KR20210071809A - Multi-Genetic Marker for Predicting Risk of Disease by Reduced Immunity and Methods of Predicting Risk of Disease Using the Same - Google Patents
Multi-Genetic Marker for Predicting Risk of Disease by Reduced Immunity and Methods of Predicting Risk of Disease Using the Same Download PDFInfo
- Publication number
- KR20210071809A KR20210071809A KR1020200093453A KR20200093453A KR20210071809A KR 20210071809 A KR20210071809 A KR 20210071809A KR 1020200093453 A KR1020200093453 A KR 1020200093453A KR 20200093453 A KR20200093453 A KR 20200093453A KR 20210071809 A KR20210071809 A KR 20210071809A
- Authority
- KR
- South Korea
- Prior art keywords
- cancer
- mir
- disease
- immunity
- predicting
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
본 발명은 면역력 저하 또는 노화에 따른 질병의 발병에 대한 증가된 위험을 예측하는 것에 관한 것이다.The present invention relates to predicting an increased risk for developing diseases with reduced immunity or aging.
우리 몸은 질병에 대한 방어 기작으로서 면역 시스템을 가지고 있으며, 이의 핵심은 자신(self)과 비자신(non-self)을 정확히 식별해서 이물질을 제거하는 것이다. 이러한 면역 시스템은 단순히 우리 몸의 파수꾼 역할만 하는 것이 아니라 체내 세포를 건강하게 유지하고, 신진대사를 활발하게 하여 신체의 기능 저하 및 세포 조직의 노화를 막아주는 역할 또한 수행한다. 즉, 면역 체계가 건강하면 스트레스에도 강해지고 질병도 걸리지 않는다.Our body has an immune system as a defense mechanism against disease, and the key to this is to accurately identify self and non-self and remove foreign substances. The immune system not only serves as a watchman for our body, but also plays a role in maintaining healthy cells in the body and preventing the deterioration of body functions and aging of cellular tissues by activating metabolism. In other words, if your immune system is healthy, you will be strong against stress and not get sick.
면역의 종류를 구분하자면 크게 '선천 면역'과 '획득(후천) 면역'으로 나눌 수 있다. 선천 면역은 말 그대로 선천적으로 가지고 있는 면역으로서 세균이나 암 세포와 같은 비정상적인 이물질을 공격하여 제거하는 면역 시스템이다. NK 세포(Natural killer cell)라 불리는 면역세포가 선천 면역의 대표적인 면역세포이다. 획득 면역은 선천 면역의 다음 면역 시스템으로 특별한 이물질을 인식하고 제거하는 면역이며, 선천 면역이 무작위적인 이물질 제거라면(non-specific immune response) 획득 면역은 항원이라는 특별한 이물의 획득을 통해 인식력을 기른 후 이물을 제거하는(specific immune response) 면역이라 할 수 있다.Immunity can be divided into 'innate immunity' and 'acquired (acquired) immunity'. Innate immunity is an immune system that attacks and removes abnormal foreign substances such as bacteria or cancer cells. Immune cells called NK cells (Natural killer cells) are representative immune cells of innate immunity. Acquired immunity is immunity that recognizes and removes special foreign substances as the next immune system of innate immunity. It can be called immunity that removes foreign substances (specific immune response).
다양한 면역 반응 가운데, 염증 반응(inflammation)은 비특이적 면역 반응의 일종으로, 만성 염증은 신체 이상을 부추기며 다양한 질병의 원인이 된다. 이러한 질병의 예로는 암, 자가면역질환, 대사성질환, 노화 등이 있으며, 이들은 염증반응과 깊은 관련성이 있다. 염증이 오랫동안 지속되는 만성 염증은, 암을 비롯한 다양한 질병을 야기시킬 가능성이 높으며, 염증 반응이 초기에 제어되지 못하면 생체 내부의 기능 손실 및 항상성 불균형에 의해 만성 감염과 자가면역질환, 대사성질환 등으로 발전될 수 있다. 특히, 만성 염증부위에서 종양이 발생한다는 사실이 19세기에 제기된 이후, 만성 염증이 암 발생률을 증가시킨다는 최근의 연구결과들은 염증과 암은 악순환의 연결고리를 통하여 공통된 신호전달이 이루어지는 것으로 알려져 있으며, 염증반응은 암의 발생(initiation), 악성으로의 전환(progression), 침윤(invasion), 전이(metastasis) 등 여러 단계로 이루어진 종양의 진행 과정에 있어서 매우 중요한 역할을 한다고 알려져 있다.Among various immune responses, an inflammatory response (inflammation) is a type of non-specific immune response, and chronic inflammation promotes abnormalities in the body and causes various diseases. Examples of such diseases include cancer, autoimmune diseases, metabolic diseases, and aging, which are closely related to inflammatory responses. Chronic inflammation, where inflammation persists for a long time, is highly likely to cause various diseases including cancer, and if the inflammatory response is not controlled in the early stages, it can lead to chronic infection, autoimmune disease, metabolic disease, etc. can be developed In particular, since the fact that tumors occur at sites of chronic inflammation was raised in the 19th century, recent research results that chronic inflammation increases the incidence of cancer have shown that inflammation and cancer share a common signal through a vicious cycle. , it is known that the inflammatory response plays a very important role in the process of tumor progression, which consists of several stages, such as cancer initiation, malignant transformation, invasion, and metastasis.
면역학적 관점에서 바라본다면 질병은 면역 시스템 항상성의 불균형에 의해 나타나는 결과물로, 면역 시스템이 저하되는 경우 다양한 질병을 유발하게 된다. 구체적으로, 면역 시스템이 억제되면 전염성 질병이나 암에 대한 감수성이 증가하게 되며, 면역 시스템의 과잉 반응은 알레르기나 자가면역질환을 일으킬 수 있다. 따라서, 균형 있는 면역 활성화는 건강의 기본이자 필수적인 조건이며 개인의 면역 활성화 정도는 질병 발생 가능성의 지표가 될 수 있다.From an immunological point of view, disease is a result of an imbalance of immune system homeostasis, and when the immune system is lowered, various diseases are caused. Specifically, when the immune system is suppressed, susceptibility to infectious diseases or cancer increases, and an overreaction of the immune system may cause allergies or autoimmune diseases. Therefore, balanced immune activation is a basic and essential condition of health, and the degree of immune activation of an individual can be an indicator of the possibility of disease.
한편, 암 세포는 사람의 몸에서 매일 수 백 내지 수 천 개가 발생되고 있다. 1 개의 암세포가 1cm의 크기(약 10억 개의 암 세포)가 되는데는 약 10년 걸린다. 이 때, 암세포의 증식이나 전이를 억제하는 대표적인 면역세포로 T 세포와 NK 세포가 있으며, T 세포는 암세포를 공격, 파괴하는 면역 반응의 중심적인 역할을, NK 세포는 림프계의 세포로서 몸 속에서 발생한 이상 세포를 직접 공격, 파괴하는 역할을 한다. 즉, 암은 이러한 면역 작용(면역 활성도)이 저하되는 경우 발생하는 것이다. 이와 비교하여 대식세포(macrophage; Mq)의 경우 종양미세환경에서 가장 풍부한 정상 세포로 암의 생성 및 진행을 촉진시키는 역할을 한다고 알려져 있다.On the other hand, hundreds to thousands of cancer cells are generated every day in the human body. It takes about 10 years for one cancer cell to become 1 cm in size (about 1 billion cancer cells). At this time, there are T cells and NK cells as representative immune cells that suppress the proliferation or metastasis of cancer cells. T cells play a central role in the immune response to attack and destroy cancer cells, and NK cells are lymphatic cells in the body. It directly attacks and destroys abnormal cells. That is, cancer occurs when such an immune action (immune activity) is lowered. In comparison, macrophages (Mq) are the most abundant normal cells in the tumor microenvironment and are known to promote the generation and progression of cancer.
즉, 다양한 면역세포(T 세포, NK 세포, 대식 세포)의 상호 작용에 대한 종합적인 분석을 기반으로 하는 면역 활성도 분석은 정확한 질병 발생 가능성의 지표가 될 수 있다.That is, the immune activity analysis based on a comprehensive analysis of the interaction of various immune cells (T cells, NK cells, macrophages) can be an accurate indicator of the possibility of disease occurrence.
본 발명자들은 면역 반응, 특히 사이토카인(cytokine)의 발현을 조절하는데 관여하는 miRNA를 선별하고, 상기 miRNA의 발현 수준이 증가 또는 감소하는 경우 면역력 감소에 의한 질병의 발병 위험이 증가된다는 사실을 확인하여, 본 발명을 완성하였다.The present inventors selected miRNAs involved in regulating the immune response, in particular, the expression of cytokines, and confirmed that when the expression level of the miRNA is increased or decreased, the risk of developing diseases due to decreased immunity is increased. , the present invention was completed.
따라서, 본 발명의 목적은 miR-146a, miR-155 및 miR-454로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는, 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측용 다중 유전자 마커 조성물을 제공하는 것이다.Accordingly, it is an object of the present invention to provide a multi-gene marker composition for predicting increased risk for disease development due to reduced immunity, comprising one or more miRNAs selected from the group consisting of miR-146a, miR-155 and miR-454 will do
본 발명의 다른 목적은 miR-146a, miR-155 및 miR-454로 이루어진 군으로부터 선택된 하나 이상의 miRNA의 발현 수준을 측정하는 제제를 포함하는, 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측용 조성물을 제공하는 것이다.Another object of the present invention is to predict an increased risk of developing a disease due to reduced immunity, including an agent for measuring the expression level of one or more miRNAs selected from the group consisting of miR-146a, miR-155 and miR-454. to provide a composition.
본 발명의 또 다른 목적은, 본 발명에 따른 조성물을 포함하는, 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for predicting an increased risk for the onset of a disease due to reduced immunity, comprising the composition according to the present invention.
본 발명의 또 다른 목적은 피검체의 면역력 감소에 의한 질병의 발병에 대한 증가된 위험을 예측하기 위한 정보제공방법을 제공하는 것이다.Another object of the present invention is to provide an information providing method for predicting an increased risk of developing a disease due to a decrease in immunity of a subject.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical task to be achieved by the present invention is not limited to the tasks mentioned above, and other tasks not mentioned can be clearly understood by those of ordinary skill in the art to which the present invention belongs from the following description. will be.
본 발명의 목적을 달성하기 위해서, 본 발명은 miR-146a, miR-155 및 miR-454로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는, 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측용 다중 유전자 마커 조성물을 제공한다.In order to achieve the object of the present invention, the present invention includes one or more miRNAs selected from the group consisting of miR-146a, miR-155 and miR-454, for predicting increased risk for the onset of disease due to reduced immunity. Genetic marker compositions are provided.
또한, 본 발명은 miR-146a, miR-155 및 miR-454로 이루어진 군으로부터 선택된 하나 이상의 miRNA의 발현 수준을 측정하는 제제를 포함하는, 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측용 조성물을 제공한다.In addition, the present invention provides a composition for predicting an increased risk of developing a disease due to reduced immunity, comprising an agent for measuring the expression level of one or more miRNAs selected from the group consisting of miR-146a, miR-155 and miR-454 provides
본 발명의 일 구현예에 있어서, 상기 제제는 하나 이상의 상기 miRNA에 특이적으로 결합하는 프라이머 또는 프로브일 수 있으나, 이에 제한되는 것은 아니다.In one embodiment of the present invention, the agent may be a primer or probe that specifically binds to one or more of the miRNAs, but is not limited thereto.
또한, 본 발명은 본 발명에 따른 조성물을 포함하는, 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측용 키트를 제공한다.In addition, the present invention provides a kit for predicting an increased risk for the onset of a disease due to reduced immunity, comprising the composition according to the present invention.
또한, 본 발명은 하기의 단계를 포함하는, 피검체의 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측 방법 또는 위험을 예측하기 위한 정보제공방법을 제공한다:In addition, the present invention provides a method for predicting an increased risk for the onset of a disease due to a decrease in immunity of a subject or an information providing method for predicting the risk, comprising the steps of:
(a) 피검체로부터 시료를 채취하는 단계;(a) taking a sample from the subject;
(b) 상기 시료로부터 miR-146a, miR-155 및 miR-454로 이루어진 군으로부터 선택된 하나 이상의 miRNA의 발현 수준을 측정하는 단계;(b) measuring the expression level of one or more miRNAs selected from the group consisting of miR-146a, miR-155 and miR-454 from the sample;
(c) 상기 miRNA의 발현 수준을 정상 대조군 시료의 해당 miRNA의 발현 수준과 비교하는 단계; 및(c) comparing the expression level of the miRNA with the expression level of the corresponding miRNA in a normal control sample; and
(d) 상기 miRNA 중 적어도 하나 이상의 발현 수준에 변화가 있는 경우 면역력 감소에 의한 질병의 발병 위험도가 증가된 것으로 예측하는 단계.(d) predicting that the risk of developing a disease due to reduced immunity is increased when there is a change in the expression level of at least one of the miRNAs.
본 발명의 일 구현예에 있어서, 상기 시료는 피검체로부터 유래한 혈액, 혈청, 혈장, 타액(saliva), 생검(biopsy), 종양 조직, 액체 배양물, 분변 및 소변으로 이루어진 군에서 선택된 어느 하나일 수 있으나, 이에 제한되는 것은 아니다.In one embodiment of the present invention, the sample is any one selected from the group consisting of blood, serum, plasma, saliva, biopsy, tumor tissue, liquid culture, feces and urine derived from a subject. may be, but is not limited thereto.
본 발명의 다른 구현예에 있어서, 상기 miRNA의 발현 수준은 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 노던 블롯팅 또는 유전자 칩을 이용하여 측정할 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the expression level of the miRNA is measured using a reverse transcriptase polymerase reaction, a competitive reverse transcriptase polymerase reaction, a real-time reverse transcriptase polymerase reaction, an RNase protection assay, Northern blotting or a gene chip. However, it is not limited thereto.
본 발명의 또 다른 구현예에 있어서, 상기 면역력 감소에 의한 질병은 암, 자가면역질환, 대사성 질환 및 감염성 질환으로 이루어진 군으로부터 선택될 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the disease caused by the decrease in immunity may be selected from the group consisting of cancer, autoimmune disease, metabolic disease, and infectious disease, but is not limited thereto.
본 발명의 또 다른 구현예에 있어서, 상기 암은 폐암, 간암, 위암, 식도암, 대장암, 췌장암, 담낭암, 담도암, 유방암, 전립선암, 방광암, 갑상선암, 신장암, 자궁경부암, 난소암, 피부암, 혈액암, 림프종, 신경교종, 결장암 및 골육종으로 이루어진 군으로부터 선택될 수 있으나, 이에 제한되는 것은 아니다.In another embodiment of the present invention, the cancer is lung cancer, liver cancer, stomach cancer, esophageal cancer, colorectal cancer, pancreatic cancer, gallbladder cancer, biliary tract cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, kidney cancer, cervical cancer, ovarian cancer, skin cancer , hematological cancer, lymphoma, glioma, colon cancer and osteosarcoma, but is not limited thereto.
본 발명에 따른 다중 유전자 마커를 이용하면, 면역에 관여하는 다양한 종류의 면역세포 활성 변화를 감지할 수 있고, 따라서 면역력 감소에 의한 질병의 발병 위험을 예측할 수 있다. 따라서, 본 발명은 질병의 예방 및 관리에 매우 효과적으로 활용될 수 있으며, 이는 개인뿐만 아니라 국가적 차원에서 의료비 절감에 매우 큰 기여를 할 것으로 기대된다.By using the multiple genetic markers according to the present invention, it is possible to detect changes in the activity of various types of immune cells involved in immunity, and thus it is possible to predict the risk of developing diseases due to reduced immunity. Therefore, the present invention can be very effectively utilized for the prevention and management of diseases, which is expected to greatly contribute to the reduction of medical expenses at the national level as well as the individual.
도 1은 정상인과 6대 암 환자의 검체를 대상으로 본 발명에 따른 다중 유전자 마커의 상대적 발현을 비교한 도이다. (BC, 유방암; CC, 대장암; HCC, 간암; PC, 전립선암; LC, 폐암; SC, 위암)
도 2a는 정상인과 1기 및 2기 암 환자의 검체를 대상으로 본 발명에 따른 다중 유전자 마커의 상대적 발현을 비교한 도이다.
도 2b는 정상인과 6대 암 환자의 검체를 대상으로 IFN-γ의 생산량 변화를 비교한 도이다.
도 3은 말초 혈액 단핵세포에서 면역세포의 증식을 유도한 뒤 miR-146a, miR-155 및 miR-454의 발현 변화를 비교한 도이다.1 is a diagram comparing the relative expression of multiple genetic markers according to the present invention in a sample of a normal person and a patient with six major cancers. (BC, breast cancer; CC, colorectal cancer; HCC, liver cancer; PC, prostate cancer; LC, lung cancer; SC, stomach cancer)
2A is a diagram comparing the relative expression of multiple genetic markers according to the present invention in samples of normal subjects and stage 1 and
Figure 2b is a diagram comparing the change in the production of IFN-γ for a sample of a normal person and six cancer patients.
3 is a diagram comparing the expression changes of miR-146a, miR-155 and miR-454 after inducing the proliferation of immune cells in peripheral blood mononuclear cells.
본 발명자들은 면역 반응을 조절하는데 관여하는 miRNA를 선별하고, 상기 miRNA의 발현 수준이 증가 또는 감소하는 경우 면역력 감소에 의한 질병의 발병 위험이 증가된다는 사실을 확인하여, 본 발명을 완성하였다.The present inventors have completed the present invention by selecting miRNAs involved in regulating the immune response and confirming that the risk of disease due to reduced immunity increases when the expression level of the miRNA is increased or decreased.
본 발명의 일 실시예에서는, 면역 활성도를 측정함으로써 면역력 저하에 의한 질병의 발병 위험을 예측하기 위한 다중 유전자 마커를 선별하고, 최종 선별된 miR-146a, miR-155 및 miR-454에 대하여, 정상인과 6대 암 환자 검체를 대상으로 상기 유전자의 발현 정도를 분석한 결과 상기 3개 유전자 가운데 1개 이상의 유전자가 통계적으로 유의한 수준의 발현 변화 패턴을 나타내고 있음을 확인하였다(실시예 1 및 2 참조).In one embodiment of the present invention, multiple genetic markers are selected for predicting the risk of disease due to reduced immunity by measuring immune activity, and for the final selected miR-146a, miR-155 and miR-454, normal As a result of analyzing the expression level of the gene in the samples of the six major cancer patients, it was confirmed that one or more of the three genes exhibited a statistically significant level of expression change pattern (see Examples 1 and 2). ).
또한, 본 발명의 일 실시예에서는, 기존의 면역활성도 측정 방법인 IFN-γ 생산량 분석과의 비교 실험을 통해 본 발명에 따른 다중 유전자 마커의 발현 변화가 더 넓은 범위의 질병이 발생될 수 있는 위험 예측이 가능함을 증명하였다(실시예 3 참조).In addition, in one embodiment of the present invention, through a comparative experiment with IFN-γ production analysis, which is a conventional method for measuring immune activity, the change in the expression of multiple genetic markers according to the present invention may cause a wider range of diseases It has been demonstrated that prediction is possible (see Example 3).
뿐만 아니라, 본 발명의 일 실시예에서는, 말초 혈액 단핵세포의 면역반응 유도 실험을 통해 다중 유전자 마커 miR-146a, miR-155 및 miR-454는 면역 반응 조절과 직접적인 관련이 있는 조절자임을 확인하였으며, 따라서 상기 다중 유전자 마커의 발현 변화를 측정함으로써 향후 질병이 발생될 증가된 위험을 예측할 수 있다는 것을 증명하였다(실시예 4 참조).In addition, in one embodiment of the present invention, it was confirmed that the multiple genetic markers miR-146a, miR-155 and miR-454 are modulators directly related to the regulation of immune responses through an immune response induction experiment in peripheral blood mononuclear cells. , thus proving that an increased risk of developing a disease in the future can be predicted by measuring the expression change of the multiple genetic markers (see Example 4).
따라서, 본 발명은 miR-146a, miR-155 및 miR-454로 이루어진 군으로부터 선택된 하나 이상의 miRNA를 포함하는, 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측용 다중 유전자 마커 조성물을 제공한다.Accordingly, the present invention provides a multigene marker composition for predicting an increased risk of developing a disease due to reduced immunity, comprising one or more miRNAs selected from the group consisting of miR-146a, miR-155 and miR-454.
본 발명에서 사용된 용어, “miR-146a”는 성숙한 서열(Mature sequence)의 hsa-miR-146a-5p (miR base Accession number: MIMAT0000449) 를 의미하며, 하기의 염기서열로 이루어진 것일 수 있다.As used herein, the term “miR-146a” refers to hsa-miR-146a-5p (miR base Accession number: MIMAT0000449) of a mature sequence, and may consist of the following nucleotide sequence.
hsa-miR-146a-5p, UGAGAACUGAAUUCCAUGGGUU (서열번호 1)hsa-miR-146a-5p, UGAGAACUGAAUUCCAUGGGUU (SEQ ID NO: 1)
본 발명에서 사용된 용어, “miR-155”는 성숙한 서열의 hsa-miR-155-5p (miR base Accession number: MIMAT0000646) 를 의미하며, 하기의 염기서열로 이루어진 것일 수 있다.As used herein, the term “miR-155” refers to hsa-miR-155-5p (miR base Accession number: MIMAT0000646) of a mature sequence, and may consist of the following nucleotide sequence.
hsa-miR-155-5p, UUAAUGCUAAUCGUGAUAGGGGUU (서열번호 2)hsa-miR-155-5p, UUAAUGCUAAUCGUGAUAGGGGUU (SEQ ID NO: 2)
본 발명에서 사용된 용어, “miR-454”는 성숙한 서열의 hsa-miR-454-3p (miR base Accession number: MIMAT0003885) 를 의미하며, 하기의 염기서열로 이루어진 것일 수 있다.As used herein, the term “miR-454” refers to hsa-miR-454-3p (miR base Accession number: MIMAT0003885) of a mature sequence, and may consist of the following nucleotide sequence.
hsa-miR-454-3p, UAGUGCAAUAUUGCUUAUAGGGU (서열번호 3)hsa-miR-454-3p, UAGUGCAAUAUUGCUUAUAGGGU (SEQ ID NO: 3)
본 발명에서 사용된 용어, “발병 위험”은 면역력 감소에 의한 질병이 발병할 수 있는 상대적인 위험일 수 있다. 예를 들면, 상기 위험은 발병의 확률이 건강한 정상인 군에 비하여 증가되어 있는지, 또는 감소되어 있는지를 나타내는 것일 수 있다. As used herein, the term “onset risk” may be a relative risk of developing a disease due to reduced immunity. For example, the risk may indicate whether the probability of developing the disease is increased or decreased compared to a healthy normal group.
본 발명의 다른 양태로서, 본 발명은 miR-146a, miR-155 및 miR-454로 이루어진 군으로부터 선택된 하나 이상의 miRNA의 발현 수준을 측정하는 제제를 포함하는, 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측용 조성물을 제공한다.In another aspect of the present invention, the present invention includes an agent for measuring the expression level of one or more miRNAs selected from the group consisting of miR-146a, miR-155 and miR-454. Increase in the onset of diseases due to reduced immunity. Provided is a composition for predicting risk.
본 발명에 있어서, 상기 제제는 하나 이상의 상기 miRNA에 특이적으로 결합하는 프라이머 또는 프로브일 수 있으나, 상기 miRNA의 발현 수준을 측정하기 위한 목적이라면 그 형태에 제한되는 것은 아니다.In the present invention, the agent may be a primer or probe that specifically binds to one or more of the miRNAs, but the form is not limited as long as it is for measuring the expression level of the miRNA.
본 발명에서 사용되는 용어, “프라이머”란 DNA 합성의 기시점이 되는 짧은 유전자 서열로써, 진단, DNA 시퀀싱 등에 이용할 목적으로 합성된 올리고뉴클레오티드를 의미한다. 상기 프라이머들은 통상적으로 15 내지 30 염기쌍의 길이로 합성하여 사용할 수 있으나, 사용 목적에 따라 달라질 수 있으며, 공지된 방법으로 메틸화, 캡화등으로 변형시킬 수 있다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다.As used herein, the term “primer” refers to an oligonucleotide synthesized for use in diagnosis, DNA sequencing, etc. as a short gene sequence serving as a starting point of DNA synthesis. The primers can be synthesized and used with a length of typically 15 to 30 base pairs, but may vary depending on the purpose of use, and may be modified by methylation, capping, etc. by a known method. Primers are capable of initiating DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in appropriate buffers and temperatures.
본 발명에서 사용되는 용어, “프로브”란 효소 화학적인 분리정제 또는 합성과정을 거쳐 제작된 수 염기 내지 수백 염기길이의 RNA와 특이적으로 결합할 수 있는 핵산을 의미한다. 방사성 동위원소나 효소 등을 표지하여 RNA의 존재 유무를 확인할 수 있으며, 공지된 방법으로 디자인하고 변형시켜 사용할 수 있다.As used herein, the term “probe” refers to a nucleic acid capable of specifically binding to RNA having a length of several bases to several hundreds of bases produced through enzymatic chemical separation and purification or synthesis. The presence or absence of RNA can be checked by labeling radioactive isotopes or enzymes, and can be designed and modified by a known method.
본 발명의 또 다른 양태로서, 본 발명은 본 발명에 따른 조성물을 포함하는, 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측용 키트를 제공한다.As another aspect of the present invention, the present invention provides a kit for predicting increased risk for the onset of disease due to reduced immunity, comprising the composition according to the present invention.
본 발명의 또 다른 양태로서, 본 발명은 하기의 단계를 포함하는, 피검체의 면역력 감소에 의한 질병의 발병에 대한 증가된 위험 예측 방법 또는 위험을 예측하기 위한 정보제공방법을 제공한다:As another aspect of the present invention, the present invention provides a method for predicting an increased risk for the onset of a disease due to a decrease in immunity of a subject or an information providing method for predicting the risk, comprising the steps of:
(a) 피검체로부터 시료를 채취하는 단계;(a) taking a sample from the subject;
(b) 상기 시료로부터 miR-146a, miR-155 및 miR-454로 이루어진 군으로부터 선택된 하나 이상의 miRNA의 발현 수준을 측정하는 단계;(b) measuring the expression level of one or more miRNAs selected from the group consisting of miR-146a, miR-155 and miR-454 from the sample;
(c) 상기 miRNA의 발현 수준을 정상 대조군 시료의 해당 miRNA의 발현 수준과 비교하는 단계; 및(c) comparing the expression level of the miRNA with the expression level of the corresponding miRNA in a normal control sample; and
(d) 상기 miRNA 중 적어도 하나 이상의 발현 수준에 변화가 있는 경우 면역력 감소에 의한 질병의 발병 위험도가 증가된 것으로 예측하는 단계.(d) predicting that the risk of developing a disease due to reduced immunity is increased when there is a change in the expression level of at least one of the miRNAs.
본 발명에 있어서, 상기 피검체는 면역력 감소에 의한 질병의 발병 위험을 예측하고자 하는 동물, 바람직하게는 포유류, 예를 들어, 인간, 마우스, 쥐, 소, 양, 개, 고양이, 원숭이, 유인원 등이 포함될 수 있으나 이에 제한되는 것은 아니다.In the present invention, the subject is an animal, preferably a mammal, for example, a human, a mouse, a rat, a cow, a sheep, a dog, a cat, a monkey, apes, etc. whose risk of developing a disease due to reduced immunity is to be predicted. may include, but is not limited to.
본 발명에 있어서, 상기 시료는 피검체로부터 자연적으로 분리되거나 인위적으로 분리한 것일 수 있고, 그 예로 혈액, 혈청, 혈장, 타액(saliva), 생검(biopsy), 종양 조직, 액체 배양물, 분변, 소변 등일 수 있으며, 바람직하게는 혈장일 수 있으나, 이에 제한되는 것은 아니다. 상기 시료는 공지의 방법에 따라 피검체에서 적절하게 채취될 수 있으며, 검출 방법에 따라 필요한 전처리 과정을 거칠 수 있다. 또한, 시료를 피검체로부터 채취하는 시점은 질병의 발병 전 또는 발병 후일 수 있으나, 바람직하게는 발병 전 시료를 채취하는 것일 수 있다.In the present invention, the sample may be naturally or artificially separated from the subject, for example, blood, serum, plasma, saliva, biopsy, tumor tissue, liquid culture, feces, It may be urine, etc., preferably plasma, but is not limited thereto. The sample may be appropriately collected from the subject according to a known method, and may be subjected to a necessary pre-treatment according to the detection method. In addition, the time point at which the sample is collected from the subject may be before or after the onset of the disease, but preferably, the sample may be collected before the onset of the disease.
본 발명에 있어서, 상기 miRNA의 발현 수준은 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 노던 블롯팅 또는 유전자 칩을 이용하여 측정할 수 있으나, miRNA의 발현 수준을 측정할 수 있는 것이라면 상기 열거한 방법으로 제한되는 것은 아니다.In the present invention, the expression level of the miRNA can be measured using a reverse transcriptase polymerase reaction, a competitive reverse transcriptase polymerase reaction, a real-time reverse transcriptase polymerase reaction, an RNase protection assay, Northern blotting or a gene chip, but miRNA If the expression level of the can be measured, it is not limited to the methods listed above.
본 발명에 있어서, 상기 면역력 감소에 의한 질병은 암, 자가면역질환, 대사성 질환, 감염성 질환 등일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the disease caused by the decrease in immunity may be cancer, autoimmune disease, metabolic disease, infectious disease, etc., but is not limited thereto.
본 발명에 있어서, 상기 암은 폐암, 간암, 위암, 식도암, 대장암, 췌장암, 담낭암, 담도암, 유방암, 전립선암, 방광암, 갑상선암, 신장암, 자궁경부암, 난소암, 피부암, 혈액암, 림프종, 신경교종, 결장암, 골육종 등일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the cancer is lung cancer, liver cancer, stomach cancer, esophageal cancer, colorectal cancer, pancreatic cancer, gallbladder cancer, biliary tract cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, kidney cancer, cervical cancer, ovarian cancer, skin cancer, blood cancer, lymphoma , glioma, colon cancer, osteosarcoma, etc., but is not limited thereto.
또한, 본 발명에 있어서, 상기 대사성 질환은 당뇨병, 저혈당, 고콜레스테롤혈증, 혈색소증, 유전분증, 포르피린증 등일 수 있으나, 이에 제한되는 것은 아니다.Further, in the present invention, the metabolic disease may be diabetes, hypoglycemia, hypercholesterolemia, hemochromatosis, hereditary disease, porphyria, etc., but is not limited thereto.
또한, 본 발명에 있어서, 상기 감염성 질환은 바이러스 또는 병원균의 감염에 의해 발생하는 질환으로, 호흡기 및 혈액, 피부접촉 등을 통해 전염되어 감염될 수 있는 질환을 모두 포함하는 개념이다. 이러한 감염성 질환의 비제한적인 예로서는 B형 및 C형 간염, 인간 파필로마 바이러스(human papilloma virus: HPV) 감염, 사이토메갈로바이러스(cytomegalovirus) 감염, 바이러스성 호흡기 질환, 인플루엔자 등이 있으나, 이에 제한되는 것은 아니다.In addition, in the present invention, the infectious disease is a disease caused by infection of a virus or pathogen, and is a concept including all diseases that can be transmitted and infected through respiratory, blood, skin contact, etc. Non-limiting examples of such infectious diseases include hepatitis B and C, human papilloma virus (HPV) infection, cytomegalovirus infection, viral respiratory disease, influenza, etc., but are limited thereto no.
본 명세서 및 청구범위에 사용된 용어나 단어는 통상적이거나 사전적인 의미로 한정해서 해석되어서는 아니 되며, 발명자는 그 자신의 발명을 가장 최선의 방법으로 설명하기 위해 용어의 개념을 적절하게 정의할 수 있다는 원칙에 입각하여 본 발명의 기술적 사상에 부합하는 의미와 개념으로 해석되어야만 한다.The terms or words used in the present specification and claims should not be construed as being limited to their ordinary or dictionary meanings, and the inventor may properly define the concept of the term in order to best describe his invention. It should be interpreted as meaning and concept consistent with the technical idea of the present invention based on the principle that there is.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.
[실시예][Example]
실험예 1: 정상인과 암 환자 검체 분양 및 준비Experimental Example 1: Distribution and preparation of samples from normal people and cancer patients
본 연구는 한국인체자원은행 사업의 일원인 충북대학교병원 인체자원은행에서 제공한 인체 자원과 데이터를 이용하여 수행되었다. 먼저, 질병관리본부 인체자원은행에서 분양 받은 암환자 샘플(혈장; plasma)을 200ul씩 분주하여 -80℃에 보관하였다. 모든 샘플은 동일하게 1 번의 냉동(freezing)과 해동(thawing)을 거치는 것을 원칙으로 하여 분석에 사용하였다.This study was conducted using human resources and data provided by the Human Resources Bank of Chungbuk National University Hospital, a member of the Korean Human Resources Bank project. First, 200ul of cancer patient samples (plasma) received from the Human Resources Bank of Korea Centers for Disease Control and Prevention were dispensed and stored at -80℃. All samples were used for analysis on the principle that they were subjected to one freezing and thawing in the same way.
실험예 2: 유전자 발현 분석Experimental Example 2: Gene expression analysis
1.1. 엑소좀 내의 RNA 추출1.1. RNA extraction in exosomes
정상인과 암 환자 혈장에서 엑소좀 내의 RNA를 추출은 시약(㈜제놀루션, 대한민국)을 사용하여 제조사의 지침에 따라 수행하였다. 혈장에서 엑소좀 내 RNA의 추출은 혈장 내 엑소좀을 분해(lysis)시킨 후 엑소좀에서 흘러나온 단백질, DNA, RNA(mRNA, miRNA, rRNA 등)에서 RNA만을 분리하였다. 이 때, 단백질과 DNA가 오염되지 않도록 최적화하여 순도를 높이고 RNAs 추출 농도(RNA prep yield)를 극대화 할 수 있는 추출 과정(protocol)을 확립하였다.Extraction of RNA in exosomes from plasma of normal people and cancer patients was performed according to the manufacturer's instructions using a reagent (Genolusion Co., Ltd., Korea). Extraction of RNA in exosomes from plasma separated only RNA from proteins, DNA, and RNA (mRNA, miRNA, rRNA, etc.) flowing out of exosomes after lysis of exosomes in plasma. At this time, we established an extraction protocol that can optimize the protein and DNA so as not to contaminate it, increase the purity and maximize the RNAs extraction concentration (RNA prep yield).
1.2. 엑소좀으로부터 추출한 RNA 정량1.2. Quantification of RNA extracted from exosomes
혈장에서 추출한 엑소좀 내 RNA 농도를 정량하기 위해 나노드롭(nano-drop, 260nm 파장에서의 흡광도)을 사용하여 농도를 측정하였다. 260/280 ratio와 260/230 ratio를 통해 RNA 순도 및 오염도를 확인하여 정상 범위 내에 속하는 RNA를 실험에 사용하였다.To quantify the RNA concentration in the exosomes extracted from plasma, the concentration was measured using a nano-drop (absorbance at 260 nm wavelength). RNA purity and contamination level were checked through 260/280 ratio and 260/230 ratio, and RNA within the normal range was used for the experiment.
1.3. qRT-PCR (quantitative Reverse Transcription-Polymerase Chain Reaction)1.3. qRT-PCR (quantitative Reverse Transcription-Polymerase Chain Reaction)
혈장에서 추출한 exo RNA 10ng을 템플릿(template)으로 하여 two-step qRT-PCR을 진행하였다. PCR 장비는 StepOne plus(ABI, 미국)를 사용하였으며, 모든 샘플은 결과의 신뢰도를 높이기 위해 duplicate으로 진행하였다.Two-step qRT-PCR was performed using 10 ng of exo RNA extracted from plasma as a template. The PCR equipment was StepOne plus (ABI, USA), and all samples were performed in duplicate to increase the reliability of the results.
실험예 3: IFN-γ 농도의 측정Experimental Example 3: Measurement of IFN-γ concentration
검체의 혈장 내 IFN-γ 농도는 인간 IFN-γ면역측정(Immunoassay) 키트(R&D, 미국)를 이용하여 측정하였다. 먼저, 포획 항체(Capture antibody)가 코팅된 플레이트를 샘플 항원과 특이적 결합을 위해 다른 표면을 블로킹(blocking) 하였다. 이어서, 항원(antigen)이 존재하는 샘플을 처리한 후, 비오틴(Biotin)으로 표지된 검출 항체(Detection antibody)를 결합시켰다. 그 후 HRP(Horseradish peroxidase)가 컨주게이션 된 아비딘(Avidin) 또는 스트렙트아비딘(streptavidin)을 처리하고, 효소와 반응하는 기질(TMB)을 처리한 다음, ELISA 리더 기기를 이용해 O.D 값을 측정하였다.IFN-γ concentration in plasma of the specimen was measured using a human IFN-γ immunoassay kit (R&D, USA). First, a plate coated with a capture antibody was blocked on another surface for specific binding to a sample antigen. Then, after processing the sample in which the antigen (antigen) is present, a detection antibody labeled with biotin was bound. Thereafter, HRP (horseradish peroxidase)-conjugated avidin (Avidin) or streptavidin was treated, and a substrate (TMB) that reacts with the enzyme was treated, and the O.D value was measured using an ELISA reader device.
실험예 4: 혈액에서 말초 혈액 단핵세포(Peripheral Blood Mononuclear Cells; PBMC)의 분리 및 배양Experimental Example 4: Isolation and culture of peripheral blood mononuclear cells (PBMC) from blood
건강한 정상인으로부터 말초 혈액을 비중 1.077 g/mL의 히스토파크(Histopaque®, Sigma, 미국)에 중첩시킨 후 400 xg에서 30분간 원심분리하여 단핵구를 분리하였다. 분리한 단핵구에 면역세포 증식유도제로서 PMA(50 ng/ml, 4.5 시간)와 이오노마이신(Ionomycin, 1 ug/ml, 4.5 시간)을 처리하여 배양 후 miRNA 발현 분석에 사용하였다. After superimposing peripheral blood on Histopaque (Histopaque ® , Sigma, USA) with a specific gravity of 1.077 g/mL from healthy individuals, centrifugation was performed at 400 x g for 30 minutes to separate monocytes. The isolated monocytes were treated with PMA (50 ng/ml, 4.5 hours) and ionomycin (Ionomycin, 1 ug/ml, 4.5 hours) as immune cell proliferation inducers, and after culturing, they were used for miRNA expression analysis.
실시예 1: 후보 유전자의 선별Example 1: Selection of candidate genes
본 발명자들은 면역 활성도를 측정함으로써 면역력 저하에 의한 질병의 발병 위험을 예측하기 위한 후보 유전자 마커를 선별하기 위해, 면역 활성과 관련된 miR에 초점을 맞추어 스크리닝을 진행하였다. 먼저 질병의 발생에 관여하는 대표적인 면역세포인 T 세포, NK 세포, 대식세포의 활성에 관여하는 사이토카인(Cytokine), IFN-γ, TNF-α, IL-2, IL-6, IL-8 등의 발현 조절에 관여하는 miRNA를 스크리닝하여 후보 miRNA를 1차로 선정하였다. 사이토카인의 mRNA 발현 조절에 관여하는 miRNA는 표적 예측 데이터베이스인 microRNA.org, TargetScan을 이용하여 mRNA UTR(Untranslated region) 지역의 결합 부위를 확인하였다.The present inventors conducted screening focusing on miRs related to immune activity in order to select candidate gene markers for predicting the risk of disease due to reduced immunity by measuring immune activity. First, cytokines, IFN-γ, TNF-α, IL-2, IL-6, IL-8, etc., which are involved in the activity of T cells, NK cells, macrophages, which are representative immune cells involved in the development of disease miRNAs involved in regulating the expression of miRNAs were screened, and candidate miRNAs were first selected. For miRNAs involved in the regulation of mRNA expression of cytokines, binding sites in the mRNA UTR (Untranslated region) region were identified using target prediction databases, microRNA.org and TargetScan.
상기 과정으로부터 스크리닝된 miRNA 가운데 암 세포의 생성 및 진행에 관여하는 기능이 알려져 있는 조건의 miRNA를 2차 후보로서 6개의 유전자를 선정하였다. 상기 유전자의 선정에는 암 유발에 관여하는 onco-miR 유전자와 암 억제에 관여하는 tumor suppressor miR 유전자를 함께 고려하였다. 그 결과 miR-146a, miR-155, miR-186, miR-454, miR-301a/b 및 miR-181a가 후보 유전자로 선정되었다.Among the miRNAs screened from the above process, 6 genes were selected as secondary candidates for miRNAs with known functions involved in the generation and progression of cancer cells. In the selection of the gene, the onco-miR gene involved in cancer induction and the tumor suppressor miR gene involved in cancer suppression were considered together. As a result, miR-146a, miR-155, miR-186, miR-454, miR-301a/b and miR-181a were selected as candidate genes.
상기 2차 후보로 선정된 6개의 유전자를 건강인과 6대 암 환자의 검체를 대상으로 하여 독립적으로 3회 반복 분석한 결과, 정상인과 암환자에서 통계적으로 의미 있는 차이를 보이는 3개의 유전자 - miR-146a, miR-155 및 miR-454 - 가 최종 선정되었다. 이 때, 검체는 10명의 암 환자의 검체를 섞어서 만든 풀링(pooling) 검체를 사용하였다.As a result of independently repeated analysis of the six genes selected as secondary candidates three times on samples from healthy individuals and patients with six major cancers, three genes showing statistically significant differences between normal individuals and cancer patients - miR -146a, miR-155 and miR-454 - were finally selected. In this case, a pooling sample prepared by mixing samples from 10 cancer patients was used as the sample.
실시예 2: 정상인과 6대 암 환자 검체를 대상으로 한 다중 유전자 마커 발현 분석Example 2: Analysis of Multiple Gene Marker Expressions in Normal Persons and Six Cancer Patient Samples
면역 활성도 측정을 위해 최종 선정된 다중 유전자 마커 miR-146a, miR-155 및 miR-454에 대하여, 정상인과 6대 암 - 유방암(BC), 대장암(CC), 간암(HCC), 전립선암(PC), 폐암(LC) 및 위암(SC) - 환자 검체를 대상으로 상기 유전자의 발현 정도를 분석하였다. 이 때, 암의 발생 및 초기 단계의 변화를 중심으로 다중 유전자 마커의 임상적 유효성을 검증하고자 암 환자 검체는 1기 및 2기에 해당하는 검체를 사용하였다.For the multi-gene markers miR-146a, miR-155 and miR-454 finally selected for the measurement of immune activity, normal persons and six major cancers - breast cancer (BC), colorectal cancer (CC), liver cancer (HCC), prostate cancer ( PC), lung cancer (LC) and gastric cancer (SC)—the expression level of the gene was analyzed in patient samples. At this time, in order to verify the clinical effectiveness of multiple genetic markers focusing on changes in the occurrence and early stages of cancer, samples corresponding to stage 1 and 2 were used for cancer patient samples.
그 결과, 6 가지의 모든 암에서 3개 유전자 가운데 1개 이상의 유전자가 통계적으로 유의한 수준의 발현 변화(증가 또는 감소) 패턴을 나타내고 있음을 확인하였다(도 1). 이러한 결과는 여러 종류의 암이 발생하는 데 있어서 면역세포의 활성을 조절하는 microRNA의 발현 변화가 필수적으로 수반됨을 시사하는 것이다. 즉, 본 발명에 따른 miR-146a, miR-155 및 miR-454는 암 발생 및 초기 단계의 변화를 매우 잘 반영하는 다중 유전자 마커라고 판단된다.As a result, it was confirmed that at least one gene among the three genes in all six cancers exhibited a statistically significant level of expression change (increase or decrease) pattern ( FIG. 1 ). These results suggest that changes in the expression of microRNAs that regulate the activity of immune cells are essential for the occurrence of various types of cancer. That is, it is determined that miR-146a, miR-155 and miR-454 according to the present invention are multiple genetic markers that very well reflect changes in cancer development and early stages.
실시예 3: 다중 유전자 마커의 발현과 IFN-γ 발현의 비교 분석Example 3: Comparative analysis of expression of multiple genetic markers and IFN-γ expression
본 발명자들은 기존의 면역활성도 측정 방법으로서 다양한 면역세포 중 NK 세포의 활성만을 측정하는 방법인 IFN-γ 생산량 분석과 비교하여, 본 발명에 따른 다중 유전자 마커, miR-146a, miR-155 및 miR-454의 임상적 가치가 더 우수함을 증명하기 위해 동일한 암 환자의 검체를 대상으로 비교 분석 실험을 진행하였다.The present inventors compared with the IFN-γ production analysis, which is a method for measuring only NK cell activity among various immune cells as a conventional method for measuring immune activity, the multiple genetic markers, miR-146a, miR-155 and miR- according to the present invention. In order to prove that the clinical value of 454 is superior, a comparative analysis experiment was conducted on samples from the same cancer patient.
그 결과, IFN-γ 생산량의 변화는 6 가지의 암 종 가운데 단 2 가지의 암 종에서만 통계적으로 유의한 수준의 차이가 나타나는 반면(도 2b), 본 발명에 따른 다중 유전자 마커는 6 가지의 모든 암 종에서 1개 이상의 유전자가 통계적으로 유의한 수준의 변화가 나타나다는 것을 확인하였다(도 2a). 상기와 같은 결과는 IFN-γ 생산량의 변화 보다 본 발명에 따른 다중 유전자 마커의 발현 변화가 더 넓은 범위의 질병이 발생될 수 있는 고위험군 선별 마커로써 더 큰 임상적 의의가 있음을 증명하는 것이다.As a result, the change in IFN-γ production showed a statistically significant level difference in only two of the six carcinomas ( FIG. 2B ), whereas the multi-gene marker according to the present invention was used in all six types of cancers ( FIG. 2B ). It was confirmed that one or more genes showed a statistically significant level of change in carcinoma ( FIG. 2A ). The above results prove that the change in the expression of the multiple genetic markers according to the present invention has greater clinical significance as a high-risk selection marker that can cause a wider range of diseases than the change in IFN-γ production.
실시예 4: 면역세포의 억제 및 활성에 따른 다중 유전자 마커의 발현 변화 분석Example 4: Analysis of changes in expression of multiple genetic markers according to the inhibition and activity of immune cells
질병이 없는 상태의 건강한 면역세포에서 본 발명에 따른 다중 유전자 마커, miR-146a, miR-155 및 miR-454의 발현 변화가 면역세포의 억제 및 활성과 연관되어 있는지 확인함으로써 본 발명이 질병의 발생 위험 예측에 유효함을 증명하고자 하였다.By confirming whether the expression changes of the multiple genetic markers, miR-146a, miR-155 and miR-454 according to the present invention in healthy immune cells in a disease-free state, are associated with the suppression and activity of immune cells, the present invention is the development of disease It was intended to prove that it is valid for risk prediction.
이에 따라, 면역세포에서 면역세포의 억제 및 활성에 의해 본 발명에 따른 다중 유전자 마커의 발현 변화를 확인하기 위해 정상인의 혈액에서 분리한 말초 혈액 단핵세포를 대상으로 면역세포 증식 유도제(PMA+Ionomycin)를 처리하여 그 발현 변화를 분석하였다. 말초 혈액 단핵세포(peripheral blood mononuclear cell, PBMC)는 둥근 핵을 가진 말초 혈액 세포로서 림프구와 단핵구로 구성되는데 구체적으로 80~85 %가 T 세포, 10 %가 단핵구, 5 %가 B 세포로 구성된다. 따라서 다양한 면역세포에서의 miRNA 발현 변화를 관찰하는데 매우 적합하다고 판단되었다.Accordingly, in order to check the expression change of multiple genetic markers according to the present invention by the suppression and activation of immune cells in immune cells, an immune cell proliferation inducer (PMA+Ionomycin) for peripheral blood mononuclear cells isolated from normal human blood. was treated to analyze the expression change. Peripheral blood mononuclear cells (PBMCs) are peripheral blood cells with a round nucleus and are composed of lymphocytes and monocytes. Specifically, 80-85% of T cells, 10% of monocytes, and 5% of B cells are composed. . Therefore, it was judged to be very suitable for observing miRNA expression changes in various immune cells.
그 결과, 도 3에 나타난 바와 같이 T 세포의 IFN-γ의 생산 조절에 관여하는 miR-155의 발현이 면역세포 증식 유도제에 의해 통계적으로 의미 있는 증가가 관찰되었다. 이러한 결과는 miR-155가 T 세포의 활성화와 직접적으로 관련이 있다는 점을 증명하는 것이다.As a result, as shown in FIG. 3 , a statistically significant increase in the expression of miR-155, which is involved in the regulation of IFN-γ production in T cells, was observed by the immune cell proliferation inducer. These results prove that miR-155 is directly related to the activation of T cells.
또한, 대식세포의 염증반응과 상관관계가 있는 miR-146a와 miR-454의 경우 말초 혈액 단핵구에서 증식유도제 처리에 의해 감소하는 변화를 관찰하였는데, 이러한 결과 또한 miR-146a 및 miR-454가 면역 반응의 음성적 조절자로서 직접 관여하고 있음을 증명하는 것이다.In addition, in the case of miR-146a and miR-454, which are correlated with the inflammatory response of macrophages, a decrease was observed in peripheral blood mononuclear cells by treatment with a proliferative agent. These results also show that miR-146a and miR-454 are immune responses It is to prove that it is directly involved as a voice regulator of
상기와 같은 결과를 종합하면, 본 발명에 따른 다중 유전자 마커 miR-146a, miR-155 및 miR-454는 면역 조절과 직접적인 관련이 있는 조절자로 볼 수 있으며, 따라서 상기 다중 유전자 마커의 발현 변화를 측정함으로써 향후 질병이 발생될 증가된 위험을 예측할 수 있는 것이다.Summarizing the above results, the multiple genetic markers miR-146a, miR-155 and miR-454 according to the present invention can be viewed as regulators directly related to immune regulation, and thus the expression change of the multiple genetic markers is measured. By doing so, it is possible to predict an increased risk of developing a disease in the future.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.
<110> SEOUL NATIONAL UNIVERSITY HOSPITAL L'epigene MD Co.,Ltd <120> Multi-Genetic Marker for Predicting Risk of Disease by Reduced Immunity and Methods of Predicting Risk of Disease Using the Same <130> MP19-277B <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 ugagaacuga auuccauggg uu 22 <210> 2 <211> 24 <212> RNA <213> Homo sapiens <400> 2 uuaaugcuaa ucgugauagg gguu 24 <210> 3 <211> 23 <212> RNA <213> Homo sapiens <400> 3 uagugcaaua uugcuuauag ggu 23 <110> SEOUL NATIONAL UNIVERSITY HOSPITAL L'epigene MD Co.,Ltd <120> Multi-Genetic Marker for Predicting Risk of Disease by Reduced Immunity and Methods of Predicting Risk of Disease Using the Same <130> MP19-277B <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 ugagaacuga auuccauggg uu 22 <210> 2 <211> 24 <212> RNA <213> Homo sapiens <400> 2 uuaaugcuaa ucgugauagg gguu 24 <210> 3 <211> 23 <212> RNA <213> Homo sapiens <400> 3 uagugcaaua uugcuuauag ggu 23
Claims (13)
A multigene marker composition for predicting an increased risk of developing a disease due to reduced immunity, comprising one or more miRNAs selected from the group consisting of miR-146a, miR-155 and miR-454.
상기 면역력 감소에 의한 질병은 암, 자가면역질환, 대사성 질환 및 감염성 질환으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 조성물.
According to claim 1,
The disease caused by the decrease in immunity is characterized in that selected from the group consisting of cancer, autoimmune disease, metabolic disease and infectious disease, the composition.
상기 암은 폐암, 간암, 위암, 식도암, 대장암, 췌장암, 담낭암, 담도암, 유방암, 전립선암, 방광암, 갑상선암, 신장암, 자궁경부암, 난소암, 피부암, 혈액암, 림프종, 신경교종, 결장암 및 골육종으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 조성물.
3. The method of claim 2,
The cancer is lung cancer, liver cancer, stomach cancer, esophageal cancer, colorectal cancer, pancreatic cancer, gallbladder cancer, biliary tract cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, kidney cancer, cervical cancer, ovarian cancer, skin cancer, blood cancer, lymphoma, glioma, colon cancer and osteosarcoma.
miR-146a, miR-155 and miR-454, comprising an agent for measuring the expression level of one or more miRNAs selected from the group consisting of, a composition for predicting an increased risk of developing a disease due to reduced immunity.
상기 제제는 하나 이상의 상기 miRNA에 특이적으로 결합하는 프라이머 또는 프로브인 것을 특징으로 하는, 조성물.
5. The method of claim 4,
The composition, characterized in that the agent is a primer or probe that specifically binds to one or more of the miRNAs.
상기 면역력 감소에 의한 질병은 암, 자가면역질환, 대사성 질환 및 감염성 질환으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 조성물.
5. The method of claim 4,
The disease caused by the decrease in immunity is characterized in that selected from the group consisting of cancer, autoimmune disease, metabolic disease and infectious disease, the composition.
상기 암은 폐암, 간암, 위암, 식도암, 대장암, 췌장암, 담낭암, 담도암, 유방암, 전립선암, 방광암, 갑상선암, 신장암, 자궁경부암, 난소암, 피부암, 혈액암, 림프종, 신경교종, 결장암 및 골육종으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 조성물.
7. The method of claim 6,
The cancer is lung cancer, liver cancer, stomach cancer, esophageal cancer, colorectal cancer, pancreatic cancer, gallbladder cancer, biliary tract cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, kidney cancer, cervical cancer, ovarian cancer, skin cancer, blood cancer, lymphoma, glioma, colon cancer and osteosarcoma.
Claims 4 to 7, comprising the composition according to any one of claims, the increased risk for the onset of disease due to reduced immunity kit for predicting.
(a) 피검체로부터 시료를 채취하는 단계;
(b) 상기 시료로부터 miR-146a, miR-155 및 miR-454로 이루어진 군으로부터 선택된 하나 이상의 miRNA의 발현 수준을 측정하는 단계;
(c) 상기 miRNA의 발현 수준을 정상 대조군 시료의 해당 miRNA의 발현 수준과 비교하는 단계; 및
(d) 상기 miRNA 중 적어도 하나 이상의 발현 수준에 변화가 있는 경우 면역력 감소에 의한 질병의 발병 위험도가 증가된 것으로 예측하는 단계.
An information providing method for predicting an increased risk of developing a disease due to a decrease in immunity of a subject, comprising the steps of:
(a) taking a sample from the subject;
(b) measuring the expression level of one or more miRNAs selected from the group consisting of miR-146a, miR-155 and miR-454 from the sample;
(c) comparing the expression level of the miRNA with the expression level of the corresponding miRNA in a normal control sample; and
(d) predicting that the risk of developing a disease due to reduced immunity is increased when there is a change in the expression level of at least one of the miRNAs.
상기 시료는 피검체로부터 유래한 혈액, 혈청, 혈장, 타액(saliva), 생검(biopsy), 종양 조직, 액체 배양물, 분변 및 소변으로 이루어진 군에서 선택된 어느 하나인 것을 특징으로 하는, 정보제공방법.
10. The method of claim 9,
The sample is characterized in that any one selected from the group consisting of blood, serum, plasma, saliva, biopsy, tumor tissue, liquid culture, feces and urine derived from a subject, information providing method .
상기 miRNA의 발현 수준은 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 노던 블롯팅 또는 유전자 칩을 이용하여 측정하는 것을 특징으로 하는, 정보제공방법.
10. The method of claim 9,
The expression level of the miRNA is characterized by measuring using a reverse transcriptase polymerase reaction, a competitive reverse transcriptase polymerase reaction, a real-time reverse transcriptase polymerase reaction, an RNase protection assay, Northern blotting or a gene chip, information providing method.
상기 면역력 감소에 의한 질병은 암, 자가면역질환, 대사성 질환 및 감염성 질환으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 정보제공방법.
10. The method of claim 9,
The disease caused by the decrease in immunity is characterized in that selected from the group consisting of cancer, autoimmune disease, metabolic disease and infectious disease, information providing method.
상기 암은 폐암, 간암, 위암, 식도암, 대장암, 췌장암, 담낭암, 담도암, 유방암, 전립선암, 방광암, 갑상선암, 신장암, 자궁경부암, 난소암, 피부암, 혈액암, 림프종, 신경교종, 결장암 및 골육종으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 정보제공방법.13. The method of claim 12,
The cancer is lung cancer, liver cancer, stomach cancer, esophageal cancer, colorectal cancer, pancreatic cancer, gallbladder cancer, biliary tract cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, kidney cancer, cervical cancer, ovarian cancer, skin cancer, blood cancer, lymphoma, glioma, colon cancer And osteosarcoma, characterized in that selected from the group consisting of, information providing method.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020200093453A KR102288359B1 (en) | 2019-12-06 | 2020-07-28 | Multi-Genetic Marker for Predicting Risk of Disease by Reduced Immunity and Methods of Predicting Risk of Disease Using the Same |
PCT/KR2020/017641 WO2021112619A1 (en) | 2019-12-06 | 2020-12-04 | Multiple genetic markers for predicting risk of developing diseases caused by decreased immunity and method for predicting risk of developing diseases by using same |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020190161350 | 2019-12-06 | ||
KR1020200093453A KR102288359B1 (en) | 2019-12-06 | 2020-07-28 | Multi-Genetic Marker for Predicting Risk of Disease by Reduced Immunity and Methods of Predicting Risk of Disease Using the Same |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020190161350 Division | 2019-12-06 | 2019-12-06 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20210071809A true KR20210071809A (en) | 2021-06-16 |
KR102288359B1 KR102288359B1 (en) | 2021-08-10 |
Family
ID=76222748
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020200093453A KR102288359B1 (en) | 2019-12-06 | 2020-07-28 | Multi-Genetic Marker for Predicting Risk of Disease by Reduced Immunity and Methods of Predicting Risk of Disease Using the Same |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR102288359B1 (en) |
WO (1) | WO2021112619A1 (en) |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2336353A1 (en) * | 2009-12-17 | 2011-06-22 | febit holding GmbH | miRNA fingerprints in the diagnosis of diseases |
US20110151430A1 (en) * | 2007-09-06 | 2011-06-23 | University Of Massachusetts | VIRUS-SPECIFIC miRNA SIGNATURES FOR DIAGNOSIS AND THERAPEUTIC TREATMENT OF VIRAL INFECTION |
EP2341145A1 (en) * | 2009-12-30 | 2011-07-06 | febit holding GmbH | miRNA fingerprint in the diagnosis of diseases |
EP2354246A1 (en) * | 2010-02-05 | 2011-08-10 | febit holding GmbH | miRNA in the diagnosis of ovarian cancer |
US20130142728A1 (en) * | 2011-10-27 | 2013-06-06 | Asuragen, Inc. | Mirnas as diagnostic biomarkers to distinguish benign from malignant thyroid tumors |
KR20170035932A (en) * | 2014-08-07 | 2017-03-31 | 에이전시 포 사이언스, 테크놀로지 앤드 리서치 | Microrna biomarker for the diagnosis of gastric cancer |
-
2020
- 2020-07-28 KR KR1020200093453A patent/KR102288359B1/en active IP Right Grant
- 2020-12-04 WO PCT/KR2020/017641 patent/WO2021112619A1/en active Application Filing
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110151430A1 (en) * | 2007-09-06 | 2011-06-23 | University Of Massachusetts | VIRUS-SPECIFIC miRNA SIGNATURES FOR DIAGNOSIS AND THERAPEUTIC TREATMENT OF VIRAL INFECTION |
EP2336353A1 (en) * | 2009-12-17 | 2011-06-22 | febit holding GmbH | miRNA fingerprints in the diagnosis of diseases |
EP2341145A1 (en) * | 2009-12-30 | 2011-07-06 | febit holding GmbH | miRNA fingerprint in the diagnosis of diseases |
EP2354246A1 (en) * | 2010-02-05 | 2011-08-10 | febit holding GmbH | miRNA in the diagnosis of ovarian cancer |
US20130142728A1 (en) * | 2011-10-27 | 2013-06-06 | Asuragen, Inc. | Mirnas as diagnostic biomarkers to distinguish benign from malignant thyroid tumors |
KR20170035932A (en) * | 2014-08-07 | 2017-03-31 | 에이전시 포 사이언스, 테크놀로지 앤드 리서치 | Microrna biomarker for the diagnosis of gastric cancer |
Non-Patent Citations (19)
Title |
---|
Advances in Experimental Medicine and Biology (2015) 889:71-87 * |
Artificial Cells, Nanomedicine, and Biotechnology (2019.07.09.) 47(1):2800-2809 * |
Biochimica et Biophysica Acta (2009) 1792:497-505 * |
Biomedicine & Pharmacotherapy (2018) 97:120-127 * |
Brazilian Archives of Biology and Technology (2018) 61:e18160730 * |
Cancer Cell International (2017) 17:118 * |
Cancer Letters (2015) 369:67-75 * |
Cancers (2019.08.14.) 11:1170 * |
Gonzalez H, Hagerling C, Werb Z. Roles of the immune system in cancer: from tumor initiation to metastatic progression. Genes Dev. 2018;32(19-20):1267-1284. doi:10.1101/gad.314617.118 |
International Journal of Medical Sciences (2014) 11(8):810-818 * |
Molecular Cancers (2015) 14:5 * |
Molecular Medicine Reports (2015) 11:533-538 * |
Molecular Medicine Reports (2018) 17:3979-3986 * |
Oncology Letters (2018) 16:2709-2714 * |
Oncology Reports (2018) 39:1494-0504 * |
Oncotarget (2015) 6(36):39225-39234 * |
Oncotarget (2017) 8(14):22674-22684 * |
PLoS ONE (2013) 8(2):e55532 * |
PLoS ONE (2013) 8(3):e60317 * |
Also Published As
Publication number | Publication date |
---|---|
WO2021112619A1 (en) | 2021-06-10 |
KR102288359B1 (en) | 2021-08-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2012261820B2 (en) | Molecular diagnostic test for cancer | |
US20160002732A1 (en) | Molecular diagnostic test for cancer | |
CN108138236A (en) | For the gene label of immunization therapy in cancer | |
EP2909340B1 (en) | Diagnostic method for predicting response to tnf alpha inhibitor | |
AU2012261820A1 (en) | Molecular diagnostic test for cancer | |
US10604809B2 (en) | Methods and kits for the diagnosis and treatment of pancreatic cancer | |
CN115612734A (en) | Molecular marker group of human esophageal squamous cell carcinoma and application thereof | |
Zhang et al. | Comprehensive analysis of prognostic value of MEX3A and its relationship with immune infiltrates in ovarian cancer | |
AU2019276749A1 (en) | L1TD1 as predictive biomarker of colon cancer | |
JP6357420B2 (en) | In vitro diagnosis or prognosis prediction method for colorectal cancer | |
KR102288359B1 (en) | Multi-Genetic Marker for Predicting Risk of Disease by Reduced Immunity and Methods of Predicting Risk of Disease Using the Same | |
WO2017026691A1 (en) | Composition for diagnosing obesity and uses therefor | |
Yuan et al. | Transcriptomic analysis of mycobacterium leprae-stimulated response in peripheral blood mononuclear cells reveal potential biomarkers for early diagnosis of leprosy | |
CN116144758A (en) | Application of two kinds of circular RNAs | |
WO2018143574A1 (en) | Composition for diagnosing obesity and use thereof | |
KR101594735B1 (en) | Composition for early diagnosis of obesity and uses thereof | |
KR20220061425A (en) | Biomarker predictive of responsiveness to an anticancer agent and use thereof | |
KR102065594B1 (en) | Biomarker for predicting resistance to anticancer agent | |
Abdallah et al. | Assessment of microRNA (96) and microRNA (298) as biomarkers for diagnosis and prognosis of rheumatoid arthritis in Egyptian patients | |
US20130225437A1 (en) | Biomarkers of cancer | |
WO2022231102A1 (en) | Biomarker for predicting responsiveness to anticancer agent and use thereof | |
Letova et al. | Accelerated and efficient method for isolating microRNA from human blood plasma | |
US20150018222A1 (en) | Method for in vitro diagnosis or prognosis of breast cancer | |
WO2019109962A1 (en) | Senile dementia treatment formulation and application thereof | |
EP4232819A1 (en) | Methods of assessing the therapeutic activity of agents for the treatment of immune disorders |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |