KR20210144121A - Artificial scaffold for corneal endothelial cell transplantation, manufacturing method thereof, and ultra-thin descemet stripping endothelial graft using the same - Google Patents

Abstract

The present invention relates to a method for tissue-engineering an artificial scaffold for corneal endothelial cell transplantation and an ultrathin descemet membrane stripping endothelial graft recellularized by transplanting cells into the scaffold prepared by the above method. The method for tissue-engineering an artificial scaffold for corneal endothelial cell transplantation according to the present invention is capable of producing a scaffold having excellent transparency and an ultrathin thickness through an optimal decellularization process. In addition, the scaffold produced by the method of the present invention has excellent morphological stability and can provide a microenvironment that is suitable for cell survival and differentiation. When corneal endothelial cells are transplanted into the scaffold of the present invention, the corneal endothelial cells can show excellent adhesion, can be distributed evenly, and can show a high survival rate. In addition, the descemet membrane stripping endothelial graft recellularized by transplanting corneal endothelial cells into the scaffold of the present invention can exhibit high transparency, can be maintained in an ultrathin shape with a thickness of 90-120 μm, and does not contain a heterologous substance that can cause an immune rejection reaction, thereby being usefully used for descemet membrane stripping endothelial keratoplasty.

Description

Artificial scaffold for corneal endothelial cell transplantation, manufacturing method thereof, and ultra-thin Descemet's membrane detachment corneal endothelial graft using the same, and ultra-thin descemet stripping endothelial graft using the same

The present invention relates to a method for tissue engineering manufacturing an artificial scaffold for corneal endothelial cell transplantation, and to a super-thin Descemet's membrane detachment corneal endothelial plate graft in which cells are transplanted into the scaffold prepared by the above method and recellularized.

The cornea (角膜, cornea) occupies 1/6 of the outer membrane of the eyeball and is one of the main organs that refracts light. The cornea consists of a total of 5 layers: corneal epithelium, Bowman's layer, corneal stroma (corneal stroma), Descemet's membrane, and corneal endothelium. The corneal epithelium consists of 5-6 cell layers, and basal cells are generated from the stem cells in the periphery, move to the center, and fall off after 7 days. Bowman's layer is composed of cell-free collagen fibers and is colorless and transparent. However, it is impossible to regenerate, leaving scars during surgery or trauma. The corneal matrix accounts for 90% of the thickness of the cornea, and the direction and size of cells are constant. Descemet's membrane consists of 3 to 4 layers of cells and is presumed to be the basement membrane of the endothelium. The corneal endothelium consists of one layer of cells, the cells of the endothelium are fixed, regeneration is extremely limited, and the number of cells decreases with age. When the number of cells decreases, the surrounding cells grow to fill the space.

Corneal endothelial dystrophy (CED) is a major cause of severe visual impairment. Fuchs endothelial corneal dystrophy (FECD) is a common corneal disease characterized by gradual loss of endothelial cells, thickening of Descemet's membrane (DM), and deposition of orbital growths. The disease is known to occur in 4% of the population over the age of 40 in the United States. The request for corneal transplantation is made at the first diagnosis of Fuchs' corneal endothelial dystrophy.

The corneal endothelium consists of a monolayer of hexagonal cells on the posterior surface of the cornea, which contains a physiological ion pump. Corneal endothelial cells (CEC) maintain mechanical strength by controlling hydration by pumping water from the stroma to the aqueous humor. The average density of human corneal endothelial cells (CEC) at birth is about 5000 cells/mm ² . However, because the mitotic potential is limited, the total cell number decreases with age. When corneal endothelial cells (CECs) are damaged, cells are repaired through cell expansion and migration rather than mitosis. When the corneal endothelial cell (CEC) density ^{drops below 500 cells/mm 2} due to genetic disease or aging, the loss can no longer be compensated by normal recovery and the damage is permanent.

Currently, the established treatment for corneal endothelial cell (CEC) loss is corneal transplantation. With penetrating keratoplasty (PK) or partial-thickness endothelial keratoplasty (EK), corneal transparency can be restored by transplantation of donor tissue.

Compared to full-thickness corneal transplantation, partial-thickness corneal endothelial grafting can reduce both the risk and recovery time before and after surgery. Including Deep Lamellar Endothelial Keratoplasty (DLEK), Descemet-stripping endothelial keratoplasty (DSEK) and Descemet membrane endothelia keratoplasty (DMEK) There are several ways to perform cell transplantation. Clinically, it was found that partial-thickness keratoplasty had better visual results than full-thickness keratoplasty, and the survival rate of endodermal endodermal graft grafts was much higher than that of full-thickness keratoplasty. Therefore, in the United States, the number of cases of corneal endothelial layer grafting compared to full-thickness corneal transplantation has been steadily increasing. However, due to the lack of donor corneal tissue worldwide, corneal transplantation is limited to 1 in 70 patients. Therefore, finding new therapies for treatment remains an important task.

Meanwhile, new studies on the differentiation of stem cells, such as induced pluripotent stem cells (iPSCs) and the induction of mesenchymal stem cells into corneal endothelial cells, have recently been performed for clinical treatment. In particular, the ability of induced pluripotent stem cells (iPSCs) to differentiate into infinite corneal endothelial-like cells (iCECs) is a promising patient-specific approach that eliminates the need for postoperative immunosuppression. A study reported in 2016 described the derivation of corneal endothelial-like cells (CECs) from induced pluripotent stem cells (iPSCs) derived from BJ human foreskin fibroblasts (Zhao and Afshari. 2016). Similarly, another study designed a procedure for adult fibroblast-derived induced pluripotent stem cells (iPSCs) for the induction of corneal endothelial-like cells (CECs) (Wagoner et al. 2018). Although studies related to these stem cells have been actively conducted, there is no study on an optimal clinically available scaffold that can provide an appropriate microenvironment for the survival and differentiation of the cells, and thus, there are limitations.

To overcome the corneal donor shortage, researchers are focusing their attention on corneal tissue engineering using appropriate biomaterials that offer in vivo mimicry and superior biocompatibility. Various types of materials for corneal endothelial implantation, such as collagen sheets, gelatin films, hydrogel lenses, and amniotic membranes, have been reported (Ishino et al. 2004; Kennedy et al. 2019; Mimura et al. 2004; Watanabe et al. 2011). Among these materials, decellularized tissues are attracting attention due to their unique organ-derived microenvironment. Other techniques for decellularization of the cornea have been investigated, including physical, chemical and biological methods, to confirm their suitability for clinical use.

However, the production of decellularized cornea has been mainly focused on the entire cornea rather than a partial thickness, and research on the production of ultra-thin Descemet's corneal endothelial plate using the decellularization method is lacking.

Under this background, the present inventors prepared an artificial scaffold for corneal endothelial cell transplantation using pig cornea as an alternative to the human cornea, and prepared an ultra-thin Descemet's membrane detachment corneal endothelial plate graft that was recellularized by transplanting cells into the scaffold. The present invention was completed by confirming that the ultra-thin Descemet's membrane detachment corneal endothelial plate graft of the present invention has very good transparency and an ultra-thin thickness in the range of 90 to 120 μm, and thus can be usefully used for corneal endothelial cell transplantation.

Korean Patent No. 10-1029887

Accordingly, an object of the present invention is to provide a method for manufacturing an artificial scaffold for transplantation of corneal endothelial cells.

Another object of the present invention is to provide an artificial scaffold for transplantation of corneal endothelial cells prepared by the above method.

Another object of the present invention is to provide an ultra-thin Descemet's membrane detachment corneal endothelial plate graft, which is recellularized by transplanting cells into a scaffold.

In order to achieve the object of the present invention as described above,

The present invention comprises the steps of a) preparing an animal's cornea; b) decellularizing both ends of the corneal endothelium, Descemet membrane, and posterior stroma in the cornea using a biopsy punch and then decellularizing; c) exfoliating the Descemet's Membrane Endothelial Plate from the decellularized cornea; d) decellularizing the exfoliated Descemet's membrane detachment corneal endothelial plate; and e) drying the decellularized Descemet's membrane detachment corneal endothelial plate.

In one embodiment of the present invention, decellularization in step d) may be performed under 0.1 to 0.5% SDS concentration conditions.

In one embodiment of the present invention, decellularization in step d) may be performed at room temperature for 8 hours to 12 hours.

In one embodiment of the present invention, the drying in step e) may be carried out at 15 to 45 ℃.

In addition, the present invention provides an artificial scaffold for transplantation of corneal endothelial cells prepared by the above method.

In addition, the present invention provides an ultra-thin Descemet's membrane detachment corneal endothelial plate graft, which is recellularized by transplanting cells into the support.

In one embodiment of the present invention, the cells may be corneal endothelial cells derived from induced pluripotent stem cells.

In one embodiment of the present invention, the graft may have a thickness of 90 to 120 μm.

The method for manufacturing an artificial scaffold for corneal endothelial cell transplantation of the present invention can produce a scaffold with excellent transparency and an ultra-thin thickness through an optimal decellularization process. In addition, the scaffold prepared by the method of the present invention has excellent morphological stability and can provide an appropriate microenvironment for cell survival and differentiation. It can show a high survival rate as well as an even distribution of cells. In addition, the Descemet's membrane detachment corneal endothelial plate graft, which is recellularized by transplanting corneal endothelial cells into the scaffold of the present invention, can maintain an ultra-thin form of 90 to 120 μm in thickness with high transparency, and heterogeneity capable of causing immune rejection Since it does not contain substances, it can be usefully used for corneal endothelial cell transplantation.

1 is a schematic diagram briefly showing the process of Method A and Method B (Endo, Endothelium, DM, Descemet's membrane; EPI, Epithelium; Full, Full-thickness cornea; DSE, Descemet stripping endothelial graft; DC, Decellularization).
2A is an observation of the total shape of the cornea at each stage of Method A and Method B. Figure 2B is a graph showing the measurement of the transparency of Descemet's membrane detachment corneal endothelial plate graft decellularized for 10 hours using 0.1% SDS (CON: control (transparent slide glass), Full: full thickness cornea, A10h: method A, B10h: Method B). Figure 2C is a graph showing the thickness of the Descemet's membrane detachment corneal endothelial plate graft decellularized for 0 hours and 10 hours using 0.1% SDS (Full: full thickness cornea, A: Method A, B: Method B ).
3A is an image of Descemet's membrane detachment corneal endothelial plate grafts decellularized in 0.1% SDS at room temperature (RT) for 0h, 4h, 6h, and 10h, followed by DAPI staining. FIG. 3B is an image of Descemet's membrane detachment corneal endothelial plate graft after decellularization at 4° C. and room temperature (RT) for 10 hours, followed by DAPI staining. Figure 3C shows the detection of porcine-derived immunogenic antigens in Descemet's membrane exfoliation corneal endothelial plate graft (DSE) without decellularization and Descemet membrane peeling corneal endothelial plate grafting graft (DSE-DC 10h) after 10 hours of decellularization. This is the result of PCR test.
Figure 4A shows the Descemet's membrane (DM) and posterior stromal structures of Descemet's membrane detachment corneal endothelial plate grafts following decellularization in 0.1% and 1% SDS, respectively, through hematoxylin and eosin (H & E) staining. This is the confirmed result (DM, Descemet's membrane; EPI, Epithelium; S, Stroma). Figure 4B shows the collagen matrix of Descemet's membrane detachment corneal endothelial plate graft (DSE) without decellularization and Descemet's membrane detachment corneal endothelial plate graft (DSE-DC 10h) after 10 hours of decellularization using Mason's trichrome. ) is the result measured using the staining method.
FIG. 5A is a photograph showing that when a wet Descemet's membrane detachment corneal endothelial plate graft is cultured in a cell seeding medium, the graft expands and curls, resulting in loss of transparency. Figure 5B is a photograph showing the morphological change when the Descemet's membrane detachment corneal endothelial plate graft was dried at various temperature conditions (40 °C, 60 °C, -70 °C). 5C is a photograph showing that transparency is maintained during culture after cell seeding in decellularized Descemet's membrane detachment corneal endothelial plate grafts that have been dried at 40°C. 5D is a photograph comparing the transparency (left) and thickness (right) of wet and dry Descemet's membrane detachment corneal endothelial plate grafts after recellularization. FIG. 5E shows the results of measuring the transparency of the recellularized wet and dry Descemet's membrane detachment corneal endothelial plate grafts compared to the control group (clear glass slides). Figure 5F shows the staining of live cells (green) and dead cells (red) of recellularized wet and dry Descemet's membrane detachment corneal endothelial plate grafts. 5G is a result of measuring the thickness of the Descemet's membrane detachment corneal endothelial plate graft before and after culture for recellularization.
6A shows the process of differentiation from human induced pluripotent stem cells (iPSCs) into corneal endothelial cells (CECs) at day 0 (D0), day 12 (D13), and day 22 (D22). 6B is the result of confirming the expression of neural crest-like cells (NCC) and corneal endothelial cell (CEC) markers in differentiated cells by immunohistochemistry. 6C is a photograph showing the transparency of a Descemet's detachable corneal endothelial plate graft recellularized into corneal endothelial cells (iCECs) differentiated from iPSCs (the letters below are clearly visible). 6D shows that the recellularized iCECs spread evenly, most of the cells survived, and it was confirmed that they were well attached to the dry Descemet's membrane detachment corneal endothelial plate graft. 6E is the result of confirming the structures of the decellularized dry graft (DC Dry graft, left column) and iCEC recellularized graft (iCEC RC graft, right column) through hematoxylin and eosin (H & E) staining method. 6F shows the results of a demonstration of Descemet's membrane ablation corneal endothelial plate grafting (DSEK) using recellularized grafts and enucleated pig eyes.

The present invention relates to a method for manufacturing an artificial scaffold for transplantation of corneal endothelial cells.

The method for manufacturing an artificial scaffold for corneal endothelial cell transplantation of the present invention comprises the steps of: a) preparing an animal's cornea; b) decellularizing both ends of the corneal endothelium, Descemet membrane, and posterior stroma in the cornea using a biopsy punch and then decellularizing; c) exfoliating the Descemet's Membrane Endothelial Plate from the decellularized cornea; d) decellularizing the exfoliated Descemet's membrane detachment corneal endothelial plate; and e) drying the decellularized Descemet's membrane detachment corneal endothelial plate graft.

Step a) of the present invention is a step of preparing the cornea of an animal, specifically, preparing by excising an intact cornea including the peripheral sclera and conjunctiva from the animal.

Step b) of the present invention is a step of decellularizing the intact cornea, specifically, corneal endothelium, Descemet membrane and posterior stroma in the intact cornea prepared through step a). It is a step of decellularization after incision (incision) of both ends using a 5 ~ 15mm biopsy punch.

The intact cornea consists of a total of five layers: corneal epithelium, Bowman's layer, corneal stroma (corneal stroma), Descemet's membrane, and corneal endothelium. Both ends (ends) of the three endothelial sites are incised using a 5-15 mm biopsy punch, and then decellularized in 0.1% SDS for 5 hours.

The step c) of the present invention is a step of peeling the Descemet's membrane peeling corneal endothelial plate, specifically, peeling the Descemet's membrane peeling corneal endothelial plate from the decellularized cornea that has undergone step b).

Descemet's membrane is the basement membrane of corneal endothelial cells, and the products synthesized and secreted in the corneal endothelial cell layer form a tight bond with endothelial cells through hemidesmosome binding. On the other hand, since the Descemet's membrane and the corneal stroma exist in an unstable state without a tight bond, separation may occur between the Descemet's membrane and the corneal stroma during intraocular surgery. This is called ‘desmemak peel’. Because Descemet's membrane separation means that the corneal endothelium is finally separated, the corneal water control function, which is a function of the corneal endothelium, is lost, and the cornea falls into a chronic edema state.

On the other hand, Descemet's stripping endothelial keratoplasty (DSEK) means that the corneal endothelium and Descemet's membrane of the host are replaced with the donor's corneal endothelium and Descemet's membrane along with a small amount of posterior stroma. It is a type of replacement corneal lamellar grafting. Since the graft does not require sutures for fixation of the graft, high and irregular astigmatism caused by suturing can be prevented, tissue rejection is small after surgery, and vision recovery is quick.

In the present invention, the term "desmété membrane detachment corneal endothelial plate" refers to a posterior lamellar plate of the cornea including a small amount of posterior stroma together with the corneal endothelium and Descemet's membrane.

Step d) of the present invention is a step of decellularizing the Descemet's membrane peeling corneal endothelial plate, and specifically, the Descemet's membrane peeling corneal endothelial plate obtained through step c) is subjected to 0.1 to 0.5% SDS concentration conditions and room temperature. This is a step of decellularization for 8 to 12 hours.

Step e) of the present invention is a step of drying the decellularized Descemet's membrane detachment corneal endothelial plate graft, specifically, drying the Descemet's membrane detachment corneal endothelial plate graft that has undergone step d) at a temperature of 15 to 45°C. am.

In addition, the present invention provides an artificial scaffold for transplantation of corneal endothelial cells prepared by the above method.

In addition, the present invention provides an ultra-thin Descemet's membrane detachment corneal endothelial plate graft in which cells are transplanted into the artificial scaffold for transplantation of corneal endothelial cells and recellularized.

In one embodiment of the present invention, the cells may be corneal endothelial cells or corneal endothelial-like cells derived from induced pluripotent stem cells.

In another embodiment of the present invention, the Descemet's membrane detachment corneal endothelial plate graft may be ultrathin having a thickness of 90 to 120 μm.

Hereinafter, the present invention will be described in more detail through examples. These examples are for explaining the present invention in more detail, and the scope of the present invention is not limited to these examples.

<Example>

1. Materials and Methods

Descemet's Membrane Endothelial Plate (DSE) Graft

Method A: Fresh pig eyes were purchased from a slaughterhouse. The cornea, including the peripheral sclera and conjunctiva, was resected. Descemet's membrane (DM) and corneal endothelial cells (CEC) were stained with 0.1% trypan blue solution (Sigma, Rockford, IL). Descemet's membrane detachment corneal endothelial plate (DSE) grafts containing minimal stromal layer were manually removed using round tip forceps. The exfoliated grafts were decellularized in 0.1% sodium dodecyl sulfate (SDS; Sigma) for 10 hours at room temperature (RT, 20° C.) with gentle agitation at a speed of 70 rpm. Washing was repeated 3 times for 4 hours each with phosphate buffer (PBS) containing 2% antibiotic-antimycotic solution (Welgene, Gyeongsan, Korea). Then, the grafts were sterilized in weakly acidic electrolyzed water (SAEW; Medilox-S, Susan, Seoul, Korea) for 1.5 hours, and washed 3 times with PBS for 30 minutes each. The grafts were kept at 4° C. for up to 1 week in cold PBS prior to use (see FIG. 1A ).

Method B: Fresh pig eyes were purchased from a slaughterhouse. The cornea, including the peripheral sclera and conjunctiva, was resected. Corneal endothelial cells (CEC), Descemet's membrane (DM), and both ends of the posterior stroma were incised using a 12 mm biopsy punch. Then, the entire corneal tissue, including the peripheral sclera and conjunctiva, was decellularized in 0.1% SDS for 5 h at room temperature with gentle agitation. Then, the Descemet's membrane detachment corneal endothelial plate (DSE) graft containing the minimal stromal layer was exfoliated using round tip forceps. The isolated Descemet's membrane detachment corneal endothelial plate (DSE) graft was decellularized again in 0.1% SDS for 10 hours, then washed, and the sterilization procedure was performed as described in Method A (see FIG. 1B ).

Graft analysis

To confirm that the pig-derived xenograft cells were removed from the decellularized graft, a drop of 4,6-diamidino-2-phenylindole (DAPI; Sigma) mounting medium was applied to the sample on a glass slide. To observe the remaining graft nuclei, z-stack imaging was performed using a fluorescence microscope (LionHeart FX, BioTek, Winoosky, VT). The thickness of each sample was measured using a digital micro caliper (Mitutoyo, Kawasaki, Japan). To evaluate the transparency of the cornea, the sample was placed on a clear glass slide, and then the Roman alphabet (Calibri 16 font, bold) was printed on paper. To quantify the transparency of the corneal graft, Neo imager software (Neoscience, Seoul, Korea) was used to compare the visibility of alphabetic letters under the slide glass as opposed to the letters under the slide glass without the sample. For cillin and eosin (H&E) staining, the sample is fixed with 4% paraformaldehyde and then dehydrated through a series of graded ethanol and xylene.Embedded in paraffin and cut into 4 μm thick sections. They were deparaffinized and stained with H & E in a conventional manner, Masson's trichrome staining was performed to assess collagen material in the samples according to the manufacturer's protocol (Polysciences, PA, Warrington, PA).

To evaluate the presence or absence of a heterologous antigen, PCR was performed using the AccuPower® Taq PCR PreMix & Master Mix (Bioneer, Daejeon, Korea) using the following protocol. After denaturation at 95°C for 5 minutes, 35 cycles were performed at 95°C for 20 seconds, annealing (51 to 55°C) 30 seconds, and 72°C for 30 seconds, and final extension was performed at 72°C for 10 minutes. DNA was obtained from 4 corneal tissues per sample using the G-spin™ Total DNA Extraction Mini Kit (Intron, Seongnam, Korea) according to the manufacturer's protocol. The sequences of the primers used are detailed in the table below. PCR products were separated on a 1.5% agarose gel (Bioneer) and visualized with RedSafe nucleic acid staining solution (Chembio, Medford, NY).

primer sequence gene Primer sequence (5'-3') porcine endogenous retrovirus-gag (PERV) forward CTACCCCGAGATTGAGGAGC Reverse GGGGGATGGTTAGTTTTCCA PERV polymerase forward CTACAACCATTAGGAAAACTAAAAG Reverse AACCAGGACTGTATATCTTGATCAG swine leukocyte antigen DR alpha (SLA-DRA) forward CGAGAAGAGGTGGCAAGACA Reverse GTCCTGGAGGATTCCCTTGA swine leukocyte antigen 2 (SLA-2) forward GTCACCTTGAGGTGCTGGG Reverse TGGCAGGTGTAGCTCTGCTC porcine beta-actin forward TGTCATGGACTCTGGGGATG Reverse GGGCAGCTCGTAGCTCTTCT

Human Corneal Endothelial Cell Line Cell Culture

For hCEC-B4G12 cell line culture, coated cell culture dishes were prepared using 10 μg/mL laminin (Sigma) and 10 ng/mL chondroitin sulfate (Sigma). According to the manufacturer's instructions, cells were cultured in human endothelial serum-free medium (SFM; Gibco, Carlsbad, CA) containing 10 ng/mL human recombinant fibroblast growth factor (FGF)-2. Cells were subcultured using 0.25% trypsin/EDTA (Welgene) at 37° C. for 2 minutes. Enzyme activity was blocked with a protease inhibitor cocktail (Sigma).

Human induced pluripotent stem cell (iPSC) culture and iPSC-derived corneal endothelial cell differentiation

The human stem cell line CMC-hiPSC-003 was obtained from the National Stem Cell Bank (National Institute of Health) provided by the Catholic University of Korea. The cells were cultured on a cell culture plate coated with growth factor-reduced Matrigel (Gibco, Carlsbad, USA) and maintained using TeSR-E8 medium (Stem Cell Technology, Vancouver, Canada) according to the manufacturer's instructions. In the present invention, the previous protocol (Wagoner et al. 2018) was slightly modified to differentiate into corneal endothelial cells.

Briefly, human induced pluripotent stem cells (iPSCs) were subcultured using Gentle cell dissociation reagent (Gibco), and the next day, the medium was mixed with DMEM/F12 (Gibco), 2% bovine serum albumin (Sigma), and 2 mM GlutaMAX. (Gibco), 0.1 mM MEM non-essential amino acid solution (Gibco), 1×trace elements A, B, and C (Gibco), 0.1 mM 2-mercaptoethanol (Gibco), 50 μg/mL (+)-sodium L -ascorbate (Sigma), 10 μg/mL transferrin (Sigma), 10 ng/mL recombinant human Heregulin β-1 (Peprotech; Rocky Hill, USA), 200 ng/mL recombinant human LONGR3 IGF-I (Sigma), 8 ng /mL recombinant human FGF2 (Peprotech), and 0.2% primocin (InvivoGen; San Diego, USA) was replaced with a basal differentiation medium containing. As an initial step, human induced pluripotent stem cells (iPSCs) were cultured for 17 days with the addition of 10 μM SB431542 (Cayman Chemical, Ann Arbor, MI) and 3 μM CHIR99021 (Miltenyi Biotec, Bergish Glabach, Germany) in a basal medium. It was induced into neural crest cells. The medium was changed daily. Then, it was replaced with CEC induction medium. The CEC induction medium consists of a basal medium and CEC factors, and the CEC factors are 0.1×B27 (Gibco), 10 ng/mL recombinant human PDGF-BB (Peprotech), and 10 ng/mL recombinant human DKK-2 (Peprotech). include The CEC induction medium was replaced daily for 30 days.

Recellularization of Decellularized Grafts

The decellularized Descemet's membrane detachment corneal endothelial plate (DSE) was placed flat on a 48-well dish with the rolling direction facing down and incubated in a drying chamber at 40°C overnight. The hCEC-B4G12 cell line or induced pluripotent stem cells (iPSCs) were harvested, and the cell suspension was seeded on the graft to a final concentration of ^{3×10 5 cells in 0.5 mL of medium without additional extracellular matrix.} The seeded scaffolds were incubated for 7 days at 37° C. in a humidified atmosphere containing _{5% CO 2 under static conditions.} The medium was changed daily.

cell staining

For immunocytochemical detection of corneal endothelial cells (iCECs) differentiated from induced pluripotent stem cells (iPSCs), mouse and rabbit-specific HRP/DAB (ABC) detection kits (Abcam, Cambridge, UK) were prepared according to the manufacturer's instructions. was used. P75/NGF receptor (Cell signaling Technology, Danvers, MA), Sox10 (Cell Signaling Technology), N-cadherin (Cell Signaling Technology), ZO-1 (Invitrogen, Carlsbad, CA) and Na+/K+ pump (Millipore, MA, A primary antibody against Burlington, MA) was used for corneal endothelial cells (CECs). To confirm the viability of the redifferentiated cells from the graft, a live/dead cell viability/cytotoxicity assay kit (Thermo, MA, Waltham, MA) was used according to the manufacturer's protocol. For imaging of stained tissue on glass slides, z-stacked images were processed using a fluorescence imager (LionHeart FX).

Descemet's corneal endothelial transplantation (DSEK) using tissue engineered Descemet's membrane detachment corneal endothelial plate (DSE) transplantation

To confirm that an induced corneal endothelial cell (iCEC)-recellularized Descemet's corneal endothelial plate (DSE) graft can be placed on the inner surface of the cornea, the graft is inserted through a clear corneal incision into the anterior chamber of the enucleated pig eye. did. After application of corneal sutures using 8-0 nylon (NJ, Somerville, Ethicon), air bubbles and a balanced salt solution were injected using a 30G cannula. Ultrasonography (ProSound Alpha7; Hitachi Healthcare Americas, Twinsburg OH) was performed to confirm the position of the implanted graft.

statistical analysis

Experimental data were analyzed statistically by analysis of variance (ANOVA) with p-value (.05) and GraphPad Prism7 statistical program (San Diego, CA).

2. Results

Transparency and thickness of Descemet's membrane detachment corneal endothelial plate (DSE) graft

The total shape of the cornea was observed in each method according to sequential steps (FIG. 2, Method A and Method B). After removing the cornea of full thickness from the pig's eye, pictures were taken (FIG. 2A, Method A(a)). In method A, Descemet's detachment corneal endothelial plate (DSE) was isolated from fresh cornea, photographed (FIG. 2A, Method A(b)), and decellularized in 0.1% SDS for 5 h and 10 h. As a result of comparing DSE decellularized for 5 hours (FIG. 2A, Method A(c)) and DSE decellularized for 10 hours (FIG. 2A, Method A(d)), transparency significantly decreased as the decellularization time increased. appeared to be On the other hand, in method B, the cornea of full thickness (Fig. 2A, Method B(a)), in which both ends of the Descemet's membrane (DM) and the posterior stroma were incised using a 12 mm biopsy punch, was 0.1 for 5 hours. Transparency was significantly reduced due to decellularization by % SDS (Fig. 2A, Method B(b)). The detached DSE graft immediately after immersion of the full-thickness cornea in 0.1% SDS for 5 hours appeared to be very transparent (Fig. 2A, Method B(c)). When the DSE grafts were decellularized in 0.1% SDS for 10 hours, there was no visual decrease in transparency compared to DSE before decellularization (Fig. 2A, Method B(d)). In particular, in method B, it was found that the lower alphabetic letters were more visible in the DSE grafts that had undergone decellularization compared to the DSE grafts before decellularization.

Transparency of each step according to the type of method was analyzed. Detailed results are shown in detail in Table 2 and FIG. 2B below.

Transparency of the graft at each stage according to the type of method (*p< .05) Method A step Total thickness 0h DSE 0h 5 h of decellularization 10 h of decellularization transparency(%) 84.9±10.8 93.9±2.1 90.7±9.9 69.8±4.8* Method B step Total thickness 0h 5 h of decellularization DSE 0h 10 h of decellularization transparency(%) 87.7±6.8 41.8±2.5* 95.8±2.1 90.0±5.0

*p< .05

In method A, the transparency of the entire corneal tissue was 84.9 ± 10.8%, the transparency of DSE was 93.9 ± 2.1%, the transparency of DSE after 5 hours of decellularization was 90.7 ± 9.9%, and the transparency of DSE after 10 hours of decellularization was 69.8 ± It was found to be 4.8%.

Meanwhile, in method B, the transparency of the entire corneal tissue was 87.7 ± 6.8%, and when the entire cornea was decellularized for 5 hours, the transparency was 41.8 ± 2.5%. Thereafter, the transparency of DSE isolated from the entire cornea was 95.8 ± 2.1%, and the transparency of DSE decellularized for 10 hours was 90.0 ± 5.0%.

In both method A and method B, it was found that the longer the decellularization time, the lower the transparency due to water absorption. On the other hand, in the case of the transparency of DSE finally obtained after 10 hours of decellularization, it was shown that method B was remarkably superior to method A. In particular, in the case of the decellularized DSE obtained through method B, it shows 90.0 ± 5.0% transparency, and this value shows a value almost similar to that of the control (see FIG. 2B). For reference, a transparent slide glass was used as a control.

In addition, the thickness of the graft at each stage according to the type of method was analyzed. Detailed results are shown in detail in FIG. 2C.

As a result, the total corneal thickness was 1240 ± 225 μm, and when the entire cornea was decellularized for 10 hours, it was found to be 4237 ± 423 μm. These results show that the cornea of full thickness contained water during decellularization in 0.1% SDS, resulting in a more than 3-fold increase in thickness.

In method A, the DSE thickness was 172.9±102 μm, and the DSE thickness after 10 h of decellularization was 233.4±12 μm, which increased during decellularization. In method B, the DSE thickness was found to be 70.17 ± 23 μm and the DSE thickness after 10 h of decellularization was 113.0 ± 35 μm. The thickness of the decellularized DSE in method B was found to be less than 50% of the thickness of the decellularized DSE in method A, approximately 48.5%.

These results suggest that the decellularized DSE prepared through method B has less substrate because it retains less water than the decellularized DSE prepared through method A.

As a result, it was found that the decellularized Descemet's membrane detachment corneal endothelial plate (DSE) prepared by method B was suitable as an artificial DSE graft due to its high transparency and thin thickness.

Optimal conditions for decellularization

To determine the optimal decellularization time of Descemet's membrane detachment corneal endothelial plate (DSE) grafts, DAPI staining was used for decellularization for 0 h, 4 h, 6 h and 10 h in 0.1% SDS at room temperature. When 4 to 6 hours elapsed after decellularization, the cells appeared to disappear slowly, and it was confirmed that the cells completely disappeared when 10 hours had elapsed (see FIG. 3A ).

Next, the temperature conditions (4°C vs. RT) were changed while other conditions were kept constant to optimize the temperature for decellularization. When decellularization was performed at each temperature for 10 hours, cells were maintained when decellularization was performed at 4°C, whereas cells were completely removed when decellularization was performed at room temperature (RT) (see Fig. 3B). . The degree of decellularization was found to be much more effective at room temperature than at 4°C. Cell destruction by SDS was estimated to be relatively more active at room temperature than at 4°C.

In this experiment, it was also confirmed whether the pig-derived immunogenic antigen was maintained through the decellularization process. As a result, as shown in FIG. 3C , the DNA sequences of PERV, PERV polymerase, SLA-DRA, SLA-2 and porcine beta-actin were not detected in decellularized grafts, unlike intact grafts. Through these results, it was confirmed that the decellularization process was properly performed in 0.1% SDS for 10 hours.

On the other hand, hematoxylin and eosin (H) in that the decellularized Descemet's membrane detachment corneal endothelial plate (DSE) graft prepared by method B maintains the intact Descemet's membrane (DM) and posterior stromal structures compared to the intact cornea. & E) was confirmed by staining (FIG. 4A). In the present invention, 0.1% SDS concentration was used, but in some previous studies, the use of 1% SDS was reported for decellularization of full thickness cornea (Du et al. 2011, He et al. 2016). Therefore, we compared the degree of decellularization at concentrations of 1% SDS and 0.1% SDS. As a result, it was found that when decellularization was performed using 1% SDS, the structure of the Descemet's membrane (DM) was destroyed and the matrix of the substrate was also modified. On the other hand, it was confirmed that cells were removed in both of the SDS concentration conditions. Through these results, it was found that 0.1% SDS was excellent for decellularization of Descemet's membrane detachment corneal endothelial plate (DSE) grafts without structural deterioration.

As a result of measuring the collagen matrix using the Masson's trichrome staining method, the collagen matrix remained in the Descemet's membrane detachment corneal endothelial plate (DSE) graft decellularized using 0.1% SDS, whereas the porcine cells in the stroma were It was confirmed that it was removed after decellularization (see FIG. 4B).

Conditions for recellularization and processing of decellularized Descemet's membrane detachment corneal endothelial plate (DSE) grafts

In this experiment, the transplantation conditions for cell seeding were optimized to produce transparent, ultrathin and homogeneously recellularized DSE grafts. When the wet, decellularized DSE grafts were placed on culture plates in medium for cell seeding, the grafts swelled and began to thicken and become opaque within 12 hours. In addition, it was found that wet grafts were easily suspended in the medium and dried, making it difficult for cell seeding (see Fig. 5A).

Therefore, the grafts were dried at various temperatures (-70, 40 and 60° C.). As a result, when drying overnight at 40 ℃, it was confirmed that the rolling state disappears and transparency increases. On the other hand, it was confirmed that the graft dried at 60 ° C. shrunk, and the graft dried at -70 ° C. was opaque, shrunk, and separated from the plate (see Fig. 5B).

To compare the transparency, thickness, rolling, and degree of cell adhesion of wet versus dry DSE grafts after cell seeding, hCEC-B4G12 cells were recellularized into the grafts and cultured for 7 days. For dry DSE grafts, the grafts did not curl (roll), float, or swell during incubation. In addition, unlike the wet graft, it was found that the transparency was remarkably excellent (see FIG. 5C ).

In the overall appearance of the recellularized DSE grafts on slide glass, the transparency of the dry graft was similar to that of the control, which was much higher than that of the wet graft (see Fig. 5D).

In addition, the present inventors histologically confirmed that the recellularized dry grafts were much thinner than the wet grafts. Clarity analysis showed that, relative to the control group, dry grafts were 91.8±2.38%, while wet grafts were only 50.6±6.38% ( FIG. 5E ).

Next, live (green)/dead cell (red) staining of the recellularized explants was performed to evaluate the distribution, adhesion and viability of cells in dry and wet conditions. Most of the redistributed cells in the dry graft appeared to be viable, adherent and distributed. On the other hand, the cells redistributed to the wet graft were evenly distributed and did not appear to adhere (FIG. 5F). This reason was considered to be due to the rolling and floating of the graft in the culture medium.

Finally, the thickness of the recellularized grafts was compared. Before recellularization, the thicknesses of wet and dry grafts prepared by method B were 113 ± 0.35 μm and 57.6 ± 7.92 μm, respectively. On the other hand, after 7 days of culture, the thickness of the wet graft increased to 222.6 ± 24.2 μm, while the dry graft showed 99.2 ± 5.98 μm, confirming that it was an ultra-thin film (FIG. 5G).

Through the above results, it was confirmed that drying the DSE graft at 40° C. before cell seeding is very effective in maintaining the transparency and ultra-thinity of the recellularized graft. Also, the use of dry grafts was superior to producing grafts in which cells were homogeneously redistributed.

Recellularization of Differentiated Corneal Endothelial Cells (iCECs) from Induced Pluripotent Stem Cells in Descemet's Membrane Detachment Corneal Endothelial Plate (DSE) Grafts

To produce corneal endothelial cells (CECs) from human induced pluripotent stem cells (iPSCs), as a first step, human induced pluripotent stem cells (iPSCs) were differentiated into neural crest-like cells (NCCs). . As a result, the colony state (FIG. 6A, D0) of human induced pluripotent stem cells (iPSCs) disappeared and the shape was changed to an elongated structure. Neural crest-like cells (NCC) were produced by adding SB431542 and CHIR99021 for 3 days, and were able to maintain the neural crest cell phenotype for about 17 days ( FIGS. 6A and D13 ). As a next step, neural crest-like cells (NCCs) were exposed to B27, PDGF-BB, and DKK-2 to induce a hexagonal rigid corneal endothelial cell (CEC)-like differentiation within 5 days (Figure 6A, D22). . From 3 to 17 days after induction, NCC markers of p75/nerve growth factor receptor (NGFR) and SRY-box transcription factor 10 (SOX10) were expressed positively. On day 23 of corneal endothelial cell (CEC) differentiation, expression of N-cadherin (N-Cad), Zolaocludens-1 (ZO-1) and Na+/K+ ATPase markers was confirmed (see FIG. 6B ).

After 7 days of culture, the iCEC-recellularized grafts appeared clear and very thin, similar to the hCEC-B4G12 recellularized grafts ( FIG. 6C ). It was confirmed that the recellularized iCECs spread evenly, most of the cells survived, and adhered well to the dry DSE grafts similar to hCEC lines (Figure 6D). H&E staining of the recellularized grafts revealed a thin iCEC layer distributed in the ultrathin DSE grafts (Fig. 6E). During incubation, the thickness remained ultra-thin, and no structural deformation was observed.

In this experiment, Descemet's membrane detachment corneal endothelial plate grafting (DSEK) was demonstrated using recellularized grafts and enucleated pig eyes. After insertion of the recellularized graft into the anterior chamber of a porcine eye from which the Descemet's membrane (DM) and endothelium layers were removed, the graft was placed inside the cornea ( FIG. 6F ).

These results suggested that the DSE graft of the present invention is advantageous for generating transparent and ultra-thin artificial DSE grafts using stem cells.

So far, the present invention has been looked at with respect to preferred embodiments thereof. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in modified forms without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

DSE: Descemet stripping endothelial
iPSC: induced pluripotent stem cell
iCECs: induced pluripotent stem cell (iPSC)-derived corneal endothelial cells
CED: Corneal endothelial dystrophy
FECD: Fuchs endothelial corneal dystrophy
DM: Descemet's membrane
CEC: corneal endothelial cell
PK: penetrating keratoplasty
EK: endothelial keratoplasty
ROCK: Rho kinase
DLEK: deep lamellar endothelial keratoplasty
DSEK: Descemet's stripping endothelial keratoplasty
DMEK: Descemet membrane endothelial keratoplasty

Claims (8)

a) preparing the animal's cornea;
b) decellularizing both ends of the corneal endothelium, Descemet membrane and posterior stroma in the cornea using a biopsy punch and then decellularizing;
c) exfoliating the Descemet's Membrane Endothelial Plate from the decellularized cornea;
d) decellularizing the exfoliated Descemet's membrane detachment corneal endothelial plate; and
e) a method for manufacturing an artificial scaffold for transplantation of corneal endothelial cells, comprising the step of drying the decellularized Descemet's membrane detachment corneal endothelial plate. According to claim 1,
The decellularization in step d) is a method for producing an artificial scaffold for corneal endothelial cell transplantation, characterized in that it is performed under a 0.1 to 0.5% SDS concentration condition. According to claim 1,
In step d), the decellularization is performed at room temperature for 8 to 12 hours. According to claim 1,
The method of manufacturing an artificial scaffold for corneal endothelial cell transplantation, characterized in that the drying in step e) is carried out at 15 to 45°C. The artificial scaffold for corneal endothelial cell transplantation prepared by the method of any one of claims 1 to 4. An ultra-thin Descemet's membrane detachment corneal endothelial plate graft obtained by transplanting cells into the support of claim 5 and recellularizing. 7. The method of claim 6,
The cells are induced pluripotent stem cells (induced pluripotent stem cells) derived from the corneal endothelial cells (corneal endothelial cells) ultra-thin Descemet's membrane detachment corneal endothelial plate graft, characterized in that. 7. The method of claim 6,
The graft is an ultra-thin Descemet's membrane detachment corneal endothelial plate graft, characterized in that it has a thickness of 90 to 120 μm.

Images