KR20210132339A - Os12BGlu38 for male sterility induction in rice and use thereof - Google Patents

Abstract

The present invention relates to an Oryza sativa beta-glucosidase 38 (Os12BGlu38) gene, which is predominantly expressed in the late pollen development phase to regulate intine synthesis in pollen cell walls, and uses thereof. More particularly, the present invention relates to Os12BGlu38 gene, protein, loss-of-function mutation, transformed plant and seeds thereof, which control intine synthesis in pollen cell wall and ultimately induce male infertility in rice, a method for controlling intine synthesis in pollen cell wall of plants by expressing the gene in plants, a method for inducing male infertility, and a composition for inducing male infertility in plants.

Description

Os12BGlu38 gene and use thereof for inducing male sterility in rice {Os12BGlu38 for male sterility induction in rice and use thereof}

The present invention relates to a plant in which male sterility is induced by inducing loss of function of Os12Bglu38 (Oryza sativa beta-glucosidase 38), which is expressed in pollen of rice and is the most important gene for intine synthesis in pollen cell wall.

Rice is one of the economically important crops as a rice-producing plant that is used as a staple food not only in Korea but also in more than one-third of the world. F1 hybrid production through the introduction of male sterility to increase the production of this crop is a technological development that all researchers around the world are paying attention to. Cytoplasmic male sterility (CMS) method is also possible in rice, but it is not realistic in terms of production cost or actual use. A method of making male infertility by inducing selective surgical tissue death using genes) is being used.

Stamens are the male reproductive organs of flowering plants and are composed of multiple tissues such as tapetium, endothecium, connective tissue, and vascular tissue, and are responsible for the production of pollen. The development process of the stamen is the first stage in which the form of the stamen is established and the microspore hair cells undergo meiosis to form the microspores of the tetrad, and the pollen and stamen are differentiated, tissue degeneration, dehiscence and pollen release It is divided into the second stage that occurs, and only some of the various genes involved in this developmental process are expressed surgically.

Pollen, the male gametes of plants, develops from anther sac through 14 stages (Zang et al., 2011). The pollen cell wall consists of two distinct layers: exine and intine. The exine layer is generated by the parental part of anther sac, and the intine layer is generated by the pollen genotype. Axin is constructed during the microspore development stage by secretion from tapetal cells, whereas intin is constructed during the bicellular stage from components contributed by pollen cells. Axin is formed by sequential polymerization of sporopollenin composed of phenol and fatty acid derivatives. Intin cells, which have begun to develop, have a composition similar to the primary cell wall of a typical plant cell, including cellulose, pectin, and various proteins.

Although a lot of investment is being made in the development and research of male sterile plants, the research results on this are very insignificant due to the problems that male sterile plants have so far. In addition, in many male sterile plant development methods using genetic engineering techniques, most of the cases in which one-to-one hybrids include foreign genes such as herbicide resistance genes, and their use is very limited due to regulations on various GMO crops. It will be possible to overcome the disadvantages of these male sterile plants and use them usefully for easy new variety development and high value-added industrial production. Therefore, it is possible to secure stable male sterility, and there is a need for research on novel methods or novel genes that can maintain male sterility.

Republic of Korea Patent Publication No. 10-2077-0121784

Accordingly, an object of the present invention for solving the above problems is to provide a method for inducing male infertility of plants.

Another object of the present invention is to provide a method for producing a transgenic plant induced in male infertility.

In addition, another object of the present invention is to provide a transgenic plant and seeds thereof prepared by the above method.

In addition, another object of the present invention is to provide a composition for inducing male infertility in plants comprising an agent for inhibiting the expression of Os12BGlu38 gene.

Another object of the present invention is to provide a method for confirming male sterility of a plant, comprising the step of determining whether the Os12BGlu38 gene is expressed.

In addition, another object of the present invention is to provide a composition for determining male infertility of a plant comprising an agent for measuring the mRNA or protein level of the Os12BGlu38 gene.

Various problems to be solved in the present invention in the above are not limited thereto, but can be clearly understood by those of ordinary skill in the art to which the present invention pertains through the examples and claims to be described later. will be.

In order to achieve the above object, the present invention provides a method for inducing male infertility in a plant comprising the step of suppressing the expression of Os12BGlu38 (Oryza sativa beta-glucosidase 38) gene.

In addition, the present invention provides a method for producing a transgenic plant in which male infertility is induced, comprising the step of inhibiting the expression of the Os12BGlu38 gene using a loss-of-function mutation of the Os12BGlu38 (Oryza sativa beta-glucosidase 38) gene.

In addition, the present invention provides a transgenic plant and seeds thereof prepared by the above method.

In addition, the present invention provides a composition for inducing male infertility in plants comprising an agent that inhibits the expression of Os12BGlu38 gene.

In addition, the present invention provides a method for confirming male sterility of a plant comprising the step of determining whether the expression of the Os12BGlu38 gene.

In addition, the present invention provides a composition for determining male infertility of a plant comprising an agent for measuring the mRNA or protein level of the Os12BGlu38 gene.

The male sterile plant regulated with beta-glucosidase 38 gene activity of the present invention has a simple seeding system, high seeding efficiency, and is hardly affected by the environment and can be used stably. It is useful because it can be applied to all plants where intines play an important role in pollen cell wall development, as well as being able to replace nuclear gene male sterility lines.

The effects according to the present invention in the above are not limited to the above, and other effects of the present invention can be clearly identified by those of ordinary skill in the art through the examples and claims to be described later. can be understood

1 is a diagram showing the expression of Os12BGlu38 gene.
(A) Expression of GH1 At/Os4 cluster genes in pollen.
(B) Expression of the Os12BGlu38 gene at various pollen development stages.
(C) Expression of Os12BGlu38:GUS in the vacuolar, bicellular, and maturation phases.
Figure 2 is a diagram showing the isolation and characteristics of the Os12BGlu38 mutant allele.
(A) Allele tree diagram of os12bglu38-1. 11 exons are indicated by black boxes, primers for genotyping and expression analysis are indicated by arrows, T-DNA inserted into the 11th exon, the last exon, is indicated by triangles.
(B) Genotyping results of progeny plants obtained by self-fertilization of the os12bglu38-1 heterozygote. The F1/R1 primer set was used to identify the Os12BGlu38 gene, and the F1/GUS primer set was used to identify the os12bglu38-1 gene.
(C) RT-PCR results of mature pollen of wild-type (WT), heterozygous (He), and homozygous (Ho) obtained through anther culture. OsUBQ5 was used as a control. The RT1F/RT1R primer set was used to confirm the mRNA expression of the Os12BGlu38 gene.
3 is a diagram showing cross-sections of anthers of wild-type, heterozygous and os12bglu38-1 homozygotes at various stages of pollen development. Scale bar: 25 μm
4 is a view showing exine and intine, which are cell wall components of wild-type, os12bglu38-1 heterozygous and homozygous pollen grains.
(A), (B), (C) Results of observation of bright field images and UV light field images by staining exine with Auramine O.
(D), (E), (F) Results of observing bright field images and UV light field images by staining intine with Calcofluor white. Pots with morphological abnormalities are indicated by DP. Scale bar: 20 μm
5 is a diagram of TEM analysis of mature pollen grains of wild-type and os12bglu38-1 homozygotes.
(A), (B) TEM analysis of wild-type mature pollen grains.
(C), (D) TEM analysis of mature pollen grains of the os12bglu38-1 homozygote.
(E), (F) TEM analysis results of mature pollen grains of the functional recovery line Comp-7. Baculum is Ba, cytosol is Cy, pollen with abnormal morphology is DP, exine is Ex, intine is In, mature pollen is MP, nexine is Ne, Tectum is denoted by Te. Scale bar: 2 μm
6 is a diagram showing the subcellular localization of Os12BGlu38-GFP observed in coleoptile cells and pollen in transgenic rice carrying ProZmUbi:Os12BGlu38-GFP.
(A) Observation of GFP fluorescence in protoplast non-isolated cotyledonous sheath cells of transgenic rice carrying ProZmUbi:Os12BGlu38-GFP.
(B) Observation of FM4-64 red (cell membrane marker) fluorescence in protoplast non-isolated cotyledonous sheath cells of transgenic rice carrying ProZmUbi:Os12BGlu38-GFP.
(C) Bright-field image observation results in non-isolated cotyledonous cells of transgenic rice carrying ProZmUbi:Os12BGlu38-GFP.
(D) Synthesis of results from (A) to (C).
(E) GFP fluorescence observation of protoplast isolated cotyledonous sheath cells of transgenic rice carrying ProZmUbi:Os12BGlu38-GFP.
(F) Microscopic observation of protoplast isolated cotyledonous cells of transgenic rice carrying ProZmUbi:Os12BGlu38-GFP.
(G) Synthesis of results from (E) and (F).
(H) Sequential z-series image acquisition results of pollen. The cell wall is denoted by CW and the cell membrane by PM. Scale bar: 5 μm
7 is a diagram showing the expression of Os12BGlu38 in various tissues of plants.
After introduction of ProOs12BGlu38:GUS, GUS activity was confirmed in (A) surgery, (B) stem, (C) seed and ear, (D) leaf, and (E) root, respectively.
8 is a diagram showing the gene tree of the T-DNA insertion homozygous mutant of the GH1 At/Os4 cluster genes Os3BGlu7, Os3BGlu8 and Os7BGlu26.
Exons are indicated by black boxes, introns are indicated by straight lines between the boxes, and inserted T-DNA is indicated by triangles.
9 is a diagram showing the phenotype of mature pollen grains in wild-type and os12bglu38-1 homozygotes.
Nuclear staining and starch staining were performed to compare the phenotypes of mature pollen grains for (A) wild-type, (B) heterozygous, and (C) homozygous.
10 is a diagram showing the analysis of the gene function recovery plant of os12bglu38.
(A) Schematic diagram of a recombinant vector for the production of os12bglu38-1 recovery plants.
(B) DNA PCR results of progeny plants obtained by self-fertilization of a functional recovery line. F1/R2 primer sets were used to identify wild-type alleles. The F1/GUS primer set was used to identify the os12bglu38-1 allele. The Fcomp/Rnos primer set was used to check whether a transgene was introduced.
11 is a diagram showing the subcellular localization of Os12BGlu38-GFP in N. benthamiana leaf epidermal cells.
(A) Observation result of GFP fluorescence of infiltrated epidermal cells.
(B) Observation result of bright field image of infiltrated epidermal cells.
(C) GFP fluorescence observation result of N. benthamiana leaf epidermal cells added with 0.8M mannitol.
(D) Bright field observation result of N. benthamiana leaf epidermal cells with 0.8M mannitol (Mannitol) added.
The cell wall is represented by CW, and the cell membrane is represented by PM. Scale bar: 50 μm
12 is a diagram showing the transient expression of Os12BGlu38-GFP and RFP-KOR in infiltrated N. benthamiana leaf epidermal cells. ProCaMV35S:RFP-KOR vector was co-infiltrated with ProCaMV35S:Os12BGlu38-GFP vector and observed with a confocal scanning microscope after 3-4 days.
(A), (D) GFP fluorescence observation.
(B), (E) RFP fluorescence observation.
(C) Synthesis of the results of (A), (B).
(F) Microscopic observation in bright field.
(G) Synthesis of results from (D), (E), (F). Scale bar: 20 μm
13 is a table showing the results of progeny plant genotyping of functional recovery lines Comp-4, Comp-7, Comp-8 and Comp-19 plants. The genotype of Os12BGlu38 was determined by PCR using Os12BGlu38-specific primers, T-DNA-specific primers and transgene-specific primers.

Hereinafter, the present invention will be described in more detail.

Glycoside hydrolase family 1 (GH1) enzymes play a variety of roles in plants, such as hydrolases and transglycosidases. In the present invention, the biological function of Os12BGlu38 was characterized. As a result of genotype analysis of progeny plants obtained by self-fertilizing the os12bglu38-1 (T-DNA insertion mutant of Os12BGlu38) heterozygote, the ratio of wild-type to heterozygous was 1:1, and no homozygous. Accordingly, it was confirmed through crossbreeding analysis that Os12BGlu38 deficiency induces male infertility. In the morphological analysis, the mature mutant pollen was distorted and hollow morphological abnormalities were observed. As a result of staining and transmission electron microscopy analysis, it was confirmed that the mutant pollen was deficient in cell wall intines. This was restored by introduction of wild-type Os12BGlu38 DNA. Os12BGlu38-GFP fused with green fluorescent protein (GFP) was confirmed to be located in the cell membrane and cell wall in rice pollen and tobacco. As a result of cell wall composition analysis, glucose decreased in os12bglu38-1. On the other hand, cutin monomer and wax components were increased in the pollen of the mutant compared to the wild-type and restorative plant lines. Os12BGlu38 expressed in recombinant bacteria and yeast exhibited β-glucosidase activity on β-1,3- and β-1,4-gluco-oligosaccharides and β-sitosterol glucoside. Based on these results, we suggest that Os12BGlu38 may contribute to cell wall synthesis or recycling necessary for proper intin development in pollen.

In order to confirm the function of Os12BGlu38 (Oryza sativa beta-glucosidase 38) represented by the nucleotide sequence of SEQ ID NO: 1 whose function is not known in the past, the present inventors selected os12bglu38-1 plants, which are T-DNA insertion mutations of the Os12BGlu38 gene, Through the male infertility phenotype of the homozygous os12bglu38-1 produced through anther culture, it was confirmed that Os12BGlu38 plays an important role in late pollen development and that the deletion of Os12BGlu38 induces male infertility.

In addition, through biochemical analysis of anther having os12bglu38 mutant pollen, it was confirmed that the loss of function of Os12BGlu38 significantly reduced intin synthesis in the pollen cell wall, which is essential for pollen development. Therefore, it can be said that Os12BGlu38 contributes to intin synthesis in the pollen cell wall during the pollen development stage, particularly in the late pollen development stage.

The present invention provides a method for inducing male infertility in a plant, comprising the step of suppressing the expression of Os12BGlu38 (Oryza sativa beta-glucosidase 38) gene represented by the nucleotide sequence of SEQ ID NO: 1 in a plant.

In addition, while the existing cytoplasmic genetic male sterility system can be used stably without being affected by the environment, there is a disadvantage that it can be used only when a maintenance system and a fertility recovery system are provided together. Although the seeding system is simple and the seeding efficiency is high, there is a problem in collecting high-purity seeds because the expression of male sterility is unstable. On the other hand, the male sterile plant regulated by Os12BGlu38 gene activity of the present invention has a simple seeding system and high seeding efficiency, and at the same time is hardly affected by the environment and can be used stably. Genetic male infertility strains can be replaced.

Therefore, it provides a method for producing a transgenic plant with male infertility, comprising the step of inhibiting the expression of the Os12BGlu38 gene using a loss-of-function mutation of the Os12BGlu38 (Oryza sativa beta-glucosidase 38) gene represented by the nucleotide sequence of SEQ ID NO: 1. .

In addition, the step of inhibiting the expression of the Os12BGlu38 gene may be made by substituting or deleting one or more partial bases of the Os12BGlu38 gene. For example, it may be formed by substituting or deleting 0.1% or more of bases in the full-length DNA.

In addition, the step of inhibiting the expression of the Os12BGlu38 gene may be performed by T-DNA insertion. The T-DNA in the present invention may be inserted into the intron or exon of the Os12BGlu38 gene. For example, a plant containing a homozygote in which T-DNA is inserted into the Os12BGlu38 gene may cause serious problems in pollen development, resulting in male infertility plants. Also, in the present invention, the position at which the T-DNA is inserted into the Os12BGlu38 gene is not particularly limited, and according to a specific embodiment, it may be inserted into the 11th exon ( FIG. 2A ).

In addition, in the above step, in addition to a foreign gene that can be inserted into the plant genome, such as T-DNA, an endogenous transposon such as TOS17 is used or X-rays or gamma-rays are injected to induce mutations or , RNAi or antisense methods, but are not limited thereto.

In addition, the method may further include the step of crossing a plant in which expression of the parent Os12BGlu38 gene is suppressed, and a plant of male fertility as a parent.

In addition, it provides a male sterile plant and seeds thereof prepared by the above manufacturing method.

In addition, the transformation can be made using all commonly used recombinant vectors, but it is preferably made through the introduction of Agrobacterium. In the above, the type of Agrobacterium is not particularly limited.

As used herein, the term "recombinant" refers to a cell in which the cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by the heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the native form of the cell, either in sense or antisense form. Recombinant cells can also express genes found in cells in a natural state, but the genes are modified and re-introduced into cells by artificial means.

In the present invention, the Os12BGlu38 gene sequence may be inserted into a recombinant expression vector. As used herein, the term “recombinant expression vector” refers to a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In general, any plasmid and vector can be used as long as it is capable of replication and stabilization in the host. An important characteristic of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element.

An expression vector containing the Os12BGlu38 gene sequence of the present invention and appropriate transcriptional/translational control signals can be constructed by methods well known to those skilled in the art. The methods include in vitro recombinant DNA techniques, DNA synthesis techniques and in vivo recombination techniques. The DNA sequence can be effectively linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector may also include a ribosome binding site and a transcription terminator as a translation initiation site.

In addition, the expression vector will preferably contain one or more selectable markers. The marker is a nucleic acid sequence having characteristics that can be selected by conventional chemical methods, and includes all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, Bleomycin, hygromycin, chloramphenicol resistance gene, aadA gene, and the like, but is not limited thereto.

The present invention provides a composition for inducing male infertility in plants comprising an agent that inhibits the expression of Os12BGlu38 gene.

In addition, the agent may be selected from the group consisting of siRNA, shRNA, miRNA, and antisense oligonucleotide that specifically binds to the mRNA of the Os12BGlu38 gene.

Next, according to another embodiment of the present invention, there is provided a method for confirming male sterility of a plant, comprising the step of determining whether the Os12BGlu38 gene is expressed.

In addition, the step may be a method of analyzing pollen defects by staining exine, intine, or nucleus of pollen of a plant.

Also, the step may be a method of analyzing a thin film of pollen tissue.

The present invention provides a composition for confirming male infertility of a plant comprising an agent for measuring the mRNA or protein level of the Os12BGlu38 gene.

In addition, the agent may be a primer capable of specifically binding to the Os12BGlu38 gene.

In addition, the agent may be an antibody against the Os12BGlu38 protein consisting of the amino acid sequence of SEQ ID NO: 3.

In the present invention, the term “rice” has a scientific name of Oryza sativa L, and is an annual herbaceous plant, and the rice in the present invention is selected from the group consisting of Japonica type, Indica type and Javanica type. It can be any one.

In the present invention, the term “male infertility” refers to a phenomenon in which pollination, fertilization, and seed phenomena do not occur due to morphological or functional abnormalities of the male organ, and there are cases where it is expressed as an environmental temporary mutation or it is expressed as a genetic trait. , Male infertility in the present invention may be induced as a genetic trait. In particular, male infertility in the present invention may be induced by suppressing the expression of Os12BGlu38 gene, which is involved in intin synthesis in pollen cell wall.

In addition, plants to which the method according to the present invention can be applied include Arabidopsis thaliana, eggplant, tobacco, red pepper, tomato, burdock root, green radish, lettuce, bellflower, spinach, chard, sweet potato, celery, root, water parsley, parsley, Chinese cabbage, cabbage. , radish, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean, pea, etc., or monocotyledonous plant such as rice, barley, wheat, rye, corn, sugarcane, oat, and onion. , preferably monocot plants. The plant may preferably be rice, but is not limited thereto for all plants that require intine synthesis in pollen cell walls.

Hereinafter, embodiments of the present invention will be described in more detail with reference to the accompanying drawings. However, the following examples are only intended to embody the contents of the present invention, and the present invention will not be limited thereby.

<Example 1> Plant material

The allele of os12bglu38-1, which is a loss-of-function mutation of the Os12BGlu38 gene represented by the nucleotide sequence of SEQ ID NO: 1, was identified from line 3A-15719 of rice (cultivar name: Dongjin). Rice is grown in a greenhouse at 30°C during the day to 20°C during the night, at approximately 80% humidity, with a light/dark cycle of 14/10 hours, or under natural environmental conditions in summer (Living Modified). Organisms, LMO) cultivated in paddy fields permitted for cultivation.

<Example 2> GH1 At / Os4 cluster gene T-DNA mutation isolation

Wild-type, heterozygous and homozygous mutant plants were tested with Os12BGlu38 gene-specific F1 (SEQ ID NO: 4) and R1 primers (SEQ ID NO: 5) and T-DNA to amplify wild-type and mutant allele-specific bands with reference to Figure 2A. PCR analysis of genomic DNA isolated from rice leaves was performed using the derived GUS gene-specific primer (SEQ ID NO: 12). T-DNA insertion mutant alleles of Os3bgGlu7 (LOC_Os03g49600), Os3BGlu8 (LOC_Os03g49610) and Os7BGlu26 (LOC_Os07g46280) belonging to the GH1 At/Os4 cluster were additionally isolated and analyzed in the same way as above. Genotyping of these lines was performed using their gene-specific primers and T-DNA-specific primers (see FIG. 8 and Table 1).

order SEQ ID NO: Os12BGlu38 Forward AATTGGGAAACAGGTAAGCAACAATTTAC SEQ ID NO: 4 Reverse CCCAGGATGTTGTTTTCTTTAACCATTAT SEQ ID NO: 5 Os3BGlu7 Forward GACAGTCAAAACATTAGATACGGAAACCAG SEQ ID NO: 6 Reverse ATGTCATAATCATTTAGCCGTATGTCACC SEQ ID NO: 7 Os3BGlu8 Forward TGTATTTTCGGACTATGCTGAGTTTTTGTT SEQ ID NO: 8 Reverse TCTGGCCACATTTATTACAGCAAACTACT SEQ ID NO: 9 Os7BGlu26 Forward ATAATTCAGTTTCTTGTAGTACTGTTTAA SEQ ID NO: 10 Reverse TCCTATTCAACAGCACAGATTTCATTCCC SEQ ID NO: 11

<Example 3> RNA isolation and semi-quantitative RT-PCR analysis

In order to check whether the genes of the GH1 At/Os4 cluster are expressed in the anthers, cDNAs synthesized from mRNA collected from the anthers of wild-type rice were synthesized from Os1BGlu1 (LOC_Os01g32364), Os3BGlu7 (LOC_Os03g49600), Os3BGlu8 (LOC_Os03g4628026) and Os3BGlu8 (LOC_Os03g4628026) was amplified with a primer for (see Table 2). The rice ubiquitin 5 (ubiquitin 5; OsUBQ5, LOC_Os01g22490) gene was amplified using OsUBQ5F (SEQ ID NO: 15) and OsUBQ5R (SEQ ID NO: 16) primers as internal controls to quantify the relative amount of cDNA. As a result, only the Os12BGlu38 gene was strongly detected among the GH1 At/Os4 cluster genes (FIG. 1A). These results mean that only the Os12BGlu38 gene among the GH1 At/Os4 cluster genes is present in anther.

order SEQ ID NO: Os12BGlu38 Forward AGACATCCATCAGCTATCTCAAT SEQ ID NO: 13 Reverse CAAACCTCACTTTTTATCATCTTC SEQ ID NO: 14 Os1BGlu1 Forward TTGTACCGTGGGGTTTGTACAAAG SEQ ID NO: 17 Reverse GTTTCCACTCGAAGTTATCCAGCA SEQ ID NO: 18 Os3BGlu7 Forward GAATCCGACAGTCGTCATAACTGA SEQ ID NO: 19 Reverse ACCAGTAGGCCGACGCCTTGGGGT SEQ ID NO: 20 Os3BGlu8 Forward GTTCCGACTGGCATGTATGGAGCTG SEQ ID NO: 21 Reverse TGATGTGTAACCTGACAGCCACTCG SEQ ID NO: 22 Os7BGlu26 Forward ATCAACAAGGCTGTGACCTATGTAA SEQ ID NO:23 Reverse TGTAGTCCACGTAGACGATGCCAA SEQ ID NO: 24 OsUBQ5 Forward GACTACAACATCCAGAAGGAGTC SEQ ID NO: 15 Reverse TCATCTAATAACCAGTTCGATTTC SEQ ID NO: 16

Then, in order to confirm the expression of Os12BGlu38 at each stage of pollen development, anthers of wild-type rice were collected and classified according to length and aspect. Total RNA of the collected anthers (Anther) was extracted using Trizol reagent (Invitrogen, Gaithersburg, MD). The isolated RNA extract was reverse transcribed using oligo-dT primers and First Strand cDNA Synthesis Kit (Roche, Mannheim, Germany). The synthesized cDNA (SEQ ID NO: 2) was used as a template in a semi-quantitative RT-PCR reaction using Os12BGlu38 gene-specific primers RTF1 (SEQ ID NO: 13) and RTR1 (SEQ ID NO: 14) (see FIG. 2A ). The rice ubiquitin 5 gene (OsUBQ5; LOC_Os01g22490) amplified with OsUBQ5F (SEQ ID NO: 15) and OsUBQ5R (SEQ ID NO: 16) primers was used as a loading control.

As a result, although subtle expression of Os12BGlu38 was observed at all different stages of pollen development, the expression was much higher in bicellular pollen and mature pollen, and the strongest expression was detected in mature pollen (Fig. 1B, left). Also, when comparing the expression of Os12BGlu38 in mature anther and pollen, higher gene expression was expressed in pollen ( FIG. 1B , right). From these results, it can be seen that Os12BGlu38 can be preferentially expressed in pollen rather than anther tissue.

<Example 4> Analysis of ProOs12BGlu38:GUS genetically modified rice

To verify the organ-specific expression pattern of Os12BGlu38, β-glucoronidase (GUS) expressed under the control of the Os12BGlu38 promoter was introduced to construct a ProOs12BGlu38:GUS transporter. To construct the ProOs12BGlu38:GUS transporter, the 5' 2kb upstream region of the Os12BGlu38 gene was first amplified by PCR. The 5' 2kb upstream region of the Os12BGlu38 gene was amplified through PCR. When PCR was performed, wild-type rice DNA was used as a template, and ProOs12BGlu38:GusF (SEQ ID NO: 25) and ProOs12BGlu38:GusR (SEQ ID NO: 26) were used as primers. Then, PCR was performed and the obtained product was cloned into the pENTR ^TM /D-TOPO® vector. Then, the cloned fragment was inserted before the promoter-free GUS reporter gene of pBI101 in order to control the expression of the GUS gene linked to the terminator of the nopaline synthase gene. Transgenic plants were obtained in selective medium containing 50 mg/L hygromycin and 250 mg/L cefotaxime according to the Agrobacterium-mediated cocultivation method. Thereafter, transgenic rice carrying the ProOs12BGlu38:GUS gene was cultivated for three generations. Among all progeny plants, only plants resistant to hygromycin were additionally selected to select homozygotes having the ProOs12BGlu38:GUS gene. Various tissues, including pollen, were prepared using 0.2 M sodium phosphate (pH 7.0), 0.1% 5-bromo-4-chloro-3-indole β-glucuronide (5-bromo-4-chloro-3-indol β- glucuronide), 20% methanol, 2% DMSO, and a GUS reaction solution containing 10 mM EDTA was used for staining. Briefly, all samples containing spikelets from which palea was removed were vacuum infiltrated 3 times for 30 min with GUS reaction solution, incubated at 37° C. overnight, and then transferred to 70% ethanol to remove chlorophyll. did. The stained samples were observed under a dissecting microscope (SZX12, Olympus, Tokyo, Japan).

1C , β-glucoronidase (GUS) activity was not detected in vacuole stage pollen, but was first detected in bicellular pollen and was most detected in mature pollen. . In addition, as a result of examining GUS activity in various organs including pollen, it was not expressed in organs other than pollen, such as stamens, stems, seeds and ears, leaves, and roots (FIG. 7). These results suggest that the Os12BGlu38 gene is specifically expressed only in pollen among various plant organs.

<Example 5> Backcross

According to the results of Examples 3 and 4, it was hypothesized that preferential expression of Os12BGlu38 in pollen may play an important role in plant tissue. T-DNA was inserted at the 3645th sequence position, the 11th exon position of the Os12BGlu38 gene represented by the nucleotide sequence of SEQ ID NO: 1 from the T-DNA-labeled japonica rice (cultivar name: Dongjinbyeo) mutant group. A mutant was created and named os12bglu38-1 (FIG. 2A). To determine whether insertion of T-DNA into the Os12BGlu38 gene altered the genotype, we genotyped the progeny plants of self-fertilizing heterozygous WT(+)/os12bglu38-1(-) plants. The results are shown in Figure 2B and Table 3. In FIG. 2B, Os12BGlu38 was confirmed using the F1/R1 primer set, and os12bglu38-1 was confirmed using the F1/GUS primer set. Wild type when detected only in Os12BGlu38(+), heterozygous when detected in both Os12BGlu38(+) and os12bglu38-1(-). The ratio of wild-type (WT, (+/+)):heterozygous ((+/-)):homozygous mutant (-/-)) appears to be 1:2:1, which is the normal separation ratio. and 1:1:0. This is a progeny genotypic segregation of a typical infertile lineage. Conversely, when the Os3BGlu7, Os3BGlu8 and Os7BGlu26 T-DNA insertion mutants prepared in Example 2 were self-fertilized, a normal separation ratio of 1:2:1 was exhibited, and this result showed that only the Os12BGlu38 gene in the rice GH1 At/Os4 cluster group was self-fertilized. This suggests that it plays an important role in pollen development. Therefore, it was predicted that os12bglu38-1 would have an infertility-inducing function.

system wild type heterozygote X ² Os12BGlu38/os12bglu38-1 31 40 1.141 (P<0.05)

Then, to determine whether Os12BGlu38 induces male infertility, wild-type and heterozygous hybrids were crossed. Before flowering, the healthy spikelet of the panicle of the maternal donor was cut horizontally around the middle, and the anther was completely removed to leave only the pistil. Panicles with anthers removed were covered with a transparent paper bag and placed in the dark. The maternal plants were brought to the vicinity of the paddy fields at noon or flowering the next day. The blossoming panicle used as the pollen donor was collected and then moved closer to the cut spikelet of the parent plant and the pollen dropped onto the pistil. The pollinated panicles were again covered with a transparent paper bag and placed in the greenhouse for 3-4 weeks. The genotype of the crossover line was determined by performing PCR.

As a result of verifying the progeny plant genotype of an intercross of Os12BGlu38/os12bglu38-1 and wild-type, as shown in Table 4, heterozygous (heterozygous) as a pollen recipient (Maternal parent) and a wild-type (Paternal parent, parent) as WT), the phenotype of the one-hybrid (F1) plant showed a similar frequency between the wild type and the heterozygote. In contrast, when a wild-type (WT) as a maternal parent and a heterozygous as a pollen donor (Paternal parent) were crossed, the phenotype of a single-hybrid (F1) plant was only wild-type (WT). appear. These results suggest that Os12BGlu38 deficiency induces male infertility. In addition, it is indicated that male sterility rice can be produced by crossing a pollen recipient whose expression of Os12BGlu38 gene is suppressed (Maternal parent) with a male fertile pollen donor (Paternal parent).

backcross target Backcross result pollen donor flowerpot receiver Observed (%) / Predicted (%)
(Number of Observed Plants / Number of Predicted Plants) Os12BGlu38/os12bglu38-1 Os12BGlu38/Os12BGlu38 (WT) WT Os12BGlu38/os12bglu38-1 100/50 (50/50) 0/50 (0/50) Os12BGlu38/Os12BGlu38 (WT) Os12BGlu38/os12bglu38-1 WT Os12BGlu38/os12bglu38-1 47.2/50 (34/72) 52.8/50 (38/72)

<Example 6> Anther culture

Since the os12bglu38-1 homozygous cannot be produced by self-fertilization, a homozygote in which Os12BGlu38 is not expressed was obtained through anther culture. To create a homozygote containing only the os12bglu38-1 gene, Eom et al. (2016), anther culture was performed according to the method described. After sterilizing the panicle surface with 70% (v/v) ethanol, anther of spikelet _{was cultured in N 6} callus induction medium and homozygous from calli in _{N 6 regeneration medium.} was produced. Homozygous plants obtained through anther culture did not differ significantly from wild-type plants throughout plant development, so it was confirmed that the loss of function of Os12BGlu38 had nothing to do with plant growth.

<Example 7> Histochemical thin film analysis

To investigate the need for Os12BGlu38 for male development, for each of wild-type, heterozygous, and homozygous, microblastic stage (stage 6), vacuolar stage (stage 10), and mitosis (stage 11) out of 13 stages of pollen development. ), a morphological analysis of pollen in the mature pollen stage (step 13) was performed. Anthers at various stages of development are described in Moon et al. (2013) were stained according to the method described. Briefly, harvested anthers were fixed in a formalin-acetic acid-alcohol solution for 8 hours. Then, it was immersed in Technovit® 8100 resin (Kulzer, Hanau, Germany) and cut to a thickness of 10 mm using a rotary microtome (2165, Leica Microsystems, Wetzlar, Germany). Stained cotton was observed using an Olympus BX61 microscope.

The results are shown in FIG. 3 . Pollen development of the three genotypes (wild-type, heterozygous, and homozygous) was similar at stages 6, 10, and 11. Also, in all three genotypes, binuclear pollen grain (BP) was observed in the 11th stage of mitosis. However, in the mature pollen of stage 13, all pollen of the wild type had a round shape and appeared in an intact form filled with starch, whereas half of the pollen of the heterozygote did not contain any starch and an abnormal shape was observed. and the other half showed an intact form similar to that of the wild type. In the case of the homozygous mutant obtained through anther culture, all pollen showed a crescent-shaped form with a retracted crescent like pollen with abnormal shape of the heterozygote, and no starch was detected.

<Example 8> Cytochemical analysis

Due to the difference in pollen phenotype for each genotype of Os12BGlu38 confirmed in Example 7, the nuclei, exine, intine, and starch contained in pollen of rice pollen were stained and observed.

For nuclear staining, first dilute Hoechst 33342 (trihydrochloride trihydrate) to a concentration of 40 mg/mL with distilled water to prevent precipitation, and use a phosphate-buffered saline (PBS) solution of pH 7.4 to 1:1000 to 1: 2000-fold dilution. After harvesting the mature pollen from steps 13 to 14, it was immersed in Hoechst 33342 solution at 65° C. for 1 hour. Bright field images and UV light field images were observed for the dyed pollen using an Olympus BX61 microscope (Olympus, Hamburg, Germany). In general, rice pollen contains three nuclei. As a result of nuclei staining with Hoechst 33342, three nuclei were detected in all pollen of the wild type, whereas pollen of the homozygous mutant was detected. No nuclei were detected in Fig. 9A, C above.

Thereafter, starch staining was performed with Lugol's solution for the pollen of each plant to determine the total amount of starch in the pollen of the os12bglu38-1 homozygous mutant, wild type, and heterozygote. Lugol solution (Sigma Aldrich) was mixed with pollen at the same stage as used for nuclear staining, and bright field images of the stained pollen were observed. As a result, all pollen of the os12bglu38-1 homozygous mutant was not stained, indicating that starch indicates no. On the other hand, all pollen of the wild type and half of the pollen of the heterozygote were darkly stained with iodine (Fig. 9 below). These results indicate that pollen of the os12bglu38-1 homozygous do not complete microgametogenesis, indicating that the Os12BGlu38 gene is essential for the formation of mature pollen.

Exine was stained with 0.001% auramine O in 17% sucrose, and intine was stained with 0.1% Calcofluor white. Bright field images and UV light field images of the dyed pollen were observed with an Olympus BX61 microscope.

The results are shown in FIG. 4 . When exine, the outer pollen cell wall, was stained with an auramine O solution, the intensity of fluorescence observed in wild-type, heterozygous, and homozygote was not significantly different, but the defect was slightly stronger (Fig. 4A- C). When intine, the inner pollen cell wall, was stained with a calcofluor white solution, the heterozygous pollen showed a very low fluorescence signal compared to the normal and bright pollen of the other half (Fig. 4E). ). Similarly, all pollen of the homozygous mutant genotype stained faintly compared to that of the wild type, which exhibited bright blue fluorescence, indicating that pollen containing the os12bglu38-1 gene is defective in the intine cell wall. (Figure 4D and F). These results indicate that the os12bglu38-1 gene, which loses the function of Os12BGlu38, inhibits intine synthesis.

<Example 9> TEM (transmission electron microscope) analysis

Anthers were fixed in a 2.5% glutaraldehyde solution of 0.1M sodium phosphate buffer pH 7.2, and then, using the same buffer, 0.8% osmium tetraoxide (osmium tetroxide, OsO ₄ ) was fixed at room temperature for one day. The sample is then dehydrated through a graded series of ethanol and dipped in Epon 821 resin. Ultra-thin fragments (50 to 70 nm) were sliced using an Ultracut-E (Reichert, Vienna, Austria) ultramicrotome with a diamond knife, 2% (w/v) uranyl acetate and 2.6% It was stained with (w/v) lead citrate aqueous solution. Then, it was irradiated with a JEM-1230 transmission electron microscope (JEOL, Tokyo, Japan) under 80 kV.

As a result, all of the wild-type pollen contained starch granules and exhibited a round shape (FIG. 5A). On the other hand, it was confirmed that the crushed os12bglu38-1 homozygous pollen did not contain starch granules (FIG. 5C). The wild-type mature pollen contained a thick intine layer below the exine, but the os12bglu38-1 homozygous pollen did not contain an intine layer (Fig. 5B, D). These results are consistent with the results of Example 8, which showed a weak fluorescence signal in pollen homozygous for os12bglu38-1 compared to the wild type. However, the exine layer was thicker in os12bglu38-1 homozygous pollen than in wild-type pollen. In addition, the exine sublayer comprising a flat nexine layer and a sexine layer running from the outside to the inside was evident not only in the wild-type pollen but also in the os12bglu38-1 homozygous pollen (Fig. 5B, D). .

<Example 10> Gene function recovery plant analysis

To confirm that pollen defects were caused by Os12BGlu38, a recovery vehicle was transformed into an os12bglu38-1 homozygote. Sequences from all exons, introns, and stop codons to 1 kb 3' downstream region from the start codon of the Os12BGlu38 gene 2 kb 5' upstream using primers Genomic F1 (SEQ ID NO: 27) and Genomic R1 (SEQ ID NO: 28) using primers It was amplified by PCR (see FIG. 10). The PCR product was then cloned into pENTRTM/D-TOPO® vector (Invitrogen, Carlsbad, CA) and sequenced to confirm the sequence. The wild-type gOs12BGlu38 insert was further subcloned into the Gateway cassette-pCAMBIA3301 vector carrying the Bialaphos resistance gene (Bar) as a second selectable marker. The resulting product (Os12BGlu38 gene) was introduced into heterozygous seed-derived rice using an Agrobacterium-mediated transformation method, and transformed calli and plants were isolated with 300 mg/L phosphinothricin. . Transgenic lines carrying wild-type gOs12BGlu38 (os12bglu38-1 homozygous recovery lines) Comp-4, Comp-7, Comp-8 and Comp-19 were cultivated for 3 generations. All progeny plants of the recovery transformation line were selected as resistant to the phosphinothricin used as a marker. Their genotypes were further analyzed by performing PCR on the wild-type gOs12BGlu38 and os12bglu38-1 alleles, respectively. For gOs12BGlu38 analysis, Fcomp (SEQ ID NO: 29) and Rnos primers (SEQ ID NO: 30) were used, and for os12bglu38-1 analysis, F1 (SEQ ID NO: 4) and R2 primers (SEQ ID NO: 37) were used (see Table 5). .

order SEQ ID NO: gOs12BGlu38 Forward TGTGGACACCATAGCCTCACTTTGT SEQ ID NO: 29 Reverse AGACCGGCAACAGGATTCAATC SEQ ID NO: 30 os12bglu38-1 Forward AATTGGGAAACAGGTAAGCAACAATTTAC SEQ ID NO: 4 Reverse ACTGTTTTGGCTTGTGTGGATGGGGCA SEQ ID NO: 37

Progeny plants were produced by self-fertilization of phosphinothricin-resistant transgenic rice (Comp-4, Comp-7, Comp-8 and Comp-19). Genotyping analysis of these progeny plants showed that the wild-type:heterozygous:homozygous ratio was 26:47:24, similar to the 1:2:1 separation ratio of Mendel's genetic law ( FIGS. 10B and 13 ). The F1/R2 primer set of FIG. 10B was used to identify the allele of the wild type, and the F1/GUS primer set was used to confirm the allele of the T-DNA insertion mutation. The Fcomp/Rnos primer set was used as a control to confirm that the transgene was introduced. Although the number of progeny plants was small, all parent plants had homozygous progeny and had more heterozygous progeny plants than wild-type and os12bglu38-1 homozygous progeny plants. These results indicate that the expression of the wild-type Os12BGlu38 gene introduced as a transgene repaired the defect of the Os12BGlu38 gene of the os12bglu38-1 homozygote and restored Mendel's genetic law. In addition, as a result of performing TEM analysis of 13-stage mature pollen selected from the heterozygote of Comp-7, it was confirmed that the phenotype of starch granules and the intin layer were restored similarly to those of the wild type (Fig. 5E, F). ). This indicates that the loss of function of the Os12BGlu38 gene inhibited the development of pollen.

<Example 11> Subcelluar localization of Os12BGlu38

SignalP (http://www.cbs.dtu.dk/services/SignalP/), BaCelLo (http://gpcr.biocomp.unibo.it/bacello/pred.htm) and PrediSi (http://www.predisi) Several computational subcellular localization prediction tools, including .de/index.html), have predicted that Os12BGlu38 has a signal peptide that targets the endoplasmic reticulum. This suggests that they can be secreted extracellularly, similar to Os1BGlu1, Os3BGlu7 and Os3BGlu8, located in secretion pathway organelles such as the endoplasmic reticulum, Golgi apparatus or vacuole or grouped in the same phylogenetic cluster as Os12BGlu38. In addition, transmembrane protein prediction tools TMpred (http://www.ch.embnet.org/software/TMPRED_form.html) (Hofmann and Stoffel, 1993) and DAS (http://www.sbc.su.se/~ miklos/DAS/) suggested that Os12BGlu38 has one transmembrane domain at the N-terminus corresponding to the signal peptide. To clarify the intracellular localization of Os12BGlu38, a vector of Os12BGlu38-GFP fusion was constructed under the control of the maize Ubi promoter and the CaMV35S promoter, and transformed into rice callus and tobacco (Nicotiana benthamiana) leaves.

For the construction of the maize Ubi promoter:Os12BGlu38-GFP fusion vector, the entire open reading frame (ORF) without the stop codon of the Os12BGlu38 cDNA (SEQ ID NO: 2) was transferred to the Os12BGlu38 R C-fusion primer (SEQ ID NO: 31) and Os12BGlu38 Full F primer (SEQ ID NO: 31) and Os12BGlu38 Full F primer (SEQ ID NO: 2). No. 32) and amplified by PCR using a proofreading EF-Taq polymerase (SolGent, Daejeon). Each PCR product was cloned into the pENTRTM/D-TOPO® vector (Invitrogen). Zea mays Ubiquitin1 promoter and GFP were fused to the N-terminus and C-terminus of Os12BGlu38 (ProZmUbi: Os12BGlu38-GFP), respectively, and pENTR/D-TOPO-Os12BGlu38 was a binary pIPKb002 expression vector using LR clonase (Invitrogen, USA). was recombined in ProZmUbi:Os12BGlu38-GFP was transformed into rice callus through Agrobacterium-mediated transformation. The mature pollen of transgenic plants and pore tissues of seedlings grown in 1/2 Murashige and Skoog medium containing hygromycin were visualized with a confocal microscope (LSM 510 META; Carl Jeniss GmbH, Jena, Germany).

In addition, a recombinant vector was constructed for transient expression of the Os12BGlu38-GFP fusion protein and the RFP-AtKOR fusion protein in tobacco. The ProCaMV35S:Os12BGlu38-GFP vector was constructed by recombination of the pENTR/D-TOPO-Os12BGlu38 vector with the binary vector p2GWF7. To construct the ProCaMV35S:RFP-AtKOR vector, AtF1Kor1RFP (SEQ ID NO: 35) and AtR1Kor1RFP (SEQ ID NO: 36) primers were used to amplify Arabidopsis KOR (AT5G49720) from young Arabidopsis leaf cDNA. The AtKOR gene product was used as a cell membrane marker protein. The PCR product was inserted after ProCaMV35S:RFP. Os12BGlu38-GFP and RFP-AtKOR were infiltrated into Nicotiana benthamiana leaves together with Agrobacterium carrying a plant expression vector of Tomato Bushy Stunt Virus P19 protein using Agrobacterium-mediated infiltration. Transgene expression of mesophyll cells was monitored using a confocal microscope (LSM 510 META) 3 to 4 days after invasion.

The white tissue of 4-5 day-old coleoptile of transgenic rice (ProZmUbi:Os12BGlu38-GFP) showed GFP signals at the cell wall and the edge of the cell membrane, and FM4-64 located at the cell membrane was colored red. indicated (Fig. 6A-D). This result suggests that Os12BGlu38 may be a cell membrane or cell wall protein. In addition, when 20 mM sucrose was added to separate the cell wall and the cell membrane, fluorescence was observed. As a result, most of the GFP fluorescence signal was observed in the cell membrane (FIGS. 6E-G). Sequential image sections of the z-series in mature pollen revealed a significant GFP signal in the outer layer composed of the cell wall (Fig. 6H). These results demonstrate that Os12BGlu38 can be an extracellular membrane or cell wall-associated protein.

In addition, when the cell membrane and the cell wall were separated from the N. benthamiana leaf epidermal cells transformed for transient expression of the fusion protein, most of the GFP signals were exhibited in the cell membrane (FIG. 11). The fluorescence of the two proteins partially overlapped in N. benthamiana leaf epidermal cells infiltrated with ProCaMV35S:Os12BGlu38-GFP and RFP-AtKOR [Arabidopsis Korrigan (KOR)] (Fig. 12). Most of the GFP signal appeared to be located near the cell membrane, whereas the red Korrigan signal was anchored to the cell membrane. This suggests that Os12BGlu38 is an extracellular membrane-associated protein.

As described above, although specific embodiments of the present invention have been described in detail, those skilled in the art who understand the spirit of the present invention may add, change, delete, etc. other components within the scope of the same spirit, and other degenerate inventions However, other embodiments included within the scope of the present invention may be easily proposed. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention is indicated by the following claims rather than the above detailed description, and all changes or modifications derived from the meaning and scope of the claims and their equivalents are included in the scope of the present invention. should be interpreted as

<110> University-Industry Cooperation Group of Kyung Hee University <120> Os12Bglu38 for male sterility induction in rice and use thereof <130> GKH19P-0297-EN <160> 37 <170> KoPatentIn 3.0 <210> 1 <211> 4048 <212> DNA <213> Oryza sativa <220> <221> gene <222> (1)..(4048) <223> BGlu38 <400> 1 gtagaccacg acatcgtgag ggaggtgaga cgggcgacac accacgaaga cgtaatagga 60 cggtggaggc aaatgggggc atcaagaaac cagtggttag gtgacgacaa tggcacatcc 120 tatggcggaa tacaaaggaa acatcagaga aattaaggta gtgtggggct ttagagacaa 180 agaatatata caggtaatgg gaagaattaa ttgagccaga gtgccagagc agaaggagac 240 ggtgttgggg ctagccaaac aacatctcta gtgggtcttt aacggtcgta gcgagataga 300 caagtggtgg cacgtagaac agaaatagtg atgaaaagac ggtggcggtg gaagctgtgg 360 catagaggag acgctcatat gagtgggttg agggtgggcc agtggaggac tggtggaaga 420 tagcaggaca tggacagcag ttggatctta atccggtggt aaaaaacttg tcatatttaa 480 aggggagttt ttttaaatat gatatactat ctgtatctca aaatataaca tttttttact 540 gtgtatttgg ggatctcaga aattgttata ttttcagact gaggtacgta ccatgcagtt 600 tccaaattta aaggcgataa gctcactgtc atgcccacta gtccagacgg tgtttaaccc 660 atcacctgat taaaagaaga aaaaaaaaca gggtaaaaac agaaatagaa aaaaataaaa 720 aaaattctag tggctcagga ccagtgcaag ccacactgct ccacaaaggc agggtggaag 780 gagtcctcct tgccgctgcc accattcgtg ccagagaaaa tcgctgttcc cctgctgcat 840 gcatgcatcg ccccgccctg accacttcac ctgcctctcc atatatacgc agtttgcagc 900 agatcagaca ctctcaccgc cgctctctct tcctctccaa catgaatatg ccattgctac 960 tcctcatcgc catcgtcgtc gtctccctct cccatggcaa cggggagcag accgacctca 1020 cgcgggagac gttccccgcg ggcttcgtct tcggcaccgc gtcgtcggcg taccaggtgg 1080 aggggaacgc cctccagtat ggccgagggc cctgcatctg ggacaccttc ctgatgcaac 1140 ctggtgagat cgatgataca tgttcaggca aaactagcaa tgtggtatct aaatatacag 1200 atcataaaca gtttgtcgca tttttcaaat aatggaatta acaatgtgtt gggacgatcc 1260 acctaaaaag agaatatgac aacaacaatc taaaaagaat tacatagcct gatattgaaa 1320 tgttgttgca ttacggcgcg ttgcattttg tacgtctcta gtggatgtat gactggttgt 1380 tgatttggct ctgattgttc ctttggatag gtgtaactcc tgataattcg accgcgaatg 1440 tgaccgtcga cgagtaccac cgctacatgg tcagtgaaag tctcatgtgt ttcagtgcct 1500 gttctaatgg gtttctgttc ctctgtatga ctcttgattt gtagcttatg tggctcctct 1560 gatgatcttc tttgcaggat gatgtggaca acatggtgag agtgggcttc gacgcgtatc 1620 gcttctcgat ctcctggtct cgcattttcc ccagtaagtt accggctgaa acatggtcag 1680 gcacagtgat gagatcatgg gatattcctt tcattgatgg tttttcttct gcgtgttgta 1740 ggtggacttg ggaagattaa caaagacggc gtggattatt accacaggct cattgattac 1800 atgcttgcta acagtacgtt ggtcttggca tttcttctag ttcttgccca tttcggattt 1860 catgatctcg aattaatagg tttttttttg gtttgatttg cacatcagac attattccat 1920 atgttgtgct ctaccactac gaccttccac aggtgctcca tgatcaatac aagggatggc 1980 tacaccccag aattgtgtaa gtgttcgtga tcaaagccat ctgtttggct gtaaaactta 2040 aaattaaata ccctttaaat tgtttgacaa actacagaag cacctctgaa gattttgtgc 2100 taaattatga aacccatagc tctctaactg cgaaatcctg acagtgaaag ttctgcaggt 2160 gtttaaccaa aataggtttc actgtagcat atccgacata cacaaatatc aaacccagac 2220 aatctgtatc ctccctttct tacgttcctt actccctttt tcttgaatta atgtgtgatt 2280 catgtctgcg acttcatttt gcaggagaga ttttgtgaga tttgcagact tctgcttcaa 2340 gacatatggt cataaggtga agaactggtt taccattaac gaacctagga tgatggcaaa 2400 tcatggctac ggtgacggct tcttcccccc tggcagatgc accggctgcc aacccggtgg 2460 gaattccgcc accgagcctt acatcgcagc ccataacctt ctcctttcac atgccgctgc 2520 tgtcaggaca tatcgtgaca agtaccaggc tagtgaatga tatccatgcc cctactatcc 2580 aattcaacat ttcttaaaat ctccaatgta tcagctcatg ttcatgatac cttgcgattt 2640 tcaggctatt cagaagggga agattggcat ccttctcgat tttgtatggt atgagccact 2700 caccgacaaa gaagaggatc acgcagctgc acatagagcc agggagttta cccttggctg 2760 gtgatacatc ttacactgtt catcaatcat tgctcttaca cggtgtccgc atgaaggttg 2820 aactgaactt ccacttgaaa cttttgctag gtacctgcac ccgattacat atggtcatta 2880 cccagaaact atgcagaatg ctgttaagga aaggctgccc aatttcacac gtgagcagtc 2940 tgagatgata aaaggatcag cggattatat tgcgatcaac cattacacaa cttattatgt 3000 cagtcaccac gtcaacaaga catccatcag ctatctcaat gattgggatg tgaaaatttc 3060 atgtatgaca ctttcaaatc acacagtatt agaccagaaa tatttgtacc ttttcaattc 3120 tttgccttcc tagctaacac attttggtcc tctattcaga tgagcgtaac ggtgtgccaa 3180 ttgggaaaca ggtaagcaac aatttacaag aaaggttgaa aagaatggta gatcatgaac 3240 taaattctgg tttttaaaca tctatgcagg cgtactcgaa ctggctttat gttgttcctt 3300 gggggatcta caaagctgtc atgcatgtca aggagaagta caaggacccc attataatca 3360 tcggagaaaa tggtaaataa agataatact ggagaccctt tcaattttcg gacagtgaac 3420 agtacaacta taaaagtgct ctgcagaatg aatctaggag caaaatctaa caagaacctt 3480 ttgcaggcat tgaccagcca ggcaatgaga ccctacctgg tgcactgtat gacttcttca 3540 ggatacaata ttttgatcag tacctccatg agcttaagag ggcgatcaag gatggtgcaa 3600 gggtcactgg gtattttgct tggtccctgc ttgacaactt cgagtggcgg ctcgggttca 3660 cttcaaaatt cggaatcgtc tatgtagacc ggagcacttt cacacggtac cctaaagact 3720 caacacgttg gttcaggaag atgataaaaa gtgaggtttg agttggatta ttatcactgt 3780 tggcagctgc tggagtgctt ttttgttatg ctagttttgg ttgtatgaat aataagatgt 3840 cttgtactag ttgagaactt cttcagattt tgtacttcta gtattctact ttttgtactt 3900 cagattttgc aagcaaggat gattttagtt taatagattc aggacatcta tatatactgg 3960 tgataagaga ggcagatttc aatttttggc ttgaattgcc catatttgtg ttttccaatg 4020 ttttttaact tcaaatttta aactttgg 4048 <210> 2 <211> 2820 <212> DNA <213> Oryza sativa <220> <221> gene <222> (1)..(2820) <223> cDNA <400> 2 atgaatatgc cattgctact cctcatcgcc atcgtcgtcg tctccctctc ccatggcaac 60 ggggagcaga ccgacctcac gcgggagacg ttccccgcgg gcttcgtctt cggcaccgcg 120 tcgtcggcgt accaggtgga ggggaacgcc ctccagtatg gccgagggcc ctgcatctgg 180 gacaccttcc tgatgcaacc tggtgagatc gatgatacat gttcaggcaa aactagcaat 240 gtggtatcta aatatacaga tcataaacag tttgtcgcat ttttcaaata atggaattaa 300 caatgtgttg ggacgatcca cctaaaaaga gaatatgaca acaacaatct aaaaagaatt 360 acatagcctg atattgaaat gttgttgcat tacggcgcgt tgcattttgt acgtctctag 420 tggatgtatg actggttgtt gatttggctc tgattgttcc tttggatagg tgtaactcct 480 gataattcga ccgcgaatgt gaccgtcgac gagtaccacc gctacatggt cagtgaaagt 540 ctcatgtgtt tcagtgcctg ttctaatggg tttctgttcc tctgtatgac tcttgatttg 600 tagcttatgt ggctcctctg atgatcttct ttgcaggatg atgtggacaa catggtgaga 660 gtgggcttcg acgcgtatcg cttctcgatc tcctggtctc gcattttccc cagtaagtta 720 ccggctgaaa catggtcagg cacagtgatg agatcatggg atattccttt cattgatggt 780 ttttcttctg cgtgttgtag gtggacttgg gaagattaac aaagacggcg tggattatta 840 ccacaggctc attgattaca tgcttgctaa cagtacgttg gtcttggcat ttcttctagt 900 tcttgcccat ttcggatttc atgatctcga attaataggt ttttttttgg tttgatttgc 960 acatcagaca ttattccata tgttgtgctc taccactacg accttccaca ggtgctccat 1020 gatcaataca agggatggct acaccccaga attgtgtaag tgttcgtgat caaagccatc 1080 tgtttggctg taaaacttaa aattaaatac cctttaaatt gtttgacaaa ctacagaagc 1140 acctctgaag attttgtgct aaattatgaa acccatagct ctctaactgc gaaatcctga 1200 cagtgaaagt tctgcaggtg tttaaccaaa ataggtttca ctgtagcata tccgacatac 1260 acaaatatca aacccagaca atctgtatcc tccctttctt acgttcctta ctcccttttt 1320 cttgaattaa tgtgtgattc atgtctgcga cttcattttg caggagagat tttgtgagat 1380 ttgcagactt ctgcttcaag acatatggtc ataaggtgaa gaactggttt accattaacg 1440 aacctaggat gatggcaaat catggctacg gtgacggctt cttcccccct ggcagatgca 1500 ccggctgcca acccggtggg aattccgcca ccgagcctta catcgcagcc cataaccttc 1560 tcctttcaca tgccgctgct gtcaggacat atcgtgacaa gtaccaggct agtgaatgat 1620 atccatgccc ctactatcca attcaacatt tcttaaaatc tccaatgtat cagctcatgt 1680 tcatgatacc ttgcgatttt caggctattc agaaggggaa gattggcatc cttctcgatt 1740 ttgtatggta tgagccactc accgacaaag aagaggatca cgcagctgca catagagcca 1800 gggagtttac ccttggctgg tgatacatct tacactgttc atcaatcatt gctcttacac 1860 ggtgtccgca tgaaggttga actgaacttc cacttgaaac ttttgctagg tacctgcacc 1920 cgattacata tggtcattac ccagaaacta tgcagaatgc tgttaaggaa aggctgccca 1980 atttcacacg tgagcagtct gagatgataa aaggatcagc ggattatatt gcgatcaacc 2040 attacacaac ttattatgtc agtcaccacg tcaacaagac atccatcagc tatctcaatg 2100 attgggatgt gaaaatttca tgtatgacac tttcaaatca cacagtatta gaccagaaat 2160 atttgtacct tttcaattct ttgccttcct agctaacaca ttttggtcct ctattcagat 2220 gagcgtaacg gtgtgccaat tgggaaacag gtaagcaaca atttacaaga aaggttgaaa 2280 agaatggtag atcatgaact aaattctggt ttttaaacat ctatgcaggc gtactcgaac 2340 tggctttatg ttgttccttg ggggatctac aaagctgtca tgcatgtcaa ggagaagtac 2400 aaggacccca ttataatcat cggagaaaat ggtaaataaa gataatactg gagacccttt 2460 caattttcgg acagtgaaca gtacaactat aaaagtgctc tgcagaatga atctaggagc 2520 aaaatctaac aagaaccttt tgcaggcatt gaccagccag gcaatgagac cctacctggt 2580 gcactgtatg acttcttcag gatacaatat tttgatcagt acctccatga gcttaagagg 2640 gcgatcaagg atggtgcaag ggtcactggg tattttgctt ggtccctgct tgacaacttc 2700 gagtggcggc tcgggttcac ttcaaaattc ggaatcgtct atgtagaccg gagcactttc 2760 acacggtacc ctaaagactc aacacgttgg ttcaggaaga tgataaaaag tgaggtttga 2820 2820 <210> 3 <211> 60 <212> PRT <213> Oryza sativa <400> 3 Met Asn Met Pro Leu Leu Leu Leu Ile Ala Ile Val Val Val Ser Leu 1 5 10 15 Ser His Gly Asn Gly Glu Gln Thr Asp Leu Thr Arg Glu Thr Phe Pro 20 25 30 Ala Gly Phe Val Phe Gly Thr Ala Ser Ser Ala Tyr Gln Val Glu Gly 35 40 45 Asn Ala Leu Gln Tyr Gly Arg Gly Pro Cys Ile Trp 50 55 60 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> F1 primer <400> 4 aattgggaaa caggtaagca acaatttac 29 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> R1 primer <400> 5 cccaggatgt tgttttcttt aaccattat 29 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Os3BGlu7-1F primer <400> 6 gacagtcaaa cattagatac ggaaaccag 29 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Os3BGlu7-1R primer <400> 7 atgtcataat catttagccg tatgtcacc 29 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Os3BGlu8-1F primer <400> 8 tgtattttcg gactatgctg agttttgtt 29 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Os3BGlu8-1R primer <400> 9 tctggccaca tttattacag caaactact 29 <210> 10 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Os7BGlu26-1F primer <400> 10 ataattcagt ttcttgtagt actgtttaa 29 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Os7BGlu26-1R primer <400> 11 tcctattcaa cagcacagat ttcattccc 29 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GUS primer <400> 12 atccagactg aatgcccaca gg 22 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> RTF1 primer <400> 13 agacatccat cagctatctc aat 23 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RTR1 primer <400> 14 caaacctcac tttttatcat cttc 24 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OsUBQ5F primer <400> 15 gactacaaca tccagaagga gtc 23 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsUBQ5R primer <400> 16 tcatctaata accagttcga tttc 24 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RTBGlu1F primer <400> 17 ttgtaccgtg gggtttgtac aaag 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RTBGlu1R primer <400> 18 gtttccactc gaagttatcc agca 24 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RTBGlu7F primer <400> 19 gaatccgaca gtcgtcataa ctga 24 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RTBGlu7R primer <400> 20 accagtaggc cgacgccttg gggt 24 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RTBGlu8F primer <400> 21 gttccgactg gcatgtatgg agctg 25 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RTBGlu8R primer <400> 22 tgatgtgtaa cctgacagcc actcg 25 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RTBGlu26F primer <400> 23 atcaacaagg ctgtgaccta tgtaa 25 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RTBGlu26R primer <400> 24 tgtagtccac gtagacgatg ccaa 24 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ProOs12Bglu38:GusF primer <400> 25 tcatctaata accagttcga tttc 24 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ProOs12Bglu38:GusR primer <400> 26 gttggagagg aagagagagc gg 22 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Genomic F1 primer <400> 27 caccaccaat atacttttca ctcttagctc 30 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Genomic R1 primer <400> 28 gatcctctcc tctcattctt tcttc 25 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Fcomp primer <400> 29 tgtggacacc atagcctcac tttgt 25 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Rnos primer <400> 30 agaccggcaa caggattcaa tc 22 <210> 31 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Os12BGlu38 R C-fusion primer <400> 31 aacctcactt tttatcatct tcctga 26 <210> 32 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Os12BGlu38 Full F primer <400> 32 caccatgaat atgccattgc tactcctc 28 <210> 33 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Recombinant F1 primer <400> 33 ggatccgggg agcagaccga cctcacgcgg 30 <210> 34 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Recombinant R1 primer <400> 34 tctagatcaa acctcacttt ttatcat 27 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> AtF1Kor1RFP primer <400> 35 caccatgtac ggaagagatc catggggagg 30 <210> 36 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AtR1Kor1RFP primer <400> 36 tcaaggtttc catggtgctg gtg 23 <210> 37 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> R2 primer <400> 37 actgttttgg cttgtgtgga tggggca 27

Claims (17)

A method of inducing male infertility in a plant, comprising the step of suppressing the expression of Os12BGlu38 (Oryza sativa beta-glucosidase 38) gene represented by the nucleotide sequence of SEQ ID NO: 1 in a plant. According to claim 1,
The method is a method for inducing male infertility in a plant, characterized in that it regulates intin synthesis in the pollen cell wall of the plant. A method for producing a male sterile plant, comprising the step of inhibiting the expression of the Os12BGlu38 gene using a loss-of-function mutation of the Os12BGlu38 (Oryza sativa beta-glucosidase 38) gene represented by the nucleotide sequence of SEQ ID NO: 1. 4. The method of claim 3,
The method for producing a male infertile plant, characterized in that the plant is rice. 4. The method of claim 3,
The step is Os12BGlu38 (Oryza sativa beta-glucosidase 38) A method for producing a male infertile plant, characterized in that made by substituting or deleting some bases of the gene. 4. The method of claim 3,
The step is a method for producing a male infertile plant, characterized in that made by T-DNA insertion. 4. The method of claim 3,
The method is a method for producing a male infertile plant, further comprising the step of crossing the parent plant, the expression of the Os12BGlu38 gene is suppressed, and the parent male plant of male fertility. A male infertile plant prepared by the method of any one of claims 3 to 7. The seed of the male infertile plant of claim 8. A composition for inducing male infertility in plants, comprising an agent that inhibits the expression of Os12BGlu38 gene. 11. The method of claim 10,
The agent is selected from the group consisting of siRNA, shRNA, miRNA and antisense oligonucleotides that specifically bind to the mRNA of the Os12BGlu38 gene, the composition for inducing male infertility in rice. A method for determining male sterility of a plant, comprising the step of determining whether the Os12BGlu38 gene is expressed. 13. The method of claim 12,
The method of confirming male sterility of a plant, wherein the step is characterized in that the defect of the pollen is confirmed by staining the exine, intine, or nucleus of the pollen of the plant. 13. The method of claim 12,
The step is a method of confirming male sterility of a plant, characterized in that the analysis of the thin film of pollen tissue. A composition for confirming male infertility of plants, comprising an agent for measuring the mRNA or protein level of the Os12BGlu38 gene. 16. The method of claim 15,
The agent is a primer that can specifically bind to the Os12BGlu38 gene, a composition for confirming male sterility of a plant. 16. The method of claim 15,
The formulation is characterized in that the antibody against the Os12BGlu38 protein consisting of the amino acid sequence of SEQ ID NO: 3, a composition for confirming male sterility of a plant.

Images