalent bond with the double-stranded nucleic acid of the stem region, it is loaded by a covalent bond, and in the case of not forming a covalent bond, the electrostatic interaction ( It means that it is mounted as a non-covalent bond by electrostatic interaction) or van der Waals interactions.

When a single-stranded nucleic acid forming a stem loop structure loaded with an intercalator anticancer agent or a groove-binding anticancer agent is introduced, the binding order may be any binding order, specifically (i) an aptamer, an intercalator anticancer agent, or Single-stranded nucleic acid forming a stem loop structure loaded with a groove-binding anticancer agent, in the order of a second anticancer agent, or (ii) a single-stranded nucleic acid forming a stem loop structure loaded with an intercalator anticancer agent or a groove-binding anticancer agent, an aptamer, The second anticancer agent may be in the order, or (iii) the single-stranded nucleic acid forming a stem loop structure loaded with the aptamer, the second anticancer agent, the intercalator anticancer agent, or the groove-binding anticancer agent may be in the order.

Here, when the aptamer and the single-stranded nucleic acid are spatially adjacent to each other, the binding site of the aptamer to the target molecule or the stem loop region of the single-stranded nucleic acid has a function (ie, binding ability to the target molecule or intercalator anticancer drug or groove binding). Its intended function may be affected by being influenced by the conformation (or secondary structure) that exerts the anticancer drug's loading capacity. Between the aptamer and the single-stranded nucleic acid to properly space the aptamer and the single-stranded nucleic acid (in the case of the aptamer-based targeting complex anticancer agent of the present invention in the order of the aptamer, the anticancer agent, and the single-stranded nucleic acid, between the aptamer and the anticancer agent) Alternatively, an anticancer agent or an oligonucleotide (between single-stranded nucleic acids) may be interposed as a spacer and coupled thereto. The length of the spacer is not particularly limited as long as the aptamer and the single-stranded nucleic acid are spaced apart so that their functions are not affected by each other. Typically, it may be 3 to 20 bp in length. These oligonucleotide spacers are DNA or RNA oligonucleotides composed of one or more nucleotides, or nucleases or heat-stable PNA (Peptide Nucleic Acid), LNA (Locked Nucleic Acid), HNA (Hexitol Nucleic Acids), ANA (Altritol Nucleic Acids), It may be MNA (Mannitol Nucleic Acids) and the like.

In addition, in the aptamer-based targeting complex anticancer agent of the present invention, additional targeting to cancer cells is possible by specifically recognizing and binding to a second target molecule different from the target molecule, and a nucleoside-like anticancer agent integrated into the aptamer and A second aptamer capable of exhibiting anticancer activity by itself by integrating one or more molecules of another nucleoside-like anticancer agent (which may be referred to as a "second nucleoside-like anticancer agent" depending on the context below) is Linked to the 5' or 3' end of the tamer or the 5' or 3' end of the single-stranded nucleic acid forming a stem-loop structure loaded with the second anticancer agent, the intercalator anticancer agent, or the groove-binding anticancer agent can be introduced.

When the second aptamer is introduced into the aptamer-based targeting complex anticancer agent of the present invention, the binding order may be any binding order, specifically (i) the first aptamer, the second aptamer, and the second aptamer. 2, or (ii) the first aptamer, the second anticancer agent, and the second aptamer in order. Here too, between the first aptamer and the second aptamer in order to space the first aptamer and the second aptamer (the present invention is an aptamer-based targeting complex anticancer agent, the first aptamer, the first In the case of the second anticancer agent and the second aptamer in the order, between the first aptamer and the second anticancer agent or between the second anticancer agent and the second aptamer) oligonucleotides may be interposed as a spacer and bound. This is to prevent the first aptamer and the second aptamer from being spatially adjacent and failing to exert their functions (specific binding ability with the corresponding target molecule). For the length of this oligonucleotide, its configuration, and the like, reference may be made to the foregoing.

In addition, when the second aptamer is introduced into the aptamer-based targeting complex anticancer agent of the present invention into which a single-stranded nucleic acid forming a stem loop structure on which the intercalator anticancer agent or groove-binding anticancer agent is loaded is introduced, the binding sequence is also arbitrary order, specifically (i) the first aptamer, the single-stranded nucleic acid, the second anticancer agent, the second aptamer, or (ii) the first aptamer, the single-stranded nucleic acid, and the second aptamer tamer, second anticancer agent, (iii) first aptamer, second aptamer, single-stranded nucleic acid, second anticancer agent, or (iv) single-stranded nucleic acid, first aptamer, second of the anticancer agent, the second aptamer, (v) single-stranded nucleic acid, the first aptamer, the second aptamer, the second anticancer agent, or (vi) the first aptamer, the second anticancer agent , single-stranded nucleic acid, second aptamer, (vii) first aptamer, second anticancer agent, second aptamer, single-stranded nucleic acid, or (viii) first aptamer, second of an aptamer, a second anticancer agent, and a single-stranded nucleic acid may be in the order.

Even in this case, an oligonucleotide spacer may be interposed and coupled to spatially space the first aptamer, the second aptamer, and the single-stranded nucleic acid.

On the other hand, the inventors of the present invention, in the following examples, a nucleoside-like anticancer agent, gemcitabine-integrated aptamer for HER2, and 5-fluorouracil, a nucleoside-like anticancer agent, for EpCAM integrated in monophosphate form. The aptamer-based targeting complex anticancer drug of the present invention equipped with two anticancer drugs while simultaneously targeting two types of target molecules, HER2 and EpCAM, in a form in which the aptamer is bound (aptamer-based targeting complex anticancer agent in Example 1 F below ), the MDA-MB-453 breast cancer cell line expressing both target molecules, the MCF-7 breast cancer cell line expressing only one target molecule, and the MDA-MB-231 breast cancer cell line expressing neither the two target molecules. As a result of treatment with the cell line, MDA-MB-453 expressing both types of target molecules without showing any cytotoxicity to the MDA-MB-231 breast cancer cell line which does not express both types of target molecules as above. It was confirmed that cytotoxicity was shown to the breast cancer cell line and the MCF-7 breast cancer cell line expressing only one target molecule (refer to item F of FIG. 13 in the accompanying drawings).

Considering the above, in another aspect, the aptamer-based targeting complex anticancer agent of the present invention is capable of targeting and binding to cancer cells by specifically recognizing and binding the first target molecule expressed on the surface of cancer cells. A first aptamer capable of exhibiting anticancer activity by itself by incorporating the nucleoside-like anticancer agent of 1 and (ii) a second target different from the first target molecule expressed on the surface of the cancer cell By specifically recognizing and binding the molecule, additional targeting to cancer cells is possible, and the first nucleoside-like anticancer agent and the second nucleoside-like anticancer agent are incorporated, thereby exhibiting anticancer activity by itself. It may be understood as an aptamer-based targeting complex anticancer agent having a configuration in which a second aptamer capable of being bound to the first aptamer.

Also in this case, a spacer, which is an oligonucleotide, may be interposed and coupled to spatially space the first aptamer and the second aptamer.

On the other hand, in the following examples, the present inventors have a single-stranded nucleic acid forming a stem-loop structure loaded with an aptamer for HER2 in which gemcitabine, a nucleoside-like anticancer drug, is integrated, and doxorubicin, an intercalator anticancer drug. The aptamer-based targeting complex anticancer drug of the present invention (aptamer-based targeting complex anticancer drug of Example 1 C below), HER2 and EpCAM, As a result of treatment with the MDA-MB-453 breast cancer cell line overexpressing both, the MCF-7 breast cancer cell line overexpressing only EpCAM but not HER2, and the MDA-MB-231 breast cancer cell line not expressing both HER2 and EpCAM, the target molecule It was confirmed that the MDA-MB-453 breast cancer cell line expressing phosphorus HER2 showed cytotoxicity but did not show cytotoxic effect on the MCF-7 breast cancer cell line and MDA-MB-231 breast cancer cell line which did not express the target molecule HER2 ( See item C in FIG. 12 of the accompanying drawings).

In view of the above, in another aspect, the aptamer-based targeting complex anticancer agent of the present invention (i) a target molecule expressed on the surface of a cancer cell (hereinafter may be referred to as a "first target molecule" depending on the context) By specifically recognizing and binding to cancer cells, targeting to cancer cells is possible, and nucleoside-like anticancer agents (which may be referred to as "first nucleoside-like anticancer agents" depending on the context below) are incorporated. An aptamer capable of itself exhibiting anticancer activity (which may be referred to as a "first aptamer" depending on context hereinafter) and (ii) a single-stranded nucleic acid forming a stem loop structure is 5' of the aptamer. Alternatively, it can be understood as having a configuration in which an intercalator anticancer agent or a groove-binding anticancer agent is inserted into the stem region, which is a double-stranded region of this single-stranded nucleic acid, and is introduced by binding to the 3' end.

In the aptamer-based targeting complex anticancer agent of the present invention, additional targeting to cancer cells is possible by specifically recognizing and binding to a second target molecule different from the first target molecule expressed on the surface of the cancer cell, The second aptamer capable of exhibiting anticancer activity by itself by incorporating the first nucleoside-like anticancer agent and another second nucleoside-like anticancer agent is the first aptamer or the single-stranded nucleic acid It can be introduced in conjunction with .

In this case, the binding order may also be in any order, specifically (i) the first aptamer, the single-stranded nucleic acid, and the second aptamer, or (ii) the first aptamer, the second aptamer, and the single strand nucleic acid sequence.

Even in this case, a spacer, which is an oligonucleotide, may be interposed and coupled to spatially space the first aptamer, the second aptamer, and the single-stranded nucleic acid.

In the aptamer-based targeting complex anticancer agent of the present invention, the single-stranded nucleic acid or the second aptamer forming a stem-loop structure is an end of the aptamer-based complex anticancer agent (eg, the aptamer and the second anticancer agent) In the configuration in which is bound, it is not between the 5' end of the aptamer or the second anticancer agent), but between its components (for example, in the configuration in which the aptamer and the second anticancer agent are combined, the 3' end of the aptamer or When introduced into the second anticancer agent), the single-stranded nucleic acid or the second aptamer is the former component (the 3' end of the aptamer in the above example) and the latter component (the second anticancer agent in the above example) It means that they are introduced in combination with all of them.

In the present invention, a cancer cell is any cancer cell (or cancer stem cell) that is in need of removal or death for therapeutic purposes. Cancer cells include esophageal cancer, stomach cancer, colorectal cancer, rectal cancer, oral cancer, pharyngeal cancer, laryngeal cancer, lung cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, ovarian cancer, prostate cancer, testicular cancer, bladder cancer, kidney cancer, liver cancer, pancreatic cancer, bone cancer, Carcinomas such as connective tissue cancer, skin cancer, brain cancer, thyroid cancer, leukemia, Hodgkin's disease, lymphoma, multiple myeloma, and blood cancer are not included.

Also, in the present invention, the target molecule is any antigen or any receptor present on the surface of cancer cells.

Such antigen or receptor preferably refers to an antigen or receptor that is expressed only in cancer cells or is overexpressed in cancer cells compared to normal cells. For example, epidermal growth factor receptor variant III (EGFRvIII) expressed in glioblastoma, epidermal growth factor receptor (EGFR) overexpressed in anaplastic thyroid cancer, breast cancer, lung cancer, glioma, etc., papillary thyroid cancer ) overexpressed metastin receptor, ErbB receptor tyrosine kinases overexpressed in breast cancer, breast cancer, bladder cancer, gallbladder cancers, cholangiocarcinomas, esophagogastric HER2 (Human epidermal growth factor receptor 2) overexpressed in junction cancers, etc., tyrosine kinase-18-receptor (c-Kit) overexpressed in nutritive renal carcinoma, etc., HGF receptor c-Met overexpressed in esophageal adenocarcinoma, etc., in breast cancer, etc. overexpressed CXCR4 or CCR7, endothelin-A receptor overexpressed in prostate cancer, peroxisome proliferator activated receptor δ (PPAR-δ) overexpressed in rectal cancer, platelet-derived growth factor receptor α (PDGFR-α) overexpressed in ovarian cancer, etc.; CD133 overexpressed in liver cancer, multiple myeloma, etc., carcinoembryonic antigen (CEA) overexpressed in lung cancer, colon cancer, stomach cancer, pancreatic cancer, breast cancer, rectal cancer, colon cancer, medullary thyroid cancer, etc., EpCAM overexpressed in liver cancer, stomach cancer, colorectal cancer, pancreatic cancer, breast cancer, etc. (Epithelial cell adhesion molecule), GD2 (disialoganglioside) overexpressed in neuroblastoma, GPC3 (Glypican 3) overexpressed in hepatocellular carcinoma, and prostate cancer PSMA (Prostate Specific Membrane Antigen), TAG-72 (tumor-associated glycoprotein 72) overexpressed in ovarian cancer, breast cancer, colon cancer, lung cancer, pancreatic cancer, etc., GD3 (disialoganglioside) overexpressed in melanoma, HLA overexpressed in blood cancer, solid cancer, etc. -DR (human leukocyte antigen-DR), MUC1 (Mucin 1) overexpressed in advanced solid cancer, and NY-ESO-1 (New York esophageal squamous cell carcinoma 1) overexpressed in advanced non-small-cell lung cancer , LMP1 (Latent membrane protein 1) overexpressed in nasopharyngeal neoplasms, etc., and TRAILR2 (tumor-necrosis factor-related apoptosis-inducing ligand receptor) overexpressed in lung cancer, non-Hodgkin's lymphoma, ovarian cancer, colon cancer, colorectal cancer, and pancreatic cancer ), vascular endothelial growth factor receptor 2 (VEGFR2), an angiogenesis factor receptor, and hepatocyte growth factor receptor (HGFR) overexpressed in hepatocellular carcinoma may be target molecules. In addition, CD44, CD166, etc., which are surface antigens of cancer stem cells, may also be target molecules, and immune checkpoints such as PD-1, PD-L1, PD-L2, etc. may be target molecules.

Many target molecules are known in the art that are overexpressed in cancer cells compared to normal cells, and for more specific target molecules other than those exemplified above, see Anne T Collins et al. Prospective Identification of Tumorigenic Prostate Cancer Stem Cells. Cancer Res. 2005 Dec 1;65(23):10946-51, Chenwei Li et al. Identification of Pancreatic Cancer Stem Cells. Cancer Res. 2007 Feb 1;67(3):1030-7, Shuo Ma et al. Current Progress in CAR-T Cell Therapy for Solid Tumors. Int J Biol Sci. 2019 Sep 7;15(12):2548-2560, Dhaval S Sanchala et al. Oncolytic Herpes Simplex Viral Therapy: A Stride Toward Selective Targeting of Cancer Cells. Front Pharmacol. 2017 May 16;8:270 and the like.

In particular, in the present invention, the target molecule is preferably HER2 or EpCAM.

In the present invention, the aptamer may be a single-stranded DNA aptamer or a single-stranded RNA aptamer. The aptamer refers to a nucleic acid ligand capable of specifically binding to a target molecule, such as a target antigen, like an antibody. If it can specifically bind to a target molecule, the aptamer may be a double-stranded DNA or RNA aptamer. The preparation and selection methods of the aptamer capable of specific binding to the target molecule are all known in the art, and in particular, the SELEX technology or a technology improved this SELEX technology, such as Counter- to increase specificity with the target molecule SELEX technology (Science 263(5152):1425-1429, 1994), Spiegelmer technology using enantiomers of a target molecule and an aptamer (Chem Biol 9(3):351-359, 2002), etc. can be used. The SELEX technology is a technology named as an abbreviation of "Systematic Evolution of Ligands by EXponential enrichment", and the technology is described in Documents Science 249 (4968):505-510, 1990, U.S. Patent No. 5,475,096, U.S. Patent No. 5,270,163 , International Patent Publication No. WO 91/19813, etc. may be referred to, and for specific methods for the selection of aptamers or the use of appropriate reagents and materials, literature Methods Enzymol 267:275-301, 1996, Methods Enzymol 318:193 -214, 2000, etc. may be referred to. The aptamer may be modified with sugar, phosphate and/or base to improve half-life in vivo. Nucleotides modified in such sugars, phosphates and/or bases are specifically known in the art, including methods for their preparation. For example, nucleotides modified in sugars are those in which the hydroxyl group (2'-OH group) of the sugar is modified with a halogen group (especially fluorine (F)), an aliphatic group, an ether group, an amine group, or in particular OMe, O-alkyl, O- Those modified with allyl, S-alkyl, S-allyl or halogen, etc., sugar analogues α-anomeric sugars, arabinose, in which the sugar ribose or deoxyribose itself can replace it; and epimeric sugars such as xylose or lyxose, pyranose sugars, furanose sugars, and the like. Also, for example, modifications in the phosphate can be modified so that the phosphate is P(O)S(thioate), P(S)S(dithioate), P(O)NR2(amidate), P(O)R, P(O)OR', CO or those modified with formacetal (CH2). wherein R or R' is H or substituted or unsubstituted alkyl, etc., and when modified in phosphate, the linking group becomes -O-, -N-, -S- or -C-, so that adjacent nucleotides through this linking group will bind to each other.

An aptamer is its target even if one or more nucleotides are added, substituted, or deleted at the site where it binds to the target molecule or at sites other than the binding site, and even if it is chemically modified or other sequences are added at both ends of the aptamer. It is well known in the art that the binding capacity with a molecule does not change or can be maintained even if the binding capacity is lowered (Molecules. 2020 Jan; 25(1):3; Int J Mol Sci. 2017 Aug; 18(8): 1683).

These aptamers can be newly selected, amplified, separated, purified, or chemically synthesized for any target molecule according to methods known in the art, such as SELEX technology, and, if necessary, the existing It is also possible to use an aptamer of a known sequence.

Sequence of target molecule and RNA aptamer target molecule Aptamer sequence(5’ → 3’) AMPA receptor GluR2Qflip GGGCGAAUUCAACUGCCAUCUAGGCAGUAACCAGGAGUUAGUAGGACAAGUUUCGUCC CD4 CUCAGACAGAGCAGAAACGACAGUUCAAGCCGAA CTLA-4 GGGAGAGAGGAAGAGGGAUGGGCCGACGUGCCGCAACUUCAACCCUGCACAACCAAUCCGCCCAUAACCCAGAGGUCGAUAGUACUGGAUCCCCCC EGFR (E07) UGCCGCUAUAAUGCACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCG GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGCp3 EGFR (J18) GGCGCUCCGACCUUAGUCUCUGCCAAGAUAAACCGUGCUAUUGACCACCCUCAACACACUUAUUUAAUGUAUUGAACGGACCUACGAACCGUGUAGCACAGCAGA EGFRvIII (E17) ACCAAAAUCAACGCAAAGAGCGCGCCUGCACGUCACCUCA Erythrocyte membrane protein1 (PfEMP1) GGGAAUUCGACCUCGGUACCAACAAUACGACUACACCAUCAAAAGUAUUAUCUUGCAUCGAAGGUUGGCGUAGCAAGCUCUGCAGUCG gp120 GGGAGACAAGACUAGACGGUGAAUGUGGGCCACGCCCGAUUUUACGCUUUUACCCGCACGCGAUUGGUUUGUUUCCC HER2 AGCCGCGAGGGGAGGGAAGGGTAGGGCGCGGCT HER3 GGGAAUUCCGCGUGUGCCAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCGGUCCGUUCGGGAUCCUC Human keratinocyte growth factor CCCAGGACGAUGCGGUGGUCUCCCAAUUCUAAACUUUCUCCAUCGUAUCUGGG GGGAGGACGAUGCGGUGGUCUCCCAAUUCUAAACUUUCUCCAUCGUAUCUGGGCAGACGACUCGCCCGA L-selectin UAACAACAAUCAAGGCGGGUUCACCGCCCCAGUAUGAGUA Neruotensin-1 (NTS-1) ACAGATACGGAACTACAGAGGTCAATTACGGTGGCCACGC NF-κB CAUACUUGAAACUGUAAGGUUGGCGUAUG Phosphatidylcholine: cholesterol liposomes GGGAUCUACACGUGACUGACUUACGAGACUGUCUCGCCAAUUCCAGUGGGCCUGCGGAUCCU PSMA (A10) GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGCAGACUCGCCCGA Raf-1 GGGAGAUCGAAUAAACGCUCAAUUUGCCUCGACGGUCUGCGAAUAGAACGCGAACCGUGAUUAGUGUACAAGGAUUCGGUUUUCGACAUGAGGCCCCUGCAGGGCG RET receptor tyrosine kinase GCGCGGGAATAGTATGGAAGGATACGTATACCGTGCAATCCAGGGCAACG TCF-1 GGGGAGCUCGGUACCGGUGCGAUCCCCUGUUUACAUUGCAUGCUAGGACGACGCGCCCGAGCGGGUACCGAUUGUGUCGUCGGAAGCUUUGCAGAGGAUC Tenascin-C (AptamerTTA1) GGGAGGACGCGUCGCCGUAAUGGAUGUUUUGCUCCCUG TGF-β type III receptor GGGCCAGGCAGCGAGAGAUAAGCAGAAGAAGUAUGUGACCAUGCUCCAGAGAGCAACUUCACAUGCGUAGCCAAACCGACCACACGCGUCCGAGA Tumor necrosis factor superfamily member 4-1BB GGGAAGAGAGGAAGAGGGAUGGGCGACCGAACGUGCCCUUCAAAGCCGUUCACUAACCAGUGGCAUAACCCAGAGGUCGAUAGUACUGGUCCCCCC Tumor necrosis factor superfamily member OX40 GGGAGGACGATGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACCAGACGACUCGCUGAGGAUCCGAGA VEGF CGGAAUCAGUGAAUGCUUAUACAUCCG Wilms tumor protein (WT1) GAUAUGGUGACCACCCCGGC αvβ3 integrin GGGAGACAAGAAUAAACGCUCAAUUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCCUUCGACAGGAGGCUCACAAAAAAGGC β-catenin GGACCGUGGUACCAGGCCGAUCUAUGGACGCUAUAGGCACACCGGAUACUUUAACGAUUGGCUAAGCUUCCGCGGGGAUC MUC1 (DNA) GCAGTTGATCCTTTGGATACCCTGG EpCAM GCGACUGGUUACCCGGUCG BAFF GGGAGGACGAUGCGGGAGGCUCAACAAUGAUAGAGCCCGCAAUGUUGAUAGUUGUGCCCAGUCUGCAGACGACUCGCCCGA′ Endothelial Integrin Alpha-V Beta-3 UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC Osteopontin CGGCCACAGAAUGAAAAACCUCAUCGAUGUUGCAUAGUUG Receptor Tyrosine Kinase (RET) Mutant (D4) GCGCGGGAAUAGUAUGGAAGGAUACGUAUACCGUGCAAUCCAGGGCAACG PSMA Aptamer (A10-3) GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCUUGUCAAUCCUCAUCGGC P-Selectin ACGCUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAGCGCAACCAGUAACACC' Carcinoembryonic Antigen Aptamer GCGGAAGCGUGCUGGGCUAGAAUAAUAAUAAGAAAACCAGUACUUUCGU'

In the present invention, the nucleoside-like anticancer agent is an anticancer agent classified as antimetabolites, and is transformed into its triphosphate form in vivo and incorporated into RNA or DNA like nucleotides to inhibit the activity of RNA or DNA synthetase. anticancer drugs that can

As such anticancer drugs, gemcitabine, fludarabine, cytarabine, cladribine, 5-fluorouracil, capecitabine, pentostatin ( Pentostatin), Adefovir, Cidofovir, Doxifluridine, Enocitabine, Fluxuridine, Fludarabine Phosphate, etc. , but is not limited thereto.

In the present invention, the nucleoside-like anticancer agent specifically recognizes and binds the target molecule to the aptamer, as long as it does not inhibit the specific binding ability of the aptamer to the target molecule, one or more moleculs. Additions can be inserted and integrated with or without replacement of the original nucleotide. For example, when the aptamer is incorporated into the aptamer without inhibiting the specific binding ability of the aptamer to the target molecule, one or more molecules of gemcitabine in the form of monophosphate include at least one binding site or non-binding site of the aptamer to the target molecule. It is integrated by replacing CTP, or one or more molecules of 5-fluorouracil are integrated by replacing one or more UTPs in the binding site or non-binding site of the aptamer in the form of monophosphate, or other nucleoside-like anticancer drugs In the monophosphate form, one or more molecules of the aptamer may be inserted by replacing the original nucleotide at the binding site or non-binding site with the target molecule or without replacing the original nucleotide.

In the art, gemcitabine can be incorporated into DNA or RNA by replacing CTP, 5-fluorouracil can be incorporated into DNA or RNA by replacing TTP or UTP (Mol Ther Nucleic Acids. 2017;6:80) -88), fludarabine, cytarabine, and cladribine are also known to be incorporated into DNA or RNA by replacing ATP, CTP, and ATP, respectively (Oncogene 22, 7524). -7536, 2003; Oncogene 27, 6522-6537, 2008).

The integration of the nucleoside-like anticancer agent into the aptamer may be accomplished through a process of chemically synthesizing the aptamer or using a mutant polymerase capable of incorporating modified nucleotides into the aptamer. As such mutant polymerases, mutant T7 polymerase Y639F, mutant T7 polymerase Y639F/H784A, mutant T7 polymerase H784A, etc. that can be used for RNA aptamer synthesis are known in the art (Science, 286:2305-2308, 1999; Nucleic Acids Res30(24):e138, 2002; Nucleic Acids Res. 2015 Sep 3; 43(15):7480-7488), kits using such mutant T7 polymerases such as the DuraScribe® T7 transcription kit (Epicentre Biotechnologies), T7 R&DNA™ Polymerase (Lucigen) and MAXIscript™ T7 Transcription Kit (ThermoFisher Scientific) are commercially available.

In the aptamer-based targeting complex anticancer agent of the present invention, the single-stranded nucleic acid forming the stem loop structure is loaded with one or more intercalator anticancer agents between planer bases or the double-stranded minor or major (major) Groove binders as anticancer drugs capable of binding to the groove may be loaded.

As an intercalator anticancer agent, representative anthracycline compounds can be mentioned, doxorubicin, daunorubicin, dactinomycin, actinomycin, and mitoxantrone. (mitoxantrone), epirubicin, and the like are such anthracycline anticancer drugs. Intercalator anticancer drugs are inserted between double-stranded planar bases to cause structural changes in DNA, thereby inhibiting DNA replication, transcription, and DNA repair processes, thereby inhibiting cancer cell death.

Since these intercalator anticancer agents have the property of intercalating particularly well with GC repeating sequence regions, the single-stranded nucleic acid forming the stem loop structure in the aptamer-based targeting complex anticancer agent of the present invention is d(GC)-Ld( CG) has a generalizable sequence. Here, in d(GC) or d(CG), which is a GC region forming the stem structure, d is an integer of 1 or more, preferably an integer of 2 or more, and more preferably an integer of 2 or more and 50 or less. L forming the loop region is composed of 2 or more nucleotides, preferably 3 to 10 nucleotides. The single-stranded nucleic acid forming the stem loop structure may be a DAN single-stranded nucleic acid or an RNA single-stranded nucleic acid, and such as a spacer of the oligonucleotide, a nuclease or heat-stable PNA (Peptide Nucleic Acid), LNA (Locked Nucleic Acid), It may be Hexitol Nucleic Acids (HNA), Altritol Nucleic Acids (ANA), Mannitol Nucleic Acids (MNA), and the like, and may be modified from sugar, phosphate and/or base to improve half-life in vivo as in the aptamer. .

Groove-binding anticancer agents can be divided into minor groove-bound anticancer drugs and major groove-bound anticancer drugs. ), etc., distamycin derivatives, CC-1065, adozelesin, carzelesin, and CC-1065 derivatives such as Bizelesin, ducamycin A (Ducarmycin A), ducamycin SA (Ducarmycin SA), ducamycin derivatives such as KW-2189, Irofulven, trabectedin (Trabectedin, ET-743), etc., and most of these minor groove binding anticancer drugs, such as distamycin A, are electrostatic Non-covalently bound to DNA by electrostatic or van der Waals interactions, but having an electrophilic group such as CC-1065, ducamycin A, irofulven, travexedine, etc. Some are covalently bound to DNA by DNA alkylation. More specific with regard to minor groove binding anticancer agents, see Cancer Treatment Reviews 35 (2009) 437-.450, Medchemcomm, 12 Dec 2018, 10(1):26-40, Beilstein J Org Chem. 2018; 14: 1051-1086, Arh Hig Rada Toksikol 2013; 64:593-602, Angew. Chem., Int. Ed. Engl., 1996, 35, 1438-1474, et al.

Examples of major groove-binding anticancer drugs include nogalamycin, ditercalinium bis-naphthalimides, aminoglycoside, and the like, which also bind to DNA through non-covalent or covalent bonding. do. For example, aminoglycosides have an electrophilic group and react with the nucleophilic N-7 of the purine base of DNA to form a covalent bond.

The aptamer-based targeting complex anticancer agent of the present invention may be PEGylated to improve in vivo stability and half-life. The site to be pegylated may be the exposed end (ie, the 5' end and/or the 3' end) of the aptamer when the aptamer is located at one or both ends in the aptamer-based targeting complex anticancer agent of the present invention.

PEGylation can be accomplished by polyethylene glycol or a derivative thereof whose chemical formula is H(OCH ₂ CH ₂ )nOH (n is an integer greater than or equal to 4).

Polyethylene glycol or a derivative thereof used for pegylation is not particularly limited in its molecular weight as long as it can exhibit intended in vivo stability and half-life. PEGylation will generally be effected by polyethylene glycol or its derivatives having a molecular weight in the range of 0.2-50 kDa, 0.5-50 kDa or 10-45 kDa.

The aptamer-based targeting complex anticancer agent of the present invention, when one or both ends of the aptamer is located, prevents degradation of the aptamer by nucleases in vivo, thereby improving in vivo stability of the 5' end of the aptamer or 3' terminal nucleotide is LNA (Locked Nucleic Acid or bridged nucleic acid, nucleic acid in which 2'O and 4C of the terminal nucleotide are linked) or idT (inverted deoxythymidine) form, or 2'-methoxy nucleoside, 2 It may be in a form having '-amino nucleoside or 2'F-nucleoside, or chemically modified with an amine linker, a thiol linker, cholesterol, or the like.

In the aptamer-based targeting complex anticancer agent of the present invention, the first or second aptamer, the cytotoxic anticancer agent, and the single-stranded nucleic acid forming the stem loop structure are an amine group, a carboxyl group, a thiol group ( A sulfhydryl group), a phosphate group, a hydroxyl group, etc. may be covalently bonded. Such bonding may be made through a functional group originally possessed by an aptamer, a cytotoxic anticancer agent, and a stem loop structure, or through a linker capable of binding to such a functional group. For example, when a nucleoside-like anticancer agent is integrated into the aptamer, the integration of the anticancer agent into the aptamer is integrated through their original functional group without the mediation of a linker. In addition, when the aptamer-based targeting complex anticancer agent of the present invention has a form in which the aptamer and the single-stranded nucleic acid forming the stem loop structure are combined, the single-stranded nucleic acid forming the aptamer and the stem loop structure has their original properties without the mediation of the linker. It may be bound through an existing functional group.

In the aptamer-based targeting complex anticancer agent of the present invention, the first or second aptamer, the cytotoxic anticancer agent, and the single-stranded nucleic acid forming the stem loop structure may bind through the functional group they originally had, but they may bind via the linker can also be combined with

The functional groups of these linkers are isothiocyanate, isocyanates, acyl azide, NHS ester, sulfonyl chloride, aldehyde, glyoxal ( glyoxal, epoxide, oxirane, carbonate, aryl halide, imidoester, carbodiimide, anhydride, fluorophenyl It may be fluorophenyl ester, hydroxymethyl phosphine, maleimide, haloacetyl, pyridyldisulfide, thiosulfonate, or vinylsulfone, etc. have.

The linker may be a linker cleavable by a protease, cleavable under acid or base conditions, cleavable under high temperature or light irradiation, or cleavable under reducing or oxidizing conditions, or a linker that is not cleavable under these conditions. it may be

Examples of the cleavable linker include a hydrazone linker cleaved under acidic conditions, a peptide linker cleaved by a protease, and a linker having a disulfide functional group cleaved under reducing conditions. Examples of the non-cleavable linker include: MCC (Maleimidomethyl cyclohexane-1-carboxylate) linker, MC (maleimidocaproyl) linker, or a derivative thereof, such as succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate (sMCC) linker or sulfosuccin imidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC).

The linker may also be a self-immolative linker or a traceless linker after cleavage. Self-immolative linkers are, for example, linkers disclosed in U.S. Patent No. 9,089,614 entitled "Hydrophilic self-immolative linkers and conjugates thereof", titled "SELF-IMMOLATIVE LINKERS CONTAINING MANDELIC ACID DERIVATIVES, DRUG-LIGAND CONJUGATES FOR TARGETED THERAPIES AND USP THEREOF", International Publication No. WO2015038426, and linkers that do not leave a trace after cleavage include a phenylhydrazide linker, an aryl-triazene linker, Blaney, et al., "Traceless solid-phase organic synthesis" ," Chem Rev. 102: 2607-2024 (2002), and the like.

The linker may also be a homobifunctional linker (a linker having two or more identical reactive functional groups) or a heterobifunctional linker (a linker having two or more different reactive functional groups).

Homobifunctional linkers include, for example, 3'3'-dithiobis(sulfosuccinimidyl propionate (DTSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl)suberate (BS), Disuccinimidyl Tartrate (DST), Disulfosuccinimidyl Tartrate (Sulfo DST), Ethylene Glycobis (Succinimidyl Succinate) (EGS), Disuccinimidyl Glutarate (DSG), N,N '-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3,3'-dithiobispropionimidate ( DTBP), 1,4-di-3'-(2'-pyridyldithio)propionamido)butane (DPDPB), bismaleimidohexane (BMH), aryl halide containing compound (DFDNB), bismaleimido Hexane (BMH), compound containing aryl halide (DFDNB), bis-β-(4-azidosalicylamido)ethyldisulfide (BASED), formaldehyde, glutaraldehyde, 1,4-butanediol diglycidyl ether , adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, α,α'-p-diaminodiphenyl, diiodo-p-xylene sulfonic acid , N,N'-ethylene-bis(iodoacetamide), N,N'-hexamethylene-bis(iodoacetamide), and the like.

Heterobifunctional linkers include amine-reactive and sulfhydryl-reactive cross-linkers, carbonyl- and sulfhydryl-reactive cross-linkers, amine-reactive and photoreactive cross-linkers, sulfhydryl-reactive and photoreactive cross-linkers, and the like. Amine-reactive and sulfhydryl-reactive cross-linkers include, for example, N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long chain N-succinimidyl 3-(2-pyridyldithio) propionate (LC-sPDP), water-soluble-long-chain N-succinimidyl 3-(2-pyridyldithio) propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-α-methyl-α -(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-α-methyl-α-(2-pyridyldithio)toluamidohexanoate (sulfo-LC-sMPT), Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC), sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo -sMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBs), m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester (sulfo-MBs), N-succinimidyl (4 -iodoacetyl)aminobenzoate (sIAB) and the like, and examples of the carbonyl-reactive and sulfhydryl-reactive crosslinker include 4-(4-N-maleimidophenyl)butyric acid hydrazide (MPBH), 4- (N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide-8 (M2C2H), 3-(2-pyridyldithio)propionyl hydrazide (PDPH), etc. are mentioned, and an amine- Reactive and photoreactive cross-linkers include, for example, N-hydroxysuccinimidyl-4-azidosalicylic acid (NHs-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylic acid (sulfo-NHs-AsA). ), sulfosuccinimidyl-(4-azidosalicylamido)hexanoate (sulfo-NHs-LC-AsA), sulfosuccinimidyl-2-(ρ-azidosalicylamido)ethyl-1 ,3'-dithiopropionate (sAsD), N-hydroxysuccinimidyl-4-azidobenzoate (HsAB), N-hydroxysulfosuccinimidyl-4-azidobenzoate (sulfo- HsAB), N -Succinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sANPAH), sulfosuccinimidyl-6-(4'-azido-2'-nitrophenylamino) hexanoate (sulfo-sANPAH), N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOs), and the like. Examples of the sulfhydryl-reactive and photoreactive cross-linker include 1-( ρ-azidosalicylamido)-4-(iodoacetamido)butane (AsIB), N-4-(ρ-azidosalicylamido)butyl-3'-(2'-pyridyldithio) and propionamide (APDP), benzophenone-4-iodoacetamide, and benzophenone-4-maleimide.

In some embodiments, the linker is a dendritic type of linker. Resin type linkers have branched, multifunctional linkers, such as, for example, PAMAM dendrimers.

In addition to the linkers exemplified above, in the art, numerous linkers applicable to the present invention are known through a significant number of documents. As such, specifically, Castaneda, et al, "Acid-cleavable thiomaleamic acid linker for homogeneous antibodydrug conjugation," Chem Commun. 49: 8187-8189 (2013), Lyon, et al, "Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates," Nat Biotechnol. 32(10):1059-1062 (2014), Dawson, et al "Synthesis of proteins by native chemical ligation," Science 1994, 266, 776-779, Dawson, et al "Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives," J Am Chem Soc. 1997, 119, 4325-4329 Hackeng, et al "Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology," Proc Natl Acad Sci USA 1999, 96, 10068-10073, Wu, et al "Building complex glycopeptides : Development of a cysteine-free native chemical ligation protocol," Angew Chem Int Ed 2006, 45, 4116-4125, Geiser et al "Automation of solid-phase peptide synthesis" in Macromolecular Sequencing and Synthesis, Alan R Liss, Inc, 1988, pp 199-218, Fields, G and Noble, R (1990) "Solid phase peptide synthesis utilizing 9-fluoroenylmethoxycarbonyl amino acids", Int J Peptide Protein Res 35:161-214 et al., U.S. Patent No. 6,884,869, U.S. Patent No. 7,498,298, U.S. Patent No. 8,288,352, U.S. Patent No. 8,609,105, U.S. Patent No. 8,697,688, U.S. Patent Publication No. 2014/0127239, U.S. Patent Publication No. 2013/028919, U.S. Patent Publication No. 2014/286970 , U.S. Patent Publication No. 2013/0309256, U.S. Patent Publication No. 2015/037360, U.S. Patent Publication No. 2014/0294851, International Patent Publication WO2015057699, International Patent Publication WO2014080251, International Patent Publication No. WO2014197854, International Patent Publication WO2014145090, International Patent publication WO2014177042 and the like may be referred to.

In the present invention, the cytotoxic anticancer agent is an antagonist of metabolism (Antimetabolites), microtubulin targeting agents (Tubulin polymerase inhibitor and tubulin depolymerisation), alkylating agents, mitosis inhibitors (Antimitotic Agents), DNA cleavage agent (DNA cleavage agent) ), DNA cross-linker agents, DNA intercalator agents, and DNA topoisomerase inhibitors. Folic acid derivatives, Purine derivatives such as Cladribine, pyrimidine derivatives such as Azacitidine, Doxifluridine, Fluorouracil and the like are known in the art, and as a microtubule targeting agent, an auristatin-based drug such as monomethylauristatin E (MMAE), monomethylauristatin F (MMAF), dolastatin, maytansines and the like are known in the art, and examples of the alkylating agent include alkyl sulfonate preparations such as Busulfan and Treosulfan, nitrogen Mustard derivatives such as Bendamustine, Platinum preparations such as Cisplatin and Heptaplatin are known in the art. In addition, as Antimitotic Agents, Taxane preparations such as Docetaxel and Paclitaxel, Vinca alkalids such as Vinflunine, and Etoposide Podophyllotoxin derivatives and the like are known in the art, and Calicheamicins are known as a DNA cleavage agent, and PBD as a DNA cross-linker agent. duplexes and the like are known. Also, as a DNA intercalator agent, doxorubicin and the like are known in the art, and as a DNA topoisomerase inhibitor, SN-28 and the like are known in the art.

The aptamer-based targeting complex anticancer agent of the present invention can be prepared in the form of particles containing the same. When the aptamer-based targeting complex anticancer agent of the present invention is prepared in the form of particles, the particles containing the aptamer-based targeting complex anticancer agent of the present invention are polymeric particles, lipid particles, solid lipid particles ( solid lipid particles), inorganic particles, or a combination thereof (eg, lipid stabilized polymeric particles). In a preferred embodiment, the particles are polymeric particles or comprise a polymeric matrix.

The particles may include one or more biodegradable polymers. A biodegradable polymer may be a water-insoluble or poorly water-soluble polymer that is converted in the body chemically or enzymatically into water-soluble substances.

The biodegradable polymer in the particle may be polyamide, polycarbonate, polyalkylene, polyalkylene glycol, polyalkylene oxide, polyalkylene terephthalate, polyvinyl halide, polyvinylpyrrolidone, polyglycolide, polysiloxane, poly urethane, a copolymer thereof, or the like.

In addition, the biodegradable polymer in the particle may be alkyl cellulose such as methyl cellulose and ethyl cellulose, hydroxyalkyl cellulose such as hydroxypropyl cellulose, cellulose ether, cellulose ester, nitro cellulose, cellulose acetate, cellulose sulfate sodium salt, and the like.

In addition, the biodegradable polymer in the particles is a polymer of acrylic acid and methacrylic acid ester such as polymethyl methacrylate, polyethyl methacrylate, polybutyl methacrylate, and polyisobutyl methacrylate, and a linear or branched copolymer thereof. , a block copolymer, or the like.

In addition, the biodegradable polymer in the particles may be polyester, polyorthoester, polyethyleneimine, polycaprolactone, polyhydroxyalkanoate, polyhydroxyvalerate, polyacrylic acid, polyglycolide, or the like.

The particles may include one or more hydrophilic polymers. Hydrophilic polymers include starch, polysaccharides, hydrophilic polypeptides, polyamino acids such as poly-L-glutamic acid (PGS) and poly-L-aspartic acid, polyalkylene glycols such as polyethylene glycol (PEG) and polypropylene glycol (PPG). , polyalkylene oxide such as polyethylene oxide (PEO), polyoxyethylated polyol, polyolefinic alcohol, and the like.

The particles may include one or more hydrophobic polymers. Hydrophobic polymers include polyhydroxy acids such as polylactic acid and polyglycolic acid, rehydroxyalkanoates such as poly3-hydroxybutyrate, polycarbonates such as polycaprolactone and tyrosine polycarbonate, polyamides, polypeptides, and polyesters amides, polyurethanes, and the like. Preferably, the hydrophobic polymer is polylactic acid, polyglycolic acid, or poly(lactic acid-co-glycolic acid).

The particles may include one or more amphoteric polymers. The amphiphilic polymer may be composed of a hydrophobic polymer block and a hydrophilic polymer block. The hydrophobic polymer block may include at least one of the hydrophobic polymer or a derivative or copolymer thereof. The hydrophilic polymer block may include at least one of the hydrophilic polymer or a derivative or copolymer thereof.

The particles may comprise one or more neutral or anionic lipids, cationic lipids, solid lipids or amphoteric compounds.

The neutral or anionic lipid may be cholesterol, phospholipid, lysolipid, pegylated lipid, phosphatidylcholine, phosphatidylserine, phosphatidylglycerol, including 1,2-diacyl-glycero-3-phosphocholine. Phingomyelin, ceramide galactopyranoside, ganglioside, 1,2-distearoylphosphatidylcholine (DSPC), 1,2-dipalmitoyl phosphatidylcholine (DPPC), 1,2-dimyristoylphosphatidylcholine (DMPC), etc. can

Examples of the cationic lipid include dimethyldioctadecyl ammonium bromide (DDAB), 1,2-diacyloxy-3-trimethylammonium propane, N-1-(2,3-dioloyloxy)propyl-N,N-dimethyl Amine (DODAP), 1,2-Diacyloxy-3-dimethylammonium propane, N-1-(2,3-dioleyloxy)propyl-N,N,N-trimethylammonium chloride (DOTMA), 1,2 -dialkyloxy-3-dimethylammonium propane, dioctadecylamidoglycylspermine (DOGS), and the like.

The solid lipids may be highly saturated alcohols, aliphatic alcohols, higher fatty acids such as stearic acid, palmitic acid and decanoic acid, sphingolipids, synthetic esters, mono-, di-, triglycerides of highly saturated fatty acids.

The amphoteric compound may be phosphatidyl choline, phosphatidyl ethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidylinositol, lysophosphatidyl derivative, cardiolipin, or the like.

The lipid particles may be liposomes, which are spherical small vesicles composed of an aqueous medium surrounded by lipids arranged in a bilayer. Liposomes contain a hydrophilic drug in an aqueous interior or a hydrophobic agent in the bilayer.

The lipid particles may be lipid micelles. Lipid micelles for drug delivery are known in the art. Lipid micelles can be formed, for example, as water-in-oil emulsions with a lipid surfactant. Lipid micelles are generally useful for delivering hydrophobic drugs.

The lipid particle may be a solid lipid particle. Solid lipid particles are formed from lipids that are solid at room temperature, and the solid lipid particles can be obtained from oil-in-water emulsions using solid lipids.

Such polymeric particles, lipid particles can be prepared by methods known in the art. For example, polymeric particles can be prepared by spray drying, interfacial polymerization, hot melt encapsulation, phase separation encapsulation (spontaneous emulsion microencapsulation, solvent evaporation microencapsulation, and solvent removal microencapsulation), coacervation, low temperature microsphere formation, phase transfer nanoencapsulation, It can be prepared by methods such as emulsion and nano-precipitation. Also, for example, the lipid particles may be prepared by a method such as a high-pressure homogenization technique, a supercritical fluid method, an emulsion method, a solvent diffusion method, spray drying, or the like. For details regarding a method for preparing such particles, reference may be made to the literature Remington's Pharmaceutical Sciences 16th edition, Osol, A. (ed.), (1980) and the like.

The size of the particles can be adjusted for the intended effect. The particles may be nanoparticles or microparticles, but nanoparticles are preferred. The particles may have a diameter of about 10 nm to about 10 μm, about 10 nm to about 1 μm, about 10 nm to about 500 nm, about 20 nm to about 500 nm, or about 25 nm to about 250 nm. In a preferred embodiment, the particles are nanoparticles having a diameter of about 25 nm to about 250 nm.

In particular, nanoparticles as a drug carrier must be large enough to not pass through normal blood vessels during blood circulation and must be small enough to avoid macrophage predation. The size of the fenestra of the sinusoid of the spleen and the Kupffer's cell located in the liver is between 150 and 200 nm, and the distance between the endothelial cells of the blood vessels distributed in the tumor is between 100 and 600 nm. . Therefore, in order to reach the tumor through these two types of characteristic vascular structures, it is preferable that the size of the nanoparticles be less than 100 nm.

In addition, when the particle has a hydrophobic surface, plasma proteins such as fibronectin, complement, and IgG are attached to the blood (opsonization), and these (opsonins) are again macrophages of the reticulo-endothelial system. As a result, nanoparticles are predated and removed. Therefore, it is desirable to make the particle surface hydrophilic, and there are two methods for making the particle surface hydrophilic. One is to cover the surface of nanoparticles with a hydrophilic polymer such as polyethylene glycol (PEG), or to use an amphiphilic block copolymer having hydrophobicity and hydrophilicity to make micellar-type nanoparticles on the surface of a hydrophilic polymer is to be located.

The aptamer-based targeting complex anticancer agent of the present invention may be mixed with a pharmaceutically acceptable carrier and formulated in a lyophilized form or in the form of an aqueous solution. A pharmaceutically acceptable carrier is a component that does not inhibit the efficacy, biological activity or properties of the aptamer-based targeting complex anticancer agent of the present invention, which is an active ingredient, at the content or concentration included in the formulation of the present invention, for example, phosphate, citrate buffers containing organic acids such as, antioxidants such as ascorbic acid and methionine, octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as Preservatives such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol; proteins such as serum albumin, gelatin, or immunoglobulin; polymers such as polyvinylpyrrolidone; Amino acids such as glycine, glutamine, asparagine, histidine, arginine, and lysine, sugars such as glucose, mannose, sucrose, mannitol, trehalose, sorbitol, and dextrin, chelating agents such as EDTA (ethylenediaminetetraacetic acid), polyethylene glycol (PEG) It may be a surfactant, such as these. In particular, acceptable pharmaceutical carriers in compositions such as injections formulated as liquid solutions include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and the like.

The carrier is not particularly limited thereto, but in the case of oral administration, a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersing agent, a stabilizer, a suspending agent, a coloring agent, a flavoring agent, etc. can be used, and in the case of an injection, a buffer, A preservative, an analgesic agent, a solubilizer, an isotonic agent, a stabilizer, etc. can be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. can be used.

The formulation of the composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it may be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like, and in the case of injections, it may be prepared in the form of unit dose ampoules or multiple doses. In addition, it can be formulated as a solution, suspension, tablet, pill, capsule, sustained release formulation, and the like.

Examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used. In addition, it may further include a filler, an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, a preservative, and the like.

In addition, the pharmaceutical composition of the present invention can be prepared according to a conventional method for tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, and freeze-drying, respectively. It may have any one formulation selected from the group consisting of formulations and suppositories.

In addition, the composition is formulated in a dosage form suitable for administration in a patient's body according to a conventional method in the pharmaceutical field, preferably a formulation useful for administration of a peptide drug, and is administered conventionally in the art. Oral, or dermal, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, pulmonary, transdermal, subcutaneous, intraperitoneal, intranasal, gastrointestinal, topical, sublingual, intravaginal or It may be administered by parenteral routes of administration including, but not limited to, rectal routes.

In addition, the aptamer-based targeting complex anticancer agent of the present invention can be used by mixing with several acceptable carriers such as physiological saline or organic solvents, and with glucose, sucrose or dextran to increase stability or absorption. Antioxidants such as carbohydrates, ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers can be used as pharmaceuticals.

Formulation of pharmaceutical compositions is known in the art, and specifically, reference may be made to Remington's Pharmaceutical Sciences (19th ed., 1995) and the like.

A preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001 mg/kg to 10 g/kg per day, preferably 0.001 mg/kg to 1 g, depending on the patient's condition, weight, sex, age, severity of the patient, and the route of administration. It can be in the range /kg. Administration may be performed once or divided into several times a day. These dosages should not be construed as limiting the scope of the invention in any respect.

As described above, according to the present invention, it is possible to provide an aptamer-based targeting complex anticancer agent that can be administered in combination by including two or more types of anticancer agents in combination and can reduce the side effects of anticancer drugs by selectively acting only on target cancer cells.

1 is a 40k PEG-ApGemHER2-SS-DM1 (A) reaction solution, HPLC (High Performance Liquid Chromatography) was performed and separation was performed using Eclipse XDB-C18 column, binding buffer (95% 0.1M TEAA, This is the result of separation through the gradient of 5% Acetonitrile) and elution buffer (50% 0.1M TEAA, 50% Acetonitrile) (a), and among them, the peak (fraction) matching the 40k PEG-ApGemHER2-SS-DM1(A) structure The process (b) of separating 6~9) is shown.
2 shows the results of analysis of the prepared 40k PEG-ApGemHER2-SH and purified 40k PEG-ApGemHER2-SS-DM1 on a 10% (19:1) polyacrylamide gel (a) and the prepared 40k PEG-ApGemHER2-SH and UV/Vis spectra of 1 mg of purified 40k PEG-ApGemHER2-SS-DM1 (A) (b) are shown.
3 is a result of analyzing the quality and size of the prepared 40k PEG-ApFdUEpCAM-SH and purified 0k PEG-ApFdUEpCAM-SS-DM1(B) on a 10% (19:1) polyacrylamide gel containing 7M urea. is shown.
Figure 4 is the result of analyzing the quality and size of 40k PEG-ApGemHER2-SH and 40k PEG-ApGemHER2-SS-SL region-NH ₂ (C) on a 10% (19:1) polyacrylamide gel containing 7M urea. is shown.
5 is a result of High Performance Liquid Chromatography (HPLC) of the complex 40k PEG-ApFdUEpCAM-SS-SL region-NH ₂ prepared by reacting the HS-SL region-NH _{2 with 40k PEG-ApFdUEpCAM-SH.}
6 shows the quality and size of 40k PEG-ApGemHER2-SS-SL region-SH and purified 40k PEG-ApGemHER2-SS-SL region-SS-DM1(D) with 7M urea at 10% (19:1) The results of analysis on polyacrylamide gel are shown.
7 shows the quality and size of 40k PEG-ApGemHER2-SS-SL region-SH and 40k PEG-ApGemHER2-SS-SL region-SS-DM1(E) 10% (19:1) polyacrylic containing 7M urea. The results of analysis on amide gel are shown.
8 shows 40k PEG-ApFdUEpCAM-SH, 40k PEG-ApGemHER2-SH and 40k PEG-ApGemHER2-SS-ApFdUEpCAM-40k PEG(F) and also ApGemHER2-SS-ApFdUEpCAM and 40k PEG-ApGemHER2-SS-ApFdUEpCAM-40k PEG-ApGemHER2-SS-ApFdUEpCAM-40k PEG-ApFdUEpCAM-SH. (F) is the result of analysis on a 10% (19:1) polyacrylamide gel containing 7M urea.
9 shows 40K PEG, ApGemHER2-SS-ApFdUEpCAM, and 40k PEG-ApGemHER2-SS-ApFdUEpCAM-40k PEG(F) reaction solutions were separated by High Performance Liquid Chromatography (HPLC) using Eclipse XDB-C18 column. And, it shows the result of separation through the gradient of the binding buffer (95% 0.1M TEAA, 5% Acetonitrile) and the elution buffer (50% 0.1M TEAA, 50% Acetonitrile).
10 is a separate and purified 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM-SS-DM1 (G), 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM-SS-PTX (H), 40k PEG -ApGemHER2-SS-SL region-SS-ApFdUEpCAM-SS-MMAE(I) and 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM-SS-MMAF(J) were analyzed by performing HPLC. .
11 shows the results of observing the quenching phenomenon according to the amount of DOX using 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM-SS-MMAE(H).
12 shows the results of observing cell viability by treating MDA-MB-453 cells overexpressing HER-2 and EpCAM with customized therapeutic molecules A, B, C, D and E.
13 shows the results of observation of cell viability in MDA-MB-453 cells overexpressing HER-2 and EpCAM by treatment with F, G, H, I and J customized therapeutic molecules.
14 and 15 show 40k PEG-ApGemHER2-SS-DM1 (A) and 40k PEG-ApFdUEpCAM-SS-DM1 (B) when DM1 as a control group and as a comparison group were administered alone according to the drug administration time schedule (FIG. 14 a) ), and mixed administration of MDA-MB-453 overexpressing HER-2 and EpCAM (FIG. 14b), and MDA-MB-231 not expressing HER2 and EpCAM (FIG. 15) of the mixed drug A and B. a) and MCF-71 overexpressing EpCAM without expressing HER2 (FIG. 15 b) is the result of observing tumor growth by administering to the transplanted mice.

Hereinafter, the present invention will be described with reference to Examples. However, the scope of the present invention is not limited to these examples.

<Example 1> Preparation of constituent molecules for the preparation of an aptamer-based targeting complex anticancer drug

In this example, the following 10 aptamer-based targeting complex anticancer drugs were prepared.

(1) 40k PEG-ApGemHER2-S-S-DM1 (A),

(2) 40k PEG-ApFdUEpCAM-S-S-DM1 (B),

(3) 40k PEG-ApGemHER2-S-S-SL region (C),

(4) 40k PEG-ApGemHER2-S-S-SL region-S-S-DM1 (D),

(5) 40k PEG-ApFdUEpCAM-S-S-SL region-S-S-DM1 (E),

(6) 40k PEG-ApGemHER2-S-S-ApFdUEpCAM-40k PEG(F);

(7) 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-DM1 (G),

(8) 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-PTX(H),

(9) 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-MMAE(I) and

(10) 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-MMAF(J)

The aptamer-based targeting complex anticancer agent was first prepared by preparing its constituent molecules as follows, and combining these constituent molecules.

(i) HER2 RNA aptamer containing 2'F-Pyrimidine and Gemcitabine as components, 40k PEG at its 5' end, and a thiol group at its 3' end (- SH group) is added to '40k PEG-ApGemHER2-SH', (ii) a thiol group at one end of a small-sized DNA fragment (SL region) having a hairpin structure (stem-loop structure), and NH _{2 at the other end} Added 'SH-SL region-NH ₂ ', (iii) as an EpCAM RNA aptamer comprising 2'F-pyrimidine and 5-FdU (5-Fluorouracil) as components, 40k PEG at the 5'end; _{As an EpCAM RNA aptamer comprising 'SH-ApFdUEpCAM-NH 2} ', (iv) 2'F-pyrimidine and 5-FdU(5-Fluorouracil) with a thiol group added to the 3' end, the 5 'SH-ApFdUEpCAM-NH ₂ ' with a thiol group at the 'end and -NH ₂ at the 3' end was custom-made (Biosynthesis, USA).

Chemical structural formulas of the four constituent molecules are shown below.

(i) 40k PEG-ApGemHER2-SH:

5'-PEG-AGC CGC GAG GGG AGG GAA GGG TAG GGC GCG GCT-SH-3'

Gemcitabine is inserted in place of C in all of the above positions

(ii) SH-SL region-NH ₂ :

5'-SH-GCG CGC GCG AAA GCG CGC GC-NH ₂ -3'

(iii) 40k PEG-ApFdUEpCAM-SH:

5'-PEG-GGC GAC UGG UUA CCC GGU CG-SH-3'

5-FdU is inserted in place of U in all of the above positions

(iv) SH-ApFdUEpCAM-NH ₂ :

5'-SH-GGC GAC UGG UUA CCC GGU CG-NH ₂ -3'

5-FdU is inserted in place of U in all of the above positions

100 μmol of each of the components prepared above was reacted with 10 μL of 1.0 M dithiothreitol (DTT) in 0.1 M triethylammonium acetate (TEAA) buffer for 15 minutes at room temperature to activate 5' or 3' terminal thiol groups, and also to remove excess DTT To do this, it was extracted three or more times using ethyl acetate. The custom-made components were dissolved in dimethyl sulfoxide (DMSO) to prepare a 10 mM stock.

In this example, the HER2 aptamer and the EpCAM aptamer are the HER2 aptamers that target HER2, which are disclosed in Table 2 above (Varmira K. et al., Nucl Med Biol. 2013 Nov; 40(8):980-6). and EpCAM aptamer (Subramanian N, et al. (2015). PLoS ONE 10(7): e0132407. doi: 10.1371/journal.pone.0132407) were used.

In this example, gemcitabine and 5-FdU (2'-deoxy-5-fluoro-uridine) were used as nucleoside-like anticancer agents integrated into the aptamer, and doxorubicin was used as the intercalator anticancer agent. As general cytotoxic anticancer agents, PTX (Paclitaxel), MMAE (monomethyl auristatin E), MMAF (monomethyl auristatin F), and DM1 (Mertansine) were used.

Gemcitabine is a chemotherapy drug used for the treatment of various types of cancer such as breast cancer, ovarian cancer, non-small cell lung cancer, pancreatic cancer and bladder cancer. It is hydrophilic and is transported into cells to become nucleosides. After entering the cell, gemcitabine is phosphated by DCK (deoxycytidine kinase) enzymatic action to form gemcitabine monophosphate (dFdCMP), followed by two other phosphates added by different enzymatic actions. It is a pharmacologically active form of gemcitabine triphosphate (dFdCTP) to which three phosphates are added.

After being phosphorylated three times, gemcitabine functions as cytidine and can be incorporated into new DNA strands synthesized during cell replication. When gemcitabine is incorporated into DNA, one more nucleotide is added and the DNA polymerase process stops (this action is called "masked chain termination"). Because gemcitabine is a defective base, abnormalities in the cell's normal repair system occur, so when gemcitabine is incorporated into the cell's DNA, an irreversible error occurs, inhibiting further DNA synthesis, resulting in cell death.

A form of gemcitabine with two phosphates attached (dFdCDP) is also active. It inhibits the enzyme ribonucleotide reductase (RNR), which is required to produce new nucleotides.

Side effects of gemcitabine include bone marrow suppression, liver and kidney problems, nausea, fever, rash, shortness of breath, mouth sores, diarrhea, neuropathy, and hair loss. If used during pregnancy, it may be harmful to the baby. It can cause retroreversible encephalopathy syndrome, which can lead to capillary leak syndrome, and can lead to serious lung conditions such as pulmonary edema, pneumonia and adult respiratory distress syndrome, and can even harm sperm.

Floxuridine (or 5-fluorodeoxyuridine) is an antimetabolites and is a pyrimidine analogue classified as deoxyuridine. Phloxuridine is a prodrug that is rapidly metabolized to 5-Fluorouracil in vivo.

Phloxuridine inhibits thymidylate synthase (EC ₅₀ = 0.6 nM), thereby inhibiting DNA synthesis during the S phase of the cell cycle. Because phloxuridine acts as an inhibitor of the S-phase of the cell cycle, it selectively kills rapidly dividing cells.

Phloxuridine is degraded to 5-fluorouracil, the active form of the drug, thereby inhibiting DNA synthesis and partially inhibiting RNA synthesis. 5-Fluorouracil inhibits uracil riboside phosphorylase, preventing the use of preformed uracil in RNA synthesis. In addition, floxuridine monophosphat e of FUDR-MP (5-fluoro-2'-deoxyuridine-5-phosphate) inhibits thymidylate synthase to deoxyuridylic acid (deoxyuridylic acid). It inhibits the methylation of thymidylic acid to thymidylic acid, thereby interfering with DNA synthesis.

Phloxuridine mainly kills cancer cells by inhibiting the growth of new and rapidly growing cells that are characteristic of cancer cells.

Phloxuridine is most often used for colorectal cancer treatment, and the quality of life and survival rates of patients receiving continuous hepatic artery infusion of floxuridine for colorectal cancer metastasis were significantly higher than those of the control group. Phloxuridine is also used to treat kidney and stomach cancer.

In this example, doxorubicin was used as an intercalator anticancer agent that intercalates in the double-stranded stem region of a single-stranded nucleic acid having a stem loop structure.

Doxorubicin is a chemotherapy drug used to treat cancer, used in breast cancer, bladder cancer, Kaposi's sarcoma, lymphoma, and acute lymphoblastic leukemia.

Doxorubicin is an anthracycline drug that ultimately inhibits the DNA replication process by inhibiting the activity of topoisomera II, an enzyme that breaks into DNA and relaxes the supercoil of DNA. Doxorubicin also induces cytotoxicity by increasing the production of free radicals in the form of quinones.

Side effects of doxorubicin include hair loss, bone marrow suppression, vomiting, rashes, and inflammation. Other serious side effects may include allergic reactions such as anaphylaxis, heart damage, tissue damage at the injection site, radiation recovery and treatment-related leukemia, and you may experience a reddish discoloration of your urine for several days. The most dangerous side effect of doxorubicin is dilated cardiomyopathy, which results in congestive heart failure, in which all four ventricles are dilated. This results in both systolic and diastolic dysfunction. As a result, a heart attack with a mortality rate of 50% can occur.

In this embodiment, in addition to the nucleoside-like anticancer agent and the intercalator anticancer agent, mertansine (DM1), paclitaxel (PTX), monomethyl auristatin E (Monomethyl) as anticancer agents for increasing cytotoxicity to cancer cells auristatin E, MMAE) and monomethyl auristatin F (MMAF) were used.

Mertansine (DM1) is a tubulin inhibitor and binds to a rhizoxin binding site of tubulin to inhibit the assembly of microtubules. Since mertansine contains a thiol group (thiol-containing maytansinoid), it is attached to a monoclonal antibody through a linker and is used to generate an antibody-drug conjugate (ADC). Examples of such ADCs include Trastuzumab emtansine (T-DM1), Lorvotuzumab mertansine (IMGN901), and Cantuzumab mertansine (huC242-DM1). These ADCs selectively induce mertansine to exhibit cytotoxicity by targeting cancer cells having a target molecule recognized by an antibody, such as trastuzumab.

Paclitaxel (Paclitaxel, PTX) is an anti-microtubule agent classified as a taxane together with docetaxel as plant alkaloids. This drug inhibits the proliferation of cancer cells by interfering with the separation of microtubules, crucial for cell division, during cell division. Currently, it is used in the treatment of ovarian cancer, breast cancer, non-small cell lung cancer, and epithelial cell carcinoma of the skin.

Side effects of paclitaxel include nausea and vomiting, loss of appetite, taste changes, epilepsy or brittle hair, pain in the joints of your arms or legs that lasts for two to three days, changes in the color of your nails, tingling in your hands, Serious side effects such as abnormal bruising or bleeding, pain at the injection site, redness or swelling, hand-foot syndrome, changes in normal bowel habits for more than 2 days, fever, chills, cough, sore onset, sore throat, difficulty swallowing, dizziness, difficulty breathing, Severe fatigue, skin rashes, hot flashes, female infertility due to ovarian damage, and chest pain can occur. Neuropathy may also occur.

MMAE (Monomethyl auristatin E) is desmethyl-auristatin E, a synthetic antitumor agent, and an antimitotic agent that inhibits cell division by blocking the polymerization of tubulin. MMAE conjugated to a monoclonal antibody (MAb) via a linker is stable in extracellular fluid, but once the conjugate enters the tumor cells, it is cleaved by cathepsin to activate the anti-mitotic mechanism.

MMAF (Monomethyl auristatin F) is a synthetic antitumor agent, a drug that forms an experimental antibody drug conjugate such as SGN-75 (Vorsetuzumab mafodotin) and SGN-CD19A (Denintuzumab Mafodotin). MMAF is an anti-mitotic agent that inhibits cell division by blocking the polymerization of tubulin. It binds to antibodies with high affinity to the structure of cancer cells, allowing MMAF to accumulate in those cells.

<Example 2> Preparation of 40k PEG-ApGemHER2-S-S-DM1 (A), 40k PEG-ApFdUEpCAM-S-S-DM1 (B) and 40k PEG-ApGemHER2-S-S-SL region (C) based on aptama-based targeting complex anticancer drug

40k PEG-ApGemHER2-SH or 40k PEG-ApFdUEpCAM-SH and DM1, which are the components made to order above, are 1:1 in 100mM potassium phosphate buffer (pH 7.0) containing 50% DMSO and 2mM ethylenediaminetetraacetic acid (EDTA). The mixture was mixed in a molar ratio and reacted at room temperature for 48 hours to form a complex.

The 40k PEG-ApGemHER2-S-S-DM1 reaction solution thus prepared was purified by High Performance Liquid Chromatography (HPLC). Separation was carried out using Eclipse XDB-C18 column, and it was separated through the gradient of binding buffer (95% 0.1M TEAA, 5% Acetonitrile) and elution buffer (50% 0.1M TEAA, 50% Acetonitrile) (Fig. 1). a). HPLC peaks were analyzed by mass spectroscopy, and among them, only peaks consistent with the 40k PEG-ApGemHER2-S-S-DM1 structure were taken and used in the experiments of the following examples (FIG. 1 b).

The quality and size of the prepared 40k PEG-ApGemHER2-SH and purified 40k PEG-ApGemHER2-SS-DM1(A) were analyzed on a 10% (19:1) polyacrylamide gel containing 7M urea (Fig. 2). a). In addition, 1 mg of each of the prepared 40k PEG-ApGemHER2-SH and purified 40k PEG-ApGemHER2-S-S-DM1 was subjected to UV/Vis spectra (FIG. 2b).

40k PEG-ApFdUEpCAM-SH and the prepared 40k PEG-ApFdUEpCAM-S-S-DM1 were analyzed on a 10% (19:1) polyacrylamide gel containing 7M urea (Fig. 3).

40k PEG-ApGemHER2-SS-SL region -NH ₂ (C) is a thiol group by reaction of both materials the 40k PEG-ApGemHER2-SH and SH-SL region -NH ₂ by the order prepared by the reaction conditions and the (- SH) were prepared by inducing disulfide bonds between them and analyzed on a 10% (19:1) polyacrylamide gel containing 7M urea (Fig. 4).

<Example 3> Preparation of 40k PEG-ApGemHER2-S-S-SL region-S-S-DM1 (D) and 40k PEG-ApFdUEpCAM-S-S-SL region-S-S-DM1 (E)

(1) 40k PEG-ApGemHER2-S-S-SL region-NH ₂ with 40k PEG-ApFdUEpCAM-S-S-SL region-NH ₂ manufacture of

40k PEG-ApGemHER2-SS-SL region-NH ₂ was prepared as in Example 2.

For the preparation of 40k PEG-ApFdUEpCAM-SS-SL region-NH ₂ , 40k PEG-ApFdUEpCAM-SH and SH-SL region-NH _{2 prepared above} were included in 50% DMSO and 2 mM ethylenediaminetetraacetic acid (EDTA). In a 100 mM potassium phosphate buffer (pH 7.0), 1:1 at room temperature for 48 hours to form a complex.

The 40k PEG-ApFdUEpCAM-SS-SL region-NH ₂ reaction solution thus prepared was purified by High Performance Liquid Chromatography (HPLC). Separation was carried out using Eclipse XDB-C18 column, and it was separated through the gradient of binding buffer (95% 0.1M TEAA, 5% Acetonitrile) and elution buffer (50% 0.1M TEAA, 50% Acetonitrile). HPLC peaks were analyzed through mass spectroscopy, and among them, _{only peaks consistent with the 40k PEG-ApFdUEpCAM-SS-SL region-NH 2} structure were taken and used in the experiments of the following examples (FIG. 5).

(2) Preparation of 40k PEG-ApGemHER2-S-S-SL region-SH and 40k PEG-ApFdUEpCAM-S-S-SL region-SH

40k PEG-ApGemHER2-SS-SL region-SH and 40k PEG-ApFdUEpCAM-SS-SL region-SH from 40k PEG-ApGemHER2-SS-SL region- _{NH 2} or 40k PEG-ApFdUEpCAM-SS-SL region-NH ₂ Preparation was performed as follows using SPDP ((succinimidyl 3-(2-pyridyldithio)propionate)) and DTT (dithiothreitol), which are linkers that convert an amine group (-NH _{2 ) into a thiol group (-SH).}

Specifically, immediately before use of the prepared 40k PEG-ApGemHER2-SS-SL region-NH ₂ or 40k PEG-ApFdUEpCAM-SS-SL region-NH ₂ , 2mg SPDP (USA, Pierce Biotechnology) was dissolved in 320 μL DMSO and 20 mM SPDP reagent solution was prepared. Dissolve 2-5 mg of 40k PEG-ApGemHER2-SS-SL region-NH ₂ or 40k PEG-ApFdUEpCAM-SS-SL region-NH ₂ in 1.0 mL PBS-EDTA, add 25 μL of 20 mM SPDP solution, and The reaction was carried out for 30 minutes. The desalting column was equilibrated with PBS-EDTA, and the buffer was exchanged to remove reaction by-products and excess unreacted SPDP reagent.

23mg DTT was dissolved in PBS-EDTA to make a 150mM DTT solution. A thiol group was introduced by adding 0.5 mL DTT solution per 1 mL of the SPDP-modified reaction solution (final concentration 50 mM DTT) and reacting for 30 minutes. The desalting column was equilibrated with PBS-EDTA, and the reaction solution was desalted to remove DTT.

The desalted 40k PEG-ApGemHER2-S-S-SL region-SH or 40k PEG-ApFdUEpCAM-S-S-SL region-SH structure was dissolved in dimethyl sulfoxide (DMSO) to prepare 10 mM stock.

(3) Preparation of 40k PEG-ApGemHER2-S-S-SL region-S-S-DM1 (D) and 40k PEG-ApFdUEpCAM-S-S-SL region-S-S-DM1 (E)

The prepared 40k PEG-ApGemHER2-S-S-SL region-SH or 40k PEG-ApFdUEpCAM-S-S-SL region-SH construct and DM1 were reacted as in Example 2 to induce a disulfide bond to form a complex. The finally obtained 40k PEG-ApGemHER2-SS-SL region-SS-DM1(D) or 40k PEG-ApFdUEpCAM-SS-SL region-SS-DM1(E) reaction solution was separated in the same manner as in Example 2 above. Purified.

The quality and size of the prepared 40k PEG-ApGemHER2-SS-SL region-SH and purified 40k PEG-ApGemHER2-SS-SL region-SS-DM1(D) were 10% (19:1) poly containing 7M urea. analyzed on an acrylamide gel (Fig. 6).

The quality and size of the prepared 40k PEG-ApFdUEpCAM-SS-SL region-SH and purified 40k PEG-ApFdUEpCAM-SS-SL region-SS-DM1(E) were 10% (19:1) poly containing 7M urea. analyzed on an acrylamide gel (Fig. 7).

<Example 4> Preparation of 40k PEG-ApGemHER2-S-S-ApFdUEpCAM-40k PEG (F)

The 40k PEG-ApGemHER2-SH and 40k PEG-ApFdUEpCAM-SH made to order above were prepared in a molar ratio of 1:1 in 100mM potassium phosphate buffer (pH 7.0) containing 50% DMSO and 2mM ethylenediaminetetraacetic acid (EDTA) at room temperature. A 40k PEG-ApGemHER2-SS-ApFdUEpCAM-40k PEG(F) complex was formed by reaction for 48 hours.

40k PEG-ApGemHER2-SH, 40k PEG-ApFdUEpCAM-SH and 40k PEG-ApGemHER2-SS-ApFdUEpCAM-40k PEG(F) thus prepared were analyzed on 10% (19:1) polyacrylamide gels containing 7M urea. (FIG. 8 a). ApGemHER2-SS-ApFdUEpCAM and 40k PEG-ApGemHER2 obtained by inducing disulfide bonds by reacting custom-made ApGemHER2-SH (Biosynthesis, USA) and custom-made ApFdUEpCAM-SH (Biosynthesis, USA) under the same reaction conditions as above. -SS-ApFdUEpCAM-40k PEG(F) was analyzed on a 10% (19:1) polyacrylamide gel containing 7M urea (Fig. 8b). 40K PEG (SigmaAldrich, USA), ApGemHER2-S-S-ApFdUEpCAM, and 40k PEG-ApGemHER2-S-S-ApFdUEpCAM-40k PEG(F) reaction solutions were purified by High Performance Liquid Chromatography (HPLC). Separation was carried out using Eclipse XDB-C18 column, and it was separated through the gradient of binding buffer (95% 0.1M TEAA, 5% Acetonitrile) and elution buffer (50% 0.1M TEAA, 50% Acetonitrile) (FIG. 9) .

<Example 5> Preparation of 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-DM1 (G)

For the preparation of 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM-SS-DM1 (G) in this example, the amine group (NH _{2 ) of SH-ApFdUEpCAM-NH 2} is converted to a thiol group (SH) and reacted with DM1 to prepare SH-ApFdUEpCAM-SS-DM1, which was then reacted with 40k PEG-ApGemHER2-SS-SL region-SH prepared in Example 3 above.

SH-ApFdUEpCAM-SH was prepared by the method described in Example 3 using SPDP ((succinimidyl 3-(2-pyridyldithio)propionate)) and DTT (dithiothreitol) in SH-ApFdUEpCAM-NH _{2 prepared above.} And this was reacted with DM1 as in Example 2 to induce disulfide bonds to prepare SH-ApFdUEpCAM-SS-DM1.

This was reacted with 40k PEG-ApGemHER2-SS-SL region-SH prepared in Example 3 as in Example 2 to induce disulfide bonds to induce 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM-SS- A DM1(G) complex was formed. The finally obtained 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-DM1(G) reaction solution was isolated and purified in the same manner as in Example 2 (FIG. 10a).

<Example 6> Preparation of 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-PTX(H)

For the production of 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM-SS-PTX(G) in this example, first, PTX-SS-ApFdUEpCAM-NH _{2 from SH-ApFdUEpCAM-NH 2} After preparing PTX-SS-ApFdUEpCAM-SH, the PTX-SS-ApFdUEpCAM-SH was then reacted with the 40k PEG-ApGemHER2-SS-SL region-SH prepared in Example 3 above.

(1) PTX-S-S-ApFdUEpCAM-NH ₂ manufacture of

The PTX-SS-ApFdUEpCAM-NH ₂ is, first, a maleimide functional group reactive with a thiol group is introduced into PTX (Paclitaxel, Sigma-Aldrich Inc., USA) using a linker (4-Maleimidobutyric acid), and the Next, it was prepared by reacting with the custom-made SH-ApFdUEpCAM-NH _{2 .}

① Synthesis of Maleimide-Introduced PTX

PTX 1g (1.17mmol, 1 eq), 4-Maleimidobutyric acid 210 mg (1.17mmol, 1eq), dimethylaminopyridine (DMAP) 140mg (2.34mmol, 2eq), dicyclohexylcarbodiimide (DCC) 480mg (1.17) mmol, 1eq) was put in a 100ml round flask, and 50ml of methylene chloride was added thereto, followed by stirring at room temperature to react.

The progress of the reaction was observed using TLC (Thin Layer Chromatography) method, and when the reaction was completed, 50 ml of distilled water (DW) was added and shaken (Work up). (Rf Value = 0.43, Hexane: Ethyl acetate = 1:1)

After the organic solvent layers were collected, moisture was removed with magnesium sulfide, and separated using silica gel column chromatography (Hexane: Ethyl acetate = 1: 1), silica gel column chromatography was performed. The obtained material was concentrated to obtain 620 mg of a compound of PTX into which maleimide was introduced.

② Preparation of PTX-SS-ApFdUEpCAM-NH ₂

After dissolving the synthesized maleimide-introduced PTX in 1ml DMSO at 20mM, the prepared SH-ApFdUEpCAM-NH ₂ was mixed in a molar ratio of 1:1.5-5. After adding 2 to 3 drops of DIPEA (Diisopropyl ethyl amine), it was reacted in Vortex for 5 minutes. The completion of the reaction was confirmed with Elman's reagent, and when the yellow color disappeared, cooled diethyl ether was added to the obtained mixture, and then the obtained compound was precipitated by centrifugation. After purification by Prep-HPLC, the molecular weight was confirmed by LC/MS and frozen to make a powder.

(2) Preparation of PTX-S-S-ApFdUEpCAM-SH

Preparation of the _{PTX-SS-ApFdUEpCAM-NH 2} PTX-SS-ApFdUEpCAM-SH is the linker, which was converted to the thiol group (-SH) an amine group (-NH ₂₎ as shown in Example 3 SPDP ((succinimidyl 3-(2-pyridyldithio)propionate)) was used together with DTT (dithiothreitol), and it was carried out as follows.

Specifically, a 20 mM SPDP reagent solution was prepared by dissolving 2 mg SPDP (USA, Pierce Biotechnology) in 320 μL DMSO. _{2-5mg of PTX-ApFdUEpCAM-NH 2} was dissolved in 1.0mL PBS-EDTA, and 25μL of 20mM SPDP solution was added thereto, followed by reaction at room temperature for 30 minutes. The desalting column was equilibrated with PBS-EDTA, and the buffer was exchanged to remove reaction by-products and excess unreacted SPDP reagent.

23mg DTT was dissolved in PBS-EDTA to make a 150mM DTT solution. A thiol group was introduced by adding 0.5 mL DTT solution per 1 mL of the SPDP-modified reaction solution (final concentration 50 mM DTT) and reacting for 30 minutes. The desalting column was equilibrated with PBS-EDTA, and the reaction solution was desalted to remove DTT.

(3) Preparation of 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-PTX(H)

The prepared PTX-SS-ApFdUEpCAM-SH was reacted with the 40k PEG-ApGemHER2-SS-SL region-SH prepared in Example 3 as in Example 2 to induce a disulfide bond to form a complex. The finally obtained 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM - SS-PTX(H) construct was isolated and purified in the same manner as in Example 2 ( FIG. 10 b ).

<Example 7> Preparation of 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-MMAE(I) and 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-MMAF(J)

For the preparation of 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM-SS-MMAE(I) and 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM-SS-MMAF(J) in this example, First, MMAE-SS-ApFdUEpCAM-NH ₂ and MMAF-SS-ApFdUEpCAM-NH ₂ were prepared from the custom-made HS-ApFdUEpCAM-NH ₂ , and then MMAE-SS-ApFdUEpCAM-SH and MMAF-SS-ApFdUEpCAM-SH After preparing , the MMAE-SS-ApFdUEpCAM-SH and MMAF-SS-ApFdUEpCAM-SH were then reacted with the 40k PEG-ApGemHER2-SS-SL region-SH prepared in Example 3.

(1) MMAE-S-S-ApFdUEpCAM-NH ₂ and MMAF-S-S-ApFdUEpCAM-NH ₂ manufacture of

Auristatin maleimidecaproyl-valine-citrulline-p-aminobenzylcarbamate-MMAE (maleimidecaproyl-valine-citrulline-p-aminobenzylcarbamate-MMAE) or maleimidocaproyl-MMAF (Levena Biopharma, San Diego, CA) was added to 1 ml DMSO at a concentration of 20 mM, and PBS with 1.5-5 times 2 mM EDTA was added to the custom-made SH-ApFdUEpCAM-NH ₂ .

After adding 2 to 3 drops of DIPEA (Diisopropyl ethyl amine), it was reacted in Vortex for 5 minutes. The completion of the reaction was confirmed with Elman's reagent, and when the yellow color disappeared, cooled diethyl ether was added to the obtained mixture, and then the obtained compound was precipitated by centrifugation. Excess drug was removed by desalting with PBS using an Amicon Ultra 10k spin column, purified by Prep-HPLC, molecular weight was confirmed by LC/MS, and frozen to make a powder. Analytical efficiency was confirmed by analytical HPLC and proceeded with 99% purity.

(2) Preparation of MMAE-S-S-ApFdUEpCAM-SH and MMAF-S-S-ApFdUEpCAM-SH

Preparation of MMAE-SS-ApFdUEpCAM-SH and MMAF-SS-ApFdUEpCAM-SH in MMAE-SS-ApFdUEpCAM-NH ₂ and MMAF-SS-ApFdUEpCAM-NH _{2 and amine group (-NH 2} ) as in Example 3 SPDP ((succinimidyl 3-(2-pyridyldithio)propionate)), a linker that converts the thiol group (-SH), was performed as follows using DTT (dithiothreitol) together.

Specifically, a 20 mM SPDP reagent solution was prepared by dissolving 2 mg SPDP (USA, Pierce Biotechnology) in 320 μL DMSO. 2-5 mg of the prepared MMAE or MMAF-SS-ApFdUEpCAM-NH ₂ dissolved in 1.0 mL PBS-EDTA was added to 25 μL of a 20 mM SPDP solution and reacted at room temperature for 30 minutes. The desalting column was equilibrated with PBS-EDTA, and the buffer was exchanged to remove reaction by-products and excess unreacted SPDP reagent.

23mg DTT was dissolved in PBS-EDTA to make a 150mM DTT solution. A thiol group was introduced by adding 0.5 mL DTT solution per 1 mL of the SPDP-modified reaction solution (final concentration 50 mM DTT) and reacting for 30 minutes. Using an Amicon Ultra 10kD spin column (Millipore, Billerica, MA), PBS + 2mM EDTA was exchanged, equilibrated with PBS-EDTA, and the reaction solution was desalted to remove DTT.

(3) Preparation of 40k PEG-ApGemHER2-S-S-SL Region-S-S-ApFdUEpCAM-S-S-MMAE(I) and 40k PEG-ApGemHER2-S-S-SL Region-S-S-ApFdUEpCAM-S-S-MMAF(J)

The 40k PEG-ApGemHER2-SS-SL region-SH structure obtained in Example 3 and the MMAE-SS-ApFdUEpCAM-SH and MMAF-SS-ApFdUEpCAM-SH prepared above were carried out as in Example 2 to form a complex. formed. The finally obtained 40k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM - SS-MMAE(I) construct and k PEG-ApGemHER2-SS-SL region-SS-ApFdUEpCAM - SS-MMAE or MMAF(J) construct are described above. Separation and purification were carried out in the same manner as in Example 2 (FIG. 10 c and d).

<Example 8> Preparation of aptamer-based targeting complex anticancer drug bound to doxorubicin

Doxorubicin (DOX) was loaded on 40k PEG-ApGemHER2-S-S-SL region-S-S-ApFdUEpCAM-S-S-MMAE(I) having a hairpin structure (SL region) prepared above.

Doxorubicin (DOX, 500 μM), the prepared construct (H) (20 μM), and formaldehyde (0.37%) were cultured in a reaction buffer (20 mM sodium phosphate, 150 mM NaCl, 0.5 mM, EDTA, pH 7.0) to load doxorubicin. An aptamer-based targeting complex anticancer drug (“DOX/I”) was prepared at 10° C. for 12 hours.

The resulting DOX/I was subjected to reverse-phase high-performance liquid chromatography (HPLC) on a C-18 column using 0.1 M trithylamine acetate (TEAA, Glen Research Corp.) and acetonitrile (ProStar, Varian, Walnut Creek, CA, USA) (Sigma Aldrich, St. Louis, MO) was used as the eluent.

Purified samples were freeze-dried, desalted and treated in Dulbecco's buffer (Sigma Aldrich) and then stored at -20°C for future use. For drug quantification by UV-Vis spectrometry, a ^{molar extinction coefficient of 11,500 M -1} cm ^{-1 at 480 nm for free DOX and a molar extinction coefficient of 7,677 M -1} cm ^-1 at 506 nm for non-covalent DOX/H bonds. was used

After excitation at 480 nm, the amount of doxorubicin loaded in the prepared structure (I) was measured and observed by measuring the emission spectrum in the range of 500 to 750 nm, and as the amount of doxorubicin increased, the prepared structure (I) As the amount of doxorubicin increased, the fluorescence intensity of doxorubicin decreased (FIG. 11).

This is due to the quenching phenomenon between the bound doxorubicin. When the prepared structure (H): doxorubicin = 1:30 (molar ratio), no further doxorubicin quenching occurred, therefore, a drug delivery system was prepared by selecting a molar ratio of 1:20 as drug encapsulation (FIG. 11) .

In this way, doxorubicin was also loaded on the other drugs of Examples including the SL region.

<Example 9> Nanoparticles of aptamer-based targeting complex anticancer agent

PLGA (poly lactide-co-glycolic acid) nanoparticles were used to deliver the prepared aptamer-based targeting complex anticancer agent. Water-in-oil-in-water (w/o/w) double emulsion method (F, Danhier et al. Journal of Controlled release, vol.133(1), pp.11-17, 2009 ), PLGA nanoparticles containing the aptamer-based targeting complex anticancer agent prepared above were prepared.

Dissolve aptamer-based targeting complex anticancer drug (1%, w/v), chitosan glycolide (1%, w/v) and PLGA (4%, w/v) in dichloromethane, and deionized water in a volume ratio of 1:5 The solution was added and emulsified at room temperature for 60 seconds at 25 W output using a probe-type sonicator (Branson Digital Sonifier®, Danbury, CT). A single emulsion (w/o) was re-emulsified in an aqueous PVA solution (4%, w/v) and sonicated at 30 W for 120 seconds (w/o/w). The double emulsion was poured into a PVA (1%, w/v) solution and stirred overnight to evaporate the solvent. The nanoparticles containing the aptamer-based targeting complex anticancer agent were obtained by centrifugation at 16000 rpm, washed, and freeze-dried to prepare nanoparticles containing the aptamer-based targeting complex anticancer agent.

<Example 10> Confirmation of cancer cell targeting of aptamer-based targeting complex anticancer agent

In order to evaluate the effect of the 10 aptamer-based targeting complex anticancer drugs prepared above on cytotoxicity according to the expression levels of HER2 and EpCAM, the breast cancer cell line MDA-MB-453 overexpressing HER-2 and EpCAM (ATCC® HTB-131™), the breast cancer cell line MCF-7 (ATCC® HTB-22™) that does not express HER2 but overexpresses EpCAM, and the breast cancer cell line MDA-MB-231 (ATCC® HTB-26™) that does not express both HER2 and EpCAM. ) was used.

Each aptamer-based targeting complex anticancer agent was added to the cell culture solution, cultured for 4 hours, washed, and cultured for 72 hours to perform MTT analysis.

The cytotoxicity of the A, B, C, D and E aptamer-based targeting combination anticancer agent targeting one of HER2 and EpCAM is shown in FIG. 12 .

As shown in FIG. 12 a, in the MDA-MB-453 cell line overexpressing HER-2 and EpCAM, all of the aptamer-based targeting complex anticancer agents A, B, C, D and E were all concentration-dependently cytotoxic. , and the IC ₅₀ values were all around 1.8 μg/mL.

As shown in FIG. 12 b, in the MCF-7 cell line overexpressing EpCAM without expressing HER2, the aptamer-based targeting complex anticancer agents B and E showed distinct cytotoxicity in a concentration-dependent manner, and the IC ₅₀ value was On the other hand, the aptamer-based targeting complex anticancer agents of A, C, and D did not show cytotoxicity at all treatment concentrations, while showing values around 2.5 μg/mL, and C partially observed the anticancer effect of passively released DOX. Could.

In the MDA-MB-231 cell line, which does not express both HER2 and EpCAM, the A, B, C, D, and E aptamer-based targeting complex anticancer drugs did not show cytotoxicity (results not shown).

The cytotoxicity of F, G, H, I and J aptamer-based targeting combination anticancer agents targeting both HER2 and EpCAM is shown in FIG. 13 .

As shown in FIG. 13A, in the MDA-MB-453 cell line overexpressing HER-2 and EpCAM, all of the aptamer-based targeting complex anticancer agents of F, G, H, I and J showed marked cytotoxicity in a concentration-dependent manner. , and the IC ₅₀ values were all around 0.182 μg/mL.

As shown in FIG. 13b , in the MCF-7 cell line overexpressing EpCAM without expressing HER2, the aptamer-based targeting complex anticancer agents of F, G, H, I, and J all showed marked cytotoxicity in a concentration-dependent manner. and the IC ₅₀ values were all around 0.285 μg/mL.

In MDA-MB-231, which does not express both HER2 and EpCAM, the F, G, H, I, and J aptamer-based targeting combination anticancer drugs did not show cytotoxicity (results not shown).

These cytotoxicity results show that the aptamer-based targeting complex anticancer agent of the present invention selectively exhibits cytotoxicity depending on the presence or absence of expression of HER2 and EpCAM target molecules in cancer cells, thereby increasing the safety of normal cells and loading two or more anticancer drugs in multiples. This means that the cytotoxic effect can also be increased.

The results of FIGS. 12 and 13 are all the results of the experiment repeated 5 times (n = 5).

<Example 11> Confirmation of anticancer effect of aptamer-based targeting complex anticancer drug in animal model of breast cancer disease

MDA-MB-453 (ATCC HTB-131™), a breast cancer cell line that overexpresses HER-2 and EpCAM, and MCF, a breast cancer cell line that does not express HER2 and overexpresses EpCAM, in immunodeficient 6-week-old female BALB/c nude mice. -7 (ATCC HTB-22™) and MDA-MB-231 (ATCC HTB-26™), a breast cancer cell line that does not express both HER2 and EpCAM, respectively ^{, were transplanted with 3×10 6} cells, as shown in FIG. 14 a. DM1 (15 mg/kg) and an aptamer-based targeting complex anticancer drug (0.5 mg/kg) were intramuscularly administered three times (2 days, 9 days, 16 days) according to the same schedule. Thereafter, the tumor volume was measured for 24 days, and the results are shown in FIG. 15 . Tumor volume (V) was measured by caliper ^{and calculated using the formula V=(length×width 2} )/2 (mean ± standard deviation (n = 5)).

The aptamer-based targeting complex anticancer agent used in this Example was 40k PEG-ApGemHER2-SS-DM1 (A) and 40k PEG-ApFdUEpCAM-SS-DM1 (B) as a single administration group, and a mixed administration group (A * B). used a mixture of A and B. In this example, the drug in the form of nanoparticles obtained in Example 9 was used.

Referring to FIG. 14 b , in mice implanted with the MDA-MB-453 cell line overexpressing HER-2 and EpCAM, respectively, 0.5 mg/kg of the aptamer-based targeted complex anticancer agent significantly reduced tumor growth in all groups.

Referring to FIG. 15 a, in mice implanted with the MDA-MB-231 cell line that does not express both HER2 and EpCAM, the aptamer-based targeting complex anticancer agent did not reduce tumor growth.

Referring to FIG. 15 b, 40k PEG-ApGemHER2-SS-DM1 (A) administered alone in mice transplanted with an MCF-71 cell line overexpressing EpCAM without HER2 expression did not reduce tumor growth, but 40k PEG -ApFdUEpCAM-SS-DM1(B), and the combined administration significantly reduced tumor growth in the group using the A and B combination drugs.

In addition, it was confirmed that no change in body weight according to drug administration was observed in all experimental groups that survived compared to the control group (results not shown).

The results in these animal models also show that the aptamer-based targeting complex anticancer agent of the present invention has an anticancer effect depending on the expression of HER2 and EpCAM, and suggests that there are relatively few side effects.

The present invention has been described and illustrated with reference to some specific embodiments thereof, and various adaptations, changes, modifications, substitutions, deletions or additions of methods or protocols may be made by those skilled in the art without departing from the spirit and scope of the invention. will understand that there is Accordingly, the present invention is defined by the scope of the following claims, which are intended to be interpreted broadly to the extent reasonable.

Claims (51)

(i) an aptamer capable of targeting cancer cells by specifically recognizing and binding to a target molecule expressed on the surface of cancer cells and capable of exhibiting anticancer activity by itself by integrating one or more molecules of a nucleoside-like anticancer agent, ( ii) An aptamer-based targeting complex anticancer agent, comprising a second anticancer agent different from the nucleoside-like anticancer agent, which is bound to the aptamer.
According to claim 1,
The aptamer-based targeting complex anticancer agent further comprises a single-stranded nucleic acid forming a stem loop structure, and the single-stranded nucleic acid is bound to the 5' or 3' end of the aptamer or to the second anticancer agent. and, an aptamer-based targeting complex anticancer agent, characterized in that one or more molecules of an intercalator anticancer agent or a groove-binding anticancer agent are interposed in the stem region.
3. The method of claim 2,
The aptamer-based targeting complex anticancer agent is (i) a single-stranded nucleic acid forming a stem loop structure loaded with an aptamer, an intercalator anticancer agent or a groove-binding anticancer agent, in the order of a second anticancer agent, or (ii) an intercalator anticancer agent or A single-stranded nucleic acid that forms a stem loop structure loaded with a groove-binding anticancer agent, an aptamer, and a second anticancer agent, or (iii) a stem loop loaded with an aptamer, a second anticancer agent, an intercalator anticancer agent or a groove-bound anticancer agent An aptamer-based targeting complex anticancer drug, characterized in that it is combined in order of single-stranded nucleic acids forming a structure.
3. The method of claim 2,
An oligonucleotide is interposed between the aptamer and the single-stranded nucleic acid to separate the aptamer and the single-stranded nucleic acid with a spacer, an aptamer-based targeting complex anticancer agent.
According to claim 1,
By specifically recognizing and binding to a second target molecule different from the target molecule, additional targeting to cancer cells is possible. An aptamer-based targeting complex anticancer agent, characterized in that the second aptamer capable of exhibiting anticancer activity by itself by being integrated above is additionally bound to the 5' or 3' terminus of the aptamer or the second anticancer agent .
6. The method of claim 5,
The aptamer-based targeting complex anticancer agent is (i) an aptamer, a second aptamer, or a second anticancer agent, or (ii) an aptamer, a second anticancer agent, and a second aptamer combined in order. Characterized, aptamer-based targeting complex anticancer drug.
6. The method of claim 5,
An oligonucleotide is interposed between the aptamer and the second aptamer in order to space the aptamer and the second aptamer with a spacer, aptamer-based targeting complex anticancer agent.
3. The method of claim 2,
By specifically recognizing and binding to a second target molecule different from the target molecule, additional targeting to cancer cells is possible. A second aptamer capable of exhibiting anticancer activity by itself by being integrated above is further bound to the 5' or 3' terminus of the aptamer or the 5' or 3' terminus of the second anticancer agent or the single-stranded nucleic acid. Characterized in that there is, an aptamer-based targeting complex anticancer agent.
9. The method of claim 8,
The aptamer-based targeting complex anticancer agent is (i) an aptamer, a single-stranded nucleic acid, a second anticancer agent, a second aptamer, or (ii) an aptamer, a single-stranded nucleic acid, a second aptamer, a second or (iii) an aptamer, a second aptamer, a single-stranded nucleic acid, a second anticancer agent, or (iv) a single-stranded nucleic acid, an aptamer, a second anticancer agent, and a second aptamer, (v) a single-stranded nucleic acid, an aptamer, a second aptamer, and a second anticancer agent, (vi) an aptamer, a second anticancer agent, a single-stranded nucleic acid, and a second aptamer, in that order, or (vii) an aptamer Tamer, second anticancer agent, second aptamer, single-stranded nucleic acid, or (viii) aptamer, second aptamer, second anticancer agent, aptamer-based targeting complex, characterized in that in the order of single-stranded nucleic acid anticancer drugs.
9. The method of claim 8,
An oligonucleotide is used to separate the aptamer and the single-stranded nucleic acid with a spacer, or between the aptamer and the second aptamer, or between the second aptamer and the single-stranded nucleic acid to separate the single-stranded nucleic acid. An aptamer-based targeting complex anticancer drug, characterized in that it was published in.
6. The method of claim 1 or 5,
The target molecule is an antigen or receptor present on the surface of cancer cells, aptamer-based targeting complex anticancer agent.
6. The method of claim 1 or 5,
The target molecule is EGFRvⅢ, EGFR, metastin receptor, tyrosine kinase, HER2, c-Kit, c-Met, CXCR4, CCR7, endothelin-A receptor, PPAR-δ, PDGFR-α, CEA , EpCAM, GD2, GPC3, PSMA, TAG-72, GD3, HLA-DR, MUC1, NY-ESO-1, LMP1, TRAILR2, VEGFR2, HGFR, CD44, CD166, PD-1, PD-L1 or PD-L2 characterized in that, aptamer-based targeting complex anticancer agent.
6. The method of claim 1 or 5,
The aptamer is a DNA aptamer or RNA aptamer, characterized in that, aptamer-based targeting complex anticancer agent.
6. The method of claim 1 or 5,
The aptamer is an RNA aptamer,
The RNA aptamer is a modified RNA aptamer, and the modified RNA aptamer is an aptamer chemically modified at any one or more of a sugar position, a phosphate position, a base position, a 5' end position, and a 3' end position of a ribonucleotide. characterized in that, aptamer-based targeting complex anticancer agent.
15. The method of claim 14,
The modified RNA aptamer is characterized in that modified with one of OMe, O-alkyl, O-allyl, S-alkyl, S-allyl and halogen in the 2'-OH group of the sugar, aptamer-based targeting complex anticancer agent.
6. The method of claim 1 or 5,
The nucleoside-like anticancer agent is gemcitabine, fludarabine, cytarabine, cladribine, 5-fluorouracil, capecitabine. , Pentostatin, Adefovir, Cidofovir, Doxifluridine, Enocitabine, Fluxuridine or Fludarabine Phosphate Characterized in that, aptamer-based targeting complex anticancer agent.
3. The method of claim 2,
The intercalator anticancer agent is doxorubicin, daunorubicin, dactinomycin, actinomycin, mitoxantrone, or epirubicin, characterized in that it is , Aptamer-based targeting complex anticancer drug.
3. The method of claim 2,
The groove-binding anticancer agent is distamycin A (Distamycin A), talimustine (Tallimustine), PNU-145156E, brostallicin, CC-1065, adozelesin (Adozelesin), carzelesin (Carzelesin), Bizel Bizelesin, Ducarmycin A, Ducarmycin SA, KW-2189, Irofulven, Trabectedin (ET-743), nogalamycin, Dieter Calinium bis-naphthalimide (ditercalinium bis-naphthalimides) or aminoglycoside (Aminoglycoside), characterized in that, aptamer-based targeting complex anticancer drug.
6. The method of claim 1 or 5,
The aptamer-based targeting complex anticancer agent, characterized in that the exposed end of the aptamer is pegylated, aptamer-based targeting complex anticancer agent.
According to claim 1,
The aptamer and the second anticancer agent, characterized in that the covalent bond, aptamer-based targeting complex anticancer agent.
21. The method of claim 20,
The aptamer and the second anticancer agent are covalently bonded through a linker, characterized in that the aptamer-based targeting complex anticancer agent.
3. The method of claim 2,
The aptamer, the second anticancer agent, and the single-stranded nucleic acid are covalently bonded to each other, aptamer-based targeting complex anticancer agent.
23. The method of claim 22,
The aptamer, the second anticancer agent, and the single-stranded nucleic acid are covalently bonded via a linker, an aptamer-based targeting complex anticancer agent.
6. The method of claim 5,
The aptamer, the second anticancer agent, and the second aptamer are covalently bonded to each other, aptamer-based targeting complex anticancer agent.
25. The method of claim 24,
The aptamer, the second anticancer agent, and the second aptamer are covalently bonded via a linker, aptamer-based targeting complex anticancer agent .
9. The method of claim 8,
The aptamer, the second anticancer agent, the second aptamer and the single-stranded nucleic acid are covalently bonded to each other, an aptamer-based targeting complex anticancer agent.
27. The method of claim 26,
The aptamer, the second anticancer agent, the second aptamer, and the single-stranded nucleic acid are covalently bonded via a linker, an aptamer-based targeting complex anticancer agent.
According to claim 1,
The second anticancer agent is a cytotoxic anticancer agent,
The cytotoxic anticancer agents include antagonists (Antimetabolites), microtubulin targeting agents (Tubulin polymerase inhibitor and Tubulin depolymerisation), Alkylating agents, Antimitotic Agents, DNA cleavage agents, DNA cross-linker agent, DNA intercalator agents, or DNA topoisomerase inhibitor, characterized in that the aptamer-based targeting complex anticancer agent.
(i) By specifically recognizing and binding to the first target molecule expressed on the surface of cancer cells, targeting to cancer cells is possible, and the first nucleoside-like anticancer agent is incorporated, thereby exhibiting anticancer activity by itself. Cancer cells by specifically recognizing and binding a first aptamer capable of being capable of a second target molecule and (ii) a second target molecule different from the first target molecule expressed on the surface of the cancer cell while being bound to the first aptamer Additional targeting is possible, and the first nucleoside-like anticancer agent and the other second nucleoside-like anticancer agent are incorporated (incorporated) to include a second aptamer capable of exhibiting anticancer activity by itself Aptamer-based targeting complex anticancer drug.
30. The method of claim 29,
The nucleoside-like anticancer agent is gemcitabine, fludarabine, cytarabine, cladribine, 5-fluorouracil, capecitabine. , Pentostatin, Adefovir, Cidofovir, Doxifluridine, Enocitabine, Fluxuridine or Fludarabine Phosphate Characterized in that, aptamer-based targeting complex anticancer agent.
30. The method of claim 29,
An oligonucleotide is a spacer, characterized in that interposed between the first aptamer and the second aptamer to separate the aptamer, aptamer-based targeting complex anticancer agent.
30. The method of claim 29,
The target molecule is an antigen or receptor present on the surface of cancer cells, aptamer-based targeting complex anticancer agent.
30. The method of claim 29,
The target molecule is EGFRvⅢ, EGFR, metastin receptor, tyrosine kinase, HER2, c-Kit, c-Met, CXCR4, CCR7, endothelin-A receptor, PPAR-δ, PDGFR-α, CEA , EpCAM, GD2, GPC3, PSMA, TAG-72, GD3, HLA-DR, MUC1, NY-ESO-1, LMP1, TRAILR2, VEGFR2, HGFR, CD44, CD166, PD-1, PD-L1 or PD-L2 characterized in that, aptamer-based targeting complex anticancer agent.
30. The method of claim 29,
The aptamer is a DNA aptamer or RNA aptamer, characterized in that, aptamer-based targeting complex anticancer agent.
30. The method of claim 29,
The aptamer is an RNA aptamer,
The RNA aptamer is a modified RNA aptamer, and the modified RNA aptamer is an aptamer chemically modified at any one or more of a sugar position, a phosphate position, a base position, a 5' end position, and a 3' end position of a ribonucleotide. characterized in that, aptamer-based targeting complex anticancer agent.
30. The method of claim 29,
The modified RNA aptamer is characterized in that modified with one of OMe, O-alkyl, O-allyl, S-alkyl, S-allyl and halogen in the 2'-OH group of the sugar, aptamer-based targeting complex anticancer agent.
30. The method of claim 29,
The aptamer-based targeting complex anticancer agent, characterized in that the exposed end of the aptamer is pegylated, aptamer-based targeting complex anticancer agent.
30. The method of claim 29,
The first aptamer and the second aptamer is characterized in that the covalent bond, aptamer-based targeting complex anticancer agent.
39. The method of claim 38,
The first aptamer and the second aptamer are covalently bonded via a linker, aptamer-based targeting complex anticancer agent.
(i) an aptamer capable of targeting cancer cells by specifically recognizing and binding to a target molecule expressed on the surface of cancer cells and capable of exhibiting anticancer activity by itself by incorporating a nucleoside-like anticancer agent and ( ii) a single-stranded nucleic acid forming a stem loop structure is introduced by binding to the 5' or 3' end of the aptamer, and an intercalator anticancer agent or a groove-binding anticancer agent is inserted into the stem region and loaded Tamer-based targeting complex anticancer drug.
41. The method of claim 40,
Additional targeting to cancer cells is possible by specifically recognizing and binding to a second target molecule different from the target molecule expressed on the surface of the cancer cell, and a second nucleoside-like anticancer agent different from the nucleoside-like anticancer agent A second aptamer capable of exhibiting anticancer activity by itself by being incorporated (incorporated) is characterized in that the first aptamer or the single-stranded nucleic acid is further bound to the aptamer-based targeting complex anticancer agent.
42. The method of claim 41,
The binding order of the aptamer, the single-stranded nucleic acid and the second aptamer is (i) the aptamer, the single-stranded nucleic acid, and the second aptamer, or (ii) the aptamer, the second aptamer, and the single-stranded aptamer. An aptamer-based targeting complex anticancer agent, characterized in that in the order of nucleic acids.
41. The method of claim 40,
The intercalator anticancer agent is doxorubicin, daunorubicin, dactinomycin, actinomycin, mitoxantrone, or epirubicin, characterized in that it is , Aptamer-based targeting complex anticancer drug.
41. The method of claim 40,
The groove-binding anticancer agent is distamycin A (Distamycin A), talimustine (Tallimustine), PNU-145156E, brostallicin, CC-1065, adozelesin (Adozelesin), carzelesin (Carzelesin), Bizel Bizelesin, Ducarmycin A, Ducarmycin SA, KW-2189, Irofulven, Trabectedin (ET-743), nogalamycin, Dieter Calinium bis-naphthalimide (ditercalinium bis-naphthalimides) or aminoglycoside (Aminoglycoside), characterized in that, aptamer-based targeting complex anticancer drug.
42. The method of claim 40 or 41,
The nucleoside-like anticancer agent is gemcitabine, fludarabine, cytarabine, cladribine, 5-fluorouracil, capecitabine. , Pentostatin, Adefovir, Cidofovir, Doxifluridine, Enocitabine, Fluxuridine or Fludarabine Phosphate Characterized in that, aptamer-based targeting complex anticancer agent.
42. The method of claim 40 or 41,
The aptamer and the single-stranded nucleic acid or the aptamer and the single-stranded nucleic acid and the second aptamer are covalently bonded, aptamer-based targeting complex anticancer agent.
47. The method of claim 46,
The covalent bond is a linker-mediated covalent bond, aptamer-based targeting complex anticancer agent, characterized in that.
42. The method of claim 40 or 41,
The aptamer is a DNA aptamer or RNA aptamer, characterized in that, aptamer-based targeting complex anticancer agent.
42. The method of claim 40 or 41,
The aptamer is an RNA aptamer,
The RNA aptamer is a modified RNA aptamer, and the modified RNA aptamer is an aptamer chemically modified at any one or more of a sugar position, a phosphate position, a base position, a 5' end position, and a 3' end position of a ribonucleotide. characterized in that, aptamer-based targeting complex anticancer agent.
50. The method of claim 49,
The modified RNA aptamer is characterized in that modified with one of OMe, O-alkyl, O-allyl, S-alkyl, S-allyl and halogen in the 2'-OH group of the sugar, aptamer-based targeting complex anticancer agent.
42. The method of claim 40 or 41,
The aptamer-based targeting complex anticancer agent, characterized in that the terminal is pegylated, aptamer-based targeting complex anticancer agent.

Images