KR20210081195A - Constitutively expressed vector on the surface using promoter of galactose mutarotase from Lactobacillus casei and thereof utilization - Google Patents

Abstract

The present invention relates to a promoter of a galactose mutarotase gene derived from Lactobacillus casei and uses thereof, and more particularly, to a promoter of a galactose mutarotase gene derived from Lactobacillus casei having a nucleotide sequence of SEQ ID NO: 1, an expression vector containing the promoter and a microorganism transformed with the expression vector, wherein the microorganism transformed with the expression vector containing the promoter according to the present invention can effectively express a target protein on a fungus body surface to be useful as a vaccine delivery system, and the like. In addition, the present invention relates to the surface expression vector having pgsA, a gene encoding polygamma-glutamic acid synthase, and a method of expressing the target protein on the surface of the microorganism using the vector, wherein the vector into which foreign genes are inserted transforms the microorganism and allows a foreign protein to be stably expressed on the surface of the microorganism.

Description

Constitutively expressed vector on the surface using promoter of galactose mutarotase from Lactobacillus casei and its utilization}

The present invention relates to a promoter of a galactose mutarotase gene derived from Lactobacillus casei , and more particularly, Lactobacillus casei represented by the nucleotide sequence of SEQ ID NO: 1 (Lactobacillus casei) It relates to a promoter of a derived galactose mutarotase gene, an expression vector containing the promoter, and a microorganism transformed with the expression vector.

In addition, the present invention relates to a new vector for effectively expressing a foreign protein on the surface of a microorganism using the extracellular membrane protein (pgsA) involved in the synthesis of polygammaglutamic acid derived from a Bacillus sp. strain, and further the present invention relates to a Bacillus sp. strain It relates to a method for producing a protein that expresses a foreign protein on the surface of a microorganism using the extracellular membrane protein involved in the synthesis of derived polygamma-glutamic acid.

Lactic acid bacteria, the most important microorganism group among food microorganisms, are microorganisms that have been used in various foods and have proven safety (GRAS: generally recognized as safe), and have plasmids, bacteriophages, transposons, etc. Since vector development is possible, transformation by a method commonly used in the art is easy, and edible selection marker genes are also secured, it can be said to be the most suitable strain for use as food. In addition, lactic acid bacteria have the effect of inhibiting harmful bacteria in the intestine and intestinal tract, reducing blood cholesterol, enhancing nutritional value, inhibiting pathogen infection, improving liver cirrhosis, anticancer action, inhibiting aging, and enhancing immunity through macrophage activation. Have.

In order to produce useful exogenous proteins in lactic acid bacteria, high-efficiency promoters (JM van der Vossen et al., Appl. Environ. Microbial., Vol.53, pp 2452-2457, 1987; Teija Koivula et al., Appl. Environ. Microbial) ., Vol.57, pp 333-340, 1991; Pascalle GGA et al., Appl. Research progress is very poor. The genome of lactic acid bacteria has so far been deciphered only for Bifidobacterium longum NCC 2705, Enterococcus faecalis V583, and Lactobacillus plantarum WFCS1. Currently, genome detoxification studies of various species of lactic acid bacteria are being conducted. In addition, as promoters isolated from lactic acid bacteria so far, the constitutive expression promoters derived from the genomes of Streptococcus thermophilus A054, Lactococcus lactis MG1614, and Lactococcus cremotis Wg2 ( Philippe Slos et al., Appl. Environ. Microbial., Vol. 57, pp 1333-1339, 1991; Teija Koivula et al., Appl. Environ. Microbial., Vol. 57, pp 333-340, 1991; JM van der Vossen et al., Appl. Environ. Microbial., Vol. 53, pp 2452-2457, 1987) are known.

Recently, in the United States and Europe, research on the development of live vaccines using lactic acid bacteria, the study of the intestinal carrier of useful hormones, the securing of efficient genetic resources and the development of the insertion vector for the lactic acid bacteria are in progress. In particular, since it is known that unmethylated CpG DNA, lipoteichoic acid, peptidoglycan, etc., which are a large amount of components contained in lactic acid bacteria, act as adjuvants, lactic acid bacteria are vaccines. The usefulness as a vehicle (vehicle) is highly evaluated. In addition, lactic acid bacteria have many advantages in that they can induce intestinal mucosal immunity because they are resistant to bile acid and gastric acid, and thus antigen delivery to the intestine is possible (Jos FMK Seegers, Trends Biotechnol., Vol. 20, pp 508- 515, 2002).

However, in order to use it as a vaccine carrier for lactic acid bacteria, it is necessary to develop a technology that allows the antigen-antibody reaction to occur smoothly by presenting the antigen protein for the generation of antibodies for disease prevention inside or outside the cell, and in fact, HPV (Human papilloma virus) Confirmation of antibody inducibility using lactic acid bacteria in which L1 protein is internally expressed (Karina Araujo Aires et al., Appl. Environ. Microbiol. Vol. 72, pp 745-752, 2006) and lactic acid bacteria of IL-2 (Interleukin-2) In addition, various research results have been published confirming that lactic acid bacteria are suitable as a vaccine carrier, such as confirmation of disease treatment efficacy using secretory-expressing strains (Lothar Steidler et al., Nat. Biotechnol. Vol. 21, pp 785-789, 2003). .

As described above, various uses of lactic acid bacteria expressing the target protein and academic research are being actively conducted, but there is still a problem that the expression amount of the target protein to be expressed is insufficient and when an inducible expression promoter is used, There is a problem such as that continuous expression at the time of administration may not be possible.

In addition, cell surface expression refers to a technology for expressing on the surface of gram-negative, positive bacteria, mold, yeast, and animal cells by fusing proteins or peptides with an appropriate anchoring motif (Lee SY, et al., Trends). Biotechnol., 21:4552, 2003). The first cell surface expression technology was in the 1980s, using phage with a relatively simple surface, and fusion of a peptide or a small protein with pIII of a filamentous phage and expressing this was called a surface-expression system. . Cell surface expression using phage has been used for antibody screening, epitope, high-affinity ligand screening, etc. However, the size of the protein that can be expressed on the surface of the phage is relatively limited, revealing a limitation. Therefore, as an alternative, cell surface expression using bacteria was developed. It is a field in which foreign proteins are stably expressed on the surface of microorganisms by using a surface protein of microorganisms such as bacteria or yeast as a surface anchoring motif.

In order to express a foreign protein on the cell surface using the outer membrane protein of a specific organism, an appropriate surface protein and the foreign protein are linked together at the gene level so that the fusion protein is biosynthesized, and these proteins pass through the inner cell membrane stably and are attached to the cell surface. should be kept For this purpose, it is preferable to use a protein having the following properties as a parent for surface expression: First, it has a secretion signal that can pass through the inner cell membrane at the N-terminus, and second, it has the following properties on the surface of the outer cell membrane. It must have a targeting signal that can be stably attached, and thirdly, it is expressed in a large amount on the cell surface within a range that does not adversely affect the growth of the cell, so that the activity of the protein can be high, and finally, the protein It should be stably expressed irrespective of the size of the protein so that it can be used for various reactions (Georgiou et al., TIBTECH, 11:6, 1993). Such a surface-expressing parent also needs to be genetically engineered to be inserted into the N-terminus or C-terminus of the outer membrane protein on the surface of the host cell, or in the center of the protein (Lee et al., TIBTECH, 21:45, 2003).

In order for the protein to be expressed on the surface of bacteria, a secretion signal through which the protein biosynthesized within the cell can pass through the cell membrane must be present on the primary sequence of the protein. Also, in the case of Gram-negative bacteria, they must pass through the inner cell membrane and the cell membrane space, be inserted and attached to the outer cell membrane, and be seated to protrude outside the membrane. In the case of bacteria, surface proteins, special enzymes, toxin proteins, and the like, may be exemplified as proteins having such secretion signals and targeting signals that allow them to settle on the cell surface. In fact, if the secretion signal and target signal of these proteins are used together with an appropriate promoter, the protein can be expressed successfully on the surface of bacteria. Bacterial surface proteins used for surface expression of foreign proteins can be roughly divided into four types: extracellular membrane proteins, lipoproteins, secreted proteins, and cell surface organ proteins. Attempts have been made to express necessary foreign proteins on the surface of bacteria using surface proteins mainly present in Gram-negative bacteria, for example, LamB, PhoE, OmpA, and the like. When these proteins are used, the size of the protein that can be structurally inserted is limited because the foreign protein is inserted into a loop protruding from the cell surface. In addition, since the C-terminus and the N-terminus of the foreign protein to be inserted must be sterically close to each other, there is a problem in that the two ends must be brought close to each other with a linking peptide when the distance is long.

In fact, in the case of using LamB or PhoE, the insertion of a foreign polypeptide consisting of 50-60 amino acids or more resulted in a structural restriction and failed to form a stable membrane protein [Charbit et al., J. Immunol., 139: 1658-1664 ( 1987); Agterberg et al., Vaccine, 8: 85-91 (1990)]. In some cases, a foreign protein was inserted into the protruding loop using OmpA, but only some OmpA fragments containing a minimal target signal capable of being seated on the outer cell membrane were used to overcome structural limitations. In this way, there is a case in which beta-lactamase (-lactamase) was linked to the C-terminus of the OmpA target signal and expressed on the cell surface.

In addition, surface expression using Ice-nucleation protein (INP) derived from the genus Pseudomonas as an extracellular membrane protein of Gram-negative bacteria used for surface expression was recently attempted [Jung et al., Nat, Biotechnol, 16: 576-560 (1998), Jung et al., Enzyme Microb. Technol, 22(5): 348-354 (1998), Lee et al., Nat. Biotechnol, 18: 645-648 (2000)]. Jung et al. (Levansucrase) at the C-terminus of the cryo-activation protein consisting of the N-terminus, the central repeat section, and the C-terminus, and the N-terminal and C-terminal repeats with the central repeat deleted. The enzyme activity was measured and confirmed by fusion of carboxymethylcellulase to the C-terminus of the ice-nuclear activity protein composed of the terminals and surface expression of each. Lee et al. also reported that the surface antigen of the hepatitis B virus and the core antigen of the hepatitis C virus were added to E. coli or After expression on the surface of Salmonella typhi Ty21a strain, it was confirmed that they can be used as a live combined vaccine.

Lipoproteins are also used for surface expression as surface proteins. In particular, Escherichia coli lipoprotein has a secretion signal at its N-terminus and can pass through the inner cell membrane, and the terminal cysteine (L-cysteine) is directly attached to the outer membrane lipid or the intracellular membrane lipid through a covalent bond. The main lipoprotein, Lpp, is bound to the cell wall (peptidoglycan, PG) at the N-terminus and the C-terminus to the cell wall (peptidoglycan, PG). There is [Francisco et al., Proc. Natl. Acad. Sci. USA, 489: 2713-2717 (1992)]. Another lipoprotein, TraT, was used to surface-express peptides such as the C3 epitope of poliovirus using these properties of the lipoprotein [Felici et al., J. Mol. Biol., 222: 301-310 (1991)]. In addition, cell wall-attached lipoprotein (PAL), whose exact function has not yet been elucidated, was also used for surface expression of recombinant antibodies [Fuchs et al., Bio/Technology, 9: 1369-1372 (1991)], In this case, the C-terminus of PAL was linked to the cell wall and the N-terminus was linked to the recombinant antibody to surface-express the fusion protein.

Secreted proteins that pass through the outer membrane can also be used as surface proteins, but in the case of Gram-negative bacteria, secreted proteins are not developed. are helping For example, Klebsiella genus pullulanase (pullulanase) is a lipoprotein whose N-terminus is substituted with lipid, is attached to the outer membrane, and is completely secreted into the cell culture medium. Kornacker et al. expressed beta-lactamer on the cell surface using the N-terminal fragment of pullulanase, but the expressed pullulanase-betalactamer fusion protein was briefly attached to the cell surface and then transferred to the cell culture medium. There was a downside. In addition, when alkaline phosphatase, which is a periplasmic space protein, was expressed using this, at least 14 proteins were involved for its secretion, so it was not stably surface-expressed [Kornacker et al., Mol. Microl., 4: 1101-1109 (1990)].

IgA protease from Neisseria, a pathogenic microorganism with a unique secretion system, has a signal that allows the N-terminal protease to settle on the outer membrane in a fragment present at the C-terminus. Once the protease reaches the outer cell membrane and protrudes on the cell surface, it is secreted into the cell culture medium by its hydrolysis ability. Klauser et al. stably expressed a cholera toxin B subunit of about 12 kDa on the cell surface using this IgA protease-fragment [Klauser et al., EMBO J., 9:1991-1999 (1990)]. However, secretion of the fusion protein was inhibited by protein folding that occurred in the cell membrane space during the secretion process.

In addition, in the case of Gram-negative bacteria, organelles that exist on the cell surface and can be applied to surface expression include flagella, Pili, and Fimbriae. Peptides derived from the cholera toxin B subunit and hepatitis B virus were stably expressed using the flagellin, a constituent subunit of flagella, and they reacted strongly with the antibody [Newton et al., Science, 244: 70-72 (1989)]. When the expression of foreign peptides was attempted using fimbrilin, a component protein of fimbria that looks like a thread on the cell surface, only small peptides were successfully expressed [Hedegaard et al., Gene, 85:115-124 (Hedegaard et al., Gene, 85:115-124 (Hedegaard et al., Gene, 85:115-124 (Hedegaard et al., Gene, 85:115-124) 1989)].

In addition to the above-mentioned surface expression attempts by surface proteins of Gram-negative bacteria, surface expression using surface proteins of Gram-positive bacteria was recently attempted [Samuelson et al., J. Bacteriol., 177:1470-1476 (1995)]. In this case, too, a secretion signal that can pass through the cell membrane and a surface-expressing matrix attached to the cell membrane are required. In fact, lipase derived from Staphylococcus hyicus is used as a secretion signal, and protein A derived from Staphylococcus aureus is used as a membrane-attached matrix to form a malaria antigen consisting of 80 amino acids. blood stage antigen) and streptococcus protein G-derived albumin adhesion protein were effectively expressed on the surface of Gram-positive bacteria.

Many useful protein expression systems have been developed through studies on the surface expression of gram-negative and positive bacteria, and have been applied for in the United States, Europe, and Japan. Among them, 5 cases (WO9504069, WO9324636, WO9310214, EP603672, US5356797) using the extracellular membrane protein of Gram-negative bacteria have been reported, and there is one case using the cell surface organ, pili (WO9410330), and also One case using cell surface lipoprotein (WO9504079) was also reported.

As described above, in order to express foreign proteins on the cell surface using bacterial extracellular membrane proteins, appropriate extracellular membrane proteins and foreign proteins are linked to each other at the gene level to induce biosynthesis of fusion proteins, and these proteins stably pass through the inner cell membrane. It must remain attached to the outer cell membrane. However, a surface-expressing matrix that satisfies all of the above conditions has not yet been developed, and so far is at a level that compensates for the disadvantages of the above case.

On the other hand, the present inventors utilize the synthetic complex gene (pgsBCA) of polygamma-glutamic acid derived from Bacillus subtilis var. Chungkookjang genus strain as a new surface expression matrix, and a novel vector for effectively expressing foreign proteins on the surface of microorganisms and the A method of expressing a target protein on the surface of a microorganism transformed with a vector has been developed (Korean Patent Registration No. 0469800).

Therefore, the present inventors have developed a vector capable of stably and high expression of an antigen or epitope in lactic acid bacteria using the surface-expressing matrix described in the above patent, since the antigen is exposed to the surface of the lactic acid bacteria, human body-friendly and efficient immune response. As a result of determining that it is possible to produce an inducible vaccine and selecting a promoter capable of high expression of the target protein in lactic acid bacteria, the promoter of the galactose mutarotase gene was improved compared to the previously used promoter. When used, it was confirmed that gene expression is improved, and further, using the synthetic gene (pgsA) of polygammaglutamic acid derived from the Bacillus sp. strain as a new surface-expressing matrix was intensively reviewed and studied, using the pgsA gene, The present invention was completed by developing a new vector for effectively expressing a foreign protein on the surface of a microorganism, and a method for expressing a large amount of the foreign protein on the surface of a microorganism.

The main object of the present invention is to provide a promoter derived from Lactobacillus casei that induces an increase in expression of a target gene.

Another object of the present invention is to provide an expression vector characterized in that the promoter and the gene encoding the target protein are linked.

Another object of the present invention is to provide a microorganism transformed with the expression vector and a method for producing a target protein using the transformed microorganism.

Another object of the present invention is to provide a method for preparing a microbial vaccine using the transformed microorganism.

Another object of the present invention is to select an extracellular membrane protein involved in the synthesis of polygamma-glutamic acid derived from a Bacillus sp. strain as a surface expression matrix capable of large-scale expression of a foreign protein on the surface of a microorganism, and use this to select a foreign protein or An object of the present invention is to prepare a target protein surface expression vector capable of expressing a peptide on the surface of a microorganism, and to provide a method for efficiently expressing a foreign protein on the surface of the transformant in various transformants transformed with this vector.

In order to achieve the above object, the present invention provides a promoter of a galactose mutarotase gene derived from Lactobacillus casei.

In the present invention, the promoter may be characterized in that it is represented by SEQ ID NO: 1.

The present invention also provides an expression vector characterized in that a target gene is linked to the end of the promoter, and a microorganism transformed with the expression vector.

The present invention also provides a microorganism surface expression vector to which the promoter, the polygamma-glutamic acid synthase complex gene, and a gene encoding a target protein are linked, and a microorganism transformed with the surface expression vector.

In the present invention, the target protein may be characterized as an antigen. Specifically, the target protein includes a hormone, a hormone analog, an enzyme, an enzyme inhibitor, a signal transduction protein or a portion thereof, an antibody or a portion thereof, a single-chain antibody, a binding protein, a binding domain, a peptide, an antigen, an adhesion protein, a structural protein, a regulatory protein, a toxin It may be characterized as any one selected from the group consisting of proteins, cytokines, transcriptional regulatory factors, blood coagulation factors, and plant biodefense inducing proteins.

In the present invention, the polygamma-glutamic acid synthase complex gene may be characterized in that at least one of pgsA, pgsB, and pgsC.

The present invention also provides a method for expressing a target protein on the surface of the microorganism, characterized in that the culture of the transformed microorganism.

The present invention also comprises the steps of (a) culturing a microorganism transformed with the microorganism surface expression vector to surface-express an antigen on the surface of the microorganism; And (b) provides a method for producing a microbial vaccine comprising the step of recovering the antigen surface-expressed microorganism.

In order to achieve the above object, the present invention provides a surface expression vector of a target protein comprising the gene pgsA encoding the polygamma-glutamic acid synthase complex and the gene encoding the target protein.

In the present invention, the gene pgsA may be characterized in that it is derived from a Bacillus sp. strain that produces polygamma-glutamic acid.

In the present invention, the gene pgsA encoding the polygamma-glutamic acid synthase complex may have any one of nucleotide sequences of SEQ ID NOs: 18 to 22 and 29 to 31. Preferably, the gene pgsA encoding the polygamma-glutamic acid synthetase complex may have a nucleotide sequence of any one of SEQ ID NOs: 18 to 21 and 29 to 31.

In the present invention, a linker may be inserted into the end portion of the gene pgsA, and a gene encoding a target protein may be inserted into the inserted linker.

In the present invention, the target protein may be characterized in that a part of the amino acid sequence of the target protein is removed or site-specifically mutated to favor surface expression.

The present invention also provides a microorganism transformed with the surface expression vector. In the present invention, the microorganism used for transformation may be characterized in that it is modified so as not to produce intracellular or extracellular proteolytic enzymes involved in decomposing the expressed target protein so as to favor the cell surface expression of the target protein. .

In the present invention, the microorganism may be characterized in that the lactic acid bacteria. In the present invention, the lactic acid bacteria may include the genus Lactobacillus, the genus Streptococcus and the genus Bifidobacterium. Representative Lactobacillus genus is Lactobacillus acidophilus ( L. acidophilus ), Lactobacillus casei ( L. casei ), Lactobacillus plantarum ( L. plantarum ), Lactobacillus fermentum ( L. ferementum ), Lactobacillus Delbruecki ( L. delbrueckii ), Lactobacillus johnsonii ( L. johnsonii LJI ), Lactobacillus reuteri ( L. reuteri ) and Lactobacillus bulgaricus ( L. bulgaricus ); Streptococcus genus is Streptococcus thermophilus ( S. thermophilus ); The genus Bifidobacterium Bifidobacterium Infante Tees (B. infantis), Bifidobacterium Bifidobacterium bonus (B. bifidum), Bifidobacterium rongeom (B. longum), Bifidobacterium pseudo rongeom (B. psuedolongum ), Bifidobacterium breve ( B. breve ), Bifidobacterium lactis Bb-12 ( B. lactis Bb-12 ) and Bifidobacterium adolesentis ( B. adolescentis ) and the like can be used as hosts. and, more preferably, the genus Lactobacillus.

The present invention also provides a cell surface expression method of a target protein comprising the steps of culturing the transformed microorganism to express the target protein on the cell surface, and recovering cells in which the target protein is expressed on the surface.

In the present invention, the target protein is a hormone, a hormone analog, an enzyme, an enzyme inhibitor, a signal transduction protein or a portion thereof, an antibody or a portion thereof, a single-chain antibody, a binding protein, a binding domain, a peptide, an antigen, an adhesion protein, a structural protein, a regulation It may be characterized as any one selected from the group consisting of proteins, toxin proteins, cytokines, transcriptional regulatory factors, blood coagulation factors and plant biodefense inducing proteins.

The present invention also provides a method characterized in that humoral immunity or cellular immunity is induced by administering the cells prepared by the above method and expressing the antigen on the surface to vertebrates other than humans.

The present invention also provides a spine, characterized in that the cells prepared by the above method and expressed on the surface of the antigen are administered to vertebrates other than humans to induce an immune response, and to recover the antibody generated by the immune response. A method of making an antibody in an animal is provided.

The present invention also provides a surface expression vector of a target protein, characterized in that the vector is applied to Gram-negative or Gram-positive bacteria.

The present invention also comprises the steps of (a) inserting a gene encoding a target protein into a vector for microbial surface expression to prepare a recombinant vector; (b) transforming a gram-negative or gram-positive host cell with the recombinant vector; and (c) culturing the transformed host cell to express the target protein on the surface of the host cell. It provides a method for expressing the target protein on the surface of a gram-negative or gram-positive host cell.

The present invention has an effect of providing a galactose mutarotase promoter derived from Lactobacillus casei capable of high expression of a target protein in lactic acid bacteria and a vector for expression using the promoter. Since the vector contains a gene for surface-expressing the target protein, the transformant using the vector can effectively express the target protein on the cell surface, so that the lactic acid bacteria can be used as a vaccine carrier.

In addition, the surface expression vector of the target protein according to the present invention can stably express the target protein, and the surface expression vector according to the present invention constantly expresses the target protein while simultaneously surface-expressing the target protein to a recombinant microorganism. It can be usefully used in the production of antigens for vaccine production.

1 shows a method for obtaining a galactose mutarotase promoter of the present invention.
Figure 2. A gene map of a vector for surface expression constructed using the galactose mutarotase promoter of the present invention is shown.
Figure 3. The expression level of the target protein between each promoter compared to the lactic acid bacteria transformed with the expression vector of the present invention is shown through Western blotting.
Figure 4. It was confirmed that the target protein was expressed on the surface of the microorganism with the expression vector of the present invention using a confocal fluorescence microscope.
Fig. 5 shows a genetic map of the surface expression vector pKV-Pald-PgsA-EGFP using Lactobacillus casei as a host according to the present invention.
6 shows a genetic map of the surface expression vector (pKV-Pald-pgsA1), PgsA motif 1-60 aa-EGFP using Lactobacillus casei as a host according to the present invention.
Figure 7. A gene map of the surface expression vector (pKV-Pald-pgsA2), PgsA motif 1-70 aa-EGFP using Lactobacillus casei as a host according to the present invention.
Fig. 8 shows a genetic map of the surface expression vector (pKV-Pald-pgsA3), PgsA motif 1-80 aa-EGFP using Lactobacillus casei as a host according to the present invention.
9. A genetic map of the surface expression vector (pKV-Pald-pgsA5), PgsA motif 1-100 aa-EGFP using Lactobacillus casei as a host according to the present invention.
10. Shows a genetic map of the surface expression vector (pKV-Pald-pgsA5), pKV-PgsA 1-188 aa-EGFP using Lactobacillus casei as a host according to the present invention.
11. Shows a genetic map of the surface expression vector (pKV-Pald-pgsA6), PgsA motif 25-60 aa-EGFP using Lactobacillus casei as a host according to the present invention.
12. A genetic map of the surface expression vector (pKV-Pald-pgsA7), PgsA motif 25-70 aa-EGFP using Lactobacillus casei as a host according to the present invention.
13. A gene map of the surface expression vector (pKV-Pald-pgsA8) and PgsA motif 25-100 aa-EGFP using Lactobacillus casei as a host according to the present invention is shown.
14. Western blotting photographs showing the surface expression of EGFP protein in Lactobacillus casei transformed with the surface expression vectors pKV-Pald-pgsA1 to pKV-Pald-pgsA8 of the present invention.

The present invention, in one aspect, Lactobacillus casei ( Lactobacillus casei ) It relates to a promoter of a galactose mutarotase (galactose mutarotase) gene derived.

In the present invention, in order to obtain the promoter of the galactose mutarotase gene, amplified from the genome of Lactobacillus casei by a PCR method, and using a gene cloning technique, a promoter of 700 bp derived from Lactobacillus casei (sequence) No. 1) was isolated. The galactose mutarotase promoter of the present invention is a promoter that induces expression of the galactose mutarotase gene present in Lactobacillus casei. In general, a promoter includes a portion to which RNA polymerase binds to induce transcription initiation, and since the degree of RNA synthesis is determined according to the nucleotide sequence of the promoter, the expression intensity of a gene may vary depending on the promoter.

In order to measure the expression inducing ability by the promoter of the present invention, the EGFP gene was inserted into the expression vector containing the promoter and the expression vector containing the conventional aldolase promoter, respectively, and the lactose gene was used using the prepared vectors. After transforming Bacillus casei, the expression level of EGFP induced by each promoter was compared through Western blotting. As a result, it was confirmed that the expression level of EGFP was effectively increased in the transformant of the vector containing the galactose mutarotase promoter, and the expression induction strength of the promoter of the present invention is also stronger than that of the conventional aldolase promoter. was confirmed.

In another aspect, the present invention relates to an expression vector containing the galactose mutarotase promoter and a gene encoding a target protein, and a microorganism transformed with the expression vector.

Expression vectors typically require at least a promoter enabling transcription, a gene expressing a target protein downstream of the promoter, a gene capable of self-replication and amplification in microorganisms, and a selection marker gene for selecting the target vector. , except for the target gene, the genes may vary depending on the backbone of the vector and the selected host. The minimally necessary genes for vector construction are well known to those skilled in the art, and can be easily selected according to the gene expression conditions and purpose. Typically, as the backbone of the vector, pWV01, one having a replication origin of pAMβ1, etc. may be used, but the present invention is not limited thereto.

A variety of methods and means can be used to insert a vector or DNA sequence for gene expression that includes a target gene as well as an additional regulatory region into a suitable host cell. For example, transformation (transformation), transfection (transfection), conjugation (conjugation), protoplast fusion method and biochemical methods such as calcium phosphate precipitation method, DEAE (diethylminoehtyl) dextran, or electroporation (electroporation) Physical methods such as

After inserting the expression vector into an appropriate host cell, the target gene can be expressed using a selection medium suitable for host growth containing an antibiotic capable of selecting only transformants using conventional techniques known in the art. Transformants containing the vector can be selected.

In another aspect, the present invention provides a microbial surface expression vector to which the galactose mutarotase promoter, the polygamma-glutamic acid synthase complex gene, and the gene encoding the target protein are linked, and the microorganism transformed with the surface expression vector. it's about

Downstream of the promoter, the gene of the polygamma-glutamic acid synthetase complex, which is a surface expression parent, is included, and the surface expression matrix is located between the promoter and the target gene on the DNA sequence of the vector. The surface-expressing parent gene plays a decisive role in surface expression of the target protein because it is linked to the first half of the target protein after it is encoded with amino acids and acts to induce the expressed protein to bind with the lipid of the cell membrane. The method of linking the surface-expressing parent gene with the promoter and the target gene is a conventional method that can be easily performed by those skilled in the art, such as PCR (polymerase chain reaction), restriction enzyme digestion, and ligation. technology can be used.

As used herein, the term 'host' or 'microorganism' refers to lactic acid bacteria that are gram-positive bacteria of probiotics, and the general selection criteria for probiotic microorganisms include (i) human-derived microorganisms; (ii) stable to bile, acids, enzymes and oxygen; (iii) have the ability to adhere to the intestinal mucosa; (iv) have the ability to colonize in the digestive tract; (v) capable of producing antibacterial substances; and (vi) that efficacy or safety can be demonstrated. Based on the above conditions, it is clear that lactic acid bacteria are friendly and harmless bacteria that grow in the human body. Therefore, when a transformant using lactic acid bacteria as a host is applied to the human body and used for purposes such as gene transfer or protein transfer for the prevention or treatment of diseases, the non-toxicity of the strain is different from the conventional vaccine manufacturing method using the strain. or no step of detoxification is required.

In the present invention, the microorganism may include the genus Lactobacillus, the genus Streptococcus and the genus Bifidobacterium. Representative Lactobacillus genus is Lactobacillus acidophilus ( L. acidophilus ), Lactobacillus casei ( L. casei ), Lactobacillus plantarum ( L. plantarum ), Lactobacillus fermentum ( L. ferementum ), Lactobacillus Delbruecki ( L. delbrueckii ), Lactobacillus johnsonii ( L. johnsonii LJI ), Lactobacillus reuteri ( L. reuteri ) and Lactobacillus bulgaricus ( L. bulgaricus ); Streptococcus genus is Streptococcus thermophilus ( S. thermophilus ); The genus Bifidobacterium Bifidobacterium Infante Tees (B. infantis), Bifidobacterium Bifidobacterium bonus (B. bifidum), Bifidobacterium rongeom (B. longum), Bifidobacterium pseudo rongeom (B. psuedolongum ), Bifidobacterium breve ( B. breve ), Bifidobacterium lactis Bb-12 ( B. lactis Bb-12) and Bifidobacterium adolecentis ( B. adolescentis ), etc. can be used as hosts. and, more preferably, the genus Lactobacillus.

In the present invention, an expression vector (pKV-Pgm-pgsA-EGFP) including the nucleotide sequence in which the promoter and pgsA, which is the surface expression parent, is linked, and capable of expressing the EGFP gene as a target gene was prepared, and the expression vector was Lactobacillus Transformants expressing EGFP were prepared by inserting into casei.

The target protein expressed by the promoter having improved gene expression ability of the present invention is expressed on the cell surface, and therefore the transformed microorganism of the present invention can be used as a vaccine.

The present invention, in another aspect, relates to a method for producing a microbial vaccine, characterized in that using the lactic acid bacteria transformed with the surface expression vector.

Vaccines are drugs used to stimulate the immune system using live organisms for the purpose of preventing disease. Immune activation refers to a process in an organism to efficiently remove antigens by producing antibodies, stimulating T-lymphocytes, or stimulating other immune cells (eg macrophages). A detailed overview of immunology for the above is readily understood by those of ordinary skill in the art (Barrett, J. T., Textbook of Immunology, 1983).

An administration target of the transformed microbial vaccine expressing a target protein as an antigen may be a mammal, and more preferably a human.

The preparation of the vaccine composition can be carried out using standard techniques, and the dosage suitable for the administerer varies depending on the antigenicity of the gene product, and is sufficient as long as it is sufficient to induce a typical immune response of the existing vaccine, and is subjected to routine testing. You can easily determine the amount you need. A typical initial vaccine dose is 0.001 to 1 mg antigen per kg body weight, increasing in amounts or using multiple doses as needed to provide the desired level of protection. The above amount can be determined by a person skilled in the art, and depends on factors such as formulation method, administration method, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity of the administration. It can also be prescribed in a variety of ways.

In order for the vaccine to be effective in producing antibodies, the antigenic material must be introduced into the body so that the antibody-producing mechanism of the vaccinated subject can be realized. Therefore, for an immune response, the microbial carrier of the gene product must first be introduced into the body. In order to stimulate a desired response by the antigen presented in the transformant of the present invention, administration methods such as intravenous injection, intramuscular injection, subcutaneous injection, etc. are possible, but oral administration, gastric insertion, or directly into the intestine or lung in the form of a spray administration is preferred.

For oral administration of the vaccine composition to a recipient, it is useful to provide it in a lyophilic form, for example in the form of a capsule. The capsules are provided in an enteric coating containing Eudragate S, Eudragate L, cellulose acetate, cellulose phthalate or hydroxy propylmethyl cellulose. The capsules may be used as such, or a lyophilic substance may be reconstituted such as a suspension prior to administration. It is effective to carry out the recomposition in a buffer of a pH suitable for the survival of the transformed microorganism. It may be useful to administer a sodium bicarbonate formulation prior to each vaccine administration to protect the transformed microorganism and vaccine from gastric acid. Alternatively, the vaccine may be formulated for parenteral administration, intranasal administration or intramammary administration.

The transformed lactic acid bacteria containing the promoter of the present invention and containing a gene expressing a target protein that can act as an antigen forms colonies in the mucous membrane of the digestive tract so that the desired efficacy can be obtained, and the lactic acid bacteria In order to maintain the desired transforming properties and to form a smooth colony, a selective antibiotic in the vector can be administered at the same time, and by means of the above means, undesirable lactic acid bacteria that do not have a vector that can be derived in the process of dividing the transformant occurrence can be controlled. The above selection method can be easily performed by a conventional technique in the art, and the selection antibiotic that can be used in the process may vary depending on the antibiotic gene contained in the expression vector.

In addition, by using the surface expression vector (pKV-Pald-PgsA-EGFP) prepared in Example 5 below, the PgsA gene was modified into fragments so that it could more stably exhibit a high expression rate in the lactic acid bacteria host.

First, in order to obtain a PgsA fragment containing 1-60 aa, 1-70 aa, 1-80 aa, 1-100 aa, 1-188 aa among the PgsA fragments, a surface expression vector (pKV-Pald-PgsA-EGFP ) was obtained by performing PCR using the primers of SEQ ID NOs: 8 to 17 as a template.

As a result, a DNA fragment including the aldolase promoter and each PgsA motif fragment was obtained, and the SphI restriction enzyme was included at the 5' end of the fragment, and the BamHI restriction enzyme site was located at the 3' end of the fragment. contains The obtained DNA fragment was treated with SphI and BamHI to secure the fragment. In addition, it was confirmed that each of the PgsA1 to A5 motif fragments had the nucleotide sequences of SEQ ID NOs: 18 to 22.

On the other hand, in order to secure a PgsA fragment containing 25-60 aa, 25-70 aa, and 25-100 aa among the PgsA fragments, the surface expression vector (pKV-Pald-PgsA-EGFP) is used as a template of SEQ ID NOs: 23 to 28 It was obtained by performing PCR using primers.

As a result, DNA fragments including each PgsA motif fragment were obtained, and EcoRV restriction enzyme was included at the 5' end of the fragment, and the BamHI restriction enzyme site was included at the 3' end of the fragment. The obtained DNA fragment was treated with EcoRV and BamHI to secure the fragment. In addition, it was confirmed that each PgsA motif fragment has the nucleotide sequence of SEQ ID NOs: 29 to 31.

The present invention selects an extracellular membrane protein involved in the synthesis of polygamma-glutamic acid derived from a Bacillus sp. strain as a new surface expression matrix capable of large-scale expression of foreign proteins on the surface of microorganisms, and uses them to produce foreign proteins or peptides in microorganisms An object of the present invention is to provide a method for preparing a surface expression vector that can be expressed on the surface and efficiently expressing a foreign protein on the surface of the transformant in various transformants transformed with this vector.

In order to achieve the above object, the present invention provides a microbial surface expression vector comprising the gene pgsA constituting the polygamma-glutamic acid synthase complex and a strain transformed by the vector.

The present invention also provides a method for expressing a foreign protein on the surface of a transformant using the microbial surface expression vector in order to achieve the above object.

The protein encoded by the gene pgsA is an extracellular membrane protein present in Bacillus subtilis (Bacillus subtilis IFO3336; Natto bacteria; Biochem. Biophy. Research Comm., 263, 6-12, 1999), Bacillus licheniformis (Bacillus subtilis IFO3336; Bacillus. licheniformis ATCC9945; Biotech. Bioeng. 57(4), 430-437, 1998), Bacillus anthracis; J. Bacteriology, 171, 722-730, 1989) edible, water-soluble, anionic, It is a protein involved in the synthesis of polygamma-glutamic acid, a biodegradable polymer.

In the case of Bacillus subtilis IFO3336, the extracellular membrane protein isolated from bacteria is a protein consisting of a total of 922 amino acids, consisting of pgsB, pgsC and pgsA, pgsB is 393 amino acids, pgsC is 149 amino acids, and pgsA is 380 amino acids. It is composed of amino acids. Ashiuchi et al. have observed the synthesis of polygammaglutamic acid in Escherichia coli by cloning and transforming the polygammaglutamic acid synthesis gene extract derived from Bacillus natto [Ashiuchi et al., Biochem. Biophys. Res. Communications, 263: 6-12 (1999)].

However, the specific role and function of the protein pgsA constituting the polygamma-glutamic acid synthetase complex has not yet been elucidated. However, among the complex proteins, pgsB is an amide ligase system, and the specific amino acid at the N-terminus of pgsB interacts with the cell membrane or cell wall, and in the case of pgsA, it has a hydrophilic specific amino acid sequence at the N-terminus and C-terminus. In addition to the help of pgsB, it is presumed that these amino acid sequences have a secretion signal, a target, and an adhesion signal that can pass through the inner cell membrane.

As a result of the study of the present inventors, it was found that the extracellular membrane protein involved in the synthesis of polygamma-glutamic acid has many advantages as a surface expression matrix for expressing foreign proteins on the cell surface due to its amino acid primary sequence structure and characteristics: First, polygammaglutamic acid The extracellular membrane protein involved in the synthesis of polygamma-glutamic acid can be expressed in large amounts on the cell surface for the synthesis and extracellular secretion of polygamma-glutamic acid. Second, the extracellular membrane protein involved in the synthesis of the expressed polygammaglutamic acid is at rest in the cell cycle. Thirdly, structurally, especially in the case of pgsA, it protrudes on the cell surface, and fourthly, the extracellular membrane protein involved in the synthesis of polygamma-glutamic acid has its origin on the surface of Gram-positive bacteria, and not only in various Gram-positive bacteria. However, there is an advantage of lighting that it can be stably expressed on the surface of Gram-negative bacteria.

An object of the present invention is to provide a useful vector capable of expressing a foreign protein on the surface of bacteria by using the properties of the extracellular membrane protein involved in the synthesis of polygamma-glutamic acid. In particular, the surface expression vector of the target protein of the present invention includes a secretion signal and a target signal possessed on the primary sequence of the extracellular membrane protein involved in the synthesis of polygamma-glutamic acid.

Another object of the present invention is to provide a method for expressing a foreign protein on the surface of a microorganism using a surface expression vector using the characteristics of the extracellular membrane protein involved in the synthesis of polygamma-glutamic acid. In particular, the present invention uses the extracellular membrane protein involved in the synthesis of polygamma-glutamic acid to express the foreign protein on the surface of the microorganism, so that the foreign protein can be efficiently used without cell disruption or protein separation and purification. It provides a manufacturing method of

In addition, in the present invention, the "target protein" or "foreign protein" refers to a protein that cannot normally exist in a transformed host cell expressing the protein. For example, when lactic acid bacteria are engineered to artificially express a virus-derived or tumor-derived protein, the protein is referred to as a foreign protein or a target protein.

More specifically, the target protein is preferably an antigen derived from an infectious microorganism, an immune disease, or an antigen derived from a tumor, for example, a fungal pathogen, bacteria, parasite, intestinal parasite (helminth), virus or an allergen. may, but is not limited thereto. More specifically, the antigen is tetanus toxoid, hemagglutinin or nucleoprotein of influenza virus, diphtheria toxoid, gp120 of HIV or a fragment thereof, gag protein of HIV, IgA pro Tinase (protease), insulin peptide B, Spongospora subterranea antigen, Vibriose antigen, Salmonella antigen, Pmeumococcus antigen, RSV (Respiratory syncytial virus) antigen , Hemophilus influenza outer membrane protein, Streptococcus pneumoniae antigen, Helicobacter pylori urease, Neisseria meningitidis pilin , N. gonorrhoeae pilin, melanoma-associated antigens: TRP2, MAGE-1, MAGE-3, gp100, tyrosinease, MART-1, HSP-70 , beta-HCG), HPV-16, -18, -31, --35, or -45 antigens of human papillomavirus including E1, E2, E6 and E7 derived from -45, CEA tumor antigens, normal or mutated ras protein, normal or mutated p53, Muc1, pSA, etc., and also include cholera, diphtheria, Haemophilus, hepatitis A, hepatitis B, influenza, measles, encephalitis, Mumps, whooping cough, chickenpox, pneumococcal pneumonia, polio, rabies, rubella, tetanus, tuberculosis, Addison's disease, immune response triggers en), antigens known in the art derived from allergens, cancer including solid tumors and hematological tumors, acquired immunodeficiency syndrome, factors involved in transplant rejection of kidney, heart, pancreas, lung bone, liver, etc. Antigens that induce autoimmunity may be included.

Accordingly, the foreign protein produced by the surface expression method of the present invention can be provided for various uses. This application includes the effective production of antibodies and enzymes, as well as the production of peptide libraries for screening antigens, adhesion or adsorption proteins, and novel physiologically active substances.

Surface expression vectors using genes involved in the synthesis of all kinds of polygammaglutamic acid, including the extracellular membrane protein involved in the synthesis of polygammaglutamic acid derived from Bacillus sp. strain, are all included in the scope of the present invention.

In addition, the surface expression vector using the polygamma-glutamic acid synthetic gene of the present invention can be applied to all strains to express foreign proteins on the surface of microorganisms, preferably Gram-negative bacteria, more preferably Escherichia coli, Salmonella typhi , Salmonella typhimurium, Vibrimo cholera, Mycobacterium bovis, Shigella, and Gram-positive bacteria, preferably Bacillus, Lactobacillus, Lactococcus, Stephylococcus, Listeria monocytogenes, Streptococcus strains, etc. can be applied. All methods for preparing foreign proteins using the strain are included in the scope of the present invention.

If necessary, various recognition sites of all or some restriction enzymes can be inserted into the N-terminus or C-terminus of the polygamma-glutamic acid synthesis gene, and all surface expression vectors into which these restriction enzyme sites are inserted are within the scope of the present invention. Included.

Specifically, the present invention includes pgsA, a polygamma-glutamic acid synthesis gene derived from a Bacillus sp. strain, and inserts a restriction enzyme recognition site at the C-terminus of pgsA to facilitate cloning of various foreign protein genes. Pald-pgsA1 to pKV-Pald-pgsA8 are provided.

The present invention is composed of pgsA, which is a complex of extracellular membrane proteins, among the complex of extracellular membrane proteins involved in the synthesis of polygamma-glutamic acid, and connects the N-terminus of the EGFP protein to the C-terminus of pgsA, thereby converting the EGFP protein into a fusion protein. Provided are surface expression vectors pKV-Pald-pgsA1 to pKV-Pald-pgsA8 that can be expressed on the surface of Gram-positive bacteria.

In particular, according to one embodiment, the gene pgsA of the extracellular membrane protein involved in polygamma-glutamic acid synthesis was obtained from Bacillus subtilis chungkookjang (Bacillus subtilis var. chungkookjang, KCTC 0697BP), but the gene is all Bacillus producing polygammaglutamic acid. Obtaining pgsA from a genus strain to prepare a vector or to surface-express a foreign protein will also be included in the scope of the present invention. For example, using the pgsA gene derived from another strain having at least 80% homology with the nucleotide sequence of the pgsA gene present in Bacillus subtilis cheonggukjang will be included in the scope of the present invention to prepare a vector or surface-express a foreign protein. .

According to another embodiment of the present invention, in order to check whether the protein is efficiently expressed on the E. coli cell surface, enhanced green fluorescent protein (EGFP) was selected and confirmed as a model protein. "Enhanced green fluorescent protein (EGFP) gene" is a gene that emits green light in a living body and makes it easy to observe cells expressing the corresponding protein, and has the advantage of being observable with a fluorescence microscope. GFP is a green fluorescent protein originating from jellyfish (Aequorea Victoria) and has been used as an important marker of gene expression in various research fields. EGFP is a mutant of GFP, and the 64th phenylalanine amino acid sequence of GFP is leucine and the 65th serine amino acid sequence is replaced with Threonine. There is an advantage of emitting a strong fluorescent signal.

The present inventors insert the EGFP gene into the pKV-Pald-pgsA1 to pKV-Pald-pgsA8 recombinant vector prepared above to prepare a surface expression vector, transform Lactobacillus casei using this, and then culture to induce expression Then, a certain amount of the culture medium was collected to obtain a protein. The obtained protein was analyzed by SDS-PAGE, and western blotting was performed using an anti-EGFP antibody. As a result, the protein EGFP was added to the prepared pKV-Pald-pgsA1 to pKV-Pald-pgsA8 recombinant vectors. was successfully inserted and it was confirmed that it was expressed on the cell surface.

In addition, although EGFP protein was used as a foreign protein in the above embodiment, any protein such as other enzymes, antigens, antibodies, adhesion proteins or adsorption proteins may be foreign proteins.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

In particular, in the following examples, the pgsA gene was used as a motif for constructing a surface expression vector, but it is also possible to obtain similar results when pgsB, pgsC, or a combination thereof is used in addition to the prior patent of the present applicant (WO2003/014360) It will be apparent to those skilled in the art as identified in

In addition, in the following examples, a surface expression vector applied to Gram-positive bacteria was prepared, and Lactobacillus casei was used as a host cell, but any Gram-positive bacteria other than Lactobacillus casei may be utilized as host cells, and Gram-positive bacteria In addition, transformation with any gram-negative bacteria and other bacteria will be apparent to those skilled in the art.

Example 1: Securing of galactose mutarotase promoter derived from Lactobacillus casei

A 700 bp DNA fragment corresponding to the promoter region of the galactose mutarotase gene was obtained from the genome of Lactobacillus casei through PCR.

Lactobacillus casei is a basal MRS medium (1% casein hydrolysate, 1.5% yeast extract, 2% dextrose, 0.2% ammonium citric acid, 0.5% sodium acetate, 0.01% magnesium sulfate, 0.05% manganese sulfate and 0.2% dipotacium phosphate, cultured in Acumedia Manufacturers, Inc.), and a ^{solution obtained by disrupting the cultured Lactobacillus 1x10 9} cells was used as a template for PCR.

To facilitate insertion into the vector during gene cloning, the cleavage sites of SphI and XhoI were prepared to be located at each end of the primers (SEQ ID NO: 2 and SEQ ID NO: 3). As a result of performing PCR using the primers, a total length of 700 An amplification product of bp (SEQ ID NO: 1) was obtained, and the PCR amplification product was cloned into pGEM-Teasy vector (Promega Co., USA) and the nucleotide sequence was analyzed (FIG. 1).

SEQ ID NO: 2: 5'-TACGGCATGCTTGAATTGGTTTCTTACGAT-3'

SEQ ID NO: 3: 5'-TACGCTCGAGGTTGAATTACCTCCTAATAG-3'

Example 2: Construction of EGFP protein surface expression vector (pKV-Pgm-pgsA-EGFP) using galactose mutarotase promoter

In order to prepare an expression vector for EGFP protein expression induced by the galactose mutarotase promoter, galactose mutaro derived from Lactobacillus casei was added to a vector having RepE, which can be replicated in Escherichia coli and Lactobacillus casei, as the replication origin (replication origin). After inserting the Tase promoter, pgsA, which is a surface expression parent derived from Bacillus subtilis var. Chungkookjang, is introduced downstream of the promoter, and BamHI, XbaI that can insert a target gene into the carboxy terminus of pgsA By adding an enzyme site, a pKV-Pgm-pgsA vector containing a galactose mutarotase promoter was prepared. The pgsA gene disclosed in Korean Patent Registration No. 0469800 was used.

The EGFP gene was obtained after PCR was performed using the synthetic EGFP gene fragment as a template and SEQ ID NO: 4 and SEQ ID NO: 5 as primers.

SEQ ID NO: 4: 5'-TGGTGGATCCGTGAGCAAGGGCGAGGAGCTG-3'

SEQ ID NO: 5: 5'-TGACTCTAGAACTAGTGTCGACGGTACCTTACTTGTACAGCTCGTCC-3'

As a result, a DNA fragment containing a BamHI restriction enzyme site at the 5' end and an XbaI restriction enzyme site at the 3' end was obtained. The 755bp DNA fragment containing the EGFP gene is cut with BamHI and XbaI and linked to the pgsA C terminus of the pKV-Pgm-pgsA vector. When transformed into a lactobacillus host, the EGFP protein can be surface-expressed outside the cell. An expression vector pKV-Pgm-pgsA-EGFP was completed ( FIG. 2 ).

Example 3: Confirmation of expression of target protein and intensity of expression induction through Western blotting

In this example, Lactobacillus casei was transformed with the pKV-Pgm-pgsA-EGFP expression vector prepared in Example 2, and the transformed recombinant Lactobacillus casei was cultured to confirm the expression of EGFP protein.

In order to confirm the expression inducing power of the new promoter by comparing the expression induction strength of the new galactose mutarotase promoter with the existing aldolase promoter, an expression vector was constructed by linking the EGFP gene as a reporter gene to each promoter, and Lactobacillus casei Each was transformed. And the amount of EGFP expression was compared through Western blotting.

First, the recombinant Lactobacillus casei transformed with the surface expression vector of the present invention was cultured in MRS medium (Lactobacillus MRS, Becton Dickinson and Company Sparks, USA), at 30° C. to induce surface expression of the EGFP protein.

The cultured whole cells of Lactobacillus casei were subjected to SDS-polyacrylamide gel electrophoresis and Western blotting using a specific antibody against EGFP to confirm the expression of the fusion protein.

Specifically, the transformed recombinant Lactobacillus casei whole cells induced in expression were denatured with the protein obtained at the same cell concentration to prepare a sample, which was analyzed by SDS-polyacrylamide gel electrophoresis, and then fractionated Proteins were transferred to PVDF (polyvinylidene-difluoride membranes, Bio-Rad) membranes. The PVDF membrane onto which the proteins were transferred was blocked in blocking buffer (50 mM Tris-HCl, 5% skim milk, pH 8.0) for 1 hour, and then each rabbit-derived polyclonal antibody to EGFP was blocked. It was diluted 1000-fold in buffer and reacted for 1 hour. After the reaction, the membrane was washed with a buffer solution, and a secondary antibody against a rabbit-derived antibody conjugated with HRP (horseradish peroxidase) was diluted 10,000 times in blocking buffer and reacted for 1 hour. After the reaction is completed, the membrane is washed with a buffer solution, and a substrate (Lumigen PS-3 acridan, H ₂ 0 ₂ ) is added to the washed membrane to develop color for about 2 minutes. Binding was confirmed.

Figure 3 shows the results of Western blotting to confirm the expression level of the EGFP protein in recombinant Lactobacillus casei whole cells transformed with the cell surface expression vector of the present invention. Lane SM is a protein size marker, Lane 1 is Lactobacillus casei (empty vector), Lane 2 and 3 are Lactobacillus casei (pKV-Pgm-pgsA-EGFP), Lane 4 is Lactobacillus casei (pKV-Pald-pgsA-EGFP) indicates expression.

In contrast to the expression vector pKV-Pald-pgsA-EGFP (Lane 4) of the target protein, the expression of the target protein was confirmed in the pKV-Pgm-pgsA-EGFP (Lane 2 and 3) expression vector of the present invention as well as the expression level. It was confirmed that it was even better. This indicates that the galactose mutarotase promoter of the present invention stably expresses the target protein in the expression vector and can be expressed more strongly compared to the Aldoalse promoter (FIG. 3).

Example 4: Confirmation of microbial surface expression of two target proteins using a confocal fluorescence microscope

In order to confirm the expression level of the surface expression vector of the present invention, the fluorescence image was observed through a confocal microscope (Carl Zeiss LSM800).

Recombinant Lactobacillus casei transformed with the surface expression vector of the present invention (pKV-Pgm-pgsA-EGFP) was cultured in MRS medium (Lactobacillus MRS, Becton Dickinson and Company Sparks, USA), 30° C. expression was induced. After binding with a specific antibody of EGFP, immunostaining was performed with Alexa488 (green), and cell surface expression of EGFP was confirmed by confocal microscopy.

As a result, as shown in FIG. 4 , it was confirmed that fluorescence was stably expressed in the recombinant Lactobacillus casei transformed with the expression vector of the present invention.

Therefore, the expression vector of the present invention does not require the step of detoxification or detoxification of the strain, unlike the conventional vaccine production method through transformation of lactic acid bacteria, and expresses the target protein more strongly, so it can be used for the production of a microbial vaccine. It is expected that there will be

Example 5: Preparation of surface expression vector pKV-Pald-pgsA-EGFP

To prepare the EGFP expression vector, a gene encoding the EGFP protein was inserted into the C-terminal of PgsA using the surface expression vector prepared in pKV-Pald-PgsA-E7 (refer to Korean Patent No. 10-1471043). A vector pKV-Pald-PgsA-EGFP that can be surface-expressed in lactic acid bacteria was obtained.

First, the HPV16 E7 gene fused with pgsA was removed from the pKV-Pald-PgsA-E7 vector, and a gene encoding EGFP was inserted. The synthetic EGFP gene fragment was obtained by performing PCR using SEQ ID NO: 6 and SEQ ID NO: 7 as primers as a template.

SEQ ID NO: 6: 5' TGGTGGATCCGTGAGCAAGGGCGAGGAGCTG 3'

SEQ ID NO: 7: 5' TGACTCTAGAACTAGTGTCGACGGTACCTTACTTGTACAGCTCGTCC 3'

As a result, a 755 bp fragment containing the EGFP gene was obtained, and the 5' end of the fragment contained a BamHI restriction site, and the 3' end of the fragment contained an XbaI restriction site. The obtained DNA fragment was treated with BamHI and XbaI restriction enzymes and cut to obtain a 741bp fragment.

The pKV-Pald-PgsA-E7 was digested with BamHI and XbaI to remove the HPV16 E7 gene portion and secure the vector portion.

The DNA fragment containing the E7 gene digested with BamHI and XbaI was ligated with the vector digested with the same restriction enzyme to complete pKV-Pald-PgsA-EGFP (FIG. 5).

Example 6: Surface expression vector PgsA motif improvement

In this example, using the surface expression vector (pKV-Pald-PgsA-EGFP) prepared in Example 5, the PgsA gene was modified into fragments so that it could more stably exhibit a high expression rate in the lactic acid bacteria host.

First, in order to obtain a PgsA fragment containing 1-60 aa, 1-70 aa, 1-80 aa, 1-100 aa, 1-188 aa among the PgsA fragments, a surface expression vector (pKV-Pald-PgsA-EGFP ) was obtained by performing PCR using the following primers as a template.

PgsA motif 1-60 a.a

SEQ ID NO: 8:

5' TCGAGCATGCAATACCCACTTATTGCGATTTGCT 3'

SEQ ID NO: 9: 5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTGAGAGTACGTCGTCAGAATACGTT 3'

PgsA motif 1-70 a.a

SEQ ID NO: 10:

5' TCGAGCATGCAATACCCACTTATTGCGATTTGCT3'

SEQ ID NO: 11:

5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTCCCATCATAATATCGCCTACAAAT 3'

PgsA motif 1-80 a.a

SEQ ID NO: 12:

5' TCGAGCATGCAATACCCACTTATTGCGATTTGCT3'

SEQ ID NO: 13:

5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTTTTTGCTCGTTACTTTTTCAACA 3'

PgsA motif 1-100 a.a

SEQ ID NO: 14:

5' TCGAGCATGCAATACCCACTTATTGCGATTTGCT3'

SEQ ID NO: 15:

5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTGCTACATAATCCGAGGCTCTAAAG 3'

PgsA motif 1-188 a.a

SEQ ID NO: 16:

:5 TCGAGCATGCAATACCCACTTATTGCGATTTGCT 3'

SEQ ID NO: 17:

5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCGACTTTCTGGTACGAAATTTTCTTT 3'

As a result, a DNA fragment including the aldolase promoter and each PgsA motif fragment was obtained, and the SphI restriction enzyme was included at the 5' end of the fragment, and the BamHI restriction enzyme site was located at the 3' end of the fragment. contains The obtained DNA fragment was treated with SphI and BamHI to secure the fragment. In addition, it was confirmed that each of the PgsA1 to A5 motif fragments had the following nucleotide sequence.

PgsA 1-60 a.a fragment sequence (PgsA1)

SEQ ID NO: 18:

5'ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAACGTATTCTGACGACGTACTCTCA 3'

PgsA 1-70 a.a fragment sequence (PgsA2)

SEQ ID NO: 19:

5'ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCGAACGTATTCTGACGACGTACTCTCAGCCTCATTTGATGG

PgsA 1-80 a.a fragment sequence (PgsA3)

SEQ ID NO: 20:

5'ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCGGAAACGTGTATTCTGACGACGTACTTAACAGTAGACTAAATTTG 3'

PgsA 1-100 a.a fragment sequence (PgsA4)

SEQ ID NO: 21:

5'ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGACGCTATGTTGAAAAAGTAACGGAGCAAAAAGGGGCAGACAGTATTTTTCAATATGTTGAACCGATCTTTAGAGCCTCGGATTATGTAGCA 3 '

PgsA 1-188 a.a fragment sequence (PgsA5)

SEQ ID NO: 22:

5'ATGAAAAAAGAACTGAGCTTTCATGAAAAGCTGCTAAAGCTGACAAAACAGCAAAAAAAGAAAACCAATAAGCACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGACGCTATGTTGAAAAAGTAACGGAGCAAAAAGGGGCAGACAGTATTTTTCAATATGTTGAACCGATCTTTAGAGCCTCGGATTATGTAGCAGGAAACTTTGAAAACCCGGTAACCTATCAAAAGAATTATAAACAAGCAGATAAAGAGATTCATCTGCAGACGAATAAGGAATCAGTGAAAGTCTTGAAGGATATGAATTTCACGGTTCTCAACAGCGCCAACAACCACGCAATGGATTACGGCGTTCAGGGCATGAAAGATACGCTTGGAGAATTTGCGAAGCAAAACCTTGATATCGTTGGAGCGGGATACAGCTTAAGTGATGCGAAAAAGAAAATTTCGTACCAGAAAGTC 3 '

The pKV-Pald-PgsA-EGFP was digested with SphI and BamHI to obtain a vector part from which the aldolase promoter and PgsA gene part were removed.

A DNA fragment containing the aldolase promoter digested with SphI and BamHI and containing each PgsA motif fragment gene was ligated with a vector digested with the same restriction enzyme to complete an improved vector ( FIGS. 6 to 10 ).

On the other hand, in order to obtain a PgsA fragment containing 25-60 aa, 25-70 aa, and 25-100 aa among the PgsA fragments, the surface expression vector (pKV-Pald-PgsA-EGFP) was used as a template using the following primers. It was obtained by performing PCR.

PgsA motif 25-60 a.a

SEQ ID NO: 23:

5' CGCTGGATATCTACATGCACGTATTTATTGCCATTCCG 3'

SEQ ID NO: 24:

5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTGAGAGTACGTCGTCAGAATACGTT 3'

PgsA motif 25-70 a.a

SEQ ID NO: 25:

5' CGCTGGATATCTACATGCACGTATTTATTGCCATTCCG 3'

SEQ ID NO: 26:

5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTCCCATCATAATATCGCCTACAAAT 3'

PgsA motif 25-100 a.a

SEQ ID NO: 27:

5' CGCTGGATATCTACATGCACGTATTTATTGCCATTCCG 3'

SEQ ID NO: 28:

5'TACGGGATCCACCAGAACCACCAGAACCACCAGAACCACCAGAACCACCTGCTACATAATCCGAGGCTCTAAAG 3'

As a result, DNA fragments including each PgsA motif fragment were obtained, and EcoRV restriction enzyme was included at the 5' end of the fragment, and the BamHI restriction enzyme site was included at the 3' end of the fragment. The obtained DNA fragment was treated with EcoRV and BamHI to secure the fragment. In addition, it was confirmed that each PgsA motif fragment has the following nucleotide sequence.

PgsA 25-60 a.a fragment sequence (PgsA6)

SEQ ID NO: 29:

5'CACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCA 3'

PgsA 25-70 a.a fragment sequence (PgsA7)

SEQ ID NO: 30:

5'CACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGA 3

PgsA 25-100 a.a fragment sequence (PgsA8)

SEQ ID NO: 31:

5'CACGTATTTATTGCCATTCCGATCGTTTTTGTCCTTATGTTCGCTTTCATGTGGGCGGGAAAAGCGGAAACGCCGAAGGTCAAAACGTATTCTGACGACGTACTCTCAGCCTCATTTGTAGGCGATATTATGATGGGACGCTATGTTGAAAAAAGTAACGGAGCAAAAAGGGGCAGACAGTGATTATTTTTCAATA 3'

pKV-Pald-PgsA-EGFP was digested with EcoRV and BamHI to obtain a vector part from which the PgsA gene part was removed.

An improved vector was completed by ligating a DNA fragment containing each PgsA motif fragment gene digested with EcoRV and BamHI with a vector digested with the same restriction enzyme ( FIGS. 11 to 13 ).

Example 7: Confirmation of expression of PgsA motif improved surface expression vector transformant

In this example, Lactobacillus casei was transformed with the PgsA motif improved surface expression vector prepared in Example 5, and the transformed recombinant Lactobacillus casei was cultured to confirm the expression of EGFP protein. The expression of the EGFP protein fused with any one of the improved fragments pgsA1 to A8 in the transformed recombinant Lactobacillus casei was examined.

Any one of the gene fragments pgsA1 to A8 for synthesizing polygamma-glutamic acid by statically culturing recombinant Lactobacillus casei transformed with the PgsA motif fragment surface expression vector in MRS medium (Lactobacillus MRS, Becton Dickinson and Company Sparks, USA) at 30°C. Surface expression of EGFP protein fused with one C-terminus was induced.

The cultured whole cells of Lactobacillus casei were subjected to SDS-polyacrylamide gel electrophoresis and western blotting using a specific antibody against EGFP to confirm the expression of the fusion protein.

Specifically, the transformed recombinant Lactobacillus casei whole cells induced in expression were denatured with the protein obtained at the same cell concentration to prepare a sample, which was analyzed by SDS-polyacrylamide gel electrophoresis, and then fractionated Proteins were transferred to PVDF (polyvinylidene-difluoride membranes, Bio-Rad) membranes. The PVDF membrane to which the proteins were transferred was blocked by shaking in a blocking buffer solution (50 mM Tris hydrochloric acid, 5% skim milk, pH 8.0) for 1 hour, and then a rabbit-derived polyclonal primary antibody against EGFP was blocked in blocking buffer. The solution was diluted 1000 times and reacted for 1 hour. After the reaction, the membrane was washed with a buffer solution, and the HRP-conjugated rabbit secondary antibody was diluted 10000 times in the blocking buffer and reacted for 1 hour. After the reaction is completed, the membrane is washed with a buffer solution, a substrate (lumigen PS-3 acridan, H202) is added to the washed membrane to develop color for about 2 minutes, and the specific binding between the EGFP-specific antibody and the fusion protein is confirmed with a CCD camera. (Fig. 14).

14 is an expression pattern (lane 6 and 11) in Lactobacillus casei according to the pKV-Pald-pgsA recombinant expression vector into which unmodified pgsA set as a control is inserted compared to the present invention (lane 6 and 11) and improved pgsA1 according to the present invention The expression patterns (lanes 1 to 5 and lanes 7 to 10) in Lactobacillus casei according to the pKV-Pald-pgsA1 to A8 recombinant expression vectors into which to A8 are inserted are shown.

Specifically, lane 1 of FIG. 14 is a recombinant Lactobacillus casei transformed with EGFP expression in PgsA motif 1-60 aa, lane 2 is PgsA motif 1-70 aa, lane 3 is PgsA motif 1-80 aa, Lane 4 is the expression of recombinant Lactobacillus casei transformed with EGFP in PgsA motif 1-100 aa. Lane 5 shows the protein expression of recombinant Lactobacillus casei transformed with EGFP in PgsA motif 1-188 a.a. Lane 6 shows protein expression of recombinant Lactobacillus casei transformed with pKV-Pald-PgsA-EGFP.

In addition, lane 7 of FIG. 14 is a recombinant Lactobacillus casei transformed with EGFP expression in PgsA motif 25-60 aa, lane 8 is PgsA motif 25-70 aa, lane 9 is PgsA motif 25-100 aa with EGFP is the expression of the transformed recombinant Lactobacillus casei. lane 10 shows the protein expression of recombinant Lactobacillus casei transformed with EGFP in PgsA motif 1-188 a.a. lane 11 shows protein expression of recombinant Lactobacillus casei transformed with pKV-Pald-PgsA-EGFP.

Compared to the expression of the EGFP fusion protein by the non-modified pKV-Pald-pgsA-EGFP surface expression vector, it was confirmed that the EGFP fusion protein containing the improved PgsA motif fragment was more strongly expressed.

<110> SEWON <120> Highly expressed vector on the surface using promoter of galactose mutarotase from Lactobacillus casei and thereof utilization <130> O/PAPCT-QQ0208 <150> KR 10-2018-0120546 <151> 2018-10-10 <160> 31 <170> KoPatentIn 3.0 <210> 1 <211> 700 <212> DNA <213> Lactobacillus casei <400> 1 ttgaattggt ttcttacgat ggtaagacca acgaaactgg tacagctgca tgggctaaag 60 ctaagcctga aaaggtcatc aagatcacca aggaattcag caagccgcaa tacaatgttt 120 ctgttttgaa gcttgaagtt ccagttgatc aaaagtttgt tgaaggctac accgatgacg 180 gcgttacccc tgtttacagc aaggaagaag ccgctaagta ttacaaggaa cagtcagatg 240 caacggatct cccattcatc ttcctgtccg ctggtgtcac caacgaattg ttccttgaag 300 aactcaagtt tgctaagcaa gcaggttcag cctttaatgg tgttctctgt ggccgtgcaa 360 cttggaagcc gggtgttaag ccatatgctg ctgaaggcga agctgctggt aagaagtggc 420 tgcagaccga aggcaaggct aacattgatc gtttgaacaa ggtgcttgca gaaactgcaa 480 ccccttggac tgacaaagtt gaaggttaat ctttaaccat agttgcaaga aaggaccgat 540 tatgatgatc ggttcttttt ttatgactgc ggacatgttt ttgtgaccac tgcaaacatc 600 aaaatgaagt tcgaaaaact tgctaacaat cattacaggt cagtgatcca gtggtagact 660 ggtattgaat gcgttttcgt ctattaggag gtaattcaac 700 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 2 tacggcatgc ttgaattggt ttcttacgat 30 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 3 tacgctcgag gttgaattac ctcctaatag 30 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 4 tggtggatcc gtgagcaagg gcgaggagct g 31 <210> 5 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 5 tgactctaga actagtgtcg acggtacctt acttgtacag ctcgtcc 47 <210> 6 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 6 tggtggatcc gtgagcaagg gcgaggagct g 31 <210> 7 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 7 tgactctaga actagtgtcg acggtacctt acttgtacag ctcgtcc 47 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 8 tcgagcatgc aatacccact tattgcgatt tgct 34 <210> 9 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 9 tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct gagagtacgt 60 cgtcagaata cgtt 74 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 10 tcgagcatgc aatacccact tattgcgatt tgct 34 <210> 11 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 11 tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct cccatcataa 60 tatcgcctac aaat 74 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 12 tcgagcatgc aatacccact tattgcgatt tgct 34 <210> 13 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 13 tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct ttttgctccg 60 ttactttttc aaca 74 <210> 14 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 14 tcgagcatgc aatacccact tattgcgatt tgct 34 <210> 15 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 15 tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct gctacataat 60 ccgaggctct aaag 74 <210> 16 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 16 tcgagcatgc aatacccact tattgcgatt tgct 34 <210> 17 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 17 tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccaccg actttctggt 60 acgaaatttt cttt 74 <210> 18 <211> 180 <212> DNA <213> Artificial Sequence <220> <223> pgsA1 <400> 18 atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag 60 aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc 120 atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca 180 180 <210> 19 <211> 210 <212> DNA <213> Artificial Sequence <220> <223> pgsA2 <400> 19 atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag 60 aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc 120 atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca 180 gcctcatttg taggcgatat tatgatggga 210 <210> 20 <211> 240 <212> DNA <213> Artificial Sequence <220> <223> pgsA3 <400> 20 atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag 60 aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc 120 atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca 180 gcctcatttg taggcgatat tatgatggga cgctatgttg aaaaagtaac ggagcaaaaa 240 240 <210> 21 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> pgsA4 <400> 21 atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag 60 aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc 120 atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca 180 gcctcatttg taggcgatat tatgatggga cgctatgttg aaaaagtaac ggagcaaaaa 240 ggggcagaca gtatttttca atatgttgaa ccgatcttta gagcctcgga ttatgtagca 300 300 <210> 22 <211> 564 <212> DNA <213> Artificial Sequence <220> <223> pgsA5 <400> 22 atgaaaaaag aactgagctt tcatgaaaag ctgctaaagc tgacaaaaca gcaaaaaaag 60 aaaaccaata agcacgtatt tattgccatt ccgatcgttt ttgtccttat gttcgctttc 120 atgtgggcgg gaaaagcgga aacgccgaag gtcaaaacgt attctgacga cgtactctca 180 gcctcatttg taggcgatat tatgatggga cgctatgttg aaaaagtaac ggagcaaaaa 240 ggggcagaca gtatttttca atatgttgaa ccgatcttta gagcctcgga ttatgtagca 300 ggaaactttg aaaacccggt aacctatcaa aagaattata aacaagcaga taaagagatt 360 catctgcaga cgaataagga atcagtgaaa gtcttgaagg atatgaattt cacggttctc 420 aacagcgcca acaaccacgc aatggattac ggcgttcagg gcatgaaaga tacgcttgga 480 gaatttgcga agcaaaacct tgatatcgtt ggagcgggat acagcttaag tgatgcgaaa 540 aagaaaattt cgtaccagaa agtc 564 <210> 23 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 23 cgctggatat ctacatgcac gtatttattg ccattccg 38 <210> 24 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 24 tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct gagagtacgt 60 cgtcagaata cgtt 74 <210> 25 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 25 cgctggatat ctacatgcac gtatttattg ccattccg 38 <210> 26 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 26 tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct cccatcataa 60 tatcgcctac aaat 74 <210> 27 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 27 cgctggatat ctacatgcac gtatttattg ccattccg 38 <210> 28 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 28 tacgggatcc accagaacca ccagaaccac cagaaccacc agaaccacct gctacataat 60 ccgaggctct aaag 74 <210> 29 <211> 108 <212> DNA <213> Artificial Sequence <220> <223> pgsA6 <400> 29 cacgtattta ttgccattcc gatcgttttt gtccttatgt tcgctttcat gtgggcggga 60 aaagcggaaa cgccgaaggt caaaacgtat tctgacgacg tactctca 108 <210> 30 <211> 138 <212> DNA <213> Artificial Sequence <220> <223> pgsA7 <400> 30 cacgtattta ttgccattcc gatcgttttt gtccttatgt tcgctttcat gtgggcggga 60 aaagcggaaa cgccgaaggt caaaacgtat tctgacgacg tactctcagc ctcatttgta 120 ggcgatatta tgatggga 138 <210> 31 <211> 228 <212> DNA <213> Artificial Sequence <220> <223> pgsA8 <400> 31 cacgtattta ttgccattcc gatcgttttt gtccttatgt tcgctttcat gtgggcggga 60 aaagcggaaa cgccgaaggt caaaacgtat tctgacgacg tactctcagc ctcatttgta 120 ggcgatatta tgatgggacg ctatgttgaa aaagtaacgg agcaaaaagg ggcagacagt 180 atttttcaat atgttgaacc gatctttaga gcctcggatt atgtagca 228

Claims (25)

Lactobacillus casei (Lactobacillus casei) derived from galactose mutarotase (galactose mutarotase) gene promoter.
The promoter according to claim 1, characterized in that it has the nucleotide sequence of SEQ ID NO: 1.
An expression vector comprising the gene encoding the promoter and target protein of claim 1 .
A microorganism transformed with the expression vector of claim 3.
The microbial surface expression vector characterized in that the promoter of claim 1, the polygamma-glutamic acid synthase complex gene, and the gene encoding the target protein are linked.
The microbial surface expression vector according to claim 5, wherein the target protein is an antigen.
The microbial surface expression vector according to claim 5, wherein the polygamma-glutamic acid synthase complex gene is any one or more of pgsA, pgsB, and pgsC.
A microorganism transformed with the microorganism surface expression vector of any one of claims 5 to 7.
The microorganism according to claim 8, wherein the microorganism is a lactic acid bacterium.
The surface expression vector of claim 5, wherein the gene encoding the polygamma-glutamic acid synthase complex is pgsA, and has any one of nucleotide sequences of SEQ ID NOs: 18 to 21 and 29 to 31.
The surface expression vector of claim 10, wherein the gene pgsA is derived from a Bacillus sp. strain that produces polygamma-glutamic acid.
The surface expression vector of claim 10, wherein the gene pgsA encoding the polygamma-glutamic acid synthase complex has the nucleotide sequence of SEQ ID NO: 22.
[11] The surface expression vector of claim 10, wherein a linker is inserted at the end of the gene pgsA, and a gene encoding the target protein is inserted into the inserted linker _.
The surface expression vector of the target protein according to claim 10, wherein a part of the amino acid sequence of the target protein is removed or site-specifically mutated so that the target protein is advantageous for surface expression.
The surface expression vector of any one of claims 10 to 14, wherein the vector is applied to Gram-negative or Gram-positive bacteria.
A microorganism transformed with the surface expression vector of any one of claims 10 to 14.
17. The transformation according to claim 16, wherein the microorganism used for transformation is modified so as not to produce an intracellular or extracellular protease related to decomposing the expressed target protein so as to favor the cell surface expression of the target protein. converted microorganisms.
The transformed microorganism according to claim 16, wherein the microorganism is a lactic acid bacterium.
A method of expressing a target protein on the surface of a microorganism, characterized in that culturing the transformed microorganism of claim 8.
A method for preparing a microbial vaccine comprising the steps of:
(a) culturing the microorganism transformed with the microorganism surface expression vector of claim 6 to surface-express the antigen on the surface of the microorganism;
and
(b) recovering the microorganism on which the antigen is surface-expressed.
The method according to claim 20, wherein the microorganism is a lactic acid bacterium.
A cell surface expression method of a target protein comprising the steps of culturing the transformed microorganism of claim 16 to express the target protein on the cell surface and recovering the cells in which the target protein is expressed on the surface.
23. The method of claim 22, wherein the target protein is a hormone, a hormone analog, an enzyme, an enzyme inhibitor, a signal transduction protein or a portion thereof, an antibody or a portion thereof, a single-chain antibody, a binding protein, a binding domain, a peptide, an antigen, an adhesion protein, a structural protein, A method, characterized in that any one selected from the group consisting of regulatory proteins, toxin proteins, cytokines, transcriptional regulatory factors, blood coagulation factors, and plant biodefense inducing proteins.
A method, characterized in that humoral immunity or cellular immunity is induced by administering the cells prepared by the method of claim 23 and expressing the antigen on the surface to vertebrates other than humans.
A method of expressing a target protein on the surface of a gram-negative or gram-positive host cell, comprising the steps of:
(a) preparing a recombinant vector by inserting a gene encoding the target protein into the surface expression vector of the target protein of claim 24;
(b) transforming a gram-negative or gram-positive host cell with the recombinant vector; and
(c) culturing the transformed host cell to express the target protein on the host cell surface.

Images