KR20210059425A - Method of reducing side-effects of CAR T cell therapy - Google Patents

Abstract

The present invention relates to a method for reducing side effects of a CAR T cell therapy product in an individual by administering a proteolytic inducer to chimeric antigen receptor polypeptide for reducing the side effects of the CAR T cell therapy product, a gene for encoding the chimeric antigen receptor polypeptide, a vector including the gene, a cell transformed into the vector, and the individual to which the cell is administered. Specifically, a CAR T cell of the present invention similarly maintains cytokine release and cell solubility of a conventional CAR T cell therapy product, treats the side effects by administering the proteolytic inducer and reducing activation of the CAR T cell when the side effects of the CAR T cell therapy product occur, and reduces the side effects of the CAR T cell therapy product which are the biggest problem by increasing the activation of the CAR T cell again without administering the CAR T cell again when the proteolytic inducer is not administered.

Description

TECHNICAL FIELD [Method of reducing side-effects of CAR T cell therapy]

The present invention relates to a method of reducing the side effects of CAR T cell therapeutics.

The immune system has a specific mechanism to protect the human body from various diseases, and in particular, it detects and removes pathogens such as bacteria and viruses. In addition, the immune system differentiates between healthy cells and diseased cells to prevent the formation and growth of cancer, which is achieved by recognizing antigens that represent the transition from healthy to pathological conditions. Accordingly, as an immunotherapy for treating cancer, studies on cell therapy in which immune cells are strengthened or genetically modified and injected are being actively conducted.

In the past, immunotherapy has used a method of proliferating in vitro using T cells isolated from tumors, but it is difficult to control the proliferation of T cells and a heterogeneous T cell group is formed to obtain antigen-specific T cells. Had difficulty. Accordingly, studies on applying chimeric antigen receptor (CAR), an artificial receptor based on gene recombination technology, to immunotherapy are being actively conducted. CAR is an artificial receptor designed to allow T cells to recognize specific antigens and exhibit cytotoxicity.The extracellular binding region (ecodomain), transmembrane domain, and intracellular signaling region (endodomain) that recognize cancer cells as antigens ). The extracellular binding region recognizes the cell membrane ligand of a cancer cell with a specific antigen, the transmembrane region connects the extracellular binding region and the intracellular signal region, and the intracellular signal region transmits the signal from the extracellular binding region into the cell. Thus, it activates the immune response of T cells.

The first-generation CAR contained the ITAM-bearing domain of CD3ζ as a signaling domain and did not contain costimulatory domains such as CD28, CD137, and CD278, so there was a limit to sufficiently expressing anticancer efficacy (Ma et al., 2002; Park et al. ., 2007). Through follow-up research, a second-generation CAR was developed that added a costimulatory domain to the signaling domain of the first-generation CAR, and the developed second-generation CAR-T significantly improved the expression persistence and anti-tumor function of the CAR compared to the first-generation CAR-T. It showed a very high therapeutic effect in B cell carcinoma (Moeller et al., 2004; Savoldo et al., 2011). Complete remission rates of 70-94% in B-ALL, 40-75% in CLL, and 57-68% in CLL were reported. Based on these results, Kymriah of Novartis and YESCARTA of Kite Pharma were approved by the U.S. FDA in 2017. (Park et al., 2016).

However, despite these clinical effects, safety issues for CAR-T treatments are constantly being raised. The side effects of CAR T cells are due to abnormal upregulation of CAR T cell activity. The most common toxic reactions observed in CD19 CAR-T clinical trials conducted to date are the cytokine release syndrome (CRS), which causes fever, discomfort, hypotension and capillary leak syndrome (Lee et al., 2015). ; Porter et al., 2015) and brain-vascular barrier (Blood-Brain Barrier, BBB) is a neurotoxic response induced by increased permeability and endothelial cell activation (Gust et al., 2017), CD19 CAR-T treatment. In the case of receiving patients, the side effect of receiving intravenous immunoglobulin throughout life to prevent B cell aplasia caused by the deficiency of normal B cells remains a problem (Kochenderfer et al., 2012).

Among the side effects of CAR T cell therapy, cytokine release syndrome (CRS) is experienced by 50 to 100% of patients receiving CAR T cell therapy, and 13 to 48% of patients have severe, life-threatening symptoms. Experience.

Several methods have been used to solve the side effects of these CAR T cell therapeutics, and a therapy in which tocilizumab, an anti-IL-6 antibody, is typically administered to patients suffering from cytokine release syndrome (CRS) is typical. However, the administration regimen of tocilizumab did not show a clear effect on CAR T cell-related neurotoxicity.

Accordingly, there is a need for a system for regulating the activity of CAR T cells when a patient is at risk due to side effects of CAR T cell therapy. As a solution to this, the iCas9 system was developed to induce apoptosis of CAR T cells using small molecules. This system uses a synthetic molecule in which FKBP_F37V is fused with caspase-9, and the ligand of FKBP_F37V, AP1903 (Rimiducid), generates a Fas signal only in cells containing this synthetic molecule, resulting in apoptosis. (MacCorkle, RA; Freeman, KW; Spencer, DM, Synthetic activation of caspases: artificial death switches.Proc Natl Acad Sci USA 1998, 95 (7), 3655) -60.). This system can induce apoptosis of CAR T cells to treat the side effects of CAR T cell therapy, but after the CAR T cells are removed by AP1903, CAR T cells that are costly to the patient to continue treatment There is a problem that needs to be injected again.

Accordingly, the present inventors can use PROTAC (Proteolysis-targeting chimaera) compounds to remove only CAR'proteins', not CAR'T cells' themselves, and CAR proteins are re-expressed upon removal of the PROTAC compound and recovered from side effects. Invented a method to reduce the side effects of a'reversible' CAR T cell therapy that does not require reinjection of T cells into the patient.

An object of the present invention is a chimeric antigen receptor polypeptide for reducing side effects of CAR T cells due to abnormal upregulation of CAR T cell activity, a gene encoding the chimeric antigen receptor polypeptide, a vector comprising the gene, the It is to provide a cell transformed with a vector, and a method of reducing the side effects of a CAR T cell therapeutic agent in an individual by administering a proteolysis inducing agent to the individual to which the cells are administered.

In order to achieve the above object, the present invention provides an extracellular binding region (ecodomain), a transmembrane domain, a protein degraded by a proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC), and an intracellular signaling region (endodomain). It provides a chimera antigen receptor polypeptide containing (chimera antigen receptor polypeptide).

In addition, the present invention provides a gene encoding the chimeric antigen receptor polypeptide.

In addition, the present invention provides a vector containing the gene.

In addition, the present invention provides a cell transformed with the vector.

In addition, the present invention provides a method of reducing the side effects of CAR T cell therapy in an individual by administering a proteolysis inducing agent to the individual to which the cells are administered.

The CAR T cell of the present invention maintains similar cytokine release and cell lysis ability of the existing CAR T cell therapy, and decreases the activity of CAR T cells by administering a proteolysis inducing agent when a side effect of the CAR T cell therapy occurs. If the proteolysis inducing agent is not administered, the activity of CAR T cells increases again, and there is an advantage that it does not require re-administration of CAR T cells. Therefore, it is the biggest problem of CAR T cell therapy, which is to reduce side effects. It can be usefully used.

1A is a schematic diagram showing the concept of a method for reducing the side effects of the CAR T cell therapeutic agent of the present invention. When the PROTAC compound is treated, the CAR protein is degraded, and when the PROTAC compound is removed, the activity of the CAR protein is restored again. It is a diagram showing that.
Figure 1b shows that most of the CAR protein is degraded when the PROTAC compound is treated at a high dose, and a part of the CAR protein is degraded when the PROTAC compound is treated at a low dose. It is a diagram showing that the activity of cells can be regulated.
Figure 2a is a diagram showing the Flag-K-Ras-BD2 and Flag-IDH1-BD2 constructs prepared to verify the hypothesis that any protein to which BD is linked will be degraded by the ARV PROTAC compound.
2B is a diagram confirming whether or not the Flag-K-Ras-BD2 and Flag-IDH1-BD2 constructs are decomposed by the ARV-771 and ARV-825 compounds through Western blotting.
3A is a diagram showing the FMC63-CD28-BD2-CD3ζ construct and the FMC63-BD2-D28-CD3ζ construct, which are CAR proteins linked to BD degraded by the ARV PROTAC compound.
Figure 3b is a diagram confirming whether the BD-linked CAR protein FMC63-CD28-BD2-CD3ζ construct and the FMC63-BD1-D28-CD3ζ construct are degraded by the ARV PROTAC compound through Western blotting.
Figure 4 shows the anti-CD19 CAR protein construct, the FMC63-CD28-BD2-CD3ζ construct and the FMC63-BD2-D28-CD3ζ construct. ) To confirm whether the decomposition of the CAR protein is caused by E3 ligase.
Figure 5 is a diagram confirming how the level of the FMC63-CD28-BD2-CD3ζ construct CAR protein changes through Western blotting when ARV-771 and ARV-825 are removed.
Figure 6 is a measurement of the cytokine IL-2 (interluekin 2) secretion ability of the BD-linked CAR construct (FMC63-CD28-BD2-CD3ζ) and the original CAR construct (FMC63-CD28-CD3ζ), This is a diagram confirming that there is no difference in function from the original CAR construct (FMC63-CD28-CD3ζ) of the BD-linked CAR protein (FMC63-CD28-BD2-CD3ζ) in terms of cytokine secretion ability.
7 is a comparison of the BD-linked CAR construct (FMC63-CD28-BD2-CD3ζ) and the original CAR construct (FMC63-CD28-CD3ζ) to measure the ability to lyse cells, and the BD-linked CAR This is a diagram confirming that the protein (FMC63-CD28-BD2-CD3ζ) has as good ability to lyse cells as the original CAR construct (FMC63-CD28-CD3ζ).
FIG. 8A shows the KHYG-1 cells into which the original CAR construct was introduced and the KHYG-1 cells into which the BD-linked CAR construct was introduced exhibits the activity to lyse the target cells, and the ARV-771 and ARV-825 compounds. It is a diagram confirming that when treated, the CAR construct to which BD is linked does not exhibit cytolytic activity in the introduced KHYG-1 cells.
Figure 8b is a diagram confirming that the activity of the CAR construct to which BD is linked is measured according to the concentration of the treated PROTAC compound, and that the activity of the CAR protein can be adjusted according to the dose of the treated PROTAC compound.

Hereinafter, the present invention will be described in detail.

The present invention is a chimeric antigen receptor polypeptide comprising an extracellular binding region (ecodomain), a transmembrane domain, a protein degraded by a proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC), and an intracellular signaling region (endodomain). (chimera antigen receptor polypeptide) is provided.

The extracellular binding region is a part that recognizes a cell membrane ligand of a cancer cell containing a specific antigen and transmits a main signal, and may include an antibody or antigen-binding fragment thereof that binds to a target antigen. The extracellular binding region can recognize a specific antigen of a cancer cell, and the specific antigen of a cancer cell is a protein produced by cancer cells that induces an immune response, particularly an immune response mediated by T cells. Specifically, the extracellular binding region binds to FMC63, a single chain variable fragment (scFv) capable of binding to CD19, a B cell-specific antigen, and IL-13 receptor (IL13R) on glioma cells. It may be IL-13, which may be, and may be heregulin, which may bind to erb B2, B3 and B4 in breast cancer cells.

The specific antigens of the cancer cells include one or more antigenic cancer epitopes associated with malignant tumors. Malignant tumors express many proteins that can serve as target antigens for immune attack. It includes MART-1, tyrosinase and GP 100 in melanoma, and Prostate specific antigen (PSA) in prostate cancer. In B cell lymphoma, CD19, CD20 or CD37 may be a specific antigen of cancer cells.

The extracellular binding region is a protein that specifically binds to a target antigen, and may be an antibody or antigen-binding fragment thereof that binds to the target antigen, and may include a polypeptide consisting of any sequence known in the art, and a target antigen It may be a variant or fragment of an amino acid having a different sequence by deletion, insertion, substitution, or a combination of amino acid residues within a range capable of maintaining a specific avidity with a family. In some cases, it may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, or farnesylation.

The transmembrane region is a part connecting the extracellular binding region and the intracellular signaling region, and may span from one side (extracellular) of the cell membrane to the other side (intracellular or cytoplasm) of the cell membrane. The transmembrane region may include at least one selected from the group consisting of an alpha helix and a beta barrel. As a component of the chimeric antigen receptor of the present invention, the transmembrane region known in the art may be used without limitation. Specifically, the transmembrane region is a membrane of a protein selected from the group consisting of CD3ε, CD4, CD5, CD8, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137 and CD154. It may include a penetrating region, and more specifically, may include a CD8 or CD28 protein.

The CD8 or CD28 protein is a natural marker on the surface of T cells, and may include a polypeptide consisting of any sequence known in the art, and as described above, within a range that does not affect the function of the protein. It may be a variant or fragment of an amino acid. In one embodiment of the present invention, the transmembrane region of the CD28 protein may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 20.

The intracellular signaling region is a part that activates an immune response of T cells, and may include a polypeptide for stimulating or activating an immune cell signaling pathway. As a component of the chimeric antigen receptor of the present invention, an intracellular signal region known in the art may be used without limitation. Specifically, the intracellular signal region may include an intracellular signal region of a protein selected from the group consisting of CD3ζ, FcεRIγ, CD28, CD137, and CD134, and more specifically, the intracellular signal region of a CD3ζ or FcεRIγ protein. Can include.

The CD3 protein consists of five subunits, of which the CD3ζ subunit (CD3 zeta) contains three immunoreceptor tyrosine-based activation (ITAM) motifs, which are important in the TCR (T cell receptor)-CD3 complex. It is a transduction region. Meanwhile, FcεRIγ is mainly distributed on the surface of mast cells and basophilic granulocytes, contains one ITAM motif, and is similar in structure, distribution, and function to CD3ζ. The intracellular signal region of the CD3ζ or FcεRIγ protein may include a polypeptide composed of any sequence known in the art, and as described above, may be a variant or fragment of an amino acid within a range that does not affect the function of the protein. have. In one embodiment of the present invention, the intracellular signal region of the CD3ζ protein may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 21.

In one embodiment of the present invention, the chimeric antigen receptor polypeptide may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 16.

Proteolysis Targeting Chimera (hereinafter, PROTAC compound) is a low-molecular compound that induces the decomposition of a specific protein and consists of a part that binds to a target protein, a part that binds to E3 ligase, and a linker. When the part that binds to the target protein of PROTAC binds to the target protein, and the part that binds to E3 ligase binds to E3 ligase, the target protein and the proteolytic enzyme, E3 ligase, become close. When the target protein and E3 ligase are linked by PROTAC, the target protein is ubiquitinated by E3 ligase and moves to the proteasome and is decomposed.

In one embodiment of the present invention, the protein degraded by the proteolysis inducing agent may be BD1 (bromodomain 1) or BD2 (bromodomain 2). The BD1 may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 22, and the BD2 may be a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 23.

In one embodiment of the present invention, the proteolysis inducing agent may be ARV-771 represented by Formula 1 below or ARV-825 represented by Formula 2 below.

The ARV-771 is a kind of proteolytic inducer compound, a moiety capable of binding to Brd4 protein, a moiety capable of binding to the von Hippel-Landau (VHL) domain of E3 ligase, and a linkage connecting the two moieties It is composed of a linker.

The ARV-825 is a kind of proteolytic inducer compound, a moiety capable of binding to Brd4 protein, a moiety capable of binding to the cereblon (CRBN) domain of E3 ligase, and a linker connecting the two moieties. ).

In addition, the present invention provides a gene encoding the chimeric antigen receptor polypeptide. The gene may include all polynucleotides composed of any sequence known in the art as long as it encodes a protein having an activity equivalent to that of the chimeric antigen receptor of the present invention, and one or more substitutions that do not reduce the activity, Variants with insertions, deletions and combinations thereof may be included. These variants may have 80%, 90%, 95%, 98% or more homology with the gene sequence encoding the chimeric antigen receptor of the present invention. In one embodiment of the present invention, in the gene, the portion encoding FMC63 may be a polynucleotide composed of a nucleotide sequence shown in SEQ ID NO: 24, and the portion encoding CD28 is a nucleotide sequence shown in SEQ ID NO: 25. It may be a polynucleotide composed of, and the portion encoding CD3ζ may be a polynucleotide composed of a nucleotide sequence represented by SEQ ID NO: 26.

In addition, the gene encoding the chimeric antigen receptor polypeptide may be a polynucleotide composed of a nucleotide sequence described in SEQ ID NO: 15.

In addition, the gene may be modified in various ways in the coding region in consideration of the codon preferred in the organism to express the chimeric antigen receptor, and within a range that does not affect the expression of the gene even in parts other than the coding region. Various modifications can be made known in the following.

In addition, the present invention provides a vector containing the gene. The vector includes an isolated polynucleotide, and as a composition that can be used to deliver it to the interior of a cell, the present invention can use a vector known in the art without limitation. The vector may be a linear polynucleotide, a polynucleotide associated with an ionic or amphiphilic compound, a plasmid, a phagemid, a cosmid, or a virus, and the virus may be a phage or a phage derivative. In addition, the vector may be a non-plasmid or non-viral compound, specifically, a polylysine compound or a liposome.

The viral vector may include an adeno virus vector, an adeno-associated virus vector, a retro virus vector, a lenti virus vector, and the like. Viral vector technology is well known in the art, and according to the type of host cell into which the vector is to be introduced, expression control sequences such as promoter, terminator, enhancer, etc. are appropriately selected, and membrane targeting or secretion The signal sequence for, etc. can be variously combined according to the purpose. In one embodiment of the present invention, the vector may be a lentiviral vector.

In addition, the present invention provides a cell transformed with the vector. A gene expressing a chimeric antigen receptor may be introduced into a cell with the vector to transform cells, and methods known in the art may be used without limitation for transformation. The cells must be able to express the chimeric antigen receptor on the cell membrane, and specifically, the cells are T cells, NKT cells, regulator T cells, NK cells (natural killer cells) or B cells (B cells) And the like, and can be obtained from bone marrow, peripheral blood, peripheral blood mononuclear cells, or cord blood. In one embodiment of the present invention, the cells may be T cells or NKT cells.

In addition, the present invention provides a method of reducing the side effects of CAR T cell therapy in an individual by administering a proteolysis inducing agent to the individual to which the cells are administered.

The side effect of the CAR T cell therapy is any one selected from the group consisting of cytokine release syndrome (CRS), B cell aplasia, and neurotoxicity.

The proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC) is an ARV-771 or ARV-825 proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC).

In a specific embodiment of the present invention, the inventors of the present invention are the PROTAC compounds that specifically degrade Bromodomain 1 (BD1) and Bromodomain 2 (BD2) in the Brd4 protein, ARV-771 and ARV-825, which also degrade BD to which other proteins are linked. And (see Figs. 2a and 2b), it was confirmed that the compound also degrades the BD2-linked CAR protein (see Figs. 3a and 3b). In addition, the decomposition of the BD2-linked CAR protein is due to the proteasome pathway by binding the ARV-771 and ARV-825 compounds to BD2 and E3 ligase to cause ubiquitination of the protein (see Fig. 4), and ARV-771 And when the ARV-825 compound was removed, it was confirmed that the activity of the CAR protein to which BD2 is linked increases again (see FIG. 5). The CAR protein to which BD2 is linked has similar cytokine release and cell lysis ability compared to the original CAR protein (see Figs. 6 and 7), and NK T cells expressing the CAR protein to which BD2 is linked are treated ARV-771 and It was confirmed that the activity decreased in proportion to the concentration of the ARV-825 compound (see FIGS. 8A and 8B).

Accordingly, chimeric antigen receptors comprising an extracellular binding region (ecodomain), a transmembrane domain, a protein degraded by a proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC) and an intracellular signaling region (endodomain) of the present invention The polypeptide, the gene encoding the polypeptide, the vector containing the gene, and the cells transformed with the vector maintain similar cytokine release and cell lysis capacity of the existing CAR T cell therapeutic agent, and CAR T cell therapeutic agent When the side effects of cytokine release syndrome, B cell aplasia, and neurotoxicity occur, proteolysis-inducing agents can be administered to reduce the activity of CAR T cells, thereby treating the side-effects. As the activity of the cell therapy is increased, there is an advantage that it is not necessary to administer the cell therapy again, so it can be usefully used to reduce side effects, which is the biggest problem of CAR T cell therapy.

Hereinafter, the present invention will be described in detail by the following examples and experimental examples.

However, the following Examples and Experimental Examples are for illustrative purposes only, and the present invention is not limited thereto.

<Example 1> Confirmation of whether the PROTAC compound degrades the target protein

In order to verify the concept of the present invention for regulating the activity of CAR T cells by removing CAR proteins other than CAR T cells, it was necessary to select a domain having a strong efficacy in inducing proteolysis by a PROTAC compound. As a result, Bromodomain (BD) was selected. Brd4 protein (Bromodomain containing protein 4) contains two bromodomains (BD), BD1 and BD2. Since the PROTAC compounds ARV 771 and ARV 825 completely degrade Brd4 by binding to BD in the Brd4 protein and linking BD and E3 ligase (VHL or CRBN), it is hypothesized that any protein to which BD is linked by ARV compounds will be degraded. Built. Accordingly, the following experiment was performed to determine whether the ARV compound degrades BD2 in the protein linked to K-Ras and BD2 and the protein linked to IDH1 and BD.

Specifically, a construct to which a polynucleotide encoding a K-Ras protein and a polynucleotide encoding a BD2 protein are linked (SEQ ID NO: 9) and a polynucleotide encoding an IDH1 protein and a polynucleotide encoding a BD2 protein are linked In order to prepare a sprout (SEQ ID NO: 10), the cDNA (addgene) of K-Ras was used as the primers in Table 1 below, and the cDNA of IDH1 (a gift from Dr. Downing of St. Jude hospital) was used as the primers in Table 2 below. Was used to amplify the sequence encoding each protein. The amplified PCR product and pLVX vector (clontech) were digested with XhoI (NEB) and BamHI (NEB), and then ligated using Ligase (NEB). The ligated DNA was transformed into HITα competent cells (RBC) to finally obtain the desired gene. The produced Flag-K-Ras-BD2 protein (SEQ ID NO: 11) and Flag-IDH1-BD2 protein (SEQ ID NO: 12) were treated with 1nM, 10nM, and 100nM compounds of Formula 1 and Formula 2 ARV-771 and ARV-825 .

Sequence number name Sequence (5'-3') SEQ ID NO: 1 Ras_Flag_F_XhoI ATCTCTCTCGAGATGGACTACAAAGACGATGACGAC AAG ATG ACT GAATATAAACTT SEQ ID NO: 2 BD2_STOP_R_BamHI ATCTCTGGATCCTTACTCGTCCGGCATCTTGGC SEQ ID NO: 3 Ras-BD2_F ACAAAGTGTGTAATTATGCCAGCACCAGAGAAGAGCAGCA SEQ ID NO: 4 Ras-BD2_R TGCTGCTCTTCTCTGGTGCTGGCATAATTACACACTTTGT

Sequence number name Sequence (5'-3') SEQ ID NO: 5 IDH1_Flag_F_XhoI atc tct CTCGAG ATG GAC TAC AAA GAC GAT GAC GAC AAG atgtccaaaaaaatc agt
SEQ ID NO: 6 BD2_STOP_R_BamHI tct GGATCC TTACTCGTCCGGCATCTTGGC SEQ ID NO: 7 IDH1-BD2_F ctagctcaggc caaactt ccag caccagagaa gagcagca SEQ ID NO: 8 IDH1-BD2_R TGCTGCTCTTCTCTGGTGCTGGAAGTTTGGCCTGAGCTAG

Then, the sample was added to 1X buffer solution containing 10% glycerol, 2% Sodium Dodecyl Sulfate (SDS), 50 mM pH 6.8 Tris solution, 3% β-mercaptoethanol, and 0.02% bromophenol blue. Then, it was separated by an SDS-PAGE gel having a gradient of 4 to 12%, and transferred to a polyvinylidene difluoride (PVDF) membrane. The membrane was incubated with antibodies specific for each protein, and detected with ECL reagent (Cat. # 32209, Thermo Fisher Scientific, USA). Images were analyzed using the LAS-3000 Imager and Image Lab software.

As a result, as shown in Figure 2b, it was confirmed that the BD2 protein was degraded in the protein linked to K-RAS and BD2 and the protein to which IDH1 and BD2 were linked by the ARV-711 and ARV-825 PROTAC compounds. The above results suggest that any protein to which BD2 is linked can be degraded by the PROTAC compound.

<Example 2> Preparation of BD-linked CAR protein

A CAR protein to which BD is linked was prepared, and whether it was degraded by an ARV compound was confirmed by the following method.

Specifically, as shown in Figure 2a, anti-CD19 CAR protein construct (FMC63-CD28-CD3ζ, SEQ ID NO: 13), FMC63-CD28-BD2-CD3ζ construct (SEQ ID NO: 14) and FMC63-BD1-D28-CD3ζ construct 293T manufactured by requesting macrogen (SEQ ID NO: 15) and cultured in RPMI-1640 medium supplemented with 10% Fetal Bovine Serum (FBS) at 37°C and 5% CO ₂ Cells (ATCC, US) were transfected. The three CAR proteins produced were treated with 5nM, 50nM, and 500nM of ARV-771 and ARV-825 compounds of the following Formulas 1 and 2, and Western blotting was performed in the same manner and conditions as in Example 1.

As a result, 3B, the original anti-CD19 CAR protein (SEQ ID NO: 16) was not degraded by the ARV compound, but the FMC63-CD28-BD2-CD3ζ protein (SEQ ID NO: 17) was degraded by the ARV compound. However, proteins located outside the transmembrane domain of the BD protein, such as the FMC63-BD1-D28-CD3ζ protein (SEQ ID NO: 18), were not degraded by the compound. The above results suggest that the protein targeted for degradation by the ARV compound must be located inside the transmembrane region of the CAR protein to be degraded by the ARV compound.

<Experimental Example 1> Confirmation of whether the decomposition of BD by the ARV compound was caused by E3 ligase

The following experiment was performed to confirm whether the decomposition of the BD protein by the ARV compound identified in Example 2 was caused by E3 ligase.

Specifically, a ligand capable of binding to VHL of E3 ligase in the anti-CD19 CAR protein construct prepared in Example 2, the FMC63-CD28-BD2-CD3ζ construct and the FMC63-BD2-D28-CD3ζ construct Phosphorus was treated with pomalidomide (Cayman Chemicals) of Formula 4, which is a ligand capable of binding to CRBN of JYH-16-100 of Formula 3 and E3 ligase. 293T cells were transfected with the FMC63-CD28-BD2-CD3ζ construct, and after 24 hours, the compound was treated according to the purpose of the experiment. After the compound was treated 6 hours after the cell lysate was collected, Western blotting was performed.

As a result, as shown in FIG. 4, when the ligand binding to E3 ligase is treated, the CAR construct is not degraded by the ARV compound, so the CAR protein decomposition mediated by the ARV compound is E3 ligase-proteasome. It was confirmed that it occurs by the (E3 ligase-Proteasome) pathway.

<Experimental Example 2> Whether the decomposition activity of CAR is changed when the PROTAC compound is removed

It was confirmed in Example 2 that the BD2 protein in the FMC63-CD28-BD2-CD3ζ construct was degraded when the PROTAC compounds ARV-771 and ARV-825 were treated. However, when ARV-771 and ARV-825 were removed, how the FMC63-CD28-BD2-CD3ζ construct CAR protein level changed was confirmed through the following experiment.

Specifically, 293T cells were transfected with the FMC63-CD28-BD2-CD3ζ construct, and 24 hours later, the compound was treated according to the purpose of the experiment. 15 hours after the compound was treated, the cell culture medium containing the compound was replaced with a new culture medium, and after 12 hours, the cell lysate was collected and Western blotting was performed.

As a result, as shown in FIG. 5, the activity of the construct CAR protein FMC63-CD28-BD2-CD3ζ, which was reduced when ARV-771 and ARV-825 were treated, was reactivated when ARV-771 and ARV-825 were removed. It was confirmed that this was recovered. The above results suggest that the present invention can regulate CAR T cell activity in proportion to the expression level of the CAR protein.

<Experimental Example 3> Confirmation of the function of the BD-linked CAR protein

If the BD-linked CAR protein does not function, it cannot be used as a cell therapy. Therefore, it is determined whether the BD-linked CAR protein (FMC63-CD28-BD2-CD3ζ) has the ability to secrete cytokines and lysate cells, which are the functions of CAR T cells. It was confirmed by the method of.

<3-1> Confirmation of the cytokine release function of the BD-linked CAR protein

The following experiment was performed to confirm the cytokine secretion ability of the BD-linked CAR protein.

Specifically, the original CAR construct prepared in Example 2 (FMC63-CD28-CD3ζ) and the BD-linked CAR construct (FMC63-CD28-BD2-CD3ζ) were used in the Neon Transfection System (Thermo Fisher Scientific, USA). ) Was used to transfect human T lymphocyte cells, Jurkat cells. Jurkat cells transfected with the CAR construct were co-cultured with NALM6 cells expressing CD19 antigen (DSMZ, Germany) at an effector-target (E/T) ratio of 10:1 for 24 hours. A supernatant of co-cultured cells was obtained and the level of IL-2 secretion was evaluated using an ELISA kit (Biolegend, USA).

As a result, as shown in FIG. 6, when Jurkat cells transfected with a BD-linked CAR construct (FMC63-CD28-BD2-CD3ζ) and CD19-positive NALM6 cells were cultured together, the original CAR construct (FMC63- CD28-CD3ζ) secreted cytokine IL-2 (interluekin 2) secretion ability was almost similar compared to the transfected Jurkat cells. The above results show that the CAR protein (FMC63-CD28-BD2-CD3ζ) to which the BD of the present invention is linked in terms of cytokine secretion ability does not differ in function from the original CAR construct (FMC63-CD28-CD3ζ).

<3-2> Confirmation of cell lytic function of CAR protein to which BD is linked

The following experiment was performed to confirm the cell lysis ability of the BD-linked CAR protein.

Specifically, cell lysis ability was specified using the NK T cell line, KHYG-1 cells. The NK T cell line KHYG-1 cells were cultured in the same manner and conditions as the 293T cells of Example 2, except that 200IU/ml of human IL-2 (Cat. 202-IL, R&D systems, USA) was supplemented. . Lentiviral expression vectors (pLVX or pLVX FMC63-CD28-CD3z or pLVX FMC63-CD28-BD2-CD3z) include pMDLg/pRRE (Addgene, Cat. 12251), pRSV-Rev (Addgene, Cat. 12253) and pMD2.G ( Addgene, Cat. 12259) and 293T cells cultured in the same manner and conditions as in Example 2 were transfected using _{CaPO 4.} After 48 hours, a culture medium was obtained and centrifuged at 500 g for 5 minutes. The centrifuged supernatant was passed through a filter having a pore of 0.45 μm and concentrated using a Lenti-X Concentrator (Clontech, USA). Thereafter, the lentiviral vector into which the concentrated CAR construct was introduced was infected with KHYG-1 cells by spin-infection (1,000 g, 1.5h). Infected cells were selected with 0.5 μg/ml puromycin.

KHYG-1 cells expressing CAR protein were co-cultured with CD19 positive NALM6 cells expressing luciferase for 4 hours at the indicated E/T ratio. Luciferase activity was measured by a Bright-Glo luciferase assay system (Promega, USA). Luciferase reagent was added to each well in the same volume as the cell culture medium. The plate was shaken for 5 minutes to lyse the cells. The luminescence of luciferase was measured in an EnVision reader (PerkinElmer, USA).

As a result, as shown in FIG. 7, in the case of KHYG-1 cells transduced with a BD-linked CAR construct (FMC63-CD28-BD2-CD3ζ), the original CAR construct (FMC63-CD28-CD3ζ) was Compared to the transduced KHYG-1 cells, the ability to lyse CD19 positive cells, NALM6 cells, was almost similar. The above results show that the BD-linked CAR protein of the present invention (FMC63-CD28-BD2-CD3ζ) has as good ability to lyse cells as the original CAR construct (FMC63-CD28-CD3ζ).

<Experimental Example 4> Confirmation of whether the PROTAC compound can regulate the cytolytic activity of CAR KHYG-1 cells

The following experiment was performed to confirm whether the PROTAC compound can regulate the cytolytic activity of KHYG-1 cells expressing the CAR protein prepared in Experimental Example 3-2.

Specifically, KHYG-1 cells expressing FMC63-CD28-CD3z and KHYG-1 cells expressing FMC63-CD28-BD2-CD3z were co-cultured with NALM6 cells expressing Green Fluorescence Protein (GFP). . The ARV-771 and ARV-825 compounds were treated with 300nM, and the expression of GFP was observed under a fluorescence microscope. In addition, KHYG-1 cells expressing FMC63-CD28-BD2-CD3z were co-cultured with NALM6 cells expressing Green Fluorescence Protein (GFP), and ARV-771 and ARV-825 compounds were 10nM, 30nM, 100nM and 300nM were treated and the expression of GFP was observed under a fluorescence microscope.

As a result, as shown in Figure 8a, the KHYG-1 cells to which the original CAR construct was introduced and the KHYG-1 cells to which the BD-linked CAR construct was introduced do not express the green fluorescent protein, thus lysing the target cells. Showed the activity to do. However, in the case of treatment with the ARV-771 and ARV-825 compounds, the KHYG-1 cells to which the original CAR construct was introduced had the activity of lysing the target cells as they were, but the KHYG to which the BD-linked CAR construct was introduced. -1 cells did not show cytolytic activity. In addition, as shown in FIG. 8B, it was confirmed that the lytic activity of KHYG-1 cells expressing the BD-linked CAR protein was inhibited in proportion to the concentration of the treated PROTAC compound. The above results show that the PROTAC compound can successfully modulate the cytolytic activity of T cells into which the BD-linked CAR construct is introduced.

<110> Korea Research Institute of Chemical Technology <120> Method of reducing side-effects of CAR T cell therap <130> 2019P-09-012 <160> 28 <170> KoPatentIn 3.0 <210> 1 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Ras_Flag_F_XhoI <400> 1 atctctctcg agatggacta caaagacgat gacgacaaga tgactgaata taaactt 57 <210> 2 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> BD2_STOP_R_BamHI <400> 2 atctctggat ccttactcgt ccggcatctt ggc 33 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Ras-BD2_F <400> 3 acaaagtgtg taattatgcc agcaccagag aagagcagca 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Ras-BD2_R <400> 4 tgctgctctt ctctggtgct ggcataatta cacactttgt 40 <210> 5 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> IDH1_Flag_F_XhoI <400> 5 atctctctcg agatggacta caaagacgat gacgacaaga tgtccaaaaa aatcagt 57 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> BD2_STOP_R_BamHI <400> 6 tctggatcct tactcgtccg gcatcttggc 30 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IDH1-BD2_F <400> 7 ctagctcagg ccaaacttcc agcaccagag aagagcagca 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IDH1-BD2_R <400> 8 tgctgctctt ctctggtgct ggaagtttgg cctgagctag 40 <210> 9 <211> 951 <212> DNA <213> Artificial Sequence <220> <223> Flag-K-Ras-BD2 <400> 9 atggactaca aagacgatga cgacaagatg actgaatata aacttgtggt agttggagct 60 ggtggcgtag gcaagagtgc cttgacgata cagctaattc agaatcattt tgtggacgaa 120 tatgatccaa caatagagga ttcctacagg aagcaagtag taattgatgg agaaacctgt 180 ctcttggata ttctcgacac agcaggtcaa gaggagtaca gtgcaatgag ggaccagtac 240 atgaggactg gggagggctt tctttgtgta tttgccataa ataatactaa atcatttgaa 300 gatattcacc attatagaga acaaattaaa agagttaagg actctgaaga tgtacctatg 360 gtcctagtag gaaataaatg tgatttgcct tctagaacag tagacacaaa acaggctcag 420 gacttagcaa gaagttatgg aattcctttt attgaaacat cagcaaagac aagacagggt 480 gttgatgatg ccttctatac attagttcga gaaattcgaa aacataaaga aaagatgagc 540 aaagatggta aaaagaagaa aaagaagtca aagacaaagt gtgtaattat gccagcacca 600 gagaagagca gcaaggtctc ggagcagctc aagtgctgca gcggcatcct caaggagatg 660 tttgccaaga agcacgccgc ctacgcctgg cccttctaca agcctgtgga cgtggaggca 720 ctgggcctac acgactactg tgacatcatc aagcacccca tggacatgag cacaatcaag 780 tctaaactgg aggcccgtga gtaccgtgat gctcaggagt ttggtgctga cgtccgattg 840 atgttctcca actgctataa gtacaaccct cctgaccatg aggtggtggc catggcccgc 900 aagctccagg atgtgttcga aatgcgcttt gccaagatgc cggacgagta a 951 <210> 10 <211> 1629 <212> DNA <213> Artificial Sequence <220> <223> Flag-IDH1-BD2 <400> 10 atggactaca aagacgatga cgacaagatg tccaaaaaaa tcagtggcgg ttctgtggta 60 gagatgcaag gagatgaaat gacacgaatc atttgggaat tgattaaaga gaaactcatt 120 tttccctacg tggaattgga tctacatagc tatgatttag gcatagagaa tcgtgatgcc 180 accaacgacc aagtcaccaa ggatgctgca gaagctataa agaagcataa tgttggcgtc 240 aaatgtgcca ctatcactcc tgatgagaag agggttgagg agttcaagtt gaaacaaatg 300 tggaaatcac caaatggcac catacgaaat attctgggtg gcacggtctt cagagaagcc 360 attatctgca aaaatatccc ccggcttgtg agtggatggg taaaacctat catcataggt 420 cgtcatgctt atggggatca atacagagca actgattttg ttgttcctgg gcctggaaaa 480 gtagagataa cctacacacc aagtgacgga acccaaaagg tgacatacct ggtacataac 540 tttgaagaag gtggtggtgt tgccatgggg atgtataatc aagataagtc aattgaagat 600 tttgcacaca gttccttcca aatggctctg tctaagggtt ggcctttgta tctgagcacc 660 aaaaacacta ttctgaagaa atatgatggg cgttttaaag acatctttca ggagatatat 720 gacaagcagt acaagtccca gtttgaagct caaaagatct ggtatgagca taggctcatc 780 gacgacatgg tggcccaagc tatgaaatca gagggaggct tcatctgggc ctgtaaaaac 840 tatgatggtg acgtgcagtc ggactctgtg gcccaagggt atggctctct cggcatgatg 900 accagcgtgc tggtttgtcc agatggcaag acagtagaag cagaggctgc ccacgggact 960 gtaacccgtc actaccgcat gtaccagaaa ggacaggaga cgtccaccaa tcccattgct 1020 tccatttttg cctggaccag agggttagcc cacagagcaa agcttgataa caataaagag 1080 cttgccttct ttgcaaatgc tttggaagaa gtctctattg agacaattga ggctggcttc 1140 atgaccaagg acttggctgc ttgcattaaa ggtttaccca atgtgcaacg ttctgactac 1200 ttgaatacat ttgagttcat ggataaactt ggagaaaact tgaagatcaa actagctcag 1260 gccaaacttc cagcaccaga gaagagcagc aaggtctcgg agcagctcaa gtgctgcagc 1320 ggcatcctca aggagatgtt tgccaagaag cacgccgcct acgcctggcc cttctacaag 1380 cctgtggacg tggaggcact gggcctacac gactactgtg acatcatcaa gcaccccatg 1440 gacatgagca caatcaagtc taaactggag gcccgtgagt accgtgatgc tcaggagttt 1500 ggtgctgacg tccgattgat gttctccaac tgctataagt acaaccctcc tgaccatgag 1560 gtggtggcca tggcccgcaa gctccaggat gtgttcgaaa tgcgctttgc caagatgccg 1620 gacgagtaa 1629 <210> 11 <211> 316 <212> PRT <213> Artificial Sequence <220> <223> Flag-K-Ras-BD2 <400> 11 Met Asp Tyr Lys Asp Asp Asp Asp Lys Met Thr Glu Tyr Lys Leu Val 1 5 10 15 Val Val Gly Ala Gly Gly Val Gly Lys Ser Ala Leu Thr Ile Gln Leu 20 25 30 Ile Gln Asn His Phe Val Asp Glu Tyr Asp Pro Thr Ile Glu Asp Ser 35 40 45 Tyr Arg Lys Gln Val Val Ile Asp Gly Glu Thr Cys Leu Leu Asp Ile 50 55 60 Leu Asp Thr Ala Gly Gln Glu Glu Tyr Ser Ala Met Arg Asp Gln Tyr 65 70 75 80 Met Arg Thr Gly Glu Gly Phe Leu Cys Val Phe Ala Ile Asn Asn Thr 85 90 95 Lys Ser Phe Glu Asp Ile His His Tyr Arg Glu Gln Ile Lys Arg Val 100 105 110 Lys Asp Ser Glu Asp Val Pro Met Val Leu Val Gly Asn Lys Cys Asp 115 120 125 Leu Pro Ser Arg Thr Val Asp Thr Lys Gln Ala Gln Asp Leu Ala Arg 130 135 140 Ser Tyr Gly Ile Pro Phe Ile Glu Thr Ser Ala Lys Thr Arg Gln Gly 145 150 155 160 Val Asp Asp Ala Phe Tyr Thr Leu Val Arg Glu Ile Arg Lys His Lys 165 170 175 Glu Lys Met Ser Lys Asp Gly Lys Lys Lys Lys Lys Lys Ser Lys Thr 180 185 190 Lys Cys Val Ile Met Pro Ala Pro Glu Lys Ser Ser Lys Val Ser Glu 195 200 205 Gln Leu Lys Cys Cys Ser Gly Ile Leu Lys Glu Met Phe Ala Lys Lys 210 215 220 His Ala Ala Tyr Ala Trp Pro Phe Tyr Lys Pro Val Asp Val Glu Ala 225 230 235 240 Leu Gly Leu His Asp Tyr Cys Asp Ile Ile Lys His Pro Met Asp Met 245 250 255 Ser Thr Ile Lys Ser Lys Leu Glu Ala Arg Glu Tyr Arg Asp Ala Gln 260 265 270 Glu Phe Gly Ala Asp Val Arg Leu Met Phe Ser Asn Cys Tyr Lys Tyr 275 280 285 Asn Pro Pro Asp His Glu Val Val Ala Met Ala Arg Lys Leu Gln Asp 290 295 300 Val Phe Glu Met Arg Phe Ala Lys Met Pro Asp Glu 305 310 315 <210> 12 <211> 542 <212> PRT <213> Artificial Sequence <220> <223> Flag-IDH1-BD2 <400> 12 Met Asp Tyr Lys Asp Asp Asp Asp Lys Met Ser Lys Lys Ile Ser Gly 1 5 10 15 Gly Ser Val Val Glu Met Gln Gly Asp Glu Met Thr Arg Ile Ile Trp 20 25 30 Glu Leu Ile Lys Glu Lys Leu Ile Phe Pro Tyr Val Glu Leu Asp Leu 35 40 45 His Ser Tyr Asp Leu Gly Ile Glu Asn Arg Asp Ala Thr Asn Asp Gln 50 55 60 Val Thr Lys Asp Ala Ala Glu Ala Ile Lys Lys His Asn Val Gly Val 65 70 75 80 Lys Cys Ala Thr Ile Thr Pro Asp Glu Lys Arg Val Glu Glu Phe Lys 85 90 95 Leu Lys Gln Met Trp Lys Ser Pro Asn Gly Thr Ile Arg Asn Ile Leu 100 105 110 Gly Gly Thr Val Phe Arg Glu Ala Ile Ile Cys Lys Asn Ile Pro Arg 115 120 125 Leu Val Ser Gly Trp Val Lys Pro Ile Ile Ile Gly Arg His Ala Tyr 130 135 140 Gly Asp Gln Tyr Arg Ala Thr Asp Phe Val Val Pro Gly Pro Gly Lys 145 150 155 160 Val Glu Ile Thr Tyr Thr Pro Ser Asp Gly Thr Gln Lys Val Thr Tyr 165 170 175 Leu Val His Asn Phe Glu Glu Gly Gly Gly Val Ala Met Gly Met Tyr 180 185 190 Asn Gln Asp Lys Ser Ile Glu Asp Phe Ala His Ser Ser Phe Gln Met 195 200 205 Ala Leu Ser Lys Gly Trp Pro Leu Tyr Leu Ser Thr Lys Asn Thr Ile 210 215 220 Leu Lys Lys Tyr Asp Gly Arg Phe Lys Asp Ile Phe Gln Glu Ile Tyr 225 230 235 240 Asp Lys Gln Tyr Lys Ser Gln Phe Glu Ala Gln Lys Ile Trp Tyr Glu 245 250 255 His Arg Leu Ile Asp Asp Met Val Ala Gln Ala Met Lys Ser Glu Gly 260 265 270 Gly Phe Ile Trp Ala Cys Lys Asn Tyr Asp Gly Asp Val Gln Ser Asp 275 280 285 Ser Val Ala Gln Gly Tyr Gly Ser Leu Gly Met Met Thr Ser Val Leu 290 295 300 Val Cys Pro Asp Gly Lys Thr Val Glu Ala Glu Ala Ala His Gly Thr 305 310 315 320 Val Thr Arg His Tyr Arg Met Tyr Gln Lys Gly Gln Glu Thr Ser Thr 325 330 335 Asn Pro Ile Ala Ser Ile Phe Ala Trp Thr Arg Gly Leu Ala His Arg 340 345 350 Ala Lys Leu Asp Asn Asn Lys Glu Leu Ala Phe Phe Ala Asn Ala Leu 355 360 365 Glu Glu Val Ser Ile Glu Thr Ile Glu Ala Gly Phe Met Thr Lys Asp 370 375 380 Leu Ala Ala Cys Ile Lys Gly Leu Pro Asn Val Gln Arg Ser Asp Tyr 385 390 395 400 Leu Asn Thr Phe Glu Phe Met Asp Lys Leu Gly Glu Asn Leu Lys Ile 405 410 415 Lys Leu Ala Gln Ala Lys Leu Pro Ala Pro Glu Lys Ser Ser Lys Val 420 425 430 Ser Glu Gln Leu Lys Cys Cys Ser Gly Ile Leu Lys Glu Met Phe Ala 435 440 445 Lys Lys His Ala Ala Tyr Ala Trp Pro Phe Tyr Lys Pro Val Asp Val 450 455 460 Glu Ala Leu Gly Leu His Asp Tyr Cys Asp Ile Ile Lys His Pro Met 465 470 475 480 Asp Met Ser Thr Ile Lys Ser Lys Leu Glu Ala Arg Glu Tyr Arg Asp 485 490 495 Ala Gln Glu Phe Gly Ala Asp Val Arg Leu Met Phe Ser Asn Cys Tyr 500 505 510 Lys Tyr Asn Pro Pro Asp His Glu Val Val Ala Met Ala Arg Lys Leu 515 520 525 Gln Asp Val Phe Glu Met Arg Phe Ala Lys Met Pro Asp Glu 530 535 540 <210> 13 <211> 1506 <212> DNA <213> Artificial Sequence <220> <223> FMC63-CD28-CD3zeta <400> 13 atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60 atcccagaca tccagatgac acagactaca tcctccctgt ctgcctctct gggagacaga 120 gtcaccatca gttgcagggc aagtcaggac attagtaaat atttaaattg gtatcagcag 180 aaaccagatg gaactgttaa actcctgatc taccatacat caagattaca ctcaggagtc 240 ccatcaaggt tcagtggcag tgggtctgga acagattatt ctctcaccat tagcaacctg 300 gagcaagaag atattgccac ttacttttgc caacagggta atacgcttcc gtacacgttc 360 ggagggggga ctaagttgga aataacaggc tccacctctg gatccggcaa gcccggatct 420 ggcgagggat ccaccaaggg cgaggtgaaa ctgcaggagt caggacctgg cctggtggcg 480 ccctcacaga gcctgtccgt cacatgcact gtctcagggg tctcattacc cgactatggt 540 gtaagctgga ttcgccagcc tccacgaaag ggtctggagt ggctgggagt aatatggggt 600 agtgaaacca catactataa ttcagctctc aaatccagac tgaccatcat caaggacaac 660 tccaagagcc aagttttctt aaaaatgaac agtctgcaaa ctgatgacac agccatttac 720 tactgtgcca aacattatta ctacggtggt agctatgcta tggactactg gggtcaagga 780 acctcagtca ccgtctcctc agcggccgca gttaacgccg ccacgcgtat tgaagttatg 840 tatcctcctc cttacctaga caatgagaag agcaatggaa ccattatcca tgtgaaaggg 900 aaacaccttt gtccaagtcc cctatttccc ggaccttcta agcccttttg ggtgctggtg 960 gtggttgggg gagtcctggc ttgctatagc ttgctagtaa cagtggcctt tattattttc 1020 tgggtgagga gtaagaggag caggctcctg cacagtgact acatgaacat gactccccgc 1080 cgccccgggc ccacccgcaa gcattaccag ccctatgccc caccacgcga cttcgcagcc 1140 tatcgctccc ctaggggcgg catgcataga gtgaagttca gcaggagcgc agacgccccc 1200 gcgtaccagc agggccagaa ccagctctat aacgagctca atctaggacg aagagaggag 1260 tacgatgttt tggacaagag acgtggccgg gaccctgaga tggggggaaa gccgagaagg 1320 aagaaccctc aggaaggcct gtacaatgaa ctgcagaaag ataagatggc ggaggcctac 1380 agtgagattg ggatgaaagg cgagcgccgg aggggcaagg ggcacgatgg cctttaccag 1440 ggtctcagta cagccaccaa ggacacctac gacgcccttc acatgcaggc cctgccccct 1500 cgctaa 1506 <210> 14 <211> 501 <212> PRT <213> Artificial Sequence <220> <223> FMC63-CD28-CD3zeta <400> 14 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser 20 25 30 Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser 35 40 45 Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly 50 55 60 Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val 65 70 75 80 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr 85 90 95 Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln 100 105 110 Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile 115 120 125 Thr Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser 130 135 140 Thr Lys Gly Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala 145 150 155 160 Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu 165 170 175 Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu 180 185 190 Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser 195 200 205 Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln 210 215 220 Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr 225 230 235 240 Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr 245 250 255 Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Ala Ala Val Asn 260 265 270 Ala Ala Thr Arg Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn 275 280 285 Glu Lys Ser Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys 290 295 300 Pro Ser Pro Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val 305 310 315 320 Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala 325 330 335 Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser 340 345 350 Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His 355 360 365 Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Pro 370 375 380 Arg Gly Gly Met His Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro 385 390 395 400 Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly 405 410 415 Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro 420 425 430 Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr 435 440 445 Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly 450 455 460 Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln 465 470 475 480 Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln 485 490 495 Ala Leu Pro Pro Arg 500 <210> 15 <211> 1857 <212> DNA <213> Artificial Sequence <220> <223> FMC63-CD28-BD2-CD3zeta <400> 15 atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60 atcccagaca tccagatgac acagactaca tcctccctgt ctgcctctct gggagacaga 120 gtcaccatca gttgcagggc aagtcaggac attagtaaat atttaaattg gtatcagcag 180 aaaccagatg gaactgttaa actcctgatc taccatacat caagattaca ctcaggagtc 240 ccatcaaggt tcagtggcag tgggtctgga acagattatt ctctcaccat tagcaacctg 300 gagcaagaag atattgccac ttacttttgc caacagggta atacgcttcc gtacacgttc 360 ggagggggga ctaagttgga aataacaggc tccacctctg gatccggcaa gcccggatct 420 ggcgagggat ccaccaaggg cgaggtgaaa ctgcaggagt caggacctgg cctggtggcg 480 ccctcacaga gcctgtccgt cacatgcact gtctcagggg tctcattacc cgactatggt 540 gtaagctgga ttcgccagcc tccacgaaag ggtctggagt ggctgggagt aatatggggt 600 agtgaaacca catactataa ttcagctctc aaatccagac tgaccatcat caaggacaac 660 tccaagagcc aagttttctt aaaaatgaac agtctgcaaa ctgatgacac agccatttac 720 tactgtgcca aacattatta ctacggtggt agctatgcta tggactactg gggtcaagga 780 acctcagtca ccgtctcctc agcggccgca gttaacgccg ccacgcgtat tgaagttatg 840 tatcctcctc cttacctaga caatgagaag agcaatggaa ccattatcca tgtgaaaggg 900 aaacaccttt gtccaagtcc cctatttccc ggaccttcta agcccttttg ggtgctggtg 960 gtggttgggg gagtcctggc ttgctatagc ttgctagtaa cagtggcctt tattattttc 1020 tgggtgagga gtaagaggag caggctcctg cacagtgact acatgaacat gactccccgc 1080 cgccccgggc ccacccgcaa gcattaccag ccctatgccc caccacgcga cttcgcagcc 1140 tatcgctccc ctaggccagc accagagaag agcagcaagg tctcggagca gctcaagtgc 1200 tgcagcggca tcctcaagga gatgtttgcc aagaagcacg ccgcctacgc ctggcccttc 1260 tacaagcctg tggacgtgga ggcactgggc ctacacgact actgtgacat catcaagcac 1320 cccatggaca tgagcacaat caagtctaaa ctggaggccc gtgagtaccg tgatgctcag 1380 gagtttggtg ctgacgtccg attgatgttc tccaactgct ataagtacaa ccctcctgac 1440 catgaggtgg tggccatggc ccgcaagctc caggatgtgt tcgaaatgcg ctttgccaag 1500 atgccggacg agatgcatag agtgaagttc agcaggagcg cagacgcccc cgcgtaccag 1560 cagggccaga accagctcta taacgagctc aatctaggac gaagagagga gtacgatgtt 1620 ttggacaaga gacgtggccg ggaccctgag atggggggaa agccgagaag gaagaaccct 1680 caggaaggcc tgtacaatga actgcagaaa gataagatgg cggaggccta cagtgagatt 1740 gggatgaaag gcgagcgccg gaggggcaag gggcacgatg gcctttacca gggtctcagt 1800 acagccacca aggacaccta cgacgccctt cacatgcagg ccctgccccc tcgctaa 1857 <210> 16 <211> 618 <212> PRT <213> Artificial Sequence <220> <223> FMC63-CD28-BD2-CD3zeta <400> 16 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser 20 25 30 Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser 35 40 45 Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly 50 55 60 Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val 65 70 75 80 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr 85 90 95 Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln 100 105 110 Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile 115 120 125 Thr Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser 130 135 140 Thr Lys Gly Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala 145 150 155 160 Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu 165 170 175 Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu 180 185 190 Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser 195 200 205 Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln 210 215 220 Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr 225 230 235 240 Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr 245 250 255 Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Ala Ala Val Asn 260 265 270 Ala Ala Thr Arg Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn 275 280 285 Glu Lys Ser Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys 290 295 300 Pro Ser Pro Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val 305 310 315 320 Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala 325 330 335 Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser 340 345 350 Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His 355 360 365 Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Pro 370 375 380 Arg Pro Ala Pro Glu Lys Ser Ser Lys Val Ser Glu Gln Leu Lys Cys 385 390 395 400 Cys Ser Gly Ile Leu Lys Glu Met Phe Ala Lys Lys His Ala Ala Tyr 405 410 415 Ala Trp Pro Phe Tyr Lys Pro Val Asp Val Glu Ala Leu Gly Leu His 420 425 430 Asp Tyr Cys Asp Ile Ile Lys His Pro Met Asp Met Ser Thr Ile Lys 435 440 445 Ser Lys Leu Glu Ala Arg Glu Tyr Arg Asp Ala Gln Glu Phe Gly Ala 450 455 460 Asp Val Arg Leu Met Phe Ser Asn Cys Tyr Lys Tyr Asn Pro Pro Asp 465 470 475 480 His Glu Val Val Ala Met Ala Arg Lys Leu Gln Asp Val Phe Glu Met 485 490 495 Arg Phe Ala Lys Met Pro Asp Glu Met His Arg Val Lys Phe Ser Arg 500 505 510 Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn 515 520 525 Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg 530 535 540 Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro 545 550 555 560 Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala 565 570 575 Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His 580 585 590 Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp 595 600 605 Ala Leu His Met Gln Ala Leu Pro Pro Arg 610 615 <210> 17 <211> 1872 <212> DNA <213> Artificial Sequence <220> <223> FMC63-BD1-CD28-CD3zeta <400> 17 atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60 atcccagaca tccagatgac acagactaca tcctccctgt ctgcctctct gggagacaga 120 gtcaccatca gttgcagggc aagtcaggac attagtaaat atttaaattg gtatcagcag 180 aaaccagatg gaactgttaa actcctgatc taccatacat caagattaca ctcaggagtc 240 ccatcaaggt tcagtggcag tgggtctgga acagattatt ctctcaccat tagcaacctg 300 gagcaagaag atattgccac ttacttttgc caacagggta atacgcttcc gtacacgttc 360 ggagggggga ctaagttgga aataacaggc tccacctctg gatccggcaa gcccggatct 420 ggcgagggat ccaccaaggg cgaggtgaaa ctgcaggagt caggacctgg cctggtggcg 480 ccctcacaga gcctgtccgt cacatgcact gtctcagggg tctcattacc cgactatggt 540 gtaagctgga ttcgccagcc tccacgaaag ggtctggagt ggctgggagt aatatggggt 600 agtgaaacca catactataa ttcagctctc aaatccagac tgaccatcat caaggacaac 660 tccaagagcc aagttttctt aaaaatgaac agtctgcaaa ctgatgacac agccatttac 720 tactgtgcca aacattatta ctacggtggt agctatgcta tggactactg gggtcaagga 780 acctcagtca ccgtctcctc agcggccgca gttaaccccc cagagacctc caaccctaac 840 aagcccaaga ggcagaccaa ccaactgcaa tacctgctca gagtggtgct caagacacta 900 tggaaacacc agtttgcatg gcctttccag cagcctgtgg atgccgtcaa gctgaacctc 960 cctgattact ataagatcat taaaacgcct atggatatgg gaacaataaa gaagcgcttg 1020 gaaaacaact attactggaa tgctcaggaa tgtatccagg acttcaacac tatgtttaca 1080 aattgttaca tctacaacaa gcctggagat gacatagtct taatggcaga agctctggaa 1140 aagctcttct tgcaaaaaat aaatgagcta cccacagaag aaaccgagac gcgtattgaa 1200 gttatgtatc ctcctcctta cctagacaat gagaagagca atggaaccat tatccatgtg 1260 aaagggaaac acctttgtcc aagtccccta tttcccggac cttctaagcc cttttgggtg 1320 ctggtggtgg ttgggggagt cctggcttgc tatagcttgc tagtaacagt ggcctttatt 1380 attttctggg tgaggagtaa gaggagcagg ctcctgcaca gtgactacat gaacatgact 1440 ccccgccgcc ccgggcccac ccgcaagcat taccagccct atgccccacc acgcgacttc 1500 gcagcctatc gctcccctag gggcggcatg catagagtga agttcagcag gagcgcagac 1560 gcccccgcgt accagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 1620 gaggagtacg atgttttgga caagagacgt ggccgggacc ctgagatggg gggaaagccg 1680 agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 1740 gcctacagtg agattgggat gaaaggcgag cgccggaggg gcaaggggca cgatggcctt 1800 taccagggtc tcagtacagc caccaaggac acctacgacg cccttcacat gcaggccctg 1860 ccccctcgct aa 1872 <210> 18 <211> 623 <212> PRT <213> Artificial Sequence <220> <223> FMC63-BD1-CD28-CD3zeta <400> 18 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser 20 25 30 Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser 35 40 45 Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly 50 55 60 Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val 65 70 75 80 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr 85 90 95 Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln 100 105 110 Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile 115 120 125 Thr Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser 130 135 140 Thr Lys Gly Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala 145 150 155 160 Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu 165 170 175 Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu 180 185 190 Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser 195 200 205 Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln 210 215 220 Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr 225 230 235 240 Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr 245 250 255 Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Ala Ala Val Asn 260 265 270 Pro Pro Glu Thr Ser Asn Pro Asn Lys Pro Lys Arg Gln Thr Asn Gln 275 280 285 Leu Gln Tyr Leu Leu Arg Val Val Leu Lys Thr Leu Trp Lys His Gln 290 295 300 Phe Ala Trp Pro Phe Gln Gln Pro Val Asp Ala Val Lys Leu Asn Leu 305 310 315 320 Pro Asp Tyr Tyr Lys Ile Ile Lys Thr Pro Met Asp Met Gly Thr Ile 325 330 335 Lys Lys Arg Leu Glu Asn Asn Tyr Tyr Trp Asn Ala Gln Glu Cys Ile 340 345 350 Gln Asp Phe Asn Thr Met Phe Thr Asn Cys Tyr Ile Tyr Asn Lys Pro 355 360 365 Gly Asp Asp Ile Val Leu Met Ala Glu Ala Leu Glu Lys Leu Phe Leu 370 375 380 Gln Lys Ile Asn Glu Leu Pro Thr Glu Glu Thr Glu Thr Arg Ile Glu 385 390 395 400 Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser Asn Gly Thr 405 410 415 Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro Leu Phe Pro 420 425 430 Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly Gly Val Leu 435 440 445 Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val 450 455 460 Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr 465 470 475 480 Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro 485 490 495 Pro Arg Asp Phe Ala Ala Tyr Arg Ser Pro Arg Gly Gly Met His Arg 500 505 510 Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln 515 520 525 Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp 530 535 540 Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro 545 550 555 560 Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp 565 570 575 Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg 580 585 590 Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr 595 600 605 Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 610 615 620 <210> 19 <211> 276 <212> PRT <213> Artificial Sequence <220> <223> FMC63 <400> 19 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser 20 25 30 Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser 35 40 45 Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly 50 55 60 Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val 65 70 75 80 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr 85 90 95 Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln 100 105 110 Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile 115 120 125 Thr Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser 130 135 140 Thr Lys Gly Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala 145 150 155 160 Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu 165 170 175 Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu 180 185 190 Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser 195 200 205 Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln 210 215 220 Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr 225 230 235 240 Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr 245 250 255 Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Ala Ala Val Asn 260 265 270 Ala Ala Thr Arg 275 <210> 20 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> CD28 <400> 20 Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser Asn 1 5 10 15 Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro Leu 20 25 30 Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly Gly 35 40 45 Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe 50 55 60 Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn 65 70 75 80 Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr 85 90 95 Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser 100 105 <210> 21 <211> 112 <212> PRT <213> Artificial Sequence <220> <223> CD3zeta <400> 21 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly 1 5 10 15 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys 50 55 60 Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg 65 70 75 80 Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala 85 90 95 Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 100 105 110 <210> 22 <211> 126 <212> PRT <213> Artificial Sequence <220> <223> BD1 <400> 22 Pro Pro Glu Thr Ser Asn Pro Asn Lys Pro Lys Arg Gln Thr Asn Gln 1 5 10 15 Leu Gln Tyr Leu Leu Arg Val Val Leu Lys Thr Leu Trp Lys His Gln 20 25 30 Phe Ala Trp Pro Phe Gln Gln Pro Val Asp Ala Val Lys Leu Asn Leu 35 40 45 Pro Asp Tyr Tyr Lys Ile Ile Lys Thr Pro Met Asp Met Gly Thr Ile 50 55 60 Lys Lys Arg Leu Glu Asn Asn Tyr Tyr Trp Asn Ala Gln Glu Cys Ile 65 70 75 80 Gln Asp Phe Asn Thr Met Phe Thr Asn Cys Tyr Ile Tyr Asn Lys Pro 85 90 95 Gly Asp Asp Ile Val Leu Met Ala Glu Ala Leu Glu Lys Leu Phe Leu 100 105 110 Gln Lys Ile Asn Glu Leu Pro Thr Glu Glu Thr Glu Thr Arg 115 120 125 <210> 23 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> BD2 <400> 23 Pro Ala Pro Glu Lys Ser Ser Lys Val Ser Glu Gln Leu Lys Cys Cys 1 5 10 15 Ser Gly Ile Leu Lys Glu Met Phe Ala Lys Lys His Ala Ala Tyr Ala 20 25 30 Trp Pro Phe Tyr Lys Pro Val Asp Val Glu Ala Leu Gly Leu His Asp 35 40 45 Tyr Cys Asp Ile Ile Lys His Pro Met Asp Met Ser Thr Ile Lys Ser 50 55 60 Lys Leu Glu Ala Arg Glu Tyr Arg Asp Ala Gln Glu Phe Gly Ala Asp 65 70 75 80 Val Arg Leu Met Phe Ser Asn Cys Tyr Lys Tyr Asn Pro Pro Asp His 85 90 95 Glu Val Val Ala Met Ala Arg Lys Leu Gln Asp Val Phe Glu Met Arg 100 105 110 Phe Ala Lys Met Pro Asp Glu 115 <210> 24 <211> 828 <212> DNA <213> Artificial Sequence <220> <223> FMC63 <400> 24 atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60 atcccagaca tccagatgac acagactaca tcctccctgt ctgcctctct gggagacaga 120 gtcaccatca gttgcagggc aagtcaggac attagtaaat atttaaattg gtatcagcag 180 aaaccagatg gaactgttaa actcctgatc taccatacat caagattaca ctcaggagtc 240 ccatcaaggt tcagtggcag tgggtctgga acagattatt ctctcaccat tagcaacctg 300 gagcaagaag atattgccac ttacttttgc caacagggta atacgcttcc gtacacgttc 360 ggagggggga ctaagttgga aataacaggc tccacctctg gatccggcaa gcccggatct 420 ggcgagggat ccaccaaggg cgaggtgaaa ctgcaggagt caggacctgg cctggtggcg 480 ccctcacaga gcctgtccgt cacatgcact gtctcagggg tctcattacc cgactatggt 540 gtaagctgga ttcgccagcc tccacgaaag ggtctggagt ggctgggagt aatatggggt 600 agtgaaacca catactataa ttcagctctc aaatccagac tgaccatcat caaggacaac 660 tccaagagcc aagttttctt aaaaatgaac agtctgcaaa ctgatgacac agccatttac 720 tactgtgcca aacattatta ctacggtggt agctatgcta tggactactg gggtcaagga 780 acctcagtca ccgtctcctc agcggccgca gttaacgccg ccacgcgt 828 <210> 25 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> CD28 <400> 25 attgaagtta tgtatcctcc tccttaccta gacaatgaga agagcaatgg aaccattatc 60 catgtgaaag ggaaacacct ttgtccaagt cccctatttc ccggaccttc taagcccttt 120 tgggtgctgg tggtggttgg gggagtcctg gcttgctata gcttgctagt aacagtggcc 180 tttattattt tctgggtgag gagtaagagg agcaggctcc tgcacagtga ctacatgaac 240 atgactcccc gccgccccgg gcccacccgc aagcattacc agccctatgc cccaccacgc 300 gacttcgcag cctatcgctc c 321 <210> 26 <211> 339 <212> DNA <213> Artificial Sequence <220> <223> CD3zeta <400> 26 agagtgaagt tcagcaggag cgcagacgcc cccgcgtacc agcagggcca gaaccagctc 60 tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120 cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180 gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 240 cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 300 tacgacgccc ttcacatgca ggccctgccc cctcgctaa 339 <210> 27 <211> 378 <212> DNA <213> Artificial Sequence <220> <223> BD1 <400> 27 cccccagaga cctccaaccc taacaagccc aagaggcaga ccaaccaact gcaatacctg 60 ctcagagtgg tgctcaagac actatggaaa caccagtttg catggccttt ccagcagcct 120 gtggatgccg tcaagctgaa cctccctgat tactataaga tcattaaaac gcctatggat 180 atgggaacaa taaagaagcg cttggaaaac aactattact ggaatgctca ggaatgtatc 240 caggacttca acactatgtt tacaaattgt tacatctaca acaagcctgg agatgacata 300 gtcttaatgg cagaagctct ggaaaagctc ttcttgcaaa aaataaatga gctacccaca 360 gaagaaaccg agacgcgt 378 <210> 28 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> BD2 <400> 28 gcaccagaga agagcagcaa ggtctcggag cagctcaagt gctgcagcgg catcctcaag 60 gagatgtttg ccaagaagca cgccgcctac gcctggccct tctacaagcc tgtggacgtg 120 gaggcactgg gcctacacga ctactgtgac atcatcaagc accccatgga catgagcaca 180 atcaagtcta aactggaggc ccgtgagtac cgtgatgctc aggagtttgg tgctgacgtc 240 cgattgatgt tctccaactg ctataagtac aaccctcctg accatgaggt ggtggccatg 300 gcccgcaagc tccaggatgt gttcgaaatg cgctttgcca agatgccgga cgagtaa 357

Claims (12)

Chimeric antigen receptor polypeptide (chimera antigen) including an extracellular binding region (ecodomain), a transmembrane domain, a protein degraded by a proteolysis targeting chimera (PROTAC), and an intracellular signaling region (endodomain). receptor polypeptide).
The chimeric antigen receptor polypeptide according to claim 1, wherein the protein degraded by the proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC) is BD1 (bromodomain 1) or BD2 (bromodomain 2).
The chimeric antigen receptor of claim 1, wherein the protein degraded by the proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC) is degraded by ARV-771 or ARV-825 proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC). Polypeptide (chimera antigen receptor polypeptide).
The method of claim 1, wherein the transmembrane region is selected from the group consisting of CD3ε, CD4, CD5, CD8, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137 and CD154. Chimeric antigen receptor polypeptide comprising a transmembrane region of a protein.
The chimeric antigen receptor polypeptide according to claim 1, wherein the intracellular signal region comprises an intracellular signal region of a protein selected from the group consisting of CD3ζ, FcεRIγ, CD28, CD137, and CD134.
The gene encoding the chimeric antigen receptor polypeptide of any one of claims 1 to 5.
A vector comprising the gene of claim 6.
Cells transformed with the vector of claim 7.
The cell of claim 8, wherein the cell is a T cell or a natural killer T cell.
A method of reducing the side effects of CAR T cell therapy in an individual by administering a proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC) to an individual administered with the cells of claim 8 or 9
The method of claim 10, wherein the side effect of the CAR T cell therapy is any one selected from the group consisting of cytokine release syndrome (CRS), B cell aplasia, and neurotoxicity. Phosphorus, a method of reducing the side effects of CAR T cell therapeutics.
The method of claim 10, wherein the proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC) is an ARV-771 or ARV-825 proteolysis inducing agent (Proteolysis Targeting Chimera, PROTAC).

Images