KR20210119176A - Composition for preventing or treating systemic scleroderma - Google Patents

Abstract

The present invention relates to a composition for preventing or treating scleroderma, wherein a miR-21-5p inhibitor of the present invention alleviates and ameliorates symptoms of scleroderma, reduces lung fibrosis, reduces inflammatory cytokines, and inhibits and reduces STAT3 activity, the miR-21-5p inhibitor can be used not only for the prevention and treatment of scleroderma, but also as an inhibitor of STAT3 activity.

Description

Composition for preventing or treating skin sclerosis {COMPOSITION FOR PREVENTING OR TREATING SYSTEMIC SCLERODERMA}

The present invention relates to a composition for preventing or treating scleroderma.

Autoimmune disease refers to a disease in which the body's immune system attacks normal and healthy tissues, organs, or other body components. Many autoimmune diseases result from an abnormal immune response in the body and cause self-destruction. Famous examples include rheumatoid arthritis (RA), systemic sclerosis (SSc), systemic lupus erythematosus (SLE), scleroderma, polymyositis, dermatomyositis, anaphylactic purpura, Sjogren's syndrome, and the like. Other diseases such as primary biliary cirrhosis (PBC), chronic active hepatitis, and Hashimoto's thyroiditis are all associated with autoimmune diseases.

On the other hand, Systemic scleroderma is a progressive, debilitating autoimmune disorder, also referred to as dermal fibrosis, characterized by excessive protein deposition into the extracellular matrix by skin fibroblasts. It is characterized by vascular damage and progressive fibrosis. In general, the most obvious clinical symptoms are skin hardening and associated scarring, for example, hardening, redness, or peeling of the skin. SSc is caused by activated fibroblasts that excessively produce connective tissue components such as collagen, and causes changes in the connective tissue of the skin, resulting in a defect in its function. SSc is a limited type in which skin hardening occurs only on the hands below the elbow, feet below the knee, and face, depending on the site of the disease, and skin is also affected in more areas, such as the skin above the elbow and above the knee, and the body. It is broadly classified as a diffuse type accompanied by invasion of internal organs such as the kidneys and lungs with changes in hardness. Patients with restricted SSc have a 5-year survival rate of more than 90%, but the prognosis of patients with diffuse SSc is poor, showing a 5-year survival rate of only 50 to 70%. Patients with diffuse skin disease often show upregulation of unique markers in the skin, such as type I interferon (IFN)-induced genes. The hypothesis that IFN plays a role in skin fibrosis is supported by a recent report of scleroderma in patients receiving IFN treatment for chronic viral infections (Varga & Abraham (2007) J. Clin. Invest. 117:557- 567 and Coelho et al. (2008) Immunol. Lett. 118:110-115). The lesion of SSc can be characterized by symptoms such as tissue fibrosis, vasculopathy of small blood vessels, and autoimmune disease specific to autoantibodies. .

Although some currently available drugs can soften the skin and reduce inflammation, there is a need for additional and effective drugs for the etiological treatment of scleroderma.

It is an object of the present invention to provide a pharmaceutical composition for preventing or treating skin sclerosis.

It is also an object of the present invention to provide inhibitors of STAT3 activity.

In addition, it is an object of the present invention to provide a method for reducing or inhibiting the activity of STAT3.

In order to solve the above problems, the present invention provides a pharmaceutical composition for preventing or treating scleroderma comprising a miR-21-5p inhibitor as an active ingredient.

In addition, the present invention provides an inhibitor of STAT3 activity comprising a miR-21-5p inhibitor.

In addition, the present invention provides a method for reducing or inhibiting the activity of STAT3 comprising the step of treating a miR-21-5p inhibitor in vitro.

According to the present invention, miR-21-5p inhibitor relieves and ameliorates the symptoms of scleroderma, reduces lung fibrosis, reduces inflammatory cytokines, and inhibits and reduces STAT3 activity, thereby preventing and treating scleroderma. It can be used as a STAT3 activity inhibitor as well as for use.

1 is a diagram confirming the symptom relief effect of scleroderma by treatment with a miR21 inhibitor.
2 is a diagram confirming the intensification of symptoms of scleroderma by miR21 precursor treatment.
3 is a diagram confirming the effect of reducing lung fibrosis by miR21 inhibitor treatment in an animal model of scleroderma.
4 is a diagram confirming the deepening of lung fibrosis symptoms by miR21 precursor treatment in an animal model of scleroderma.
5 is a diagram confirming the inflammatory cytokine reduction effect by the miR21 inhibitor treatment in an animal model of scleroderma.
6 is a diagram confirming the increase of inflammatory cytokines by miR21 precursor treatment in an animal model of scleroderma.
7 is a diagram confirming the increase in STAT3 activity by miR21 precursor treatment in an animal model of scleroderma.
8 is a diagram confirming the STAT3 activity inhibition effect by the miR21 inhibitor treatment in an animal model of scleroderma.

Hereinafter, the present invention will be described in detail as an embodiment of the present invention with reference to the accompanying drawings. However, the following embodiments are presented as examples of the present invention, and when it is determined that detailed descriptions of well-known techniques or configurations known to those skilled in the art may unnecessarily obscure the gist of the present invention, the detailed description may be omitted, and , the present invention is not limited thereby. Various modifications and applications of the present invention are possible within the scope of equivalents interpreted therefrom and the description of the claims to be described later.

In addition, the terms used in this specification are terms used to properly express the preferred embodiment of the present invention, which may vary according to the intention of a user or operator, or customs in the field to which the present invention belongs. Accordingly, definitions of these terms should be made based on the content throughout this specification. Throughout the specification, when a part "includes" a certain component, it means that other components may be further included, rather than excluding other components, unless otherwise stated.

All technical terms used in the present invention, unless otherwise defined, have the meaning as commonly understood by one of ordinary skill in the art of the present invention. In addition, although preferred methods and samples are described herein, similar or equivalent ones are also included in the scope of the present invention. The contents of all publications herein incorporated by reference are incorporated herein by reference.

In one aspect, the present invention relates to a pharmaceutical composition for preventing or treating scleroderma comprising a miR-21-5p inhibitor as an active ingredient.

In one embodiment, the miR-21-5p inhibitor may include a nucleic acid represented by the nucleotide sequence of SEQ ID NO: 1 or a nucleic acid encoding and expressing the same, and may be a plasmid comprising the same, and is used in the art. It can be administered in a plasmid form, a vector form, an antisense form, an shRNA form, an oligo form, and the like.

In one embodiment, the composition of the present invention may contain the miR-21-5p inhibitor at a concentration of 10-500 μg per dose, and the total amount of the miR-21-5p inhibitor at a concentration of 10-5000 μg.

In one embodiment, the composition of the present invention can reduce or inhibit the expression of inflammatory cytokines TNF-α, IL-1β, IL-6 or IL-17.

In one embodiment, the composition of the present invention is capable of reducing or inhibiting the activity of STAT3.

In one embodiment, the miR-21-5p may include a nucleic acid represented by the nucleotide sequence of SEQ ID NO: 2, and is a mature miRNA.

In one embodiment, the composition of the present invention can reduce or inhibit fibrosis.

As used herein, the term “miR21” refers to “miR-21-5p” and may be used interchangeably.

As used herein, the term “anti-miR21” refers to a “miR21 inhibitor”, and may also be used interchangeably with “anti-miR-21-5p”.

Small RNA (hereinafter referred to as “sRNA”) refers to a ribonucleic acid having a length of about 17 to 25 nucleotides (nucleotide: hereinafter referred to as “nt”), which plays a role in regulating gene expression in vivo. sRNA is largely classified into microRNA (microRNA, miR: hereinafter referred to as “miRNA”) and small interfering RNA (hereinafter referred to as “siRNA”) according to the method in which it is produced. miRNA is produced from partially double-stranded hairpin RNA, and siRNA is derived from long double-stranded RNA (hereinafter referred to as "dsRNA"). Generally, it plays an important role in various regulatory processes in vivo. sRNA that does this is miRNA, and sRNA used to control the expression of a specific gene in the experimental technique is classified as siRNA.

miRNA is an endogenous hairpin-shaped transcript (Bartel, DP, Cell 116:281-) as a single-stranded RNA (hereinafter referred to as “ssRNA”) molecule of 19-25 nt in length. 297, 2004; Acts as a transcriptional gene suppressor and suppresses target genes by inducing translational repression and mRNA destabilization miRNAs play an important role in various processes such as development, differentiation, proliferation, apoptosis and metabolism. do.

In addition, miRNA biosynthesis is initiated via transcription by RNA polymerase II (Cai. X., et al., RNA 10:1957-1966, 2004; Kim, VN Nat. Rev. Mol. Cell. Biol. 6: 376-385, 2005; Lee, Y., et al., EMBO J 21:4663-4670,2002; Lee, Y., et al., EMBO J 23:4051-4060, 2004). Primary miRNA (primary microRNA: hereinafter referred to as “pri-miRNA”) usually exceeds a length of several Kb, and includes a 5' cap and poly A tail. pri-miRNA is ribocuclease III, Drosha (Lee, Y., et al., Nature 425:415-419, 2003) and its sub-element DGCR8 (Gregory, RI et al., Nature 432:235-240) , 2004; Han, J., et al., Genes Dev. 18:3016-3027, 2004; Landthaler, M., et al., Curr. Biol. 14:2162-2167, 2004). ) is first cleaved by a complex called ) and separated into about 65 nt hairpin-structure precursors (pre-miRNA). The pre-miRNA process is a central step in miRNA biosynthesis and is defined as the process of generating one end of a molecule containing an mRNA sequence in a long pre-miRNA. The pre-miRNA generated after the initiation process is transported to the cytoplasm by the nuclear transport factor Exp5 (exportin-5) (Bohnsack, MT, et al., RNA 10:185-191, 2004; Lund, E., et al.) al., Science 303:95-98, 2004; Yi, R., et al., Genes Dev. 17:3011-3016, 2003). In the cytoplasm, Dicer, an intracytoplasmic RNase III type protein, cuts the delivered pre-miRNA to generate a 22 nt miRNA double strand. One strand of the Dicer product is a mature miRNA that exists in the cytoplasm and assembles with an effector complex called miRNP (microribonucleoprotein) or miRISC (miRNA-induced silencing complex) (Khvorova, A., et al. , Cell 115:209-216, 2003; Schwarz, DS, et al., Cell 115:199-208, 2003). The RNAi phenomenon, which is a gene silencing mechanism by sRNA, is being used as an effective gene research tool in mammalian systems. Effective and stable gene knockdown occurs when small hairpin RNA (small hairpin RNA: hereinafter referred to as "shRNA") is expressed and processed into small interfering RNA (siRNA). Recent advances in RNAi technology have been made by constructing shRNA expression cassettes that mimic natural miRNA genes (Dickins, RA, et al., Nat. Genet. 37:1289-1295, 2005; Silva, JM et al., Nat Genet. 37:1281-1288, 2005: Zeng, Y., et al., Mol. Cell 9:1327-1333. 2002). The miRNA-based shRNA regulated by the RNA polymerase II promoter effectively and stably induces gene silencing regulation in cultured cells such as animal models.

The pharmaceutical composition of the present invention may further include an adjuvant. The adjuvant may be used without limitation as long as it is known in the art, and for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase the immunity thereof.

As used herein, the term "treatment" means, unless otherwise stated, the disease or condition to which the term applies, or one or more symptoms of the disease or disorder, which reverses, ameliorates, inhibits the progression, or It means to prevent, and the term treatment as used in the present invention refers to the act of treating scleroderma. Accordingly, treatment or therapy for scleroderma in a mammal may include one or more of the following:

(1) inhibiting the growth of scleroderma, ie, arresting its development;

(2) preventing the spread of scleroderma, ie, preventing metastasis;

(3) alleviating scleroderma;

(4) preventing recurrence of scleroderma; and

(5) alleviating the symptoms of scleroderma (palliating)

As used herein, the term "mammal" refers to a mammal that is the subject of treatment, observation or experimentation, preferably a human.

A composition is indicated to be "pharmaceutically or physiologically acceptable" if the recipient animal can tolerate administration of the composition, or if administration of the composition to that animal is suitable. When the amount administered is physiologically important, the agent can be said to have been administered in a "therapeutically effective amount". An agent is physiologically meaningful if the presence of the agent results in a physiologically detectable change in the recipient patient.

The therapeutically effective amount of the composition of the present invention may vary depending on several factors, for example, the administration method, the target site, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined as an appropriate amount in consideration of both safety and efficiency. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These considerations in determining effective amounts are found, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not to cause side effects, and the effective dose level is determined by the patient's Health status, disease type, severity, drug activity, drug sensitivity, administration method, administration time, administration route and excretion rate, treatment period, factors including drugs used in combination or concurrently, and other factors well known in the medical field can be determined according to The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

The composition of the present invention may also include carriers, diluents, excipients or combinations of two or more commonly used in biological agents. A pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc. Compounds described in , saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components can be mixed and used as needed. Conventional additives may be added. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to formulate into injectable formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, granules or tablets. Furthermore, it can be preferably formulated according to each disease or component using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

The pharmaceutical composition of the present invention may be formulated in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, or sterile injection solutions according to conventional methods, respectively. have.

As used herein, the term “pharmaceutically acceptable” refers to exhibiting non-toxic properties to cells or humans exposed to the composition.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additive includes starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate. , lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, Calcium stearate, sucrose, dextrose, sorbitol and talc and the like can be used. The pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

As used herein, the term "administration" means providing a predetermined substance to a patient by any suitable method, and parenteral administration (eg, intravenous, subcutaneous, intraperitoneal or topical administration according to a desired method) ) or oral administration, and the dosage varies according to the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of disease.

The composition of the present invention may be administered parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) or orally, depending on the desired method, and the dosage may vary depending on the subject's age, weight, sex, physical condition, etc. is selected taking into account. It is self-evident that the concentration of the active ingredient included in the pharmaceutical composition can be variously selected depending on the subject, and is preferably included in the pharmaceutical composition at a concentration of 0.01 μg/ml to 50 mg/ml. If the concentration is less than 0.01 μg/ml, pharmaceutical activity may not appear, and if it exceeds 50 mg/ml, it may be toxic to the human body.

The pharmaceutical composition of the present invention may be formulated in various oral or parenteral dosage forms. Formulations for oral administration include, for example, tablets, pills, hard, soft capsules, solutions, suspensions, emulsifiers, syrups, granules, and the like. crose, mannitol, sorbitol, cellulose and/or glycine), lubricants (eg, silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycol). In addition, the tablet may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and optionally starch, agar, alginic acid. or disintegrants such as sodium salts thereof or effervescent mixtures and/or absorbents, coloring, flavoring and sweetening agents. The formulation may be prepared by conventional mixing, granulating or coating methods. In addition, representative formulations for parenteral administration are injection formulations, and water, Ringer's solution, isotonic physiological saline, or suspension can be exemplified as a solvent for the injection formulation. The sterile, fixed oil of the injectable preparation may be used as a solvent or suspending medium, and any non-irritating fixed oil including mono- and di-glycerides may be used for this purpose. In addition, the injection preparation may use a fatty acid such as oleic acid.

In the present invention, the term "prevention" refers to any action that inhibits or delays the occurrence, spread, and recurrence of scleroderma by administration of the pharmaceutical composition according to the present invention.

In one aspect, the present invention relates to an inhibitor of STAT3 activity comprising a miR-21-5p inhibitor.

In one embodiment, the miR-21-5p inhibitor may include a nucleic acid represented by the nucleotide sequence of SEQ ID NO: 1.

In one aspect, the present invention relates to a method for reducing or inhibiting the activity of STAT3 comprising the step of treating a miR-21-5p inhibitor in vitro.

In one embodiment, the miR-21-5p inhibitor may include a nucleic acid represented by the nucleotide sequence of SEQ ID NO: 1.

In one embodiment, it was confirmed that miR-21-5p does not inhibit STAT3 in an animal model of scleroderma, but rather inhibits STAT3 when miR-21-5p is inhibited. activity may be reduced or inhibited.

The present invention will be described in more detail through the following examples. However, the following examples are only for specifying the contents of the present invention, and the present invention is not limited thereto.

Example 1. Confirmation of skin hardening reduction effect of miR21 inhibitor

1-1. Skin thickness reduction effect by miR21 inhibitor

After depilating C57BL/6 or balb/c normal mouse back hair, pre-prepared bleomycin was dissolved in 0.9% sodium chloride (1mg/ml), 100ul each daily for a total of 4 weeks from the neck to the back (square shape). A scleroderma model was prepared by subcutaneous injection in each of the four corners). Thereafter, the vector encoding and expressing the miR21 inhibitor (anti-miR21) (SEQ ID NO: 1) of Table 1 below was hydrodynamically injected into the mouse model by 100 μg per mouse (20-25 g) in 1 ml volume (saline). (hydrodynamic injection), and injected once a week for a total of 3 times from 2 weeks to 5 weeks. Thereafter, the skin of the normal mouse group (control group), the scleroderma mouse group (untreated control group), and the miR21 inhibitor-administered mouse group (experimental group) were fixed with 10% formalin each 35 days after sclerosis induction to prepare blocks with paraffin. From this, skin sections were prepared and attached to slides, deparaffinized using xylene, hydrated using high- and low-concentration ethanol, and skin sections were stained with hematoxylin and eosin. In addition, the skin sections were stained with Masson's Trichrome (MT) to determine the density of collagen fibers.

designation sequence (5'->3') SEQ ID NO: miR-21-5p inhibitor UCAACAUCAGUCUGAUAAGCUA One miR-21-5p uagcuuaucagacugauguuga 2

As a result, compared with the normal mouse group, the thickness of the skin and the density of collagen fibers in the dermis of the scleroderma mouse model were dense and there was no space, and the size of the hair follicles was significantly reduced and the location of the blood vessels was drooping down. It was shown that the symptoms of scleroderma were remarkably alleviated by the inhibitor treatment (FIG. 1).

1-2. Effect verification by miR21 inhibition

In order to verify that the effect of reducing skin hardening by the miR21 inhibitor is the effect shown by inhibiting miR21, the miR21 precursors in Table 2 below were administered to the scleroderma mouse model prepared in Example 1-1, and mice (20-25 g) 100 μg of the DNA vector per animal was hydrodynamically injected in a volume of 1 ml (saline), and a total of 3 times a week from 2 weeks to 5 weeks. Thereafter, the skin sections of the miR21 precursor-administered group and the control group were stained with hematoxylin and eosin as in the above example, and the skin sections were stained with Masson's Trichrome (MT).

designation sequence (5'->3') SEQ ID NO: pre-miR21 UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA 3

As a result, when pre-miR21 was treated, scleroderma symptoms occurred to a degree similar to that of the scleroderma mouse model ( FIG. 2 ), confirming that the effect of the miR21 inhibitor in Example 1-1 was through the inhibition of miR21. there was.

Example 2. Confirmation of the effect of miR21 inhibitors on reducing skin fibrosis

2-1. Fibrosis Reduction Effect by miR21 Inhibitors

In order to confirm the effect of miR21 inhibitor on the improvement of lung tissue fibrotic damage in an animal model of scleroderma, 35 days after sclerosis induction, a normal mouse group (control group), a scleroderma mouse group (untreated control group), and a miR21 inhibitor-administered mouse group ( Lungs of the experimental group) were fixed with 10% formalin, respectively, and blocks were prepared with paraffin. From this, lung sections were prepared and attached to slides, deparaffinized using xylene, hydrated using high- and low-concentration ethanol, and lung sections were stained with hematoxylin and eosin.

As a result, lung fibrosis was significantly increased compared to the scleroderma mouse group (untreated control group) not treated with miR21 inhibitor, but the experimental group treated with miR21 inhibitor had decreased lung fibrosis compared to the control group, and lung tissue of the normal group It was confirmed by histological analysis and severity index that the relief was remarkably similar to

2-2. Effect verification by miR21 inhibition

In order to verify that the miR21 inhibitory effect on reducing lung fibrosis is the effect shown by inhibiting miR21, a miR21 precursor was administered to a scleroderma mouse model, and lung sections were stained with hematoxylin and eosin as in the above example.

As a result, when pre-miR21 was treated, lung fibrosis was increased compared to the scleroderma mouse group (untreated control group) not treated with the miR21 inhibitor ( FIG. 4 ). It was confirmed that the effect was through the inhibition of

Example 3. Confirmation of inflammatory cytokine inhibitory effect of miR21 inhibitor

3-1. Inhibition of inflammatory cytokines by miR21 inhibitors

In order to confirm the level of inflammatory cytokine expression in the dermis of skin tissue by miR21 inhibitor treatment in an animal model of scleroderma, a normal mouse group (control group), a scleroderma mouse group (untreated control group) and After preparing a skin section from each miR21 inhibitor-administered mouse group (experimental group) and attaching it to a slide, immunochemical staining of TNF-α, IL-1β, IL-6 and IL-17, which are representative inflammatory cytokines related to autoimmune sclerosis, was performed. was used for staining, and it was analyzed with an optical microscope.

As a result, the expression of TNF-α, IL-1β, IL-6 and IL-17 in the skin tissue of the miR21 inhibitor-administered group of the present invention was significantly suppressed compared to the scleroderma mouse group (untreated control group) (FIG. 5) , It was confirmed from the above results that the miR21 inhibitor can modulate the activity of inflammatory cytokines in autoimmune scleroderma disease.

3-2. Effect verification by miR21 inhibition

In order to verify that the inflammatory cytokine reduction effect of the miR21 inhibitor is the effect shown by inhibiting miR21, the miR21 precursor was administered to a scleroderma mouse model, and histological examination of the skin tissue was performed as in the above example.

As a result, when pre-miR21 was treated, the expression of inflammatory cytokines was significantly increased compared to the scleroderma mouse group (untreated control group) not treated with the miR21 inhibitor ( FIG. 6 ). It was confirmed that the effect was through the inhibition of miR21.

Example 4. Confirmation of the inhibitory effect of miR21 inhibitors on STAT3 activity

In order to find out whether miR21 inhibitor can inhibit the activity of STAT3 (signal transducer and activator of transcription-3) in an animal model of scleroderma, normal mouse group (control group), scleroderma mouse group (untreated control group), miR21 inhibitor administration Spleens were extracted from the mice of the mouse group (experimental group) and the mice of the miR21 precursor group, respectively. The extracted spleen was used to embed a frozen section (Optimal Cutting Temperature compound; O.C.T. compound), the tissue was rapidly cooled in liquid nitrogen, and then attached to a slide with a thickness of 5 μm using a cryosectioning machine. Thereafter, the sections were fixed with acetone, and 10% normal goat serum was applied to block non-specific reactions for 30 minutes. Then, in order to analyze STAT3, PE-labeled anti-STAT3, PE-labeled anti-p-STAT3 (s727) Ab and PE-labeled anti-p-STAT3 ( Y705) Ab was reacted with a primary antibody at 4° C. overnight, washed with PBS solution the next day, and the stained tissue was analyzed with a confocal microscope.

As a result, the number of STAT3, Y705 phosphorylated STAT3, and S727 phosphorylated STAT3 positive cells in the miR21 precursor group increased significantly more than in the scleroderma mouse group (untreated control group) ( FIG. 7 ), which was significantly decreased in the miR21 inhibitor-treated group ( FIG. 7 ). Fig. 8).

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> COMPOSITION FOR PREVENTING OR TREATING SYSTEMIC SCLERODERMA <130> PN <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> anti-miR-21-5p <400> 1 ucaacaucag ucugauaagc ua 22 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-21-5p <400> 2 uagcuuauca gacugauguu ga 22 <210> 3 <211> 72 <212> RNA <213> Artificial Sequence <220> <223> pre-miR-21-5p <400> 3 ugucggguag cuuaucagac ugauguugac uguugaaucu cauggcaaca ccagucgaug 60 ggcugucuga ca 72

Claims (11)

A pharmaceutical composition for preventing or treating scleroderma comprising a miR-21-5p inhibitor as an active ingredient. The pharmaceutical composition for preventing or treating scleroderma according to claim 1, wherein the miR-21-5p inhibitor comprises a nucleic acid represented by the nucleotide sequence of SEQ ID NO: 1. The pharmaceutical composition for preventing or treating scleroderma according to claim 1, comprising the miR-21-5p inhibitor at a concentration of 0.05 to 5000 μg. The pharmaceutical composition for preventing or treating scleroderma according to claim 1, which reduces or inhibits the expression of inflammatory cytokines TNF-α, IL-1β, IL-6 or IL-17. The pharmaceutical composition for preventing or treating scleroderma according to claim 1, which reduces or inhibits the activity of STAT3. The pharmaceutical composition for preventing or treating scleroderma according to claim 1, wherein miR-21-5p comprises a nucleic acid represented by the nucleotide sequence of SEQ ID NO: 2. The pharmaceutical composition for preventing or treating skin sclerosis according to claim 1, which reduces or inhibits fibrosis. An inhibitor of STAT3 activity comprising a miR-21-5p inhibitor. The STAT3 activity inhibitor of claim 8, wherein the miR-21-5p inhibitor comprises a nucleic acid represented by the nucleotide sequence of SEQ ID NO: 1. A method of reducing or inhibiting the activity of STAT3 comprising treating a miR-21-5p inhibitor in vitro. The method of claim 10, wherein the miR-21-5p inhibitor comprises a nucleic acid represented by the nucleotide sequence of SEQ ID NO: 1, reducing or inhibiting the activity of STAT3.

Images