KR20210066634A - A composition, kit and method for diagnosing PARP1 inhibitor resistant cancer - Google Patents

Abstract

According to a composition, kit and method for diagnosing PARP1 inhibitor resistance, it is possible to efficiently diagnose PARP1 inhibitor-resistant cancer, maximize the therapeutic effect using the PARP1 inhibitor, and efficiently select candidate substances capable of treating PARP1 inhibitor-resistant cancer.

Description

Composition, kit and method for diagnosing PARP1 inhibitor resistant cancer {A composition, kit and method for diagnosing PARP1 inhibitor resistant cancer}

Compositions, kits and methods for the diagnosis of PARP1 inhibitor-resistant cancer.

The PARP enzyme plays a role in reducing the anticancer effect by helping the DNA recovery of tumor cells damaged by anticancer drugs. Since PARP activity is increased in cancer cells, it is also closely related to the survival mechanism of cancer cells. For this reason, PARP inhibitors inhibit DNA repair of cancer cells and enhance the effects of cancer treatment such as radiation. Although PARP-based therapeutics have already been launched as new drugs on the market, follow-up studies to expand indications are active. So far, AstraZeneca's olaparib (ingredient name olaparib), Tesaro's niraparib, and Clovis Oncology's rucaparib are being used as ovarian cancer treatments. -Additionally approved for an indication for negative metastatic breast cancer.

As such, PARP1 inhibitors have proven their anticancer effects in BRCA mutant ovarian cancer and breast cancer and are being used in actual clinical trials, but there is a problem in that acquired resistance occurs in most cases. In this regard, the results of studies confirming that loss of 53BP1 (p53-binding protein) function can experimentally induce PARP1 inhibitor resistance (Cell 2010; Nat Struct Mol Biol 2010; Cell Cycle 2012); Results of a study confirming that the expression of Rad51, a gene of the homologous recombination DNA repair pathway, was increased in PARP inhibitor-resistant cells (Mol Cancer Res 2009); In PARP inhibitor-resistant cells, phosphorylation of ribosomal protein S6, a subgene of mTOR pathway, is increased, and there is a study result (Oncotarget 2014) confirming that PARP inhibitor resistance is overcome by rapamycin, an mTOR inhibitor.

However, most of these study results are results from studies on the mechanism of acquired resistance to cisplatin, and are indirectly inferred that the acquired resistance of PARP1 inhibitors will be similar to this. That is, the mechanism of acquired resistance of PARP1 inhibitors that have reached agreement to be used for cancer treatment is not known.

One aspect is to measure the expression level of one or more genes selected from the group consisting of S100A7 (S100 calcium-binding protein), PROM1 (Prominin-1), MT1G (Metallothionein 1G), and CCL2 (Chemokine (CC motif) ligand 2) To provide a composition for diagnosis of PARP1 inhibitor resistance comprising a formulation for

Another aspect is to provide a kit for diagnosing PARP1 inhibitor resistance, comprising an agent for measuring the expression level of one or more genes selected from the group consisting of S100A7, PROM1, MT1G, and CCL2.

Another aspect is to provide an information providing method for diagnosing PARP1 inhibitor resistance, comprising measuring the expression level of one or more genes selected from the group consisting of S100A7, PROM1, MT1G, and CCL2 from a sample of an individual.

Another aspect is PARP1 inhibitor resistance comprising the step of measuring the expression level of one or more genes selected from the group consisting of S100A7, PROM1, MT1G, and CCL2 from a sample of an individual administered with a candidate substance for the treatment of PARP1 inhibitor-resistant cancer To provide a method for screening a cancer therapeutic agent.

One aspect is to measure the expression level of one or more genes selected from the group consisting of S100A7 (S100 calcium-binding protein), PROM1 (Prominin-1), MT1G (Metallothionein 1G), and CCL2 (Chemokine (CC motif) ligand 2) It provides a composition for diagnosis of PARP1 inhibitor resistance comprising a formulation for

As used herein, the term "S100A7 (S100 calcium-binding protein)" is a protein containing two EF-hand calcium-binding motifs, and belongs to the S100 family. S100 protein is widely present in cells such as the nucleus and/or cytoplasm of cells and is known to be involved in the regulation of many cellular processes such as cell cycle progression and differentiation. In particular, S100A7, unlike other S100 proteins whose structure is known, lacks calcium binding ability, and is known to mainly function as an excellent antibacterial peptide against E. coli. The S100A7 may be S100A7 derived from various animals capable of generating tumor tissue, in particular S100A7 derived from a human, and the sequence information can be found in NCBI GeneBank, a known database. For example, it can be translated into a protein expressed from mRNA containing NM_002963.4, a peptide or protein containing the amino acid sequence of NP_002954.2. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having biologically equivalent activity may be regarded as S100A7 mRNA or S100A7 protein.

As used herein, the term "PROM1 (Prominin-1)" is also known as the CD133 antigen, and in particular, is a pentaspan transmembrane glycoprotein located in the cell protrusion. The exact function of PROM1 is unknown, and it has been suggested that it may play a role in organizing the cell membrane topology. The PROM1 may be PROM1 derived from various animals capable of generating tumor tissues, particularly PROM1 derived from humans, and its sequence information can be found in NCBI GeneBank, a known database. For example, expression from an mRNA comprising NM_001145847.2, NM_001145848.2, NM_001145849.2, NM_001145850.2, NM_001145851.2, NM_001163577.1, NM_001163578.1, NM_001163581.1, NM_001163582.1, or NM_001163583.1 a peptide comprising the amino acid sequence of NP_001139319.1, NP_001139320.1, NP_001139321.1, NP_001139322.1, NP_001139323.1, NP_001157049.1, NP_001157050.1, NP_001157053.1, NP_001157054.1, or NP_001157055.1 Or it can be translated into a protein. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having a biologically equivalent activity may be regarded as an mRNA of PROM1 or a PROM1 protein.

As used herein, the term “MT1G (Metallothionein 1G)” is a type of metal-induced protein, and is a low-molecular-weight protein rich in cysteine among constituent amino acids. It is known to bind to a wide range of metals such as cadmium, lead, zinc, mercury, copper, arsenic, silver, and the like. It is also known to play a role in regulating oxidative stress, as the cysteine residue of metallothionene can trap harmful oxidative radicals. The MT1G may be MT1G derived from various animals capable of generating tumor tissues, particularly MT1G derived from humans, and its sequence information can be found in NCBI GeneBank, a known database. For example, it can be translated into a protein expressed from an mRNA comprising NM_005950.3, or NM_001301267.2, a peptide or protein comprising the amino acid sequence of NP_001288196.1 or NP_005941.1. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having a biologically equivalent activity may be regarded as an MT1G mRNA or MT1G protein.

As used herein, the term "CCL2 (Chemokine (CC motif) ligand 2)" is also called monocyte chemoattractant protein 1 (MCP1)) or small inducible cytokine A2 (small inducible cytokine A2), It is known to play a role in recruiting monocytes, memory T cells, and dendritic cells to sites of inflammation produced by tissue damage or infection. The CCL2 may be CCL2 derived from various animals capable of generating tumor tissues, in particular CCL2 derived from humans, and its sequence information can be found in NCBI GeneBank, a known database. For example, it can be translated into a protein expressed from mRNA containing NM_002982.4 or NM_011331.3, a peptide or protein containing the amino acid sequence of NP_002973.1 or NP_035461.2. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having a biologically equivalent activity may be regarded as an mRNA of CCL2 or a CCL2 protein.

As used herein, the term "PARP1 (Poly [ADP-ribose] polymerase 1)" is a molecule involved in DNA repair, balance of the cellular energy pool, which results in necrosis and cellular dysfunction, and expression of pro-inflammatory genes, oxidized It is known to be found in a variety of physiological conditions, such as inflammatory damage promoted by inflammatory stress and DNA damage. The sequence information of the PARP1 can be known from NCBI GeneBank, a known database. For example, it can be translated into a protein expressed from mRNA comprising NM_001618.4 or NM_007415.3, a peptide or protein comprising the amino acid sequence of NP_001609.2. Even if the mRNA or the protein and some nucleotide sequence or amino acid sequence do not match, a nucleotide sequence or amino acid sequence having biologically equivalent activity may be regarded as an mRNA of PARP1 or a PARP1 protein.

As used herein, the term "PARP1 inhibitor" refers to an agent that reduces the expression or activity of PARP1 in a cell, for example, acts directly on PARP1 or indirectly acts on an up-regulator of PARP1 to inhibit PARP1. It may refer to an agent that reduces the expression level or activity of PARP1 by decreasing the expression at the transcriptional level, increasing the degradation of the expressed PARP1, or interfering with the activity thereof, and reducing the expression or activity of PARP1 in the cell Any agent capable of enhancing the radiation sensitivity of cells may be included without limitation. In one embodiment, as a result of inhibiting PARP1 in keloid fibroblasts, it was confirmed that the growth and mobility of the cells, the expression of fibrosis markers were significantly inhibited, and the size and hardness of the keloid tissue were significantly reduced.

The PARP1 inhibitor is not particularly limited as long as it is a substance having PARP1 inhibitory activity, but biological molecules such as nucleic acids or polypeptides that can be processed into cells through standard techniques known in the art, compounds, extracts isolated from bacteria, plants, or animals can be

The PARP1 activity inhibitor may be an antibody that specifically binds to the PARP1 protein or fragment thereof, an antigen-binding fragment thereof, a peptide, a protein, or a combination thereof.

The PARP1 expression inhibitor may be an siRNA specific for PARP1, an RNA aptamer, a ribozyme, an antisense nucleic acid molecule that complementarily binds to a nucleotide sequence encoding PARP1, or a combination thereof.

The PARP1 inhibitor may be olaparib, Talazoparib, Niraparib, Rucaparib, Veliparib, Pamiparib, or a combination thereof. In one embodiment, S100A7, PROM1, MT1G, and CCL2 were found as genes related to PARP1 inhibitor resistance using a BRCA1 mutant ovarian cancer animal model to which olaparib was administered.

As used herein, the term "diagnosis" refers to confirming the presence or characteristics of a pathological condition, and may mean including determining whether PARP1 inhibitor resistance exists, whether or not PARP1 inhibitor-resistant cancer develops or is likely to develop. .

As used herein, the term "PARP1 inhibitor resistance" means that when a cancer patient is treated using a PARP1 inhibitor, there is no therapeutic effect from the initial stage of treatment, or there is an initial cancer treatment effect, but the cancer treatment effect is lost during the continuous treatment process. . The determination of the general therapeutic effect in anticancer drug treatment can be determined based on the response evaluation criteria in the solid tumor group (RECIST v1.1: New response evaluation criteria in solid tumours: Revised RECIST guideline (version 1.1)) (EUROPEAN JOURNAL OF CANCER 45) , (2009) 228-247). According to the above criteria, the effect of cancer treatment is a complete response (CR), partial response (PR), progressive disease (PD) or stable disease (SD) group from a change in the size of the tumor. can be classified. For example, if a target lesion (TL) is determined according to RECIST v1.1, the complete response group (CR) has all target lesions disappear, and pathological lymph nodes are reduced in all target and non-target lesions. It may mean a group with a short axis <10 mm. The partial response group (PR) may refer to a group in which the sum of the diameters of the target lesions is reduced by at least 30% based on the total diameter of the baseline. In the advanced group (PD), the sum of the diameters of the target lesions is increased by at least 20% based on the smallest sum according to the study, and the sum of these diameters is increased by 20% relatively, but also absolutely at least 5 mm may mean an increased group. The stable group (SD) may refer to a group that does not decrease sufficiently to be classified as a partial response group and does not increase sufficiently to be classified as an advanced group based on the smallest diameter according to the study.

The "measurement of the expression level" may be determined by checking the gene itself of S100A7, PROM1, MT1G, CCL2 or a combination thereof, or the level at which the gene is expressed, that is, the expression level of the protein encoded by the gene. For example, an antisense oligonucleotide that specifically binds to the gene, a primer pair, or a probe may be used to measure the expression level of the gene.

The "antisense oligonucleotide" refers to an antisense oligomer that hybridizes with a target sequence in RNA by Watson-Crick base pairing, thereby allowing the formation of a miRNA and RNA:oligomeric heteroduplex within the target sequence. Sequences and subunits of nucleotide bases It may refer to an oligomer having a liver backbone. An oligomer may have exact sequence complementarity or approximate complementarity to a target sequence.

The "primer" is a nucleic acid sequence having a free 3' hydroxyl group, capable of base pairing with a template complementary to a specific base sequence and serving as a starting point for template strand copying. nucleic acid sequence. The primer is capable of initiating DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. For example, PCR amplification is performed using sense and antisense primers having a sequence of 7 to 50 nucleotides as specific primers for S100A7, PROM1, MT1G, or CCL2. Through measurement of the amount of production of the desired product, the individual's PARP1 inhibitor resistance can be diagnosed. PCR conditions and lengths of sense and antisense primers may be appropriately selected according to techniques known in the art. The primers are 10 to 100, 15 to 100, 10 to 80, 10 to 50, 10 to 30, 10 to 20, 15 to 80, 15 to 50, 15 to 30, 15 to 20, 20 to 100, 20 to 80 , 20 to 50, or 20 to 30 nt.

The "probe" refers to a nucleic acid fragment such as RNA or DNA that can specifically bind to a target nucleic acid, for example, miRNA, and is labeled to check the presence, content, and expression level of a specific miRNA. may have been The probe may be manufactured in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, or the like. For example, by performing hybridization using a probe having a nucleic acid sequence complementary to S100A7, PROM1, MT1G, or CCL2, and measuring the expression level through the degree of hybridization, the individual's PARP1 inhibitor resistance can be diagnosed. Suitable probe selection and hybridization conditions can be appropriately selected according to techniques known in the art. The probe is 10 to 100, 15 to 100, 10 to 80, 10 to 50, 10 to 30, 10 to 20, 15 to 80, 15 to 50, 15 to 30, 15 to 20, 20 to 100, 20 to 80 , 20 to 50, or 20 to 30 nt.

In addition, antisense oligonucleotides, primers or probes can be chemically synthesized using phosphoramidite solid support synthesis or other well-known methods. In addition, such nucleic acid sequences can be modified through various methods known in the art. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, or modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates. etc.) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.). In addition, the primer or probe may be modified with a label capable of providing a detectable signal, either directly or indirectly. Examples of such labels may include radioactive isotopes, fluorescent molecules, or biotin.

According to one embodiment, an increase in the expression of S100A7, PROM1 or CCL2 and a decrease in the expression of MT1G in a tumor cell or tissue were found to be associated with PARP1 inhibitor resistance. Thus, the expression level of S100A7, PROM1, CCL2, or MT1G can be used to diagnose PARP1 inhibitor resistance.

Another aspect provides a kit for diagnosing PARP1 inhibitor resistance, comprising an agent for measuring the expression level of one or more genes selected from the group consisting of S100A7, PROM1, MT1G, and CCL2.

Among the terms or elements mentioned in the kit, those mentioned in the description of the composition are understood as being referred to in the description of the composition above.

The kit has the effect of diagnosing PARP1 inhibitor resistance by measuring the expression level of S100A7, PROM1, CCL2, or MT1G. The kit may further include antisense oligonucleotides, primer pairs, probes, etc. for the diagnosis of PARP1 inhibitor resistance, as well as one or more other component compositions, solutions, or devices suitable for the assay method, RT-PCR kit , a microarray chip kit, and a DNA chip kit.

The kit for measuring the expression level of S100A7, PROM1, CCL2, or MT1G may be a kit including elements necessary for performing RT-PCR. In addition to each primer pair specific for a marker gene, the RT-PCR kit includes a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC -Water (DEPC-water), sterile water, etc. may be included.

In addition, the kit for measuring the expression level of S100A7, PROM1, CCL2, or MT1G may be a kit including essential elements necessary for performing a microarray. The microarray kit includes a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and the substrate may include a cDNA corresponding to a quantitative control gene or a fragment thereof. It can be easily manufactured by the manufacturing method used as In order to fabricate a microarray, a micropipetting method using a piezoelectric method or a pin type to immobilize the detected marker on a substrate of a DNA chip using the probe DNA molecule A method using a spotter or the like can be used. The substrate of the microarray chip may be coated with an active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane.

In addition, the kit for measuring the expression level of S100A7, PROM1, CCL2, or MT1G may be a kit including essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA or oligonucleotide corresponding to a gene or fragment thereof is attached, and reagents, agents, enzymes, etc. for preparing a fluorescent probe. In addition, the substrate may include cDNA or oligonucleotide corresponding to a control gene or a fragment thereof.

Another aspect provides an information providing method for diagnosing PARP1 inhibitor resistance, comprising measuring the expression level of one or more genes selected from the group consisting of S100A7, PROM1, MT1G, and CCL2 from a sample of an individual.

Among the terms or elements mentioned in the information providing method for diagnosis, those mentioned in the description of the composition or kit are understood to be the same as those mentioned in the description of the composition or kit above.

As used herein, the term "subject" refers to an individual who wants to confirm or predict the presence of PARP1 inhibitor resistance. The subject may be a vertebrate, specifically mammals, amphibians, reptiles, birds, etc., and more specifically mammals, for example, humans (Homo sapiens).

As used herein, the term "sample" may include whole blood, serum, plasma, saliva, urine, sputum, lymph, cells, tissues, etc. isolated from an individual, for example, it may be a tumor cell or tumor tissue.

The "method for measuring the expression level" may be one or more selected from the group consisting of a reverse transcription polymerase reaction, a competitive reverse transcription polymerase reaction, a real-time reverse transcription polymerase reaction, an RNase protection assay, Northern blotting, and a DNA chip.

In the method, when the expression level of S100A7, PROM1, or CCL2 measured from the subject's sample is increased compared to the normal control, and the expression level of MT1G measured from the subject's sample is decreased compared to the normal control, PARP1 inhibitor It can be judged to be resistant. The change in the expression level of the subject is a similar level or 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% compared to the normal control or positive control. , 60%, 70%, 80%, 90%, and 100% or more increasing or decreasing.

Another aspect is PARP1 inhibitor resistance comprising the step of measuring the expression level of one or more genes selected from the group consisting of S100A7, PROM1, MT1G, and CCL2 from a sample of an individual administered with a candidate substance for the treatment of PARP1 inhibitor-resistant cancer A method for screening a cancer therapeutic agent is provided.

Among the terms or elements mentioned in the screening method, those mentioned in the description of the diagnostic composition, kit or method are understood to be the same as those mentioned in the description of the diagnostic composition, kit or method.

As used herein, the term "candidate substance" is a newly synthesized or known compound, and may include, without limitation, substances expected to have an effect in the treatment of PARP1 inhibitor-resistant cancer.

The "administration" of the candidate drug means introducing a predetermined substance into a subject by an appropriate method. The administration route of the candidate substance may be administered through any general route as long as it can reach the target tissue. It can be administered by intraperitoneal administration, intravenous administration, administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, rectal administration, and the like.

In the method, when the expression level of S100A7, PROM1, or CCL2 measured from the subject's sample is increased compared to the normal control, and the expression level of MT1G measured from the subject's sample is decreased compared to the normal control, the candidate substance can be determined as a therapeutic agent for PARP1 inhibitor-resistant cancer. The change in the expression level of the subject is a similar level or 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% compared to the normal control or positive control. , 60%, 70%, 80%, 90%, and 100% or more increasing or decreasing.

The composition, kit and method for diagnosing PARP1 inhibitor resistance according to an aspect can efficiently diagnose PARP1 inhibitor-resistant cancer, maximize the therapeutic effect using the PARP1 inhibitor, and efficiently select candidate substances capable of treating PARP1 inhibitor-resistant cancer. can

1 is a view showing an overall experimental method for selecting a gene that can be used for diagnosis of PARP1 inhibitor resistance.

Hereinafter, it will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1. Confirmation of association between PARP1 inhibitor resistance and S100A7, PROM1, MT1G, and CCL2 expression

To confirm the association between PARP1 inhibitor resistance and S100A7, PROM1, MT1G, and CCL2 expression, a patient-derived tumor xenograft (PDTX: Patient-Derived Tumor Xenograft) animal model of germline BRCA1 mutant ovarian cancer was used as an ovarian cancer anticancer drug and PARP1 inhibitor. After administration of olaparib gradually increased from the standard dose, olaparib-resistant animal models were constructed, and microarrays were performed by securing the resistant tumor tissue therefrom. The overall experimental process is shown in FIG. 1 .

Specifically, each of 6 NSG mice was subcutaneously transplanted with germline BRCA1 mutant ovarian cancer patient-derived tumor xenografts. Among them, 3 mice were used as a control group, and the remaining 3 mice were treated as an experimental group by administering olaparib, a PARP1 inhibitor. When the tumor size in the animal model reached about 100 mm ³ , oral administration of olaparib was started. The standard dose, 50 mg/kg, was administered once a day, 75 mg/kg was administered twice a day, and 100 mg/kg was administered twice a day in a gradually increasing manner for 3-4 months. Thereafter, the tumor size was measured three times a week. When the tumor size increased again from the maximum decrease and increased by 25% or more, it was judged as acquired resistance (Nat Genet. 2012 Jul 1:44(8):852-60). Tissues with acquired resistance to PARP1 inhibitors were obtained. mRNA microarrays were performed using the tissue. The probe sequences used are shown in Table 1 below.

gene name probe sequence SEQ ID NO: S100A7 GAGAAGACATTTTATTGTTCCTGGG One TCTCAAAGACATCGGCGAGGTAATT 2 AAGACATCGGCGAGGTAATTTGTGC 3 ATCGGCGAGGTAATTTGTGCCCTTT 4 ACATCGGCGAGGTAATTTGTGCCCT 5 GGAGAAGACATTTTATTGTTCCTGG 6 CATCGGCGAGGTAATTTGTGCCCTT 7 GACATCGGCGAGGTAATTTGTGCCC 8 AGACATCGGCGAGGTAATTTTGGCC 9 AAAGACATCGGCGAGGTAATTTGTG 10 CTTTCAGCCAGTAGTCAGTCTGGGC 11 TCTGGTGGGAGAAGACATTTTATTG 12 PROM1 GAACTCGATCCACTGCAGATAATGT 13 TGTGAACGCCTTGTCCTTGGTAGTG 14 AAATCCAGAGAAGCTAGAATCCTAG 15 GAAGTCTTGGTCCTGCACATCAATG 16 ATGATAAAAGATTCACTCCTGCGGG 17 GAGTTTCATTCAAGAGAGTTCGCAA 18 CAGCAGTATCTAGAGCGGTGGCCAC 19 CGGAATAATTCCTTGCTCGTGTAAG 20 CGTGGTTTGGCGTTGTACTCTGTCA 21 TCACCAACAGGGAGATTGCAAAGCA 22 TCTATAGGAAGGACTCGTTGCTGGT 23 GGGTCTCAGTCGGTCAAGAATTCCG 24 CATTCGACGATAGTACTTAGCCAGT 25 CCCGAGAGCGAGTCCGAAGTCTCTG 26 CAGTACAGTGGAAGGAGTGCGCTCA 27 GACCCTGGCTCGTGAATTATTTATG 28 TTAGACCTAAGATTACAGTTTCTGG 29 TGCTGCACCCAACAGAAAGATATTA 30 CAGGTGAAGAGTGCCGTAAGTGCCT 31 GCTTCCCAGAGAGATAGTATTCCCA 32 AAGGCAAGCGTGTTCCTGGGCAGAA 33 TAACACTGGGCATGGCACGTAGTCG 34 GTTGTCAAGTTCTGCATCCACGGGT 35 CATTGAGAGATGACCGCAGGCTAGT 36 CTGAACAGAGAGTGACCCAACTACTA 37 CGCGAGCTGCGGGACACAAAAGAAT 38 TGTGTGCTGAGATAACCTCCCAGGC 39 TGAGCAGGCTTCTCCTATCTGGGCC 40 GAAATCACGCGGCTGTACCACATAG 41 GACGCACTCTGATTGGACCGGCTGA 42 CCTTGAATAGTGATGGACCATGGAC 43 CATCTTGCTCCAAAATGTAGGTCCC 44 GGATACCCAACATCTGAGACCACGT 45 TGTGTAGCAGTGAGAGCCTTCCAGA 46 TGTCATAACAGGATTGTGAATAACCA 47 CTGGCACGCAGCTGGAAGGCTATCT 48 TCTAAGTGGCTCTCTGGGTGAACCA 49 TGGAAAGTCCTTGTAGACCCAGAAA 50 TAAACTGAGCCTTGAGTTAAGGTCC 51 GATCCTTGATCTGCCCGCTTAGTAG 52 TCCAGATCCACGAGAAAGGAGCCCA 53 CCAGATCCACGAGAAAGGAGCCCAC 54 CAGGCCTGGGTAATTCTTGTGGTCA 55 TTGTGACATGCTTGCTCTCCCTGCT 56 CATGTCTGCTGCTATCCACAACCTG 57 CAGATCCACGAGAAAGGAGCCCACA 58 TATTCCGGACGGTCGTGGTGCCATC 59 TGCTGCTATCCACAACCTGTGTCTG 60 TGCTATCCACAACCTGTGTCTGTGA 61 GTTCTGCTGCTATCCACAACCTGTGT 62 TCTGCTGCTATCCACAACCTGTGTC 63 GTCCAGATCCACGAGAAAGGAGCCC 64 GAGTATTCTTACAAGTGTCCCCAGG 65 GCTATCCACAACCTGTGTCTGTGAG 66 GGTCCAGATCCACGAGAAAGGAGCC 67 CATCTTCTGGAGCTGTGATTCTGCA 68 MT1G CAAGTAGGGAGACGTATGTAACAAA 69 CCTGTGAACTGGACTGAACGAGACA 70 GACATCACAGCTCTGGTGATCCCAG 71 GTGGCCATCACAACACCTAGACGGG 72 AAGTTCTCCCGCCAGGCGGCCTGGG 73 CCAGTTAAAACTGAACAGGTGCCTT 74 TGTAGGACTGCAAGACACTGGACCG 75 GCGGTGGCTTCTCCCAATCAGTTCA 76 AGCGGTGGCTTCTCCCAATCAGTTC 77 GGGACCCCAATGACCATGATACAGT 78 TAAGCAGGAGAACGACTCAAGATAC 79 CTTTCCTGAGGTGATCAGCCGCACG 80 TGAGAGCAGCTTTAACACACAGGCC 81 TGCCCAGGCCGTAGTGCTGCACGTA 82 AGGTAGTCAGCCATGGTCTCCTCCC 83 AGGCCTTCTCCTTCTAAGTGTTGCA 84 TGCTCCCAAGGAGAACACAAGGAAG 85 TCTTGACAGAGTGCTGGGCCTGGCC 86 TGCTCTGTAAGATCCGCCAAGTCCA 87 TTTCCTGAGGTGATCAGCCGCACGC 88 CACGGCGGAAAGTCTGCAGGAAGTC 89 AAATAAAAGCGTCAGGTCCCAACAG 90 CACACTTTCAATCCGAGGAGCCAGC 91 CTGAAACAGAGGGTTGCGGCCTGAA 92 CCGGGCATCGTGGACCTCGATGATA 93 GCTGCCGCAGGATAGTTAGGCTGAA 94 AGCACGCGCTCTACGTTGTCACAGG 95 CAGTACACCGCGGAGCCGACGCAGGA 96 TTTGGCGCAAAGACTATGACGACTG 97 CAAAGACACCGTGCCGTGAGGAAGA 98 CAAAGACACTAACCAAGAGGACGGC 99 CCL2 AATAAGTTAGCTGCAGATTCTTGGG 100 GGTGGTCCATGGAATCCTGAACCCA 101 GCAAAGACCCTCAAAACATCCCAGG 102 TCTGCACTGAGATCTTCCTATTGGT 103 TGATTCTTCTATAGCTCGCGAGCCT 104 GTGATTCTTCTATAGCTCGCGAGCC 105 GAGAGTGCGAGCTTCAGTTTGAGAA 106 CGAGAGTGCGAGCTTCAGTTTGAGA 107 GATCTCCTTGGCCACAATGGTCTTG 108 GGTGATTCTTCTATAGCTCGCGAGC 109 TGGTGATTCTTCTATAGCTCGCGAG 110

Table 2 shows the fold change in expression of each gene in the PARP1 inhibitor-resistant tissue compared to the control tissue by analyzing the microarray results. As shown in Table 2 below, compared to the control group, the gene expression in at least one of the two olaparib-resistant tissues (OR_2, OR_3) was selected for a 3.5-fold increase or decrease in gene expression.

gene OR2/C Fold Change OR3/C Fold Change S100A7 13 PROM1 5.1 6.6 MT1G -12.9 -2.7 CCL2 4.2 1.7

Genes exhibiting at least 3.5-fold change from microarray data were selected. All selected genes were analyzed by KEGG software. KEGG software is a collection of databases covering the genes underlying mechanisms, genetic information, immune system and disease. Only genes thought to have an important role in the mechanism of PARP1 inhibitor resistance within this database were selected. In addition, all genes were analyzed with DAVID software. The DAVID software is a database based on bioinformation related to mechanisms and diseases, and using it, genes that are thought to play a major role in the resistance mechanism were selected.

Through the above analysis, a total of 10 genes were selected, and their pathway analysis, expression analysis, location analysis, and function analysis were performed using a gene card to diagnose a novel, PARP1 inhibitor resistance not presented in the existing literature. A total of four possible genes were selected.

From the above results, it can be confirmed that the expression levels of S100A7, PROM1, MT1G, and CCL2 are significantly different in the PARP1 inhibitor-resistant tissue compared to the normal control tissue or the positive control tissue administered with the PARP1 inhibitor. That is, by measuring the expression levels of S100A7, PROM1, MT1G, and CCL2, it is possible to efficiently diagnose PARP1 inhibitor resistance, maximize the therapeutic effect using the PARP1 inhibitor, and efficiently select candidate substances capable of treating PARP1 inhibitor-resistant cancer. It was confirmed that selection was possible.

<110> SUNGKWANG MEDICAL FOUNDATION <120> {A composition, kit and method for diagnosing PARP1 inhibitor resistant cancer <130> PN130402 <160> 110 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 1 <400> 1 gagaagacat tttattgttc ctggg 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 2 <400> 2 tctcaaagac atcggcgagg taatt 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 3 <400> 3 aagacatcgg cgaggtaatt tgtgc 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 4 <400> 4 atcggcgagg taatttgtgc ccttt 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 5 <400> 5 acatcggcga ggtaatttgt gccct 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 6 <400> 6 ggagaagaca ttttattgtt cctgg 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 7 <400> 7 catcggcgag gtaatttgtg ccctt 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 8 <400> 8 gacatcggcg aggtaatttg tgccc 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 9 <400> 9 agacatcggc gaggtaattt gtgcc 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 10 <400> 10 aaagacatcg gcgaggtaat ttgtg 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 11 <400> 11 ctttcagcca gtagtcagtc tgggc 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> S100A7 probe 12 <400> 12 tctggtggga gaagacattt tattg 25 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 1 <400> 13 gaactcgatc cactgcagat aatgt 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 2 <400> 14 tgtgaacgcc ttgtccttgg tagtg 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 3 <400> 15 aaatccagag aagctagaat cctag 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 4 <400> 16 gaagtcttgg tcctgcacat caatg 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 5 <400> 17 atgataaaag attcactcct gcggg 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 6 <400> 18 gagtttcatt caagagagtt cgcaa 25 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 7 <400> 19 cagcagtatc tagagcggtg gccac 25 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 8 <400> 20 cggaataatt ccttgctcgt gtaag 25 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 9 <400> 21 cgtggtttgg cgttgtactc tgtca 25 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 10 <400> 22 tcaccaacag ggagattgca aagca 25 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 11 <400> 23 tctataggaa ggactcgttg ctggt 25 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 12 <400> 24 gggtctcagt cggtcaagaa ttccg 25 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 13 <400> 25 cattcgacga tagtacttag ccagt 25 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 14 <400> 26 cccgagagcg agtccgaagt ctctg 25 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 15 <400> 27 cagtacagtg gaaggagtgc gctca 25 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 16 <400> 28 gaccctggct cgtgaattat ttatg 25 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 17 <400> 29 ttagacctaa gattacagtt tctgg 25 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 18 <400> 30 tgctgcaccc aacagaaaga tatta 25 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 19 <400> 31 caggtgaaga gtgccgtaag tgcct 25 <210> 32 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 20 <400> 32 gcttcccaga gagatagtat tccca 25 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 21 <400> 33 aaggcaagcg tgttcctggg cagaa 25 <210> 34 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 22 <400> 34 taacactggg catggcacgt agtcg 25 <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 23 <400> 35 gttgtcaagt tctgcatcca cgggt 25 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 24 <400> 36 cattgagaga tgaccgcagg ctagt 25 <210> 37 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 25 <400> 37 ctgaacagaa gtgacccaac tacta 25 <210> 38 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 26 <400> 38 cgcgagctgc gggacacaaa agaat 25 <210> 39 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 27 <400> 39 tgtgtgctga gataacctcc caggc 25 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 28 <400> 40 tgagcaggct tctcctatct gggcc 25 <210> 41 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 29 <400> 41 gaaatcacgc ggctgtacca catag 25 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 30 <400> 42 gacgcactct gattggaccg gctga 25 <210> 43 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 31 <400> 43 ccttgaatag tgatggacca tggac 25 <210> 44 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 32 <400> 44 catcttgctc caaaatgtag gtccc 25 <210> 45 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 33 <400> 45 ggatacccaa catctgagac cacgt 25 <210> 46 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 34 <400> 46 tgtgtagcag tgagagcctt ccaga 25 <210> 47 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 35 <400> 47 tgtcataaca ggattgtgaa tacca 25 <210> 48 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 36 <400> 48 ctggcacgca gctggaaggc tatct 25 <210> 49 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 37 <400> 49 tctaagtggc tctctgggtg aacca 25 <210> 50 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 38 <400> 50 tggaaagtcc ttgtagaccc agaaa 25 <210> 51 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 39 <400> 51 taaactgagc cttgagttaa ggtcc 25 <210> 52 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 40 <400> 52 gatccttgat ctgcccgctt agtag 25 <210> 53 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 41 <400> 53 tccagatcca cgagaaagga gccca 25 <210> 54 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 42 <400> 54 ccagatccac gagaaaggag cccac 25 <210> 55 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 43 <400> 55 caggcctggg taattcttgt ggtca 25 <210> 56 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 44 <400> 56 ttgtgacatg cttgctctcc ctgct 25 <210> 57 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 45 <400> 57 catgtctgct gctatccaca acctg 25 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 46 <400> 58 cagatccacg agaaaggagc ccaca 25 <210> 59 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 47 <400> 59 tattccggac ggtcgtggtg ccatc 25 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 48 <400> 60 tgctgctatc cacaacctgt gtctg 25 <210> 61 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 49 <400> 61 tgctatccac aacctgtgtc tgtga 25 <210> 62 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 50 <400> 62 gtctgctgct atccacaacc tgtgt 25 <210> 63 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 51 <400> 63 tctgctgcta tccacaacct gtgtc 25 <210> 64 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 52 <400> 64 gtccagatcc acgagaaagg agccc 25 <210> 65 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 53 <400> 65 gagtattctt acaagtgtcc ccagg 25 <210> 66 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 54 <400> 66 gctatccaca acctgtgtct gtgag 25 <210> 67 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 55 <400> 67 ggtccagatc cacgagaaag gagcc 25 <210> 68 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PROM1 probe 56 <400> 68 catcttctgg agctgtgatt ctgca 25 <210> 69 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 1 <400> 69 caagtaggga gacgtatgta acaaa 25 <210> 70 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 2 <400> 70 cctgtgaact ggactgaacg agaca 25 <210> 71 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 3 <400> 71 gacatcacag ctctggtgat cccag 25 <210> 72 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 4 <400> 72 gtggccatca caacacctag acggg 25 <210> 73 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 5 <400> 73 aagttctccc gccaggcggc ctggg 25 <210> 74 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 6 <400> 74 ccagttaaaa ctgaacaggt gcctt 25 <210> 75 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 7 <400> 75 tgtaggactg caagacactg gaccg 25 <210> 76 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 8 <400> 76 gcggtggctt ctcccaatca gttca 25 <210> 77 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 9 <400> 77 agcggtggct tctcccaatc agttc 25 <210> 78 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 10 <400> 78 gggaccccaa tgaccatgat acagt 25 <210> 79 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 11 <400> 79 taagcaggag aacgactcaa gatac 25 <210> 80 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 12 <400> 80 ctttcctgag gtgatcagcc gcacg 25 <210> 81 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 13 <400> 81 tgagagcagc tttaacacac aggcc 25 <210> 82 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 14 <400> 82 tgcccaggcc gtagtgctgc acgta 25 <210> 83 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 15 <400> 83 aggtagtcag ccatggtctc ctccc 25 <210> 84 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 16 <400> 84 aggccttctc cttctaagtg ttgca 25 <210> 85 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 17 <400> 85 tgctcccaag gagaacacaa ggaag 25 <210> 86 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 18 <400> 86 tcttgacaga gtgctgggcc tggcc 25 <210> 87 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 19 <400> 87 tgctctgtaa gatccgccaa gtcca 25 <210> 88 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 20 <400> 88 tttcctgagg tgatcagccg cacgc 25 <210> 89 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 21 <400> 89 cacggcggaa agtctgcagg aagtc 25 <210> 90 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 22 <400> 90 aaataaaagc gtcaggtccc aacag 25 <210> 91 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 23 <400> 91 cacactttca atccgaggag ccagc 25 <210> 92 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 24 <400> 92 ctgaaacaga gggttgcggc ctgaa 25 <210> 93 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 25 <400> 93 ccgggcatcg tggacctcga tgata 25 <210> 94 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 26 <400> 94 gctgccgcag gatagttagg ctgaa 25 <210> 95 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 27 <400> 95 agcacgcgct ctacgttgtc acagg 25 <210> 96 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 28 <400> 96 cagtacacgc ggagccgacg cagga 25 <210> 97 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 29 <400> 97 tttggcgcaa agactatgac gactg 25 <210> 98 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 30 <400> 98 caaagacacc gtgccgtgag gaaga 25 <210> 99 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MT1G probe 31 <400> 99 caaagacact aaccaagagg acggc 25 <210> 100 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 1 <400> 100 aataagttag ctgcagattc ttggg 25 <210> 101 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 2 <400> 101 ggtggtccat ggaatcctga accca 25 <210> 102 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 3 <400> 102 gcaaagaccc tcaaaacatc ccagg 25 <210> 103 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 4 <400> 103 tctgcactga gatcttccta ttggt 25 <210> 104 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 5 <400> 104 tgattcttct atagctcgcg agcct 25 <210> 105 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 6 <400> 105 gtgattcttc tatagctcgc gagcc 25 <210> 106 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 7 <400> 106 gagagtgcga gcttcagttt gagaa 25 <210> 107 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 8 <400> 107 cgagagtgcg agcttcagtt tgaga 25 <210> 108 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 9 <400> 108 gatctccttg gccacaatgg tcttg 25 <210> 109 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 10 <400> 109 ggtgattctt ctatagctcg cgagc 25 <210> 110 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCL2 probe 11 <400> 110 tggtgattct tctatagctc gcgag 25

Claims (12)

An agent for measuring the expression level of one or more genes selected from the group consisting of S100A7 (S100 calcium-binding protein), PROM1 (Prominin-1), MT1G (Metallothionein 1G), and CCL2 (Chemokine (CC motif) ligand 2) A composition for diagnosis of PARP1 inhibitor resistance comprising. The composition of claim 1 , wherein the agent comprises an antisense oligonucleotide, a primer pair, or a probe that specifically binds to a gene. The method according to claim 1, wherein the PARP1 inhibitor is olaparib, talazoparib, niraparib, rucaparib, veliparib, pamiparib, or a combination thereof. composition. A kit for diagnosing PARP1 inhibitor resistance, comprising the composition of any one of claims 1 to 3. Measuring the expression level of one or more genes selected from the group consisting of S100A7, PROM1, MT1G, and CCL2 from the subject's sample; and
Information providing method for predicting PARP1 inhibitor resistance comprising the step of comparing the expression level of the measured gene with the expression level of a normal control sample. The method according to claim 5, wherein the step of measuring the expression level of the gene is reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR), real-time reverse transcription polymerase reaction (Realtime RT-PCR), RNase An information providing method that is performed by a protection assay (RPA; RNase protection assay), Northern blotting, or a DNA chip. The method according to claim 5, wherein the sample is a tumor tissue. The method according to claim 5, when the measured expression level of the S100A7, PROM1 or CCL2 gene is higher than that of the normal control, and when the measured expression level of the MT1G gene is lower than that of the normal control, the step of determining PARP1 inhibitor resistance Information providing method that further includes. Measuring the expression level of one or more genes selected from the group consisting of S100A7, PROM1, MT1G, and CCL2 from a sample of an individual administered with a candidate substance for treatment of PARP1 inhibitor-resistant cancer; and
A method of screening a PARP1 inhibitor-resistant cancer therapeutic agent comprising the step of comparing the measured expression level of the gene with the expression level of a normal control sample. The screening method according to claim 9, wherein the sample is a tumor tissue. The screening method according to claim 9, wherein the step of measuring the expression level of the gene is performed by a reverse transcription polymerase reaction, a competitive reverse transcription polymerase reaction, a real-time reverse transcription polymerase reaction, an RNase protection assay, Northern blotting, or a DNA chip. Way. The method according to claim 9, when the measured expression level of the S100A7, PROM1 or CCL2 gene is higher than that of the normal control, and when the measured expression level of the MT1G gene is lower than that of the normal control, the administered candidate substance is PARP1 inhibitor resistance The screening method further comprising the step of determining a cancer therapeutic agent.

Images