KR20210052042A - Mutant type IDH inhibitors, preparation method thereof, and pharmaceutical composition containg the same as an active ingredient - Google Patents

Abstract

The present invention relates to a mutant-type IDH1 inhibitor, a method for manufacturing the same, and a pharmaceutical composition containing the same as an active component. A compound represented by chemical formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof according to the present invention has excellent inhibitory activity on mutant-type IDH1, and thus can reduce the level of intracellular tumor-inducing metabolites (2-HG). Therefore, the present invention has a useful effect of providing a pharmaceutical composition containing the compound for preventing or treating mutant-type IDH1-related diseases, such as cancer, and a health functional food composition for preventing or alleviating mutant-type IDH1-related diseases, such as cancer.

Description

Mutant type IDH inhibitors, preparation method thereof, and pharmaceutical composition containg the same as an active ingredient}

The present invention relates to a mutant IDH inhibitor, a method for preparing the same, and a pharmaceutical composition containing the same as an active ingredient.

Isocitrate dehydrogenase (IDH) is a major family of enzymes found in cellular metabolism. ^{These are NADP+} /NAD ⁺ and metal dependent oxidoreductases of the enzyme class EC 1. 1. 1. 42. The wild-type protein catalyzes the oxidative decarboxylation of isocitrate to alpha-ketoglutarate, which in the process produces carbon dioxide and NADPH/NADH. They are also known to convert oxalosuccinate to alpha-ketoglutarate. Mutations in IDH1 (cytoplasm) and IDH2 (mitochondria) include glioma, glioblastoma polymorphic, adrenal ganglionoma, primitive neuroectodermal tumor, acute myelogenous leukemia (AML), prostate cancer, thyroid cancer, colon cancer, chondrosarcoma, cholangiocarcinoma, It has been identified in a number of cancer types including, but not limited to, peripheral T-cell lymphoma and melanoma. (L. Dang et al., Trends Mol. Med., 2010, 16, 387; T. Shibata et al., Am. J. Pathol., 2011, 178(3), 1395; Gaal et al., J. Clin. Endocrinol. Metab. 2010; Hayden et al., Cell Cycle, 2009; Balss et al., Acta Neuropathol., 2008). Mutations were found at or near key residues in the active site: G97D, R100, R132, H133Q and A134D for IDH1, and R140 and R172 for IDH2. (See L. Dang et al., Nature, 2009, 462, 739; L. Sellner et al., Eur. J. Haematol., 2011, 85, 457).

This mutant form of IDH has been shown to have neomorph activity (also known as function acquisition activity) reducing alpha-ketoglutarate to 2-hydroxyglutarate (2-HG). (See P. S. Ward et al., Cancer Cell, 2010, 17, 225). In general, the production of 2-HG is enantiomeric specific, thus leading to the production of the D-enantiomer (also known as the R enantiomer or R-2-HG). Normal cells have low native levels of 2-HG, whereas cells bearing this mutation in IDH1 or IDH2 show significantly elevated levels of 2-HG. High levels of 2-HG were detected in the mutation bearing tumors. For example, high levels of 2-HG were detected in the plasma of patients with mutant IDH containing AML. (See S. Gross et al., J. Exp. Med., 2010, 207(2), 339). High levels of 2-HG are highly associated with oncogenesis.

The mutant IDH2 is also associated with a rare neurometabolic disorder type II D-2-hydroxyglutarsanuria (type II D-2-HGA). A germline mutation was found in R140 in IDH2 in 15 patients with type II D-2-HGA. In addition, patients with this disorder had consistently increased levels of D-2-HG in their urine, plasma and cerebrospinal fluid. (See [Kranendijk, M. et al., Science, 2010, 330, 336]). Finally, patients with Oliere's disease and Mapucci syndrome (two rare disorders prone to chondrogenic tumors) were shown to be somatic mosaic for the IDH1 and 2 mutations, and to show high levels of D-2-HG. (See Amary et al., Nature Genetics, 2011 and Pansuriya et al., Nature Genetics, 2011).

Thus, there is a need for inhibitors of mutant IDH for the treatment of diseases and disorders associated with IDH.

It is an object of the present invention to provide a mutant IDH inhibitor.

Another object of the present invention is to provide a method for preparing the mutant IDH inhibitor.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating mutant IDH-related diseases.

Another object of the present invention is to provide a functional food composition for preventing or improving mutant IDH-related diseases.

To achieve the above object,

The present invention provides a compound represented by the following Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:

[Formula 1]

In Formula 1,

Any one of R ¹ and R ³ is -H, C _1-5 straight or branched chain alkyl, -SH, -SC _1-3 straight or branched chain alkyl, -SO ₂ or -SO ₂ -C _1-3 Of straight or branched chain alkyl, and the other is unsubstituted or substituted phenyl,

Here, the substituted phenyl is substituted or unsubstituted C _1-5 linear or branched alkyl, substituted or unsubstituted C _1-5 linear or branched alkoxy, hydroxy, amino, nitro, cyano, halo Is substituted with 1 to 5 substituents independently selected from the group consisting of lozen, C _6-10 aryl and C _6-10 aryloxy, wherein the substituted alkyl or substituted alkoxy is substituted with one or more halogens,

When the substituted phenyl has two or more alkoxy as a substituent, the two or more alkoxy may be optionally linked to each other to form one or more cyclic substituents;

R ² is substituted or unsubstituted phenyl, substituted or unsubstituted dibenzofuran, or a 5 to 6 membered substituted or unsubstituted hetero atom including at least one hetero atom selected from the group consisting of N, O and S Aryl,

Wherein the substituted phenyl, substituted dibenzofuran and substituted heteroaryl are each -CHO, -COOH, -C(O)-C _1-5 linear or branched alkyl, -COO-C _1-5 linear or branched Consisting of chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, cyano, and halogen Substituted with one or more substituents selected from the group, wherein the substituted alkyl or substituted alkoxy is substituted with one or more halogens; And

R ⁴ is substituted or unsubstituted phenyl, or substituted or unsubstituted phenyl-C _1-3 alkyl,

Wherein the substituted phenyl and substituted phenyl-C _1-3 alkyl are each substituted or unsubstituted C _1-5 linear or branched alkyl, substituted or unsubstituted C _1-5 linear or branched alkoxy, hydride It is substituted with one or more substituents selected from the group consisting of oxy, amino, nitro, cyano, and halogen, and the substituted alkyl or substituted alkoxy is substituted with one or more halogens.

In addition, the present invention, as shown in the following Scheme 1,

Reacting a compound represented by Formula 2 with a compound represented by R ⁴ -NH-NH ₂ to obtain a compound represented by Formula 1'; And

It provides a method for preparing a compound represented by Formula 1, comprising: obtaining a compound represented by Formula 1 from the compound represented by Formula 1'obtained in the above step:

[Scheme 1]

In Scheme 1 above,

R ¹ , R ² , R ³ and R ⁴ are as defined in Formula 1; And

^{R 1 ', R 2',} R 3 ' and R ^4' is one of each of said R ^1, R ^2, R ³ and R ⁴ the same or ^{R 1 ', R 2',} R 3 ' and R ^4' The above may be independently defined differently ^{from the R 1} , R ² , R ³ and R ^4,

Here, the ^"case where R ¹ and the other, R ^{1 'wherein} R ¹ is a straight or branched chain alkyl -SH or -SC _1-3 R ¹ is a straight chain of -SO ₂ or -SO ₂ -C _1-3 or Branched chain alkyl,

^"If the R ³ and the other, R ^{3 'wherein} R ³ is -SH or -SC _1-3 straight or branched chain alkyl and R ³ is -SO ₂ or -SO ₂ -C _1-3 straight or branched chain Alkyl,

^"When the R ² and the other, R ^{2 'wherein} R ² is -Br, and R ² are as defined in formula (I),

^"When the R ⁴ and the other, R ^{4 'wherein} R ⁴ is -H, and R ⁴ are as defined in formula (I).

Furthermore, the present invention provides a pharmaceutical composition for preventing or treating mutant IDH-related diseases containing the compound represented by Formula 1, its stereoisomer, or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a health functional food composition for preventing or improving mutant IDH-related diseases containing the compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient.

Furthermore, the present invention provides a method for preventing or treating mutant IDH-related diseases comprising administering to a subject the compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

In addition, the present invention provides a use of a compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof, in the manufacture of a drug for preventing or treating mutant IDH-related diseases.

The compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof according to the present invention not only has excellent inhibitory activity against mutant IDH, but also increases the level of intracellular tumor-causing metabolite (2-HG). As can be reduced, there is a useful effect that a pharmaceutical composition for preventing or treating mutant IDH-related diseases, for example, cancer, and a health functional food composition for preventing or improving containing it as an active ingredient can be provided.

1A shows the enzyme mechanism of wild-type IDH1, and FIG. 1B shows the enzyme mechanism of mutant IDH1.
2A shows the expression of IDH1 in mock U-87 MG and IDH1 R132H U-87 MG cell lines, and FIG. 2B shows the intracellular 2-HG concentration of mock U-87 MG and IDH1 R132H U-87 MG cells. .
Figure 3 shows the SDS-PAGE of the purified recombinant IDH1 R132H protein.

Hereinafter, the present invention will be described in detail.

The present invention provides a compound represented by the following Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:

[Formula 1]

In Formula 1,

Any one of R ¹ and R ³ is -H, C _1-5 straight or branched chain alkyl, -SH, -SC _1-3 straight or branched chain alkyl, -SO ₂ or -SO ₂ -C _1-3 Of straight or branched chain alkyl, and the other is unsubstituted or substituted phenyl,

Here, the substituted phenyl is substituted or unsubstituted C _1-5 linear or branched alkyl, substituted or unsubstituted C _1-5 linear or branched alkoxy, hydroxy, amino, nitro, cyano, halo Is substituted with 1 to 5 substituents independently selected from the group consisting of lozen, C _6-10 aryl and C _6-10 aryloxy, wherein the substituted alkyl or substituted alkoxy is substituted with one or more halogens,

When the substituted phenyl has two or more alkoxy as a substituent, the two or more alkoxy may be optionally linked to each other to form one or more cyclic substituents;

R ² is substituted or unsubstituted phenyl, substituted or unsubstituted dibenzofuran, or a 5 to 6 membered substituted or unsubstituted hetero atom including at least one hetero atom selected from the group consisting of N, O and S Aryl,

Wherein the substituted phenyl, substituted dibenzofuran and substituted heteroaryl are each -CHO, -COOH, -C(O)-C _1-5 linear or branched alkyl, -COO-C _1-5 linear or branched Consisting of chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, cyano, and halogen Substituted with one or more substituents selected from the group, wherein the substituted alkyl or substituted alkoxy is substituted with one or more halogens; And

R ⁴ is substituted or unsubstituted phenyl, or substituted or unsubstituted phenyl-C _1-3 alkyl,

Wherein the substituted phenyl and substituted phenyl-C _1-3 alkyl are each substituted or unsubstituted C _1-5 linear or branched alkyl, substituted or unsubstituted C _1-5 linear or branched alkoxy, hydride It is substituted with one or more substituents selected from the group consisting of oxy, amino, nitro, cyano, and halogen, and the substituted alkyl or substituted alkoxy is substituted with one or more halogens.

In another aspect of the present invention,

The compound represented by Formula 1,

Any one of R ¹ and R ³ is -SH, -SC _1-3 linear or branched alkyl, -SO ₂ or -SO ₂ -C _1-3 linear or branched alkyl, and the other is unsubstituted Or substituted phenyl,

Here, the substituted phenyl is substituted or unsubstituted C _1-5 linear or branched alkyl, substituted or unsubstituted C _1-5 linear or branched alkoxy, hydroxy, amino, nitro, cyano, halo Is substituted with 1 to 5 substituents independently selected from the group consisting of lozen, phenyl and phenyloxy, the substituted alkyl or substituted alkoxy is substituted with one or more halogens,

When the substituted phenyl has two or more alkoxy as a substituent, the two or more alkoxy may be optionally linked to each other to form a single ring-type substituent.

In another aspect of the present invention,

The compound represented by Formula 1,

R ² is substituted or unsubstituted phenyl, unsubstituted dibenzofuran, or a 5-membered substituted or unsubstituted heteroaryl containing at least one hetero atom selected from the group consisting of N and O,

Wherein the substituted phenyl and substituted heteroaryl are each -CHO, -COOH, -C(O)-C _1-5 straight or branched chain alkyl, -COO-C _1-5 straight or branched chain alkyl, substituted or unsubstituted At least one selected from the group consisting of cyclic C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, cyano, and halogen Substituted with a substituent, the substituted alkyl or substituted alkoxy is substituted with one or more halogens; And

Wherein R ⁴ is substituted or unsubstituted phenyl, or substituted or unsubstituted benzyl,

Wherein the substituted phenyl and substituted benzyl are each substituted or unsubstituted C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, It is substituted with one or more substituents selected from the group consisting of cyano and halogen, and the substituted alkyl or substituted alkoxy is substituted with one or more halogens.

In another aspect of the present invention,

The compound represented by Formula 1,

Any one of R ¹ and R ³ is -SH, -S-CH ₃ , -SO ₂ or -SO ₂ -CH ₃ , and the other is unsubstituted or substituted phenyl,

Here, the substituted phenyl is substituted or unsubstituted C _1-5 linear or branched alkyl, substituted or unsubstituted C _1-5 linear or branched alkoxy, hydroxy, amino, nitro, cyano, halo Is substituted with 1 to 3 substituents independently selected from the group consisting of lozen, phenyl and phenyloxy, and the substituted alkyl or substituted alkoxy is substituted with one or more halogens,

When the substituted phenyl has two or more alkoxy as a substituent, the two or more alkoxy may be optionally linked to each other to form a substituent in the form of one ring;

,

,

, 또는

이고,R ² is substituted or unsubstituted phenyl, unsubstituted dibenzofuran,

,

,

, or

ego,

Wherein the substituted phenyl is each -CHO, -COOH, -C(O)-C _1-5 straight or branched chain alkyl, -COO-C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _{1- 5} straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, cyano, and substituted with one or more substituents selected from the group consisting of halogen, The substituted alkyl or substituted alkoxy is substituted with one or more halogens; And

Wherein R ⁴ is substituted or unsubstituted phenyl, or substituted or unsubstituted benzyl,

Wherein the substituted phenyl and substituted benzyl are each substituted or unsubstituted C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, It is substituted with one or more substituents selected from the group consisting of cyano and halogen, and the substituted alkyl or substituted alkoxy is substituted with one or more halogens.

In one embodiment of the present invention, preferred examples of the compound represented by Formula 1 include the following compounds:

(1) 5-(3,4-dichlorophenyl)-1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(2) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-p-tolyl-1H-pyrazole;

(3) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-nitrophenyl)-1H-pyrazole;

(4) 1-(3,5-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(5) 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(6) 5-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(7) 5-(4-chlorophenyl)-1-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(8) 1,5-bis(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(9) 1-(4-isopropylphenyl)-5-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(10) 5-(2,4-difluorophenyl)-1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyra Sol;

(11) 4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-5-(4-nitrophenyl)-1H-pyrazole;

(12) 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-nitrophenyl)-1-p-tolyl-1H-pyrazole;

(13) 1-(4-isopropyl-2-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-nitrophenyl)-1H-pyra Sol;

(14) 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-nitrophenyl)-1-o-tolyl-1H-pyrazole;

(15) 5-(biphenyl-4-yl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-(trifluoromethyl)phenyl)-1H- Pyrazole;

(16) 5-(biphenyl-4-yl)-1-(3,5-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(17) 1-(2,4-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-phenyl-1H-pyrazole;

(18) 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole;

(19) 1-(2-ethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole;

(20) 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1-(4-nitrophenyl)-1H-pyrazole;

(21) 1-(2,4-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole;

(22) 1-(2-chlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole;

(23) 1-(4-isopropyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole;

(24) 5-(2,5-dimethoxyphenyl)-1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(25) 5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-(trifluoromethyl)phenyl)-1H -Pyrazole;

(26) 5-(2,5-dimethoxyphenyl)-1-(2-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(27) 1-(3,4-dichlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole ;

(28) 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(29) 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(30) 1-(3-chloro-4-methylphenyl)-5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(31) 5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-m-tolyl-1H-pyrazole;

(32) 1-(2,4-dimethylphenyl)-5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(33) 1-(4-isopropylphenyl)-5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(34) 1-(2-ethylphenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(35) 4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-5-(4-phenoxyphenyl)-1H-pyrazole;

(36) 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-phenoxyphenyl)-1H-pyrazole;

(37) 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-phenoxyphenyl)-1H-pyrazole;

(38) 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-phenoxyphenyl)-1-p-tolyl-1H-pyrazole;

(39) 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(2,3,4-trichlorophenyl)-1H-pyra Sol;

(40) 1-(3-chloro-4-methylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(2,3,4-trichlorophenyl)-1H -Pyrazole;

(41) 4-(1H-imidazol-1-yl)-3-(methylthio)-1-p-tolyl-5-(2,3,4-trichlorophenyl)-1H-pyrazole;

(42) 4-(1H-imidazol-1-yl)-1-(4-isopropylphenyl)-3-(methylthio)-5-(2,3,4-trichlorophenyl)-1H-pyra Sol;

(43) 4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-nitrophenyl)-5-(2,3,4-trichlorophenyl)-1H-pyrazole ;

(44) 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(45) 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(46) 5-(4-chlorophenyl)-1-(2-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylsulfonyl)-1H-pyrazole;

(47) 1,5-bis(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylsulfonyl)-1H-pyrazole;

(48) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylsulfonyl)-1H-pyrazole;

(49) 5-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1 -o-tolyl-1H-pyrazole;

(50) 1-(3,4-dichlorophenyl)-5-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)-4-(1H-imidazole-1- Yl)-3-(methylthio)-1H-pyrazole;

(51) 1-(3,5-dichlorophenyl)-5-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)-4-(1H-imidazole-1- Yl)-3-(methylthio)-1H-pyrazole;

(52) 5-(methylthio)-1,3,4-triphenyl-1H-pyrazole;

(53) 4-(4-methoxyphenyl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole;

(54) 3-(5-(methylthio)-1,3-diphenyl-1H-pyrazol-4-yl)benzonitrile;

(55) 1-(4-(5-(methylthio)-1,3-diphenyl-1H-pyrazol-4-yl)phenyl)ethanone;

(56) tert-butyl 3-(5-(methylthio)-1,3-diphenyl-1H-pyrazol-4-yl)benzoate;

(57) 4-(dibenzofuran-4-yl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole;

(58) 4-(furan-2-yl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole;

(59) 4-(3-fluorophenyl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole;

(60) 5-(methylthio)-1,3-diphenyl-4,4'-bi(1H-pyrazole);

(61) 5-(methylthio)-1,4-diphenyl-3-p-tolyl-1H-pyrazole;

(62) 3-(5-(methylthio)-1-phenyl-3-p-tolyl-1H-pyrazol-4-yl)benzonitrile;

(63) 4-(4-methoxyphenyl)-5-(methylthio)-1-phenyl-3-p-tolyl-1H-pyrazole;

(64) 4-(4-methoxyphenyl)-5-(methylsulfonyl)-1,3-diphenyl-1H-pyrazole;

(65) 5-(methylsulfonyl)-1,3,4-triphenyl-1H-pyrazole;

(66) tert-butyl 3-(5-(methylsulfonyl)-1,3-diphenyl-1H-pyrazol-4-yl)benzoate;

(67) 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1-phenyl-1H-pyrazole;

(68) 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(69) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-phenyl-1H-pyrazole;

(70) 5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-phenyl-1H-pyrazole;

(71) 4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1-phenyl-1H-pyrazole;

(72) 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(73) 1-(2,6-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylsulfonyl)-1H-pyrazole;

(74) 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylsulfonyl)-1H-pyrazole;

(75) 1-Benzyl-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(76) 1-Benzyl-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(77) 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-1-(4-methylbenzyl)-3-(methylthio)-1H-pyrazole;

(78) 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1-(4-nitrobenzyl)-1H-pyrazole;

(79) 1-(4-bromobenzyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(80) 4-(1H-imidazol-1-yl)-1-(4-methoxybenzyl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(81) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methylbenzyl)-3-(methylthio)-1H-pyrazole;

(82) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methoxybenzyl)-3-(methylthio)-1H-pyrazole;

(83) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-nitrobenzyl)-1H-pyrazole;

(84) 1-(4-bromobenzyl)-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(85) 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-1-(4-methylbenzyl)-3-(methylsulfonyl)-1H-pyrazole;

(86) 1-(4-bromobenzyl)-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylsulfonyl)-1H-pyrazole;

(87) 1-(1-(2-ethylphenyl)-3-(methylthio)-5-phenyl-1H-pyrazol-4-yl)-1H-1,2,4-triazole;

(88) 1-(1-(4-chlorophenyl)-3-(methylthio)-5-phenyl-1H-pyrazol-4-yl)-1H-1,2,4-triazole;

(89) 1-(2-chlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(90) 1-(2,6-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(91) 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1-(o-tolyl)-1H-pyrazole;

(92) 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1H-pyrazole;

(93) 4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1-(o-tolyl)-1H-pyrazole;

(94) 5-(4-chlorophenyl)-1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(95) 1-(2,6-dichlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole ;

(96) 1-(3-chloro-4-methylphenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyra Sol;

(97) 5-(2,5-dimethoxyphenol)-1-(2,4-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole ;

(98) 5-(2,5-dimethoxyphenol)-1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole ;

(99) 1-(4-chlorophenyl)-5-(2,4-difluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;

(100) 5-(2,4-difluorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole ;

(101) 5-(2,4-difluorophenyl)-1-(2-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole ; And

(102) 4-(1H-imidazol-1-yl)-1,5-bis(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole.

The compound represented by Formula 1 of the present invention may be used in the form of a pharmaceutically acceptable salt, and an acid addition salt formed by a pharmaceutically acceptable free acid is useful. Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid, phosphorous acid, etc., aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. It is obtained from non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids, acetic acid, benzoic acid, citric acid, lactic acid, maleic acid, gluconic acid, methanesulfonic acid, 4-toluenesulfonic acid, tartaric acid, fumaric acid, and the like. Examples of such pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, i. Odide, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, sube Rate, sebacate, fumarate, maleate, butine-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitro benzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfonate, chlorobenzenesulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β-hydroxybutyrate, Glycolate, malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, mandelate, and the like.

The acid addition salt according to the present invention can be prepared by a conventional method, for example, a precipitate formed by dissolving the derivative of Formula 1 in an organic solvent such as methanol, ethanol, acetone, methylene chloride, acetonitrile, etc. and adding an organic or inorganic acid It can be prepared by filtration and drying, or it can be prepared by distilling a solvent and an excess of acid under reduced pressure and then drying to crystallize under an organic solvent.

In addition, a pharmaceutically acceptable metal salt can be made using a base. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate. At this time, it is pharmaceutically suitable to prepare sodium, potassium or calcium salt as the metal salt. In addition, the corresponding salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable negative salt (eg, silver nitrate).

Further, the compound represented by Formula 1 may be used in the form of a pharmaceutically acceptable salt thereof, as well as a solvate, stereoisomer, hydrate, etc. that may be prepared therefrom.

The compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof according to the present invention has excellent inhibitory activity against mutant IDH and can reduce the level of intracellular tumor-causing metabolites (2-HG). As possible, it has a useful effect of preventing, ameliorating, ameliorating, or treating mutant IDH-related diseases (in other words, tumor-causing metabolites (2-HG)-related diseases).

The compounds of the present invention are inhibitors of mutant IDH and are thus useful in the treatment of diseases or disorders associated with such proteins, such as, but not limited to, cell proliferative disorders such as cancer. Examples of mutant IDHs are for example mutant IDH1 and mutant IDH2. Neomorph activity associated with mutant IDH1 and mutant IDH2 produces 2-hydroxyglutarate (2-HG neomorph activity), specifically R-2-HG (R-2-HG neomorph activity). It's ability. Mutations at IDH1 associated with 2-HG neomorph activity, specifically R-2-HG neomorph activity, are mutations at residues 97, 100 and 132, e.g. G97D, R100Q, R132H, R132C, R132S, R132G , R132L and R132V. Mutations in IDH2 associated with 2-HG neoplasms, specifically R-2-HG neomorph activity, include mutations at residues 140 and 172, e.g. R140Q, R140G, R172K, R172M, R172S, R172G and R172W. do.

As used herein, the term “neomorph activity” refers to the acquisition of novel activity of a protein that the wild-type protein does not have or does not exhibit to a significant extent. For example, the neomorphic activity associated with the mutant forms of IDH1 and IDH2 is the ability to reduce alpha-ketoglutarate to 2-hydroxyglutarate (i.e., 2-HG, specifically R-2-HG). to be. On the other hand, the wild-type form of IDH1 and IDH2 does not have the ability to reduce alpha-ketoglutarate to 2-hydroxyglutarate (i.e., 2-HG, specifically R-2-HG), or In the absence of it it does not produce a significant (ie, harmful or disease-causing) amount of 2-HG.

Although the present invention is not limited to a particular theory, for example the mutant IDH produces 2-hydroxyglutarate (i.e., 2-HG, specifically R-2-HG) from which the mutant forms listed above It can be understood that IDH-related diseases develop, progress, or worsen.

Although the present invention is not limited to a particular theory, for example, an abnormality of the alpha-ketoglutarate dependent dioxygenase is derived from 2-hydroxyglutarate produced by the mutant IDH, resulting in the mutant IDH listed above. It can be understood that related diseases, such as cancer, develop, progress, or worsen.

In addition, the present invention, as shown in the following Scheme 1,

Reacting a compound represented by Formula 2 with a compound represented by R ⁴ -NH-NH ₂ to obtain a compound represented by Formula 1'; And

It provides a method for preparing a compound represented by Formula 1, comprising: obtaining a compound represented by Formula 1 from the compound represented by Formula 1'obtained in the above step:

[Scheme 1]

In Scheme 1 above,

R ¹ , R ² , R ³ and R ⁴ are as defined in Formula 1; And

^{R 1 ', R 2',} R 3 ' and R ^4' is one of each of said R ^1, R ^2, R ³ and R ⁴ the same or ^{R 1 ', R 2',} R 3 ' and R ^4' The above may be independently defined differently ^{from the R 1} , R ² , R ³ and R ^4,

Here, the ^"case where R ¹ and the other, R ^{1 'wherein} R ¹ is a straight or branched chain alkyl -SH or -SC _1-3 R ¹ is a straight chain of -SO ₂ or -SO ₂ -C _1-3 or Branched chain alkyl,

^"If the R ³ and the other, R ^{3 'wherein} R ³ is -SH or -SC _1-3 straight or branched chain alkyl and R ³ is -SO ₂ or -SO ₂ -C _1-3 straight or branched chain Alkyl,

^"When the R ² and the other, R ^{2 'wherein} R ² is -Br, and R ² are as defined in formula (I),

^"When the R ⁴ and the other, R ^{4 'wherein} R ⁴ is -H, and R ⁴ are as defined in formula (I).

Hereinafter, the manufacturing method according to the present invention will be described in detail.

The step of obtaining the compound represented by Formula 1'by reacting the compound represented by Formula 2 with the compound represented by R ⁴ -NH-NH ₂ may be understood as a step of forming a pyrazole ring having a parent nucleus structure, and the following It can be carried out with reference to the method disclosed in Example 1-102.

Further, in the step of obtaining the compound represented by Formula 1 from the obtained compound represented by Formula 1', R ^{1' , R 2'} , R ^3'and R ^4'are each of the R ¹ , R ² , R ³ and R ^{If it is the same as 4} , it can be understood that there is no separate step,

Or R ^1′ , R ^2′ , R ^3′, and R ^4′ when at least one is independently ^{defined differently from the above R 1} , R ² , R ³ and R ⁴ , it may be understood as follows.

R ¹ when ^'or R ^3' is a straight or branched chain alkyl of -SH or -SC _1-3, optionally, oxidizing this to straight or branched chain alkyl of -SO ₂ or -SO ₂ -C _1-3 May be to perform more,

When R ^2′ is -Br, it may be understood as a step of substituting this bromine substituent with R ^2,

If R ^{4 'is} -H, it may be understood by introducing the R ⁴ substituent at this position.

Meanwhile, the number of the above-described cases includes one case and all cases in which each is combined.

Preferably, the step can be carried out with reference to the method disclosed in Example 1-102 below.

Meanwhile, the solvent, reaction time, and reaction temperature used in the preparation examples are not particularly limited as long as the compound represented by Chemical Formula 5 can be prepared, and in particular, the reaction conditions described in Examples 1 and 7 below. It will be understood by those skilled in the art that all of the reaction conditions, such as a solvent, reaction time, reaction temperature, and the like, to a degree that can be easily changed/modified therefrom are included in the present invention.

Furthermore, the present invention provides a pharmaceutical composition for preventing or treating mutant IDH-related diseases containing the compound represented by Formula 1, its stereoisomer, or a pharmaceutically acceptable salt thereof as an active ingredient.

Here, the mutant IDH-related disease refers to any disease that can be prevented, ameliorated, improved, or treated by inhibiting the activity of the mutant IDH1 or IDH2, but is not limited thereto, for example, a mutation known to date Diseases or symptoms related to type IDH, or diseases reported to be related to mutant IDH are all included.

In one embodiment of the invention, it has been found that the compounds of the invention have inhibitory activity against mutant IDH1 (eg IDH R132H). Therefore, the compounds of the present invention can exhibit effective effects (prevention, improvement, treatment) in mutant IDH1-related diseases.

In one aspect of the present invention, the mutant IDH-related disease may be, for example, but not limited to a cell proliferative disorder, such as cancer.

Examples of mutant IDH are mutant IDH1 and mutant IDH2. The associated neomorph activity is the ability to produce 2-hydroxyglutarate (2-HG neomorph activity), specifically R-2-HG (R-2-HG neomorph activity). Mutations at IDH1 associated with 2-HG neomorph activity, specifically R-2-HG neomorph activity, are mutations at residues 97, 100 and 132, e.g. G97D, R100Q, R132H, R132C, R132S, R132G , R132L and R132V. Mutations in IDH2 associated with 2-HG neoplasms, specifically R-2-HG neomorph activity, include mutations at residues 140 and 172, e.g. R140Q, R140G, R172K, R172M, R172S, R172G and R172W. do.

In one aspect of the present invention, the cell-proliferative disorder associated with the mutant IDH includes, but is not limited to, cancer. Examples of such cancers include adult acute lymphoblastic leukemia; Childhood acute lymphoblastic leukemia; Adult acute myelogenous leukemia; Adrenal cortical carcinoma; Childhood adrenal cortical carcinoma; AIDS-related lymphoma; AIDS-related malignancies; Anal cancer; Pediatric cerebellar astrocytoma; Childhood cerebral astrocytoma; Extrahepatic bile duct cancer; Bladder cancer; Bladder cancer in children; Bone cancer, osteosarcoma/malignant fibrous histiocytoma; Pediatric brainstem glioma; Adult brain tumor; Childhood brain tumor, brainstem glioma; Childhood brain tumor, cerebellar astrocytoma; Childhood brain tumor, cerebral astrocytoma/malignant glioma; Pediatric brain tumor, epicytoma; Childhood brain tumor, medulloblastoma; Pediatric brain tumors, tentacle primitive neuroectodermal tumors; Pediatric brain tumors, visual pathways and hypothalamic glioma; Pediatric brain tumors (other); Breast cancer; Breast cancer and pregnancy; Childhood breast cancer; Male breast cancer; Pediatric bronchial adenoma/carcinoid; Childhood carcinoid tumor; Gastrointestinal carcinoid tumor; Adrenal cortical carcinoma; Islet cell carcinoma; Primary carcinoma of unknown cause; Primary central nervous system lymphoma; Pediatric cerebellar astrocytoma; Childhood cerebral astrocytoma/malignant glioma; Cervical cancer; Childhood cancer; Chronic lymphocytic leukemia; Chronic myelogenous leukemia; Chronic myeloproliferative disorder; Transparent cell sarcoma of hay; Colon cancer; Pediatric colorectal cancer; Cutaneous T-cell lymphoma; Endometrial cancer; Pediatric cytoma; Ovarian epithelial cancer; Esophageal cancer; Childhood esophageal cancer; Ewing tumors; Pediatric extracranial germ cell tumor; Extratesticular germ cell tumor; Extrahepatic bile duct cancer; Eye cancer, intraocular melanoma; Eye cancer, retinoblastoma; Gallbladder cancer; Stomach cancer; Gastric cancer in children; Gastrointestinal carcinoid tumor; Pediatric extracranial germ cell tumor; Extratesticular germ cell tumor; Ovarian germ cell tumor; Gestational trophoblast tumor; Pediatric brainstem glioma; Pediatric visual pathway and hypothalamic glioma; Hairy cell leukemia; Head and neck cancer; Adult hepatocellular carcinoma (liver cancer) (primary); Childhood hepatocellular carcinoma (liver cancer) (primary); Hodgkin's lymphoma in adults; Hodgkin's lymphoma in children; Hodgkin's lymphoma during pregnancy; Hypopharyngeal cancer; Pediatric hypothalamic and visual pathway glioma; Intraocular melanoma; Islet cell carcinoma (endocrine pancreas); Kaposi's sarcoma; Kidney cancer; Laryngeal cancer; Laryngeal cancer in children; Adult acute lymphoblastic leukemia; Childhood acute lymphoblastic leukemia; Adult acute myelogenous leukemia; Childhood acute myelogenous leukemia; Chronic lymphocytic leukemia; Chronic myelogenous leukemia; Hairy cell leukemia; Cleft lip and oral cancer; Liver cancer in adults (primary); Childhood liver cancer (primary); Non-small cell lung cancer; Small cell lung cancer; Adult acute lymphoblastic leukemia; Childhood acute lymphoblastic leukemia; Chronic lymphocytic leukemia; AIDS-related lymphoma; Central nervous system lymphoma (primary); Cutaneous T-cell lymphoma; Hodgkin's lymphoma in adults; Hodgkin's lymphoma in children; Hodgkin's lymphoma during pregnancy; Adult non-Hodgkin's lymphoma; Childhood non-Hodgkin's lymphoma; Non-Hodgkin's lymphoma during pregnancy; Primary central nervous system lymphoma; Waldenstrom macroglobulinemia; Male breast cancer; Adult malignant mesothelioma; Childhood malignant mesothelioma; Malignant thymoma; Pediatric medulloblastoma; Melanoma; Intraocular melanoma; Merkel cell carcinoma; Malignant mesothelioma; Latent primary metastatic squamous neck cancer; Pediatric multiple endocrine neoplasia syndrome; Multiple myeloma/plasma cell neoplasm; Mycosis fungoides; Myelodysplastic syndrome; Chronic myelogenous leukemia; Childhood acute myelogenous leukemia; Multiple myeloma; Chronic myeloproliferative disorder; Nasal and sinus cancer; Nasopharyngeal cancer; Nasopharyngeal cancer in children; Neuroblastoma; Adult non-Hodgkin's lymphoma; Childhood non-Hodgkin's lymphoma; Non-Hodgkin's lymphoma during pregnancy; Non-small cell lung cancer; Pediatric oral cancer; Oral cancer and cleft lip cancer; Oropharyngeal cancer; Osteosarcoma/malignant fibrous histiocytoma of bone; Ovarian cancer in children; Ovarian epithelial cancer; Ovarian germ cell tumor; Ovarian hypomalignant latent tumor; Pancreatic cancer; Childhood pancreatic cancer; Islet cell pancreatic cancer; Sinus and nasal cancer; Parathyroid cancer; Penile cancer; Chromium affinity cell tumor; Pediatric pineal and supine primitive neuroectodermal tumors; Pituitary tumor; Plasma cell neoplasm/multiple myeloma; Pleural pulmonary blastoma; Breast cancer and pregnancy; Pregnancy and Hodgkin's lymphoma; Pregnancy and non-Hodgkin's lymphoma; Primary central nervous system lymphoma; Adult primary liver cancer; Childhood primary liver cancer; Prostate cancer; Rectal cancer; Renal cell carcinoma (kidney cancer); Childhood renal cell carcinoma; Renal pelvis and ureter, transitional cell carcinoma; Retinoblastoma; Pediatric rhabdomyosarcoma; Salivary adenocarcinoma; Salivary adenocarcinoma in children; Sarcoma, Ewing tumor; Kaposi's sarcoma; Sarcoma of bone (ostesarcoma)/malignant fibrous histiocytoma of bone; Pediatric sarcoma, rhabdomyosarcoma; Adult soft tissue sarcoma; Pediatric soft tissue sarcoma; Sezary syndrome; cutaneous cancer; Childhood skin cancer; Skin cancer (melanoma); Merkel cell skin carcinoma; Small cell lung cancer; Small intestine cancer; Soft tissue sarcoma (adult); Pediatric soft tissue sarcoma; Latent primary metastatic squamous neck cancer; Stomach cancer; Gastric cancer in children; Pediatric tentacle primitive neuroectodermal tumor; Cutaneous T-cell lymphoma; Testicular cancer; Pediatric thymoma; Malignant thymoma; Thyroid cancer; Thyroid cancer in children; Transitional cell carcinoma of the renal pelvis and ureters; Gestational trophoblast tumor; Childhood cancer of unknown primary site; Abnormal cancer in children; Ureter and renal pelvis, transitional cell carcinoma; Urethral cancer; Uterine sarcoma; Vaginal cancer; Pediatric visual pathway and hypothalamic glioma; Vulvar cancer; Waldenstrom macroglobulinemia; And Wilms' tumor.

In another aspect, the cancer associated with the mutant IDH is a brain cancer, such as an astrocytoma (e.g., a stellate cell tumor, a pseudocellular giant cell astrocytoma, diffuse astrocytoma, polymorphic yellow astrocytoma, anaplastic astrocytoma. , Astrocytoma, giant cell glioblastoma, glioblastoma, secondary glioblastoma, primary adult glioblastoma and primary juvenile glioblastoma); Oligodendrocyte tumors (eg, oligodendroglioma and anaplastic oligodendrosis); Oligodendrocyte tumors (eg, oligodendrocyte tumors and anaplastic oligodendrocytes); Epicytoma (eg, cytoma on mucous papillary and anaplastic epicytoma); Medulloblastoma; Primitive neuroectodermal tumor, Schwanncytoma, meningioma, atypical meningioma, anaplastic meningioma; And pituitary adenoma. In another embodiment, the brain cancer is a glioma, glioblastoma polymorphic, paraganglion, or tentative primitive neuroectodermal tumor (sPNET).

In another aspect, the cancer associated with mutant IDH is leukemia, such as acute myelogenous leukemia (AML), myelodysplastic syndrome (MDS), chronic myelogenous leukemia (CML), myeloproliferative neoplasm (MPN), chronic myelomonocytic leukemia. Including MDS. MPN, AML after MDS, AML after MPN, AML after MDS/MPN, del(5q)-associated high risk MDS or AML, acute phase chronic myelogenous leukemia, angioimmunoblastic lymphoma and acute lymphoblastic leukemia.

In another aspect, the cancer associated with mutant IDH is skin cancer, such as melanoma.

In another aspect, the cancer associated with mutant IDH is prostate cancer, thyroid cancer, colon cancer or lung cancer.

In another aspect, the cancer associated with mutant IDH is a sarcoma, such as central chondrosarcoma, central and periosteal chondroma and fibrosarcoma.

In another aspect, the cancer associated with mutant IDH is cholangiocarcinoma.

Another disease or disorder associated with mutant IDH with R-2-HG neomorph activity is D-2-hydroxyglutarsanuria.

Another disease or disorder associated with mutant IDH with R-2-HG neomorph activity is Oliere's disease and Mapucci syndrome.

In the pharmaceutical composition according to the present invention, the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof may be administered in various oral and parenteral formulations at the time of clinical administration. It can be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Formulations for oral administration include, for example, tablets, pills, hard/soft capsules, solutions, suspensions, emulsifiers, syrups, granules, elixirs, and troches. , Dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine), lubricants (such as silica, talc, stearic acid and magnesium or calcium salts thereof and/or polyethylene glycol). Tablets may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and in some cases boron such as starch, agar, alginic acid or sodium salt thereof. It may contain release or boiling mixtures and/or absorbents, colorants, flavoring agents, and sweetening agents.

The pharmaceutical composition containing the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof according to the present invention as an active ingredient may be administered parenterally, and parenteral administration may be administered by subcutaneous injection, intravenous injection, intramuscular injection, or chest It depends on how I inject my injections.

At this time, in order to formulate a formulation for parenteral administration, the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof is mixed in water with a stabilizer or buffer to prepare a solution or suspension, and the ampoule or vial unit dosage form It can be manufactured with. The composition may be sterilized and/or contain adjuvants such as preservatives, stabilizers, hydrating agents or emulsification accelerators, salts and/or buffers for controlling osmotic pressure, and other therapeutically useful substances, which are conventional methods of mixing and granulation. It can be formulated according to the method of painting or coating.

In addition, the dose to the human body of the pharmaceutical composition containing the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient of the present invention is the patient's age, weight, sex, dosage form, health condition and disease. It may vary depending on the degree, and based on an adult patient weighing 70 Kg, it is generally 0. 1-1000 mg/day, preferably 1-500 mg/day, and at the judgment of a doctor or pharmacist. Accordingly, it may be dividedly administered once or several times a day at regular time intervals.

The compound represented by Formula 1 or a pharmaceutically acceptable salt thereof may be administered in various oral and parenteral formulations upon clinical administration. In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient in one or more compounds, such as starch, calcium carbonate, sucrose, or lactose ( lactose), gelatin, etc. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, syrups, etc.In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as humectants, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, and emulsions. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.

The compounds of the present invention can be administered by any suitable route, including oral and parenteral administration. Parenteral administration is typically by injection or infusion and includes intravenous, intramuscular and subcutaneous injection or infusion.

The compounds of the present invention can be administered according to a dosing regimen in which one or multiple doses are administered at various time intervals over a given period of time. For example, the dose can be administered 1, 2, 3 or 4 times per day. Doses can be administered until the desired therapeutic effect is achieved or to maintain the desired therapeutic effect indefinitely. Suitable dosing regimens for a compound of the present invention depend on the pharmacokinetic properties of the compound, such as absorption, distribution and half-life, which can be determined by one of ordinary skill in the art. In addition, the dosing regimen suitable for the compounds of the present invention (including the duration at which such therapy is administered) is within the knowledge and skill of a person skilled in the art, the disease or condition to be treated, the severity of the disease or condition to be treated, the age and physical condition of the subject to be treated, It depends on the medical history of the subject to be treated, the nature of the combination therapy, the desired therapeutic effect and other factors. In addition, those skilled in the art will understand that suitable dosing regimens may require adjustments depending on the individual subject's response to the dosing regimen or as individual subjects require changes over time. A typical daily dosage may vary depending on the particular route of administration chosen. A typical daily dosage for oral administration to a human weighing approximately 70 kg will range from about 5 mg to about 500 mg of the compound of formula 1.

One embodiment of the present invention is to treat a disease or disorder comprising administering a therapeutically effective amount of a compound of formula 1 to a subject in need thereof, which is associated with a mutant form of IDH having neomorph activity. Provides a way to do it. In one embodiment, the disease or disorder associated with a mutant form of IDH with neomorph activity is a cell proliferative disorder. In another embodiment, the cell proliferative disorder is cancer. In another embodiment, the cancer is a cancer associated with a mutant IDH1 having 2-HG neomorph activity or a mutant IDH2 having 2-HG neomorph activity. In another embodiment, the neomorph activity is R-2-HG neomorph activity. In another embodiment, the cancer has a mutation at residues 97, 100 or 132, such as G97D, R100Q, R132H, R132C, R132S, R132G, R132L and R132V, 2-HG or R-2-HG neomorph activity. It is associated with the mutation IDH1 with In another embodiment, the cancer has a 2-HG or R-2-HG neomorph activity with a mutation at residue 140 or 172, e.g., R140Q, R140G, R172K, R172M, R172S, R172G and R172W. It is associated with the mutation IDH2. In another embodiment, the cancer is brain cancer, leukemia, skin cancer, prostate cancer, thyroid cancer, colon cancer, lung cancer, or sarcoma. In another embodiment, the cancer is glioma, glioblastoma polymorphic, paraganglion, primitive neuroectodermal tumor, acute myelogenous leukemia, myelodysplastic syndrome, chronic myelogenous leukemia, melanoma, prostate, thyroid, colon, lung, central cartilage Sarcoma, central and periosteal chondroma tumor, fibrosarcoma and cholangiocarcinoma.

Another embodiment of the invention comprises administering a therapeutically effective amount of a compound of formula 1 to a subject in need thereof for treatment of a disease or disorder associated with a mutant form of IDH having R-2-HG neomorph activity, A method of treating the disease or disorder is provided, wherein the disease or disorder is D-2-hydroxyglutarsanuria, Oliere's disease or Mapucci's syndrome.

Another embodiment of the present invention provides the use of a compound of formula 1 in therapy. In a further embodiment, the therapy is a disease or disorder associated with a mutant form of IDH with neomorph activity. In another embodiment, the therapy is a cell proliferative disorder associated with a mutant form of IDH with neomorph activity. In another embodiment, the therapy is cancer. In another embodiment, the therapy is a cancer associated with a mutant IDH protein with neomorph activity, such as a mutant IDH1 with 2-HG neomorph activity or a mutant IDH2 with 2-HG neomorph activity. In another embodiment, the neomorph activity is R-2-HG neomorph activity. In another embodiment, the cancer has a mutation at residues 97, 100 or 132, such as G97D, R100Q, R132H, R132C, R132S, R132G, R132L and R132V, 2-HG or R-2-HG neomorph activity. It is associated with the mutation IDH1 with In another embodiment, the cancer has a mutation at residues R140 or 172, e.g., with 2-HG or R-2-HG neomorph activity, with R140Q, R140G, R172K, R172M, R172S, R172G and R172W. It is associated with the mutation IDH2. In another embodiment, the cancer is brain cancer, leukemia, skin cancer, prostate cancer, thyroid cancer, colon cancer, lung cancer, or sarcoma. In another embodiment, the cancer is glioma, glioblastoma polymorphic, paraganglion, primitive neuroectodermal tumor, acute myelogenous leukemia, myelodysplastic syndrome, chronic myelogenous leukemia, melanoma, prostate, thyroid, colon, lung, central cartilage Sarcoma, central and periosteal chondroma tumor, fibrosarcoma and cholangiocarcinoma.

Another embodiment of the present invention provides the use of a compound of formula 1 in therapy which is D-2-hydroxyglutarsanuria, Oliere's disease or Mapucci's syndrome.

Another embodiment of the invention provides the use of a compound according to formula 1 in the manufacture of a medicament for the treatment of a disease or disorder associated with a mutant form of IDH with neomorph activity. In one embodiment, the disease or disorder associated with a mutant form of IDH with neomorph activity is a cell proliferative disorder. In another embodiment, the cell proliferative disorder is cancer. In another embodiment, the cancer is a cancer associated with a mutant IDH protein with neomorph activity, such as a mutant IDH1 with 2-HG neomorph activity or a mutant IDH2 with 2-HG neomorph activity. In another embodiment, the neomorph activity is R-2-HG neomorph activity. In another embodiment, the cancer has a mutation at residues 97, 100 or 132, such as G97D, R100Q, R132H, R132C, R132S, R132G, R132L and R132V, 2-HG or R-2-HG neomorph activity. It is associated with the mutation IDH1 with In another embodiment, the cancer has a 2-HG or R-2-HG neomorph activity with a mutation at residue 140 or 172, e.g., R140Q, R140G, R172K, R172M, R172S, R172G and R172W. It is associated with the mutation IDH2. In another embodiment, the cancer is brain cancer, leukemia, skin cancer, prostate cancer, thyroid cancer, colon cancer, lung cancer, or sarcoma. In another embodiment, the cancer is glioma, glioblastoma polymorphic, paraganglion, primitive neuroectodermal tumor, acute myelogenous leukemia, myelodysplastic syndrome, chronic myelogenous leukemia, melanoma, prostate, thyroid, colon, lung, central cartilage Sarcoma, central and periosteal chondroma tumor, fibrosarcoma and cholangiocarcinoma.

Another embodiment of the invention provides the use of a compound according to formula 1 in the manufacture of a medicament for the treatment of a disease or disorder associated with a mutant form of IDH with R-2-HG neomorph activity, wherein the disease Or the disorder is D-2-hydroxyglutarsanuria, Oliere's disease or Mapucci's syndrome.

Another embodiment of the present invention provides a compound of formula 1 for use in therapy. In a further embodiment, the therapy is a disease or disorder associated with a mutant form of IDH with neomorph activity. In another embodiment, the therapy is a cell proliferative disorder associated with a mutant form of IDH with neomorph activity. In another embodiment, the therapy is cancer. In another embodiment, the therapy is a cancer associated with a mutant IDH protein with neomorph activity, such as a mutant IDH1 with 2-HG neomorph activity or a mutant IDH2 with 2-HG neomorph activity. In another embodiment, the neomorph activity is R-2-HG neomorph activity. In another embodiment, the cancer has a mutation at residues 97, 100 or 132, such as G97D, R100Q, R132H, R132C, R132S, R132G, R132L and R132V, 2-HG or R-2-HG neomorph activity. It is associated with the mutation IDH1 with In another embodiment, the cancer has a mutation at residues R140 or 172, e.g., with 2-HG or R-2-HG neomorph activity, with R140Q, R140G, R172K, R172M, R172S, R172G and R172W. It is associated with the mutation IDH2. In another embodiment, the cancer is brain cancer, leukemia, skin cancer, prostate cancer, thyroid cancer, colon cancer, lung cancer, or sarcoma. In another embodiment, the cancer is glioma, glioblastoma polymorphic, paraganglion, primitive neuroectodermal tumor, acute myelogenous leukemia, myelodysplastic syndrome, chronic myelogenous leukemia, melanoma, prostate, thyroid, colon, lung, central cartilage Sarcoma, central and periosteal chondroma tumor, fibrosarcoma and cholangiocarcinoma.

Another embodiment of the present invention provides a compound of Formula 1 for use in therapy, which is D-2-hydroxyglutarsanuria, Oliere's disease or Mapucci's syndrome.

The pharmaceutical compositions of the present invention may be prepared and packaged in bulk form, wherein a therapeutically effective amount of a compound of the present invention may be extracted and then provided to a subject, such as as a powder or syrup. Alternatively, the pharmaceutical compositions of the present invention may be prepared and packaged in unit dosage form, wherein each physical discrete unit contains a therapeutically effective amount of a compound of the present invention. When prepared in unit dosage form, the pharmaceutical compositions of the present invention typically contain about 5 mg to 500 mg of a compound of formula 1.

As used herein, the term “pharmaceutically acceptable carrier or excipient” refers to a pharmaceutically acceptable substance, composition or vehicle that is involved in providing form or consistency to, for example, a pharmaceutical composition. Each excipient, when administered to a patient, is compatible with the other ingredients of the pharmaceutical composition, such that interactions that substantially reduce the efficacy of the compounds of the present invention and interactions resulting in a pharmaceutically unacceptable pharmaceutical composition are prevented. Should be. In addition, each excipient must, of course, be of high enough purity to make it pharmaceutically acceptable.

The compounds of the present invention and pharmaceutically acceptable carrier or excipient(s) will typically be formulated into a dosage form adapted for administration to a patient by the preferred route of administration. For example, dosage forms may be (1) those adapted for oral administration, such as tablets, capsules, caplets, pills, troches, powders, syrups, elixirs, suspensions, solutions, emulsions, sachets and cachets; And (2) those adapted for parenteral administration, such as sterile solutions, suspensions and powders for reconstitution. Suitable pharmaceutically acceptable excipients will depend on the particular dosage form chosen. In addition, suitable pharmaceutically acceptable excipients may be selected due to the specific function they are capable of performing in the composition. For example, certain pharmaceutically acceptable excipients can be selected for their ability to facilitate the preparation of a homogeneous dosage form. Certain pharmaceutically acceptable excipients can be selected for their ability to facilitate the preparation of stable dosage forms. Certain pharmaceutically acceptable excipients may be selected for their ability to facilitate transport or transport of a compound or compounds of the invention from one organ or part of the body to another organ or part of the body when administered to a patient. have. Certain pharmaceutically acceptable excipients can be selected for their ability to enhance patient compliance.

Suitable pharmaceutically acceptable excipients include the following types of excipients: diluents, lubricants, binders, disintegrants, fillers, lubricants, granulating agents, coating agents, wetting agents, solvents, co-solvents, suspending agents, emulsifying agents, sweetening agents, flavoring agents. Agents, flavor masking agents, colorants, anti-caking agents, humectants, chelating agents, plasticizers, viscosity increasing agents, antioxidants, preservatives, stabilizers, surfactants and buffers.

Those skilled in the art have the knowledge and skills in the art to enable them to select suitable pharmaceutically acceptable carriers and excipients in appropriate amounts for use in the present invention. In addition, pharmaceutically acceptable carriers and excipients are described and there are a number of resources available to the skilled artisan that may be useful in selecting suitable pharmaceutically acceptable carriers and excipients. Examples include Remington's Pharmaceutical Sciences (Mack Publishing Company), The Handbook of Pharmaceutical Additives (Gower Publishing Limited), and The Handbook of Pharmaceutical Excipients (the American Pharmaceutical Association and the Pharmaceutical Press).

Pharmaceutical compositions of the present invention are prepared using techniques and methods known to those skilled in the art. Some methods commonly used in the art are described in Remington's Pharmaceutical Sciences (Mack Publishing Company).

In one aspect, the invention relates to a solid oral dosage form, such as a tablet or capsule, comprising a therapeutically effective amount of a compound of the invention and a diluent or filler. Suitable diluents and fillers are lactose, sucrose, dextrose, mannitol, sorbitol, starch (e.g. corn starch, potato starch and pregelatinized starch), cellulose and its derivatives (e.g. microcrystalline cellulose), sulfuric acid. And calcium and dibasic calcium phosphate. The oral solid dosage form may further comprise a binder. Suitable binders are starch (e.g., corn starch, potato starch and pregelatinized starch), gelatin, acacia, sodium alginate, alginic acid, tragacanth, guar gum, povidone, and cellulose and derivatives thereof (e.g., fine Crystalline cellulose). The oral solid dosage form may further comprise a disintegrant. Suitable disintegrants include crospovidone, sodium starch glycolate, croscarmellose, alginic acid and sodium carboxymethyl cellulose. The oral solid dosage form may further comprise a lubricant. Suitable lubricants include stearic acid, magnesium stearate, calcium stearate and talc.

Where appropriate, dosage unit formulations for oral administration may be microencapsulated. The composition may also be prepared to delay or sustain release, for example by coating or embedding the particulate material with a polymer, wax, or the like.

The compounds of the present invention may also be coupled with soluble polymers as targetable drug carriers. Such polymers may include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropylmethacrylamidephenol, polyhydroxyethylaspartamidephenol, or polyethyleneoxidepolylysine substituted with a palmitoyl moiety. In addition, the compounds of the present invention are a class of biodegradable polymers useful for achieving controlled release of drugs, such as polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoester, polyacetal, polydihydro It can be coupled to a crosslinked or amphiphilic block copolymer of pyran, polycyanoacrylate, and hydrogel.

In another aspect, the present invention relates to a liquid oral dosage form. Oral liquids such as solutions, syrups and elixirs can be prepared in dosage unit form such that a given amount contains a predetermined amount of a compound of the invention. The syrup may be prepared by dissolving a compound of the present invention, suitably in an aqueous flavor solution; Meanwhile, elixirs are prepared through the use of non-toxic alcoholic vehicles. Suspensions can be formulated by dispersing a compound of the present invention in a non-toxic vehicle. Solubilizing and emulsifying agents such as ethoxylated isostearyl alcohol and polyoxyethylene sorbitol ether, preservatives, flavor additives such as peppermint oil or other natural sweeteners or saccharin or other artificial sweeteners and the like may also be added.

In another aspect, the invention relates to parenteral administration. Pharmaceutical compositions adapted for parenteral administration include aqueous and non-aqueous sterile injectable solutions, which may contain antioxidants, buffers, bacteriostatic agents, and solutes that render the agent isotonic with the blood of the intended recipient; And aqueous and non-aqueous sterile suspensions which may contain suspending agents and thickening agents. The compositions may be presented in unit-dose or multi-dose containers, e.g. sealed ampoules and vials, under freeze drying (lyophilization) conditions requiring only the addition of a sterile liquid carrier, e.g. water for injection, immediately prior to use. Can be stored. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets.

Combination

The compounds of the present invention may be administered simultaneously with, before or after one or more other therapeutic agent(s). The compounds of the present invention may be administered individually by the same or different routes of administration, or together as different agent(s) in the same pharmaceutical composition.

In one embodiment, the invention provides a product comprising a compound of Formula 1 and at least one other therapeutic agent as a combination formulation for simultaneous, separate or sequential use in therapy. In one embodiment, the therapy is treatment of a disease or disorder associated with a mutant form of IDH. The product provided as a combination formulation may be a composition comprising a compound of formula 1 and another therapeutic agent(s) together in the same pharmaceutical composition, or in separate form, for example, a compound of formula 1 and another therapeutic agent(s) in the form of a kit. It includes a composition comprising a.

In one embodiment, the invention provides a pharmaceutical composition comprising a compound of Formula 1 and another therapeutic agent(s). Optionally, the pharmaceutical composition may comprise a pharmaceutically acceptable excipient as described above.

In one embodiment, the invention provides a kit comprising two or more separate pharmaceutical compositions, at least one of which contains a compound of formula 1. In one embodiment, the kit comprises means for individually holding the composition, such as a container, a divided bottle, or a divided foil packet. An example of such a kit is a blister pack as typically used in the packaging of tablets, capsules, and the like.

The kits of the present invention can be used in different dosage forms, for example, for oral and parenteral administration, for administering the individual compositions at different dosage intervals, or for titrating the individual compositions with respect to each other. To aid in compliance, the kits of the present invention typically include instructions for administration.

In the combination therapy of the present invention, the compounds of the present invention and other therapeutic agents may be prepared and/or formulated by the same or different manufacturers. Moreover, the compounds of the present invention and other therapeutic agents may be (i) distributed to a physician as a combination product (eg, in the case of a kit comprising the compounds of the present invention and other therapeutic agents); (ii) by the physician himself (or under the physician's direction) immediately prior to administration; (iii) In the patient itself, for example, during sequential administration of a compound of the present invention and other therapeutic agents, combined into a combination therapy.

Accordingly, the present invention provides the use of a compound of formula 1 for treating a disease or disorder associated with a mutant form of IDH, wherein a medicament is prepared for administration with another therapeutic agent. The invention also provides the use of another therapeutic agent for treating a disease or disorder associated with a mutant form of IDH, wherein the medicament is administered in combination with a compound of formula 1.

The invention also provides a compound of formula 1 for use in a method of treating a disease or disorder associated with a mutant form of IDH, wherein the compound of formula 1 is prepared for administration with another therapeutic agent. The invention also provides another therapeutic agent for use in a method of treating a disease or disorder associated with a mutant form of IDH, wherein the other therapeutic agent is formulated for administration with a compound of Formula 1. The invention also provides a compound of Formula 1 for use in a method of treating a disease or disorder associated with a mutant form of IDH, wherein the compound of Formula 1 is administered in combination with another therapeutic agent. The invention also provides another therapeutic agent for use in a method of treating a disease or disorder associated with a mutant form of IDH, wherein the other therapeutic agent is administered in combination with a compound of Formula 1.

The invention also provides the use of a compound of formula 1 for treating a disease or disorder associated with a mutant form of IDH, wherein the patient has previously been treated (eg, within 24 hours) with another therapeutic agent. The invention also provides the use of another therapeutic agent for treating a disease or disorder associated with a mutant form of IDH, wherein the patient has been previously (eg, within 24 hours) treated with a compound of formula 1.

In one embodiment, the other therapeutic agent is selected from: In one embodiment, the other therapeutic agent is a vascular endothelial growth factor (VEGF) receptor inhibitor, a topoisomerase II inhibitor, a smoothed inhibitor, an alkylating agent, an anti-tumor antibiotic, an anti Metabolites, retinoids and other cytotoxic agents.

Examples of vascular endothelial growth factor (VEGF) receptor inhibitors are bevacizumab (sold under the trade name Avastin® by Genentech/Roche), axitinib, (N-methyl-2- [[3-[(E)-2-pyridin-2-ylethenyl]-1H-indazol-6-yl]sulfanyl]benzamide, also known as AG013736, in PCT Publication No. WO 01/002369 Described), brivanib alaninate ((S)-((R)-1-(4-(4-fluoro-2-methyl-1H-indol-5-yloxy)-5-methylpyrrolo [2,1-f][1,2,4]triazine-6-yloxy)propan-2-yl)2-aminopropanoate, also known as BMS-582664), motesanib (N- (2,3-dihydro-3,3-dimethyl-1H-indol-6-yl)-2-[(4-pyridinylmethyl)amino]-3-pyridinecarboxamide, PCT Publication No. WO 02/066470 ), facireotide (also known as SOM230 and described in PCT Publication No. WO 02/010192) and sorafenib (sold under the trademark Nexavar®), but limited thereto. It does not become.

Examples of topoisomerase II inhibitors are etoposides (also known as VP-16 and etoposide phosphates and sold under the trade names Toposar®, VePesid® and Etopophos®. ) And teniposide (also known as VM-26 and sold under the trade name Vumon®).

Examples of alkylating agents are temozolomide (sold under the trade names Temodar® and Temodal® by Schering-Plough/Merck), dactinomycin (actinomycin Also known as -D and sold under the trade name Cosmegen®), melphalan (also known as L-PAM, L-sarcolysin and phenylalanine mustard, sold under the trade name Alkeran®), Altretamine (also known as hexamethylmelamine (HMM) and sold under the trade name Hexalen®), carmustine (sold under the trade name BiCNU®), bendamustine (trade name Treanda®) ), Busulfan (sold under the trademarks Busulfex® and Myleran®), carboplatin (sold under the trademark Paraplatin®), Lomustine (also as CCNU) Known and sold under the trade name CeeNU®), cisplatin (also known as CDDP and sold under the trade names Platinol® and Platinum®-AQ), chlorambucil (sold under the trade name Leukeran®) ), cyclophosphamide (sold under the trade names Cytoxan® and Neosar®), dacarbazine (DTIC, DIC and imidazole carboxamide, also known as DTIC-Dome )®), altretamine (also known as hexamethylmelamine (HMM) and sold under the trade name Hexalene®), ifosphamide (sold under the trade name Ifex®), procarbazine ( Sold under the trade name Matulane®), mechloretamine (also known as nitrogen mustard, mustin and mechloroethamine hydrochloride, sold under the trade name Mustargen®), streptozosine ( Sold under the trade name Zanosar®), thiotepa (also known as thiophosphoamide, TESPA and TSPA, trade name Thioplex®) Sold under), but is not limited thereto.

Examples of antitumor antibiotics are doxorubicin (sold under the trademarks Adriamycin® and Rubex®), bleomycin (sold under the trademark lenoxane®), daunorubicin (also daunorubicin Known as hydrochloride, daunomycin and rubidomycin hydrochloride, sold under the trade name Cerubidine®), daunorubicin liposomes (daunorubicin citrate liposomes, trade name Daunoxome®) Sold), mitoxantrone (also known as DHAD and sold under the trade name Novantrone®), epirubicin (sold under the trade name Ellens™), Idarubicin (the trade name Idamycin) (Idamycin)®, sold under Idamycin PFS®) and Mitomycin C (sold under the trademark Mutamicin®).

Examples of antimetabolites are cladribine (2-chlorodeoxyadenosine, sold under the tradename leustatin®), 5-fluorouracil (sold under the tradename Adrucil®), 6-thioguanine (Sold under the trade name Purinthhol®), Pemetrexed (sold under the trade name Alimta®), Cytarabine (also known as Arabinocytosine (Ara-C), trade name Cytosar) -U®), cytarabine liposomes (also known as liposomes Ara-C and sold under the trade name Depocyt™), decitabine (sold under the trade name Dacogen®), hydroxy Urea (sold under the trademarks Hydrea®, Droxia™ and Mylocel™), fludarabine (sold under the trademark Fludara®), phloxuridine (sold under the trademark FUDR) ®), cladribine (also known as 2-chlorodeoxyadenosine (2-CdA) and sold under the trade name Leustatin™), methotrexate (ametopterin, methotrexate sodium (MTX)) , Sold under the trade names Rheumatrex® and Trexall™) and pentostatin (sold under the trade name Nipent®).

Examples of retinoids are alitretinoin (sold under the tradename Panretin®), tretinoin (all-trans retinoic acid, also known as ATRA, sold under the tradename Vesanoid®), isotretinoin (13-cis -Retinoic acid, trade names Accutan®, Amnestim®, Claravis®, Clarus®, Decutan®, Isotane®, Izotech ( Izotech®, Oratane®, Isotret® and Sotret®) and Bexarotene (sold under the trademark Targretin®), It is not limited.

Examples of other cytotoxic agents are arsenic trioxide (sold under the trade name Trisenox®), asparaginase (also known as L-asparaginase and Erwinia L-asparaginase, trade name Elspar) And Kidrolase®).

In addition, the present invention provides a health functional food composition for preventing or improving mutant IDH-related diseases containing the compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient.

In the health functional food composition, the compound represented by Formula 1 according to the present invention may be added to food as it is or may be used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined depending on the purpose of use (for prevention or improvement). In general, the amount of the compound in the health food may be added in 0.1 to 90 parts by weight of the total food weight. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above range, and there is no problem in terms of safety, so the active ingredient may be used in an amount above the above range.

In addition, the health functional beverage composition of the present invention is not particularly limited to other ingredients other than containing the compound as an essential ingredient in the indicated ratio, and may contain various flavoring agents or natural carbohydrates, etc. as additional ingredients, as in ordinary beverages. have. Examples of the above-described natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, and the like; And polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (taumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The proportion of the natural carbohydrate is generally about 1-20 g, preferably about 5-12 g per 100 g of the composition of the present invention.

Further, in addition to the above, the compound represented by Chemical Formula 1 according to the present invention is a variety of nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavors and natural flavoring agents, coloring agents and heavy weight agents (cheese, chocolate, etc.), pects. Acids and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like. In addition, the compound represented by Chemical Formula 1 of the present invention may contain flesh for the manufacture of natural fruit juice and fruit juice beverages and vegetable beverages.

Furthermore, the present invention provides a method for preventing or treating mutant IDH-related diseases comprising administering to a subject the compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

Here, the mutant IDH-related disease includes all of the diseases listed above in the present application, and the therapeutically effective amount may prevent, improve, or treat a symptom or condition of a subject when administered into the body according to the method of administration. It says the amount that can be done. In addition, the amount may vary according to the weight, age, sex, state, and family history of the subject to be administered, and the treatment method in the present invention may determine a different amount of dosage according to different conditions for each subject.

As used herein, the term “subject” refers to an animal. Typically the animal is a mammal. Subject also refers to, for example, primates (eg, humans, males or females), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, birds, and the like. In certain embodiments, the subject is a primate. In another embodiment, the subject is a human.

As used herein, an "effective amount" referred to for a compound of the present invention is sufficient to treat the disease or condition of a subject within the scope of a reasonable medical judgment, but sufficient to avoid serious side effects (at a reasonable benefit/noxious ratio). Means a low amount of compound. An effective amount of a compound may be determined by the particular compound selected (eg, taking into account the potency, potency and half-life of the compound); The route of administration chosen, the condition to be treated; The severity of the condition being treated; The age, size, weight and physical condition of the patient to be treated; The medical history of the patient to be treated; Duration of treatment; The nature of combination therapy; Desired therapeutic effect; And other factors, and can be determined routinely by a person skilled in the art.

As used herein, the terms “treat”, “treating” or “treatment” for any disease or disorder, in one embodiment, improves the disease or disorder (ie, at least one of the disease or its clinical symptoms Slowing or stopping or decreasing of development). In another embodiment, “treat”, “treating” or “treatment” refers to alleviation or amelioration of at least one physical parameter, including those that may not be discernible by the patient. In another embodiment, “treat”, “treating” or “treatment” treats the disease or disorder physically, (eg, stabilization of identifiable symptoms), physiologically, (eg, physical Stabilization of parameters), or both. In another embodiment, “treat”, “treating” or “treatment” refers to preventing or delaying the onset or development or progression of a disease or disorder.

As used herein, when a subject is biologically, medically or quality-of-life beneficial from treatment, the subject “needs” such treatment.

The compounds of the present invention can be administered by any suitable route, including oral and parenteral administration. Parenteral administration is typically by injection or infusion and includes intravenous, intramuscular and subcutaneous injection or infusion.

In addition, the present invention provides a use of a compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof, in the manufacture of a drug for preventing or treating mutant IDH-related diseases.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following Examples and Experimental Examples.

<Example 1> 5-(3,4-dichlorophenyl)-1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyra Preparation of sol

In the preparation method of Example 67 below, 3,4-dichlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,5-dimethylphenylhydrazine was used in place of phenylhydrazine in step 3 Except for use, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 429. 3 [M+H] ^+.

<Example 2> Preparation of 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-p-tolyl-1H-pyrazole

In the preparation method of Example 67 below, 3,4-dichlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-methylphenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 415. 3 [M+H] ^+.

<Example 3> 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-nitrophenyl)-1H-pyrazole Produce

In the preparation method of Example 67 below, 3,4-dichlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-nitrophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 446. 2 [M+H] ^+.

<Example 4> 1-(3,5-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole Manufacture of

In the preparation method of Example 67 below, 4-methoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 3,5-dichlorophenylhydrazine was used in place of phenylhydrazine in step 3 Except for that, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 431.3 [M+H] ^+.

<Example 5> 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole Produce

In the preparation method of Example 67 below, 4-methoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-fluorophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 381. 3 [M+H] ^+.

<Example 6> Preparation of 5-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole

In the preparation method of Example 67 below, 4-chlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-methoxyphenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 397. 3 [M+H] ^+.

<Example 7> 5-(4-chlorophenyl)-1-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole Produce

In the preparation method of Example 67 below, 4-chlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 3,4-dichlorophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 435. 2 [M+H] ^+.

<Example 8> Preparation of 1,5-bis(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole

In the preparation method of Example 67 below, 4-fluorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-fluorophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 369. 3 [M+H] ^+.

<Example 9> 1-(4-isopropylphenyl)-5-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole Produce

In the preparation method of Example 67 below, 4-fluorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-isopropylphenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 393. 4 [M+H] ^+.

<Example 10> 5-(2,4-difluorophenyl)-1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H -Preparation of pyrazole

In the preparation method of Example 67 below, 2,4-difluorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,5-dimethylphenyl was used in place of phenylhydrazine in step 3 Except for the use of hydrazine, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 396. 4 [M+H] ^+.

<Example 11> Preparation of 4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-5-(4-nitrophenyl)-1H-pyrazole

In the preparation method of Example 67 below, 4-nitrophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-methoxyphenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 408. 3 [M+H] ^+.

<Example 12> Preparation of 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-nitrophenyl)-1-p-tolyl-1H-pyrazole

In the preparation method of Example 67 below, except that 4-nitrophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-methylphenylhydrazine was used in place of phenylhydrazine in step 3 , Was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 392. 3 [M+H] ^+.

<Example 13> Preparation of 1-(4-isopropylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-nitrophenyl)-1H-pyrazole

In the preparation method of Example 67 below, 4-nitrophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2-fluoro-4-isopropylphenyl was used in place of phenylhydrazine in step 3 Except for the use of hydrazine, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 420. 3 [M+H] ^+.

<Example 14> Preparation of 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-nitrophenyl)-1-o-tolyl-1H-pyrazole

In the preparation method of Example 67 below, except that 4-nitrophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2-methylphenylhydrazine was used in place of phenylhydrazine in step 3 , Was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 392. 3 [M+H] ^+.

<Example 15> 5-(biphenyl-4-yl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-(trifluoromethyl)phenyl)- Preparation of 1H-pyrazole

In the preparation method of Example 67 below, 4-phenylphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-(trifluoromethyl)-phenyl was used in place of phenylhydrazine in step 3 Except for the use of hydrazine, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 477. 4 [M+H] ^+.

<Example 16> 5-(biphenyl-4-yl)-1-(3,5-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyra Preparation of sol

In the preparation method of Example 67 below, 4-phenylphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 3,5-dichlorophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 477. 3 [M+H] ^+.

<Example 17> Preparation of 1-(2,4-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-phenyl-1H-pyrazole

In the preparation method of Example 67 below, except that phenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,4-dimethylphenylhydrazine was used in place of phenylhydrazine in step 3 , Was carried out in the same manner as in Example 67 to obtain the desired product.

<Example 18> Preparation of 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole

Except that in the preparation method of Example 67 below, 3-nitrophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-chlorophenylhydrazine was used in place of phenylhydrazine in step 3 And carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 412. 3 [M+H] ^+.

<Example 19> Preparation of 1-(2-ethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole

Except that in the preparation method of Example 67 below, 3-nitrophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2-ethylphenylhydrazine was used in place of phenylhydrazine in step 3 And carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 406. 3 [M+H] ^+.

<Example 20> Preparation of 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1-(4-nitrophenyl)-1H-pyrazole

Except for the fact that in the preparation method of Example 67 below, 3-nitrophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-nitrophenylhydrazine was used in place of phenylhydrazine in step 3 And carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 423. 3 [M+H] ^+.

<Example 21> 1-(2,4-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole Produce

In the preparation method of Example 67 below, 3-nitrophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,4-dimethylphenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 406. 3 [M+H] ^+.

<Example 22> Preparation of 1-(2-chlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole

In the preparation method of Example 67 below, except that 3-nitrophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2-chlorophenylhydrazine was used in place of phenylhydrazine in step 3 And carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 412. 3 [M+H] ^+.

<Example 23> Preparation of 1-(4-isopropyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole

In the preparation method of Example 67 below, 3-nitrophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-isopropylphenyl hydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 420. 3 [M+H] ^+.

<Example 24> 5-(2,5-dimethoxyphenyl)-1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyra Preparation of sol

In the preparation method of Example 67 below, 2,5-dimethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-fluorophenylhydrazine was used in place of phenylhydrazine in step 3 Except for use, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 411.3 [M+H] ^+.

<Example 25> 5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-(trifluoromethyl)phenyl) Preparation of -1H-pyrazole

In the preparation method of Example 67 below, 2,5-dimethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-(trifluoromethyl) was used in place of phenylhydrazine in step 3 ) Except for the use of phenylhydrazine, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 461.3 [M+H] ^+.

<Example 26> 5-(2,5-dimethoxyphenyl)-1-(2-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyra Preparation of sol

In the preparation method of Example 67 below, 2,5-dimethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2-fluorophenylhydrazine was used in place of phenylhydrazine in step 3 Except for use, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 411.3 [M+H] ^+.

<Example 27> 1-(3,4-dichlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H- Preparation of pyrazole

In the preparation method of Example 67 below, 2,5-dimethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 3,4-dichlorophenylhydrazine was substituted for phenylhydrazine in step 3 Except for using, and was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 461.3 [M+H] ^+.

<Example 28> 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole Produce

In the preparation method of Example 67 below, 3-methoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-fluorophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 381. 3 [M+H] ^+.

<Example 29> Preparation of 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole

In the preparation method of Example 67 below, 3-methoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-chlorophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

<Example 30> 1-(3-chloro-4-methylphenyl)-5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyra Preparation of sol

In the preparation method of Example 67 below, 3-ethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 3-chloro-4-methylphenylhydrazine was used in place of phenylhydrazine in step 3 Except for use, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 425. 3 [M+H] ^+.

<Example 31> Preparation of 5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-m-tolyl-1H-pyrazole

In the preparation method of Example 67 below, except that 2-ethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 3-methylphenylhydrazine was used in place of phenylhydrazine in step 3 And carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 391. 4 [M+H] ^+.

<Example 32> 1-(2,4-dimethylphenyl)-5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole Manufacture of

In the preparation method of Example 67 below, 3-ethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,4-dimethylphenylhydrazine was used in place of phenylhydrazine in step 3 Except for the point, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 405. 3 [M+H] ^+.

<Example 33> 1-(4-isopropylphenyl)-5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole Produce

In the preparation method of Example 67 below, 3-ethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-isopropylphenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 419. 4 [M+H] ^+.

<Example 34> Preparation of 1-(2-ethylphenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole

In the preparation method of Example 67 below, 3-methoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2-ethylphenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 391. 4 [M+H] ^+.

<Example 35> 4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-5-(4-phenoxyphenyl)-1H-pyrazole Produce

In the preparation method of Example 67 below, 4-phenoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-methoxyphenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 455.4 [M+H] ^+.

<Example 36> Preparation of 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-phenoxyphenyl)-1H-pyrazole

In the preparation method of Example 67 below, 4-phenoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-chlorophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 459. 3 [M+H] ^+.

<Example 37> 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-phenoxyphenyl)-1H-pyrazole Manufacture of

In the preparation method of Example 67 below, 4-phenoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,5-dimethylphenylhydrazine was used in place of phenylhydrazine in step 3 Except for the point, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 453. 4 [M+H] ^+.

<Example 38> Preparation of 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-phenoxyphenyl)-1-p-tolyl-1H-pyrazole

Except that in the preparation method of Example 67 below, 4-phenoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-methylphenylhydrazine was used in place of phenylhydrazine in step 3 And carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 439. 4 [M+H] ^+.

<Example 39> 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(2,3,4-trichlorophenyl)-1H -Preparation of pyrazole

In the preparation method of Example 67 below, 2,3,4-trichlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-fluorophenyl was substituted for phenylhydrazine in step 3 Except for the use of hydrazine, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 453.2 [M+H] ^+.

<Example 40> 1-(3-chloro-4-methylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(2,3,4-trichlorophenyl) Preparation of -1H-pyrazole

In the preparation method of Example 67 below, 2,3,4-trichlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 3-chloro-4 was substituted for phenylhydrazine in step 3 -Except for the use of methylphenylhydrazine, it was carried out in the same manner as in Example 67 to obtain the desired product.

<Example 41> 4-(1H-imidazol-1-yl)-3-(methylthio)-1-p-tolyl-5-(2,3,4-trichlorophenyl)-1H-pyrazole Produce

In the preparation method of Example 67 below, 2,3,4-trichlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-methylphenylhydrazine was used in place of phenylhydrazine in step 3 Except for use, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 49.4 [M+H] ^+.

<Example 42> 4-(1H-imidazol-1-yl)-1-(4-isopropylphenyl)-3-(methylthio)-5-(2,3,4-trichlorophenyl)-1H -Preparation of pyrazole

In the preparation method of Example 67 below, 2,3,4-trichlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-ispropylphenyl in place of phenylhydrazine in step 3 Except for the use of hydrazine, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 477. 2 [M+H] ^+.

<Example 43> 4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-nitrophenyl)-5-(2,3,4-trichlorophenyl)-1H- Preparation of pyrazole

In the preparation method of Example 67 below, 2,3,4-trichlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-nitrophenylhydrazine was substituted for phenylhydrazine in step 3 Except for using, and was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 480. 2 [M+H] ^+.

<Example 44> 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1H-pyrazole Produce

In the preparation method of Example 67 below, 2-methoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-fluorophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 381. 3 [M+H] ^+.

<Example 45> Preparation of 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1H-pyrazole

In the preparation method of Example 67 below, 2-methoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-chlorophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 397. 3 [M+H] ^+.

<Example 46> 5-(4-chlorophenyl)-1-(2-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylsulfonyl)-1H-pyrazole Produce

In the preparation method of Example 67 below, 4-chlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2-fluorophenylhydrazine was used in place of phenylhydrazine in step 3 Except, it was carried out in the same manner as in Example 67 to obtain the desired product.

<Example 47> Preparation of 1,5-bis(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylsulfonyl)-1H-pyrazole

In the preparation method of Example 67 below, 3,4-dichlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 3,4-dichlorophenylhydrazine was used in place of phenylhydrazine in step 3 Except for use, it was carried out in the same manner as in Example 67 to obtain the desired product.

<Example 48> 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylsulfonyl)-1H-pyra Preparation of sol

In the preparation method of Example 67 below, 3,4-dichlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-methoxyphenylhydrazine was used in place of phenylhydrazine in step 3 Except for the point, it was carried out in the same manner as in Example 67 to obtain the desired product.

<Example 49> 5-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)-4-(1H-imidazol-1-yl)-3-(methylthio) Preparation of -1-o-tolyl-1H-pyrazole

In the preparation method of Example 67 below, 2-bromo-1-(2,3-dihydrobenzo[b][1,4]dioxin-6- in place of 3-methoxyphenacyl bromide in step 1) Il) Ethan-1-one was used, and 2-methylphenylhydrazine was used in place of the phenylhydrazine in step 3, and the procedure was carried out in the same manner as in Example 67 to obtain the desired product.

<Example 50> 1-(3,4-dichlorophenyl)-5-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)-4-(1H-imidazole- Preparation of 1-yl)-3-(methylthio)-1H-pyrazole

In the preparation method of Example 67 below, 2-bromo-1-(2,3-dihydrobenzo[b][1,4]dioxin-6- in place of 3-methoxyphenacyl bromide in step 1) Il) Ethan-1-one was used, and 3,4-dichlorophenylhydrazine was used in place of the phenylhydrazine in step 3, and the procedure of Example 67 was carried out to obtain the desired product.

LC/MS (ESI) m/z 459. 2 [M+H] ^+.

<Example 51> 1-(3,5-dichlorophenyl)-5-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)-4-(1H-imidazole- Preparation of 1-yl)-3-(methylthio)-1H-pyrazole

In the preparation method of Example 67 below, 2-bromo-1-(2,3-dihydrobenzo[b][1,4]dioxin-6- in place of 3-methoxyphenacyl bromide in step 1) Il) Ethan-1-one was used, and 3,5-dichlorophenylhydrazine was used in place of the phenylhydrazine in step 3, and the procedure was carried out in the same manner as in Example 67 to obtain the desired product.

LC/MS (ESI) m/z 459. 2 [M+H] ^+.

<Example 52> Preparation of 5-(methylthio)-1,3,4-triphenyl-1H-pyrazole

After dissolving 4-bromo-5-(methylthio)-1,3-diphenyl-1H-pyrazole in EtOH and toluene in the enclosed tube, 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Then Pd(PPh ₃ ) ₄ was added last. Then, the lid was closed and heated.

Yield: 50 mg (63%)

¹ H NMR (300 MHz, CDCl ₃ ): δ 7.78-7. 30 (m, 15H), 1.97 (s, 3H); LC/MS (ESI) m/z 343. 1 [M+H] ^+.

<Example 53> Preparation of 4-(4-methoxyphenyl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole

After dissolving 4-bromo-5-(methylthio)-1,3-diphenyl-1H-pyrazole in EtOH and toluene in the enclosed tube, 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 60 mg (71%)

¹ H NMR (300 MHz, CDCl ₃ ): δ 7.77-7. 28 (m, 12H), 6. 96 (d, J = 9. 0 Hz, 2H), 3. 88 (s, 3H), 1.97 (s, 3H); LC/MS (ESI) m/z 373. 1 [M+H] ^+.

<Example 54> Preparation of 3-(5-(methylthio)-1,3-diphenyl-1H-pyrazol-4-yl)benzonitrile

4-Bromo-5-(methylthio)-1,3-diphenyl-1H-pyrazole After dissolving in EtOH and toluene in the enclosed tube, 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 25 mg (47%)

¹ H NMR (300 MHz, CDCl ₃ ): δ 7.65-7. 32 (m, 14H), 1.97 (s, 3H); LC/MS (ESI) m/z 368. 1 [M+H] ^+.

<Example 55> Preparation of 1-(4-(5-(methylthio)-1,3-diphenyl-1H-pyrazol-4-yl)phenyl)ethanone

4-Bromo-5-(methylthio)-1,3-diphenyl-1H-pyrazole After dissolving in EtOH and toluene in the enclosed tube, 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 24 mg (44%)

¹ H NMR (300 MHz, CDCl ₃ ): δ 7.74-7. 29 (m, 14H), 2. 27 (s, 3H), 1.97 (s, 3H); LC/MS (ESI) m/z 385. 1 [M+H] ^+.

<Example 56> Preparation of tert-butyl 3-(5-(methylthio)-1,3-diphenyl-1H-pyrazol-4-yl)benzoate

4-Bromo-5-(methylthio)-1,3-diphenyl-1H-pyrazole After dissolving in EtOH and toluene in the enclosed tube, 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 78 mg (78%)

¹ H NMR (300 MHz, CD ₃ OD): δ7. 97-7. 33 (m, 14H), 1.99 (s, 3H), 1.57 (s, 9H); LC/MS (ESI) m/z 443.1 [M+H] ^+.

<Example 57> Preparation of 4-(dibenzofuran-4-yl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole

4-Bromo-5-(methylthio)-1,3-diphenyl-1H-pyrazole After dissolving in EtOH and toluene in the enclosed tube, 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 27 mg (30%), colorless oil

¹ H NMR (300 MHz, CDCl ₃ ): δ 8. 04 (d, J= 3. 0 Hz, 2H), 8. 01 (d, J= 3. 0 Hz, 2H), 7. 86-7. 38 (m, 10H), 7. 20 (t, J = 3. 0, 3. 0 Hz, 3H), 1. 99 (s, 3H); LC/MS (ESI) m/z 433. 1 [M+H] ^+.

<Example 58> Preparation of 4-(furan-2-yl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole

4-Bromo-5-(methylthio)-1,3-diphenyl-1H-pyrazole After dissolving in EtOH and toluene in the enclosed tube, 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 34 mg (45%)

¹ H NMR (300 MHz, CDCl ₃ ): δ 7.73-7. 35 (m, 11H), 6. 54 (d, J = 3. 0 Hz, 2H), 2. 14 (s, 3H); LC/MS (ESI) m/z 33.1 [M+H] ^+.

<Example 59> Preparation of 4-(3-fluorophenyl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole

4-Bromo-5-(methylthio)-1,3-diphenyl-1H-pyrazole After dissolving in EtOH and toluene in the enclosed tube, 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 40 mg (77%)

¹ H NMR (300 MHz, CDCl ₃ ): δ 7.75 (d, J= 9. 0 Hz, 2H), 7. 51-7. 08 (m, 12H), 1. 98 (s, 3H); LC/MS (ESI) m/z 361. 1 [M+H] ^+.

<Example 60> Preparation of 5-(methylthio)-1,3-diphenyl-4,4'-bi(1H-pyrazole)

4-Bromo-5-(methylthio)-1,3-diphenyl-1H-pyrazole After dissolving in EtOH and toluene in the enclosed tube, 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 35 mg (75%)

¹ H NMR (300 MHz, CDCl ₃ ): δ 8. 00 (d, J= 3. 0 Hz, 2H), 7. 67-7. 42 (m, 8H), 2. 31 (s, 3H); LC/MS (ESI) m/z 333.1 [MH] ^+.

<Example 61> Preparation of 5-(methylthio)-1,4-diphenyl-3-p-tolyl-1H-pyrazole

4-Bromo-5-(methylthio)-1-phenyl-3-(p-tolyl)-1H-pyrazole In the enclosed tube, EtOH and toluene were dissolved, and 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 40 mg (80%)

¹ H NMR (300 MHz, CDCl ₃ ): δ 7.77 (d, J = 9. 0 Hz, 2H), 7. 57-7. 28 (m, 10H), 2.35 (s, 3H), 1.97 (s, 3H); LC/MS (ESI) m/z 357.1 [M+H] ^+.

<Example 62> Preparation of 3-(5-(methylthio)-1-phenyl-3-p-tolyl-1H-pyrazol-4-yl)benzonitrile

4-Bromo-5-(methylthio)-1,3-diphenyl-1H-pyrazole After dissolving in EtOH and toluene in the enclosed tube, 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 40 mg (75%)

¹ H NMR (300 MHz, CDCl ₃ ): δ 7.74-7. 48 (m, 13H), 7. 13 (d, J = 9. 0 Hz, 2H), 2. 37 (s, 3H), 1. 96 (s, 3H); LC/MS (ESI) m/z 382.1 [MH] ^+.

<Example 63> Preparation of 4-(4-methoxyphenyl)-5-(methylthio)-1-phenyl-3-p-tolyl-1H-pyrazole

4-Bromo-5-(methylthio)-1-phenyl-3-(p-tolyl)-1H-pyrazole In the enclosed tube, EtOH and toluene were dissolved, and 2M Na ₂ CO ₃ and boronic acid were added. Then, nitrogen gas was connected and bubbled for 10 minutes. Pd(PPh ₃ ) ₄ was added last. The lid was closed and heated.

Yield: 40 mg (74%)

¹ H NMR (300 MHz, CDCl ₃ ): 7.75 (d, J= 9. 0 Hz, 2H), 7. 56-6. 90 (m, 12H), 3.87 (s, 3H), 2.39 (s, 3H), 1.97 (s, 3H); LC/MS (ESI) m/z 287.1 [M+H] ^+.

<Example 64> Preparation of 4-(4-methoxyphenyl)-5-(methylsulfonyl)-1,3-diphenyl-1H-pyrazole

4-(4-methoxyphenyl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole _{was added to CHCl 3} and m-CPBA was added at 0°C. Then, it was raised to rt and stirred. After TLC check, it was separated/purified with _{NaHCO 3} and CHCl _3. It was dried over _{MgSO 4 and concentrated.}

Yield: 36 mg (75%) white solid.

¹ H NMR (300 MHz, CDCl ₃ ): δ 7.67-7. 29 (m, 12H), 6. 99 (d, J = 9. 0 Hz, 2H), 3. 89 (s, 3H), 2. 74 (s, 3H); LC/MS (ESI) m/z 405.1 [M+H] ^+.

<Example 65> Preparation of 5-(methylsulfonyl)-1,3,4-triphenyl-1H-pyrazole

5-(methylthio)-1,3,4-triphenyl-1H-pyrazole _{was added to CHCl 3} and then m-CPBA was added at 0°C. Then, it was raised to rt and stirred. After TLC check, it was separated/purified with _{NaHCO 3} and CHCl _3. It was dried over _{MgSO 4 and concentrated.} Filtered with hexane.

Yield: 5 mg (14%)

LC/MS (ESI) m/z 37.5 1 [M+H] ⁺

<Example 66> Preparation of tert-butyl 3-(5-(methylsulfonyl)-1,3-diphenyl-1H-pyrazol-4-yl)benzoate

After tert-butyl 3-(5-(methylthio)-1,3-diphenyl-1H-pyrazol-4-yl)benzoate _{was added to CHCl 3} , m-CPBA was added at 0°C. Then, it was raised to rt and stirred. After TLC check, it was separated/purified with _{NaHCO 3} and CHCl _3. It was dried over _{MgSO 4 and concentrated.}

28 mg (42%)

¹ H NMR (300 MHz, DMSO): δ7. 94-7. 31 (m, 14H) 3. 12 (s, 3H), 1.53 (s, 9H); LC/MS (ESI) m/z 475. 1 [M+H] ^+.

<Example 67> Preparation of 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1-phenyl-1H-pyrazole

Step 1: Preparation of 2-(1H-imidazol-1-yl)-1-(3-methoxyphenyl)ethanone

After dissolving 5 g of 3-methoxyphenacyl bromide in 30 mL of acetonitrile, 4. 58 g of imidazole was added at 0° C., followed by stirring for 2 h and 1.5 h at rt. After removing the solvent, the residue was washed with water, extracted with MC, dried over _{MgSO 4 and concentrated.} After dissolving in methanol, decolorization was performed using charcoal, the solvent was removed, diethyl ether was added, and then the mixture was solidified with hexane.

Yield: 2. 92 g (60%, white solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.54 (d, J = 4. 65 Hz, 1H), 7. 52 (s, 1H), 7. 49 (t, J = 1. 47 Hz, 1H ), 7.44 (t, J = 4.83 Hz, 1H), 7.20 (ddd, J = 4.92 Hz, 1.53 Hz, 0.36 Hz, 1H), 7. 19 (s, 1H), 6.95 (s, 1H), 5.38 (s, 2H), 3.87 (s, 3H); LC/MS (ESI) m/z 21.3 [M+H] ^+.

Step 2: Preparation of 2-(1H-imidazol-1-yl)-1-(3-methoxyphenyl)-3,3-bis(methylthio)prop-2-en-1-one

After dissolving 200 mg of 2-(1H-imidazol-1-yl)-1-(3-methoxyphenyl)ethanone in DMF 1.5 mL, CS ₂ 0.8 mL and NaH 44 mg were added at 0 °C. After 1 h, under the same conditions, 0.1 mL of MeI was added and stirred for 1 h. After pouring ice water into the reaction product, the organic layer was extracted. The organic layer was washed with water once more, extracted with MC, dried over _{MgSO 4 and concentrated.}

Yield: 214 mg (69 %, yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.69 (s, 1H), 7.40 (dd, J = 3. 03 Hz, 0.33 Hz, 1H), 7. 38-7. 35 (m, 2H), 7. 14-7. 07 (m, 3H), 3.84 (s, 3H), 2. 26 (s, 3H), 2. 25 (s, 3H); LC/MS (ESI) m/z 321.3 [M+H] ^+.

Step 3: Preparation of 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1-phenyl-1H-pyrazole

2-(1H-imidazol-1-yl)-1-(3-methoxyphenyl)-3,3-bis(methylthio)prop-2-en-1-one 100 mg dissolved in 2 mL of EtOH After adding 0.3 mL of phenylhydrazine, the mixture was stirred at rt for 2 h and refluxed for 2 h. The solvent was removed, washed with water, dissolved in MC, extracted _{, dried over MgSO 4} , and concentrated. Purified by MPLC (EA/MC 50%).

Yield: 45 mg (36%, yellow gel)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.48 (s, 1H), 7. 35-7. 28 (m, 5H), 7.14 (t, J = 3.93 Hz, 2H), 6.99 (s, 1H), 6.84 (d,d, J = 7.62 Hz, 1.71 Hz, 1H), 6.57 (d, J = 7.77 Hz, 1H), 6.48 (t, J = 3Hz, 1H), 3.58 (s, 3H), 2. 52 (s, 3H ); LC/MS (ESI) m/z 363. 3 [M+H] ^+.

<Example 68> 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole Manufacture of

2-(1H-imidazol-1-yl)-1-(3-methoxyphenyl)-3,3-bis(methylthio)prop-2-en-1-one 100 mg dissolved in 5 mL of EtOH After adding 107 mg of dimethylphenylhydrazine·HCl and 0.8 mL of TEA, the mixture was stirred for 4 h while refluxing. The solvent was removed, washed with water, dissolved in MC, extracted _{, dried over MgSO 4} , and concentrated. Purified by MPLC (EA/MC 50%).

Yield: 108 mg (89%, yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.51 (s, 1H), 7.16 (t, J = 1. 17 Hz, 1H), 7. 11 (d, J = 1. 8 Hz, 3H ), 7.06 (t, J = 4. 35, 1H), 7. 01 (t, J = 1.23 Hz, 1H), (ddd, J = 2. 58 Hz, 8. 37 Hz, 1H) , 6. 45 (dt, J = 1. 41 Hz, 7. 62 Hz, 1H), 6. 37 (t, J = 2. 37 Hz, 1H), 3. 51 (s, 3H), 2. 49 (s, 3H), 2.30 (s, 3H), 1.96 (s, 3H); LC/MS (ESI) m/z 391. 3 [M+H] ^+.

<Example 69> Preparation of 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1- phenyl- 1H-pyrazole

Step 1: Preparation of 1-(3,4-dichlorophenyl)-2-(1H-imidazol-1-yl)ethanone

After dissolving 1 g of 3,4-dichlorophenacyl bromide in 10 mL of acetonitrile, 762 mg of imidazole was added at 0 °C, followed by stirring for 2 h and 1.5 h at rt. After removing the solvent, the residue was washed with water, extracted with MC, dried over _{MgSO 4 and concentrated.} After adding diethyl ether, it was solidified with hexane.

Yield: 578 mg (60%, yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 8. 05 (d, J = 2. 04 Hz, 1H), 7.80 (dd, J = 8. 37 Hz, 2. 07 Hz, 1H), 7. 63 (d, 8. 37 Hz, 1H), 7. 51 (s, 1H), 7. 14 (s, 1H), 6. 93 (s, 1H), 5. 37 (s, 2H); LC/MS (ESI) m/z 256. 1 [M+H] ^+.

Step 2: Preparation of 1-(3,4-dichlorophenyl)-2-(1H-imidazol-1-yl)-3,3-bis(methylthio)prop-2-en-1-one

After dissolving 200 mg of 1-(3,4-dichlorophenyl)-2-(1H-imidazol-1-yl)ethanone in DMF 1.5 mL, CS ₂ 0.7 mL, NaH 37 mg at 0 °C After the addition, 1 h, 1 mL of MeI was added under the same conditions and stirred for 1 h. After pouring ice water into the reaction product, the organic layer was extracted. The organic layer was washed with water once more, extracted with MC, dried over _{MgSO 4 and concentrated.}

228 mg (78 %, yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 8. 25 (s, 1H), 7. 96 (d, J = 1.2 Hz, 1H), 7. 72 (dd, J = 4. 98 Hz, 1 2 Hz, 1H), 7.58 (d, J = 5. 04 Hz, 1H), 7. 28 (s, 1H), 7. 15 (s, 1H), 2. 33 (s, 6H); LC/MS (ESI) m/z 360. 3 [M+H] ^+.

Step 3: Preparation of 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-phenyl-1H-pyrazole

1-(3,4-dichlorophenyl)-2-(1H-imidazol-1-yl)-3,3-bis(methylthio)prop-2-en-1-one 100 mg t-buOH 2 After dissolving in mL, 0.3 mL of phenylhydrazine and 65 mg of t-buOK were added, followed by stirring while refluxing for 2 h. The solvent was removed, washed with water, dissolved in MC, extracted _{, dried over MgSO 4} , and concentrated. Purified by MPLC (EA/MC 50%).

10 mg (8%, yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.69-7. 64 (m, 4H), 7.59-7. 50 (m, 5H), 7.36 (d, J = 8. 43 Hz, 1H), 7. 32 (s, 1H), 7. 08 (s, 1H), 7. 01 (d,d, J = 8.37 Hz, 1.95 Hz) 2.00 (s, 3H)

<Example 70> Preparation of 5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-phenyl-1H-pyrazole

Step 1: Preparation of 1-(2,5-dimethoxyphenyl)-2-(1H-imidazol-1-yl)-3,3-bis(methylthio)prop-2-en-1-one

After dissolving 200 mg of 1-(2,5-dimethoxyphenyl)-2-(1H-imidazol-1-yl)ethanone in 1 mL of DMF, CS ₂ 0.7 mL and 38 mg of NaH were added at 0 °C. After 1 h, under the same conditions, 0.1 mL of MeI was added and stirred for 1 h. After pouring ice water into the reaction product, the organic layer was extracted. The organic layer was washed with water once more, extracted with MC, dried over _{MgSO 4 and concentrated.} Purified by MPLC (EA/MC 50%).

228 mg (80%, yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 8. 01 (s, 1H), 7. 59 (s, 1H), 7. 17 (d, J = 3. 18 Hz, 1H), 7. 01-6 . 95 (m, 3H), 6.78(d, J = 9. 03Hz, 1H), 3.78 (s, 3H), 3. 75 (s, 3H), 2. 24(s, 3H), 2 13 (s, 3H); LC/MS (ESI) m/z 351.3 [M+H] ^+.

Step 2: Preparation of 5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1- phenyl- 1H-pyrazole

1-(2,5-dimethoxyphenyl)-2-(1H-imidazol-1-yl)-3,3-bis(methylthio)prop-2-en-1-one 100 mg in EtOH 3 mL After dissolving in 0.13 mL of phenylhydrazine, the mixture was stirred while refluxing for 4 h. The solvent was removed, washed with water, dissolved in MC, extracted _{, dried over MgSO 4} , and concentrated. Purified by MPLC (EA/MC 50%).

30 mg (27%, yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.48 (s, 1H), 7. 30-7. 26 (m, 5H), 7. 08 (s, 1H), 6. 99 (s, 1H), 6. 85 (dd, J = 3. 09 Hz, 9. 06 Hz, 1H), 6. 73 ( d, J = 9. 06 Hz, 1H), 6. 49 (d, J = 3. 03 Hz, 1H), 3. 59 (s, 3H), 3. 37 (s, 3H), 2. 52 ( s, 3H); LC/MS (ESI) m/z 393. 3 [M+H] ^+.

<Example 71> Preparation of 4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1- phenyl- 1H-pyrazole

Step 1: Preparation of 2-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3,3-bis(methylthio)prop-2-en-1-one

After dissolving 200 mg of 2-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)ethanone in 0.5 mL of DMF, CS ₂ 0.8 mL and 45 mg of NaH were added at 0 °C. After 1 h, under the same conditions, 0.1 mL of MeI was added and stirred for 1 h. After pouring ice water into the reaction product, the organic layer was extracted. The organic layer was washed with water once more, extracted with MC, dried over _{MgSO 4 and concentrated.} Purified by MPLC (EA/MC 50%).

250 mg (84%, yellow oil)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.93 (d, J = 8. 97 Hz, 2H), 7.86 (d, J = 2. 52 Hz, 1H), 7. 66 (d, J = 1.44 Hz, 1H), 6.97-6. 91 (m, 2H), 6.38 (t, J = 2. 4 Hz, 1H), 3. 87 (s, 3H), 2. 28 (s, 3H), 2. 27 (s, 3H); LC/MS (ESI) m/z 321. 4 [M+H] ^+.

Step 2: Preparation of 4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1-phenyl-1H-pyrazole

After dissolving 100 mg of SM in 3 mL of EtOH, 0.4 mL of phenylhydrazine was added, and the mixture was stirred for 4 h while refluxing. The solvent was removed, washed with water, dissolved in MC, extracted _{, dried over MgSO 4} , and concentrated. Purified by MPLC (EA/MC 50%).

80 mg (70%, yellow oil)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.71 (s, 1H), 7. 36 (s, 1H), 7. 30 (s, 5H), 6. 99 (d, J = 7. 74 Hz , 2H), 6. 73 (d, J = 7. 92 Hz, 2H), 6. 34 (s, 1H), 3. 75 (s, 3H), 2. 48 (s, 3H)

LC/MS (ESI) m/z 363. 2 [M+H] ⁺

<Example 72> 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(4 -methoxyphenyl )-3-(methylthio)-1H-pyrazole Manufacture of

2-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3,3-bis(methylthio)prop-2-ene-1 prepared in step 1 of Example 71 After dissolving 100 mg of -one in 5 mL of EtOH, 108 mg of dimethylphenylhydrazine·HCl and 0.8 mL of TEA were added, followed by refluxing and stirring for h. The solvent was removed, washed with water, dissolved in MC, extracted _{, dried over MgSO 4} , and concentrated. Purified by MPLC (EA/MC 50%).

74 mg (60%, yellow oil)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.73(s, 1H), 7.42(s, 1H), 7. 09 (d, J = 13. 6 Hz, 3H) 6. 89 (d, J = 7.77 Hz, 2H), 6.65 (d, J = 7.71 Hz, 2H), 6. 36 (s, 1H) 3.71 (s, 3H), 2. 46 (s, 3H ), 2. 31 (s, 3H), 1.93 (s, 3H); LC/MS (ESI) m/z 391. 1 [M+H] ^+.

<Example 73> 1-(2,6-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(4 -methoxyphenyl )-3-(methylsulfonyl)-1H-pyra Preparation of sol

1-(2,6-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole 50 mg DCM 2 After dissolving in mL, 38 mg of m-CPBA was added at 0° C. and stirred at rt. After 19 h, the reaction was washed with water and extracted with MC. It was dried over _{MgSO 4 and concentrated.} Purified by MPLC (EA/MC 80%).

18 mg (36%, yellow solid)

LC/MS (ESI) m/z 287.1 [M+H] ⁺

<Example 74> 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(4 -methoxyphenyl )-3-(methylsulfonyl)-1H-pyra Preparation of sol

1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole 45 mg into DCM 1 After dissolving in mL, 50 mg of m-CPBA was added at 0° C. and stirred at rt. After 19 h, the reaction was washed with water and extracted with MC. It was dried over _{MgSO 4 and concentrated.} Purified by MPLC (EA/MC 80%).

37 mg (88%, white solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.75 (d, J = 1. 4 Hz, 1H), 7. 56 (d, J = 2. 3 Hz, 1H), 7. 16 (d, J = 6. 4 Hz, 2H), 7. 09 (d, J = 7. 9 Hz, 1H ), 6. 88 (d, J = 9. 0 Hz, 2H), 6. 68 (d, J = 9 .0 Hz, 2H), 6. 40 (t, J = 2. 3 Hz, 1H), 3. 72 (s, 3H), 3. 25 (s, 3H), 2. 33 (s, 3H), 1. 91 (s, 3H); LC/MS (ESI) m/z 287.1 [M+H] ^+.

<Example 75> Preparation of 1-benzyl-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole

After dissolving 143 mg of 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole in THF, add 24 mg of NaH and stir for 1 hour. . Thereafter, benzyl bromide was added and stirred overnight to proceed the reaction. After that, work-up with water and MC is performed, and the product in the organic layer is extracted. Excess moisture is removed from the extracted organic layer _{using MgSO 4 and then filtered.} After that, the product is obtained after MPLC using a column.

120 mg, 63. 6%, yellow solid

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.56 (s, 1H), 7.21-7. 29 (m, 6H), 7. 12 (m, 2H), 6. 54~6. 94 (m, 5H), 5.56 (s, 2H), 3.70 (s, 3H), 1.93 (s, 3H); LC/MS (ESI) m/z 377. 1 [M+H] ⁺ 378. 1.

<Example 76> Preparation of 1-benzyl-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole

After dissolving 162 mg of 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole in THF, 30 mg of NaH was added and stirred for 1 hour. Let it. Thereafter, benzyl bromide was added and stirred overnight to proceed the reaction. After that, work-up with water and MC is performed, and the product in the organic layer is extracted. After removing excess moisture from the extracted organic layer _{using Na 2} SO ₄ , it is filtered. After that, the product is obtained after MPLC using a column.

133.4 mg, 64.8%, yellow solid

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.59 (s, 1H), 7.55 (s, 1H), 7. 26-7. 37 (m, 7H), 6. 90~7. 09 (m, 2H), 5.55 (s, 2H), 1.94 (s, 3H); LC/MS (ESI) m/z 415. 2 [M+H] ⁺ 416. 2.

<Example 77> Preparation of 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-1-(4-methylbenzyl)-3-(methylthio)-1H-pyrazole

After dissolving 162 mg of 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole in THF, 30 mg of NaH was added and stirred for 1 hour. . Thereafter, 4-methylbenzyl bromide was added and stirred overnight to proceed the reaction. After confirming the completion of the reaction by TLC, work-up is omitted and filtered to separate solid and liquid. Since there is a product in the liquid, the liquid is subjected to MPLC by column to obtain the product. The product was generated in a ratio of 3:1 with the isomer, resulting in coupling of the NMR spectrum (3:1).

White solid, 133.4mg, 68.3%

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.55 (s, 1H), 7. 20-6. 91 (m, 7H), 6.91-6. 84 (m, 3H), 5.51 (s, 2H), 3.70 (s, 3H), 2. 34 (s, 3H), 1. 95 (s, 3H); LC/MS (ESI) m/z 399.1 [M+H] ⁺ 391. 1.

<Example 78> Preparation of 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1-(4 - nitrobenzyl)-1H-pyrazole

After dissolving 143 mg of 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole in THF, 30 mg of NaH was added and stirred for 1 hour. . Thereafter, 4-nitrobenzyl bromide was added and stirred overnight to proceed the reaction. After confirming the completion of the reaction by TLC, work-up is omitted and filtered to separate solid and liquid. Since there is a product in the liquid, the liquid is subjected to MPLC by column to obtain the product. After the reaction, a trace amount of the starting material remained, but the processed product was generated in a 3:1 ratio with the isomer by work-up, resulting in a coupling (3:1) of the NMR spectrum.The product was separated into a solid (not dissolved in MC) and a liquid

Yellow solid & liquid 129. 6 mg, 61. 5%

¹ H NMR (300 MHz, CDCl ₃ ) δ 8. 26 (d, J = 8. 73 Hz, 2H), 7. 60-7. 52 (m, 3H), 7.27~7. 21 (m, 1H), 7. 05 (m, 1H), 6. 90~6. 85 (m, 4H), 5.67 (s, 2H), 3.71 (s, 3H), 2. 03 (s, 3H); LC/MS (ESI) m/z 421. 1 [M+H] ⁺ 422.1 [MH] ⁺ 420. 1.

<Example 79> 1-(4-bromobenzyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole Produce

After dissolving 143 mg of 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole in THF, 30 mg of NaH was added and stirred for 1 hour. . Thereafter, 4-bromobenzyl bromide was added and stirred overnight to proceed the reaction. After confirming the completion of the reaction by TLC, the work-up is omitted, filtered, and separated into a solid and a liquid. Since there is a product in the liquid, MPLC the liquid with a column to obtain the product. After the reaction, a trace amount of the starting material remained, but the processed product was generated in a 3:1 ratio with the isomer by work-up, resulting in a coupling (3:1) of the NMR spectrum

107. 7mg, 47%, white solid

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.56-7. 42 (m, 4H), 7. 18 (m, 4H), 6. 97~6. 83 (m, 4H), 5. 49 (m, 2H), 3. 70 (m, 3H), 1.97 (s, 3H); LC/MS (ESI) m/z 45.4 [M+H] ⁺ 45.5 0.

<Example 80> 4-(1H-imidazol-1-yl)-1-(4-methoxybenzyl)-5-(3 -methoxyphenyl )-3-(methylthio)-1H-pyrazole Produce

After dissolving 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole in THF, 30 mg of NaH was added and stirred for 1 hour. Then, 4-methoxybenzyl chloride and tetrabutylammonium bromide were added and stirred overnight to proceed the reaction. After confirming the completion of the reaction by TLC, work-up is omitted, and the liquid obtained by filtration is subjected to MPLC using a column to obtain a product.

164. 7mg, 81%, yellow oil

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.55 (s, 1H), 7.23-7. 20 (m, 1H), 7. 03 (m, 2H), 6. 93~6. 82 (m, 7H), 5.48 (s, 2H), 3.79 (s, 3H), 3.69 (s, 3H), 1. 95 (s, 3H); LC/MS (ESI) m/z 407 [M+H] ⁺ 408. 2.

<Example 81> 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-1-(4 -methylbenzyl )-3-(methylthio)-1H-pyrazole Produce

After dissolving 162 mg of 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole in THF, 30 mg of NaH was added and stirred for 1 hour. Let it. Thereafter, 4-methylbenzyl bromide was added and stirred overnight to proceed the reaction. After confirming the completion of the reaction by TLC, work-up is omitted and filtered to separate solid and liquid. Since there is a product in the liquid, the liquid is subjected to MPLC by column to obtain the product.

Yellow oil, 95. 6 mg, 44. 5%

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.58 (d, J = 1. 9 Hz, 2H), 7. 28 (m, 4H), 7. 16 (m, 2H), 6. 97-6. 92 (m, 2H), 5. 49 (s, 2H), 2. 34 (s, 3H), 1. 95 (s, 3H); LC/MS (ESI) m/z 429. 0 [M+H] ⁺ 430. 1.

<Example 82> 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-1-(4 -methoxybenzyl )-3-(methylthio)-1H-pyrazole Manufacture of

5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole is dissolved in THF, and then NaH 30mg is added and stirred for 1 hour. . Then, 4-methoxybenzyl chloride and tetrabutylammonium bromide were added and stirred overnight to proceed the reaction. After confirming the completion of the reaction by TLC, work-up is omitted, and the liquid obtained by filtration is subjected to MPLC using a column to obtain a product.

White solid, 35. 6 mg, 16%

¹ H NMR (300 MHz, acetone d6) δ 7.59~7. 54 (m, 2H), 7. 26 (m, 4H), 6. 97~6. 88 (m, 4H), 5. 47 (s, 2H), 3. 80 (s, 3H), 1. 96 (s, 3H); LC/MS (ESI) m/z 445. 0 [M+H] ⁺ 446. 1.

<Example 83> 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-nitrobenzyl)-1H-pyrazole Produce

After dissolving 162 mg of 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole in THF, 30 mg of NaH was added and stirred for 1 hour. Let it. Thereafter, 4-nitrobenzyl bromide was added and stirred overnight to proceed the reaction. After that, work-up with water and MC is performed, and the product in the organic layer is extracted. Excess moisture is removed from the extracted organic layer _{using MgSO 4 and then filtered.} Find the product after MPLC.

Brown oil, 75.7 mg, 33%

¹ H NMR (300 MHz, acetone d6) δ 8. 27-8. 24 (m, 2H), 7.67 (m, 3H), 7. 53 (m, 1H), 7. 47 (m, 1H), 7. 27 (m, 1H), 7. 26~7. 16 (m, 2H), 5.84 (s, 2H), 2. 18 (s, 3H); LC/MS (ESI) m/z [M+H] ⁺ 460. 1.

<Example 84> 1-(4-bromobenzyl)-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole Manufacture of

After dissolving 162 mg of 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole in THF, 30 mg of NaH was added and stirred for 1 hour. Let it. Thereafter, 4-bromobenzyl bromide was added and stirred overnight to proceed the reaction. After confirming the completion of the reaction by TLC, work-up with water and MC is performed, and the product in the organic layer is extracted. Excess moisture is removed from the extracted organic layer _{using MgSO 4 and then filtered.} The product is obtained by chromatography with a column (eluent; EA:MC=7:3).

Yellow oil, 73. 6 mg, 30%

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.58-7. 49 (m, 5H), 7. 25 (m, 3H), 6. 98~6. 92 (m, 2H), 5. 48 (s, 2H), 1. 98 (s, 3H); LC/MS (ESI) m/z 494. 9 [M+H] ^+.

<Example 85> 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-1-(4-methylbenzyl)-3-(methylsulfonyl)-1H-pyrazole Produce

60. 6 mg of 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-1-(4-methylbenzyl)-3-(methylthio)-1H-pyrazole was added to MC. After dissolving, 53. 6mg of m-CPBA was added, followed by stirring at 0°C. After reaction overnight, it was extracted with MC after work-up with water. It was dried over anhydrous MgSO _{4 and concentrated.} Purified by MPLC (eluent; EA:MC=3:7). The solubility in hexane was low and solidified to obtain an ivory solid product.

Yield: 18. 1 mg, 27. 7%

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.63 (s, 1H), 7.34-7. 17 (m, 6H), 7. 06 (s, 1H), 6. 89~6. 86 (m, 2H), 6.76 (m, 1H), 5. 80 (s, 2H), 3. 70 (s, 3H), 2. 57 (s, 3H), 2. 35 (s, 3H ); LC/MS (ESI) m/z [M+H] ^+.

<Example 86> 1-(4-bromobenzyl)-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylsulfonyl)-1H-pyra Preparation of sol

1-(4-bromobenzyl)-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole 54. 8 mg of MC After dissolving, m-CPBA 54. 5mg was added, followed by stirring at 0°C. After reaction overnight, it was extracted with MC after work-up with water. It was dried over anhydrous MgSO4 and concentrated. Purified by MPLC. There were many impurities and separated into preparations.

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.59 (s, 1H), 7.54-7. 52 (m, 3H), 7.37~7. 30 (m, 4H), 7. 03 (s, 1H), 6.86~6. 82 (dd, J = 8. 4 Hz, J = 2. 1 Hz, 1H), 5. 78 (s, 2H), 2. 68 (s, 3H);

<Example 87> 1-(4-bromobenzyl)-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylsulfonyl)-1H-pyra Preparation of sol

After dissolving 328 mg of 3,3-bis(methylthio)-1-phenyl-2-(1H-1,2,4-triazol-1-yl)prop-2-en-1-one in EtOH, 2 -Ethylphenylhydrazine hydrochloride 383mg, TEA 0.31mL was added, stirred at 85℃ overnight, and then worked up with water and extracted with MC. It was dried over anhydrous MgSO4 and concentrated. Purified by MPLC (eluent;EA:MC=3:7).

¹ H NMR (300 MHz, CDCl ₃ ) δ 8. 12 (s, 1H), 8. 09 (s, 1H), 7. 35-7. 18 (m, 7H), 6.99~6. 96 (m, 2H), 2. 53 (s, 3H), 2. 45~2. 38 (m, 2H), 1.07 (t, J = 6. 8 Hz, 3H).

<Example 88> Preparation of 1-(1-(4-chlorophenyl)-3-(methylthio)-5-phenyl-1H-pyrazol-4-yl)-1H-1,2,4-triazole

3,3-bis(methylthio)-1-phenyl-2-(1H-1,2,4-triazol-1-yl)prop-2-en-1-one 208. 6 mg dissolved in EtOH After adding 320 mg of 4-chlorophenylhydrazine hydrochloride and 0.2 mL of TEA, the mixture was stirred at 85° C. overnight, followed by work-up with water, followed by extraction with MC. It was dried over anhydrous MgSO4 and concentrated. Purified by MPLC (eluent;EA:MC=3:7).

¹ H NMR (300 MHz, CDCl ₃ δ 8. 09 (s, 1H), 8. 03 (s, 1H), 7. 35-7. 28 (m, 5H), 7. 25-7. 20 (m , 2H), 7.11-7.07 (m,2H), 2.55 (s, 3H).

<Example 89> 1-(2-chlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole Manufacture of

In the preparation method of Example 67, 2,5-dimethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2-chlorophenylhydrazine was used in place of phenylhydrazine in step 3 Except for the point, it was carried out in the same manner as in Example 67 to obtain the desired product.

<Example 90> 1-(2,6-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole Manufacture of

Step 1: Preparation of 2-(1H-imidazol-1-yl)-1-(3-methoxyphenyl)ethan-1-one

After dissolving 5 g of 3-methoxyphenacyl bromide in 30 mL of acetonitrile, 4.58 g of imidazole was added at 0° C. and stirred for 2 hours, followed by stirring at room temperature for 1.5 hours. After removing the solvent, the residue was washed with water, extracted with MC, dried over _{MgSO 4 and concentrated.} After dissolving this in methanol, decolorizing using charcoal, removing the solvent, adding diethyl ether, and solidifying with hexane to obtain a product.

Yield: 2.92 g (60%, white solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.54 (d, J = 4.65 Hz, 1H), 7.52 (s, 1H), 7.49 (t, J = 1.47 Hz, 1H), 7.44 (t, J = 4.83 Hz , 1H), 7.20 (ddd, J = 4.92 Hz, 1.53 Hz, 0.36 Hz, 1H), 7.19 (s, 1H), 6.95 (s, 1H), 5.38 (s, 2H), 3.87 (s, 3H); LC/MS (ESI) m/z 217.3 [M+H] ⁺

Step 2: Preparation of 2-(1H-imidazol-1-yl)-1-(3-methoxyphenyl)-3,3-bis(methylthio)prop-2-en-1-one

After dissolving 200 mg of the compound prepared in step 1 in 1.5 mL of DMF _{, 0.08 mL of CS 2} and 44 mg of NaH were added at 0° C., stirred for 1 hour, and 0.11 mL of MeI was added under the same conditions and stirred for 1 hour. . After pouring ice water into the reaction product, the organic layer was extracted. The organic layer was washed with water once more, extracted with MC _{, dried over MgSO 4} , and concentrated to obtain the desired product.

Yield: 214 mg (69 %, yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.69 (s, 1H), 7.40 (dd, J = 3.03 Hz, 0.93 Hz, 1H), 7.38-7.35 (m, 2H), 7.14-7.07 (m, 3H) , 3.84 (s, 3H), 2.26 (s, 3H), 2.25 (s, 3H); LC/MS (ESI) m/z 321.3 [M+H] ⁺

Step 3: Preparation of 1-(2,6-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole

After dissolving 100 mg of the compound prepared in step 2 in 2 mL of EtOH, 62 mg of 2,6-dichlorophenylhydrazine·HCl and 0.04 mL of TEA were added, refluxed at room temperature for 2 hours, and stirred for 2 hours. The solvent was removed, washed with water, dissolved in MC, extracted _{, dried over MgSO 4} , concentrated, and purified by MPLC (EA/MC 50%) to obtain the desired product.

Yield: 42 mg (34 %, yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.54 (s, 1H), 7.40 (d, J = 3Hz, 1H), 7.38 (s, 1H), 7.31 (d,d, J = 6.48 Hz, 2.88 Hz, ), 7.14 (d, J = 3.24 Hz, 1H), 7.10 (d, J = 7.95 Hz, 1H), 7.04 (s, 1H), 6.80 (d,d, J = 8.46 Hz, 2.58 Hz), 6.63 ( d, J = 7.71 Hz, 1H), 6.56 (t, J = 1.95 Hz, 1H) 3.59 (s, 3H), 2.53 (s, 3H); LC/MS (ESI) m/z 432.3 [M+H] ⁺

<Example 91> Preparation of 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1-(o-tolyl)-1H-pyrazole

In the preparation method of Example 90, the target product was obtained in the same manner as in Example 90, except that 2-methylphenylhydrazine was used in place of the 2,6-dichlorophenylhydrazine in step 3.

<Example 92> 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1H-pyrazole Manufacture of

In the preparation method of Example 90, 2-methoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,5-dichlorophenylhydrazine was substituted in step 3 Except for the use of dimethylphenylhydrazine, it was carried out in the same manner as in Example 90 to obtain the desired product.

<Example 93> Preparation of 4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1-(o-tolyl)-1H-pyrazole

In the preparation method of Example 90, 2-methoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2-methylphenylhydrazine was substituted for 2,6-dichlorophenylhydrazine in step 3 Except for using, it was carried out in the same manner as in Example 90 to obtain the desired product.

<Example 94> Preparation of 5-(4-chlorophenyl)-1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole

In the preparation method of Example 90, 4-chlorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-fluorophenyl was substituted for 2,6-dichlorophenylhydrazine in step 3 Except for the use of hydrazine, it was carried out in the same manner as in Example 90 to obtain the desired product.

<Example 95> 1-(2,6-dichlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H- Preparation of pyrazole

Step 1: Preparation of 2-bromo-1-(2,5-dimethoxyphenyl)ethan-1-one

After dissolving 5 g of 2,5-dimethoxyacetophenone in 60 mL of diethyl ether, 1.5 mL of _{Br 2 and 150 mg of AlCl 3} were added at 0° C., stirred for 0.5 hours, and stirred at room temperature for 1.5 hours. After slowly adding 30 mL of water to the reaction product, the organic layer was separated, washed twice with water, and the organic layer was extracted. It was dried over MgSO4 and concentrated. Then, 8 mL of hexane was added thereto and solidified while stirring at 0°C to obtain the desired product.

Yield: 5.36 g (75%, white solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.36 (d, J = 3.21 Hz, 1H), 7.09 (dd, J = 9.03 Hz, 3.24 Hz, 1H), 6.94 (d, J = 9.03 Hz, 1H), 4.61 (s, 2H), 3.91 (s, 3H), 3.79 (s, 3H); LC/MS (ESI) m/z 230.2 [M+H] ⁺

Step 2: Preparation of 1-(2,5-dimethoxyphenyl)-2-(1H-imidazol-1-yl)ethan-1-one

After dissolving 3 g of the compound prepared in step 1 in 15 mL of acetonitrile, 2.36 g of imidazole was added at 0° C., stirred for 2 hours, and stirred at room temperature for 1.5 hours. After removing the solvent, the residue was washed with water, extracted with MC, dried over _{MgSO 4 and concentrated.} After dissolving this in methanol again, decolorizing using charcoal, removing the solvent, adding diethyl ether, and solidifying with hexane.

Yield: 2.15 g (75%, light yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.51 (s,1H), 7.45 (d, J =1.95 Hz, 1H), 7.17-7.14 (m, 2H), 7.00 (d, J = 5.43 Hz, 1H) , 6.94 (s, 1H), 5.36 (s, 2H), 3.99 (s, 3H), 3.81 (s, 3H); LC/MS (ESI) m/z 247.3 [M+H] ⁺

Step 3: Preparation of 1-(3,4-dichlorophenyl)-2-(1H-imidazol-1-yl)-3,3-bis(methylthio)prop-2-en-1-one

After dissolving 200 mg of the compound prepared in step 2 in 1.5 mL of DMF, _{0.07 mL of CS 2} and 37 mg of NaH were added at 0 °C, followed by stirring for 1 hour. In the same conditions, 0.1 mL of MeI was added and stirred for 1 hour. After pouring ice water into the reaction product, the organic layer was extracted, the organic layer was washed with water once more, extracted with MC _{, dried over MgSO 4} and concentrated to obtain the desired product.

Yield: 228 mg (78 %, yellow solid)

¹ H NMR (300 MHz, CDCl ₃ ) δ 8.25 (s, 1H), 7.96 (d, J = 1.2 Hz, 1H), 7.72 (dd, J = 4.98 Hz, 1.2 Hz, 1H), 7.58 (d, J = 5.04 Hz, 1H), 7.28 (s, 1H), 7.15 (s, 1H), 2.33 (s, 6H); LC/MS (ESI) m/z 360.3 [M+H] ⁺

Step 4: 1-(2,6-dichlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole Manufacture of

After dissolving 100 mg of the compound prepared in step 3 in 3 mL of EtOH, 200 mg of Molecularsieves, 120 mg of dichlorophenylhydrazine·HCl, and 0.08 mL of TEA were added, followed by refluxing and stirring for 19 hours. The solvent was removed, washed with water, dissolved in MC, extracted, _{dried over MgSO 4} , concentrated, and purified by MPLC (EA/MC 50%) to obtain the desired product.

Yield: 70 mg (76%, yellow oil)

¹ H NMR (300 MHz, CDCl ₃ ) δ 7.54 (s, 1H), 7.38-7.24 (m, 3H), 7.08 (s, 1H), 7.03 (t, J = 1.23 Hz, 1H), 6.80 (dd, J = 9.03 Hz, 3.06 Hz, 1H), 6.68 (d, J = 9.03 Hz, 1H), 6.58 (d, J = 3.03 Hz, 1H), 3.56 (s, 3H), 3.45 (s, 3H), 2.53 (s, 3H); LC/MS (ESI) m/z 461.0 [M+H] ⁺

<Example 96> 1-(3-chloro-4-methylphenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H -Preparation of pyrazole

In the preparation method of Example 90, 2,5-dimethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 3-dichlorophenylhydrazine in step 3 was substituted. Except for the use of chloro-4-methylphenylhydrazine, it was carried out in the same manner as in Example 90 to obtain the desired product.

<Example 97> 5-(2,5-dimethoxyphenol)-1-(2,4-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H- Preparation of pyrazole

In the production method of Example 90, 2,5-dimethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,6-dichlorophenylhydrazine in step 3 was replaced with 2, Except for the use of 4-dimethylphenylhydrazine, it was carried out in the same manner as in Example 90 to obtain the desired product.

<Example 98> 5-(2,5-dimethoxyphenol)-1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H- Preparation of pyrazole

In the production method of Example 90, 2,5-dimethoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,6-dichlorophenylhydrazine in step 3 was replaced with 2, Except for the use of 5-dimethylphenylhydrazine, it was carried out in the same manner as in Example 90 to obtain the desired product.

<Example 99> 1-(4-chlorophenyl)-5-(2,4-difluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyra Preparation of sol

In the preparation method of Example 90, 2,4-difluorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,6-dichlorophenylhydrazine in step 3 was replaced with 4 -A target product was obtained in the same manner as in Example 90, except that chlorophenylhydrazine was used.

<Example 100> 5-(2,4-difluorophenyl)-4-(1H-imidazol- 1-yl) -1-(4-methoxyphenyl)-3-(methylthio)-1H- Preparation of pyrazole

In the preparation method of Example 90, 2,4-difluorophenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 2,6-dichlorophenylhydrazine in step 3 was replaced with 4 -A target product was obtained in the same manner as in Example 90, except that methoxyphenylhydrazine was used.

<Example 101> 5-(2,4-difluorophenyl)-1-(2-fluorophenyl)-4-(1H-imidazol-1-yl) -3-(methylthio)-1H- Preparation of pyrazole

In the preparation method of Example 90, 2,4-difluorophenacyl bromide was used instead of 3-methoxyphenacyl bromide in step 1, and 2,6-dichlorophenylhydrazine was substituted in step 3 -A target product was obtained in the same manner as in Example 90, except that fluorophenylhydrazine was used.

<Example 102> Preparation of 4-(1H-imidazol-1-yl)-1,5-bis(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole

In the preparation method of Example 90, 4-methoxyphenacyl bromide was used in place of 3-methoxyphenacyl bromide in step 1, and 4-methoxyphenacyl bromide was used in place of 2,6-dichlorophenylhydrazine in step 3 Except for the use of phenylhydrazine, it was carried out in the same manner as in Example 90 to obtain the desired product.

The chemical structural formula of the compound prepared in Example 1-102 is shown in Table 1 below.

Example Chemical structural formula Example Chemical structural formula One

52

2

53

3

54

4

55

5

56

6

57

7

58

8

59

9

60

10

61

11

62

12

63

13

64

14

65

15

66

16

67

17

68

18

69

19

70

20

71

21

72

22

73

23

74

24

75

25

76

26

77

27

78

28

79

29

80

30

81

31

82

32

83

33

84

34

85

35

86

36

87

37

88

38

89

39

90

40

91

41

92

42

93

43

94

44

95

45

96

46

97

47

98

48

99

49

100

50

101

51

102

<Experimental Example 1> Evaluation of IDH1 inhibitory activity

In order to evaluate the inhibitory activity against IDH1 of the compound according to the present invention, the following experiment was performed.

<1-1> Protein induction and purification

E. coli BL21 (DE3) was transformed with pRSFDuet-1 IDH1 R132H vector (supplied by Dr. James Downing, St. Jude hospital). Cells were grown in LB medium (50 μg/ml kanamycin, 37° C.) until the culture medium reached an optical density (OD) of 600 nm of 0.8.

0.6 μM isopropyl β-D-1-thiogalactopyranoside (IPTG) (overnight, 18° C.) was added to induce the protein. Next, the cells were harvested by centrifugation, and the pellet was sonicated in lysis buffer (50 mM NaH ₂ PO ₄ , 300 mM NaCl, 10 mM imidazole, pH 8. 0). Then, the lysate was ultracentrifuged (10,000 rpm, 4° C., 1 hour).

The supernatant of the lysate and Ni-NTA beads (QIAGEN) were mixed (4 °C, 2 hours), and the mixture was placed in a polypropylene column (QIAGEN) and a buffer solution (50mM NaH ₂ PO ₄ , 300mM NaCl, 20mM imidazole, pH 8 Washed with 0). Finally, the protein was eluted with an elution buffer (50 mM NaH ₂ PO ₄ , 300 mM NaCl, 250 mM imidazole, pH 8. 0) and stored at -70 °C.

<1-2> Cell line generation and culture

To make the lentivirus, the IDH1 R132H gene was transferred to the pHR plasmid. The pHR vector was digested with BamHI and EcoRI restriction enzymes. Polymerase chain reaction (PCR) of the IDH1 R132H gene was performed using pHH-IDH1-forward primer (5'AGCATC GGATCC ATGTCCAAAAAAATC 3') and pHR-IDH1-reverse primer (5'ATCTGA GAATTC TTAAAGTTTGGCCTGAGCTAGTTT G 3').

Next, 1. 6 x 10 ⁷ 293T cells were seeded in a 100 mm dish. After overnight incubation, the lentiviral packaging plasmid, pRSV-Rev, pMDLg/pRRE and pMD2. A mock vector or pHR-IDH1 R132H vector transfected with G (Addgene, # 12253, # 12251, # 12259) was added to 293T cells. The next day, we changed the medium and collected the 24 hour supernatant (containing lentivirus) at 24 and 48 hours after co-transfection. Subsequently, the supernatant was concentrated using a 0. 45 μm polyethersulfone (PES) filter and a Lenti-X concentrator (Clontech, # 631232). For transduction, lentivirus-containing supernatant, U-87 MG cells and 8 μg/ml polybrene were combined into 6-well plates. 72 hours after transduction, cells were selected using 5 μg/ml puromycin. 293T and U-87 MG cell lines were cultured in Dulbecco's Modified Eagles Medium (HyClone, # SH30243) supplemented with 10% fetal bovine serum (Gibco, # 16000-044) and grown in a humidified incubator (37 ℃, 5% CO ₂ ). Made it.

<1-3> Enzyme analysis

First, 1X assay buffer (150 mM NaCl, 20 mM Tris 7.5, 10 mM MgCl ₂ , 0.5% bovine serum albumin) was added to a 384 well plate. Next, the test compound (Example 1-15), 2 nM purified IDH1 R132H, 1 mM α-ketoglutaric acid (Sigma-Aldrich, # 75892) and 24 μM β-nicotinamide adenine dinucleotide 2'-phosphate ( Sigma-Aldrich, # N7505) was added to each well. Then, the reaction plate (25°C, 1 hour) was incubated. Here, the total reaction volume was 50 μl. To perform the second step reaction, 10 mM resazurin (Sigma-Aldrich, # R7017) and 12 μg/μl diaphorase (Sigma-aldrich, # D5540) were added to the initial reaction wells. Then, after centrifugation (1000 rpm, 30 seconds), the reaction plate was cultured (25° C., 30 minutes). The final total volume per reaction well was 75 μl. Finally, fluorescence was detected at 544 nm excitation and 590 nm emission using Envision 2104 (PerkinElmer).

An enzyme assay system was established to investigate the efficacy of inhibitors targeting IDH1 R132H. Wild-type IDH1 converts isocitrate to α-KG (FIG. 1A ), whereas mutant IDH1 converts α-KG to 2-HG using NADPH as a cofactor (FIG. 1B ). The enzyme assay system uses this function of the mutant IDH1 and consists of two reaction steps. In the first step, α-KG is converted to 2-HG by IDH1 R132H, in this step NADPH is oxidized to NADP, and the remaining NADPH is involved in the second reaction step. In this second step, resazurin is converted to fluorescent resorufin using residual NADPH. Thus, if the compound effectively inhibits IDH1 R132H, remarkable fluorescence will be observed.

Recombinant IDH1 R132H protein was purified prior to use in enzymatic analysis. For this, pRSFDuet-1 IDH1 R132H vector (including His-tag and maltose-binding protein (MBP) 6x tag) was transformed into E. coli BL21 (DE3). MBP-tag was used to improve the solubility of recombinant proteins. Transformed E. coli was cultured in LB medium containing kanamycin and IDH1, and R132H expression was stimulated using IPTG. Then, the recombinant IDH1 R132H protein was purified. To confirm the expression of IDH1 R132H, each sample was put on an SDS-PAGE gel and stained with Coomassie Brilliant Blue. Recombinant IDH1 R132H protein was identified as 90 kDa (IDH1 R132H = 46 kDa and MBP-tag = 42 kDa) (Fig. 3).

<1-5> 2-HG concentration measurement

2-HG levels in U-87 MG cells were measured using liquid chromatography-mass spectrometry (LC-MS). First, mock U-87 MG and pHR-IDH1 R132H U-87 MG cells were seeded in a 12-well plate at ^{a density of 4 x 10 5} cells/well. To extract 2-HG from the cultured cells, 80% cold methanol was added and centrifuged (13,000 rpm, 4° C., 10 minutes). Next, the supernatant was transferred to a micro tube. The LC-MS method was based on a known protocol (Jaitz et al., 2011).

To investigate the inhibitory effect of the compounds of the present invention on the activity of IDH1 R132H in cells, we generated a stable IDH1 R132H cell line. Next, the mock vector or IDH1 R132H was transduced into U-87 MG glioblastoma cancer cells. Subsequently, after puromycin selection, expression of the IDH1 protein was confirmed through western blotting (FIG. 2A).

To evaluate the 2-HG level in cells, culture media of mock U-87 MG and IDH1 R132H U-87 MG cell lines were collected. The concentration of 2-HG was determined using liquid chromatography-electrospray ionization-mass spectrometry (LC-MS) (Figure 2B).

As expected, the concentration of 2-HG was very low in mock U-87 MG cells. In contrast, 2-HG levels in IDH1 R132H U-87 MG cells were significantly increased. As previously reported, it is clear that this mutation of IDH1 increases the production of 2-HG in cells.

Accordingly, IDH1 R132H U-87 MG cells were treated with the compounds of Examples 1-15 of the present invention. As with the enzyme assay, we used AGI-5198 as the reference compound. IDH1 R132H U-87 MG cells were seeded into 12-well plates and treated with 25 μM of test compound (Examples 1-15). After overnight incubation, samples were collected and 2-HG levels were measured. As a result, the compounds of Examples 1-15 of the present invention effectively reduced the level of 2-HG in cells (Table 2).

<1-6> Antibodies and immunoblotting

To confirm the expression of IDH1, 4 x 10 ⁵ mock U-87 MG or IDH1 R132H U-87 MG cells were seeded in 12 well plates. After overnight incubation, cells were harvested using sample buffer (10% glycerol, 2% SDS, 50mM tris-HCl (pH 6. 8), 3% β-mercaptoethanol) and then boiled (95° C., 10 minutes ). The lysate was loaded on a 4-15% gradient gel (BioRad) and the amount of protein was measured using an anti-IDH1 (Cell Signaling Technology, # 8137) antibody. As a loading control, tubulin (Invitrogen, # MA5-16308) was used.

Table 2 below shows the IDH1 R132H inhibitory activity (%, IC ₅₀ ) and 2-HG production inhibitory activity (%) according to the treatment of Examples 1-15 of the present invention.

Example At 15 μM
Enzyme inhibition (%) Enzyme analysis
(IC ₅₀ , μM) At 25 μM
2-HG inhibition (%) One 75.3 - 26 2 115.4 - 10 3 113 - 27 4 79.2 - -13 5 74.5 - 4 6 97.8 - 32 7 102.2 - 2 8 51.2 - 11 9 24.9 - N/A 10 27.9 - N/A 11 46.7 - -12 12 35.3 - -18 13 116.6 - 24 14 82.3 - -20 15 18.8 - N/A 16 20.6 - N/A 17 48.6 - -One 18 70.1 - 15 19 43.6 - -14 20 92.4 - -8 21 74.8 - 15 22 84.2 - 21 23 63.4 - 13 24 50.6 - 14 25 57.1 - 5 26 59.7 - 25 27 29.8 - 9 28 34.4 - 13 29 64.6 - 11 30 88.7 - 12 31 95.4 - 20 32 67.5 - 16 33 89.8 - 12 34 48.1 - 32 35 97.6 - 23 36 3.3 - N/A 37 75 - 15 38 9.7 - N/A 39 29.5 - 4 40 20.2 - N/A 41 42.7 - -7 42 0.3 - N/A 43 87.1 - 24 44 44.6 - 6 45 3.7 - N/A 46 49.9 - -7 47 100.6 - -One 48 70.3 - -12 49 67.8 - 26 50 93.7 - 7 51 91.5 - 13 52 - 100> >30 - 53 - >100 - 54 - >100 - 55 - >100 - 56 - >100 57 - >100 - 58 - 100> >30 - 59 - >100 - 60 - 100> >30 - 61 - >100 - 62 - >100 - 63 - >100 - 64 - - - 65 - >100 - 66 - >100 - 67 - 8.5 - 68 - 6.8 - 69 - 100> >30 - 70 - 7.3 - 71 - 100> >30 - 72 - 100> >30 - 73 - 100> >30 - 74 - >100 - 75 - 100> >30 - 76 - 100> >30 - 77 - 100> >30 - 78 - 100> >30 - 79 - 100> >30 - 80 - 100> >30 - 81 - 100> >30 - 82 - 100> >30 - 83 - 100> >30 - 84 - >100 - 85 - >100 - 86 - >100 - 87 - 100> >30 - 88 - 100> >30 - 89 64.4 - 57 90 88.6 - 71 91 70.7 - 46 92 70.2 - 45 93 63.6 - 33 94 101.7 - 39 95 71.1 - 81 96 87.9 - 58 97 68.6 - 58 98 58.4 - 71 99 71.9 - 7 100 65.4 - 8 101 69.8 - 3 102 87.4 - 28

Looking at Table 2, it can be seen that Example 1-88 of the present invention has inhibitory activity against IDH1 R132H, and the production of 2-HG is inhibited, from which the compound of the present invention prevents, improves or treats mutant IDH-related diseases. It can be seen that it is valid for.

Claims (10)

A compound represented by the following Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:
[Formula 1]

In Formula 1,
Any one of R ¹ and R ³ is -H, C _1-5 straight or branched chain alkyl, -SH, -SC _1-3 straight or branched chain alkyl, -SO ₂ or -SO ₂ -C _1-3 Of straight or branched chain alkyl, and the other is unsubstituted or substituted phenyl,
Here, the substituted phenyl is substituted or unsubstituted C _1-5 linear or branched alkyl, substituted or unsubstituted C _1-5 linear or branched alkoxy, hydroxy, amino, nitro, cyano, halo Is substituted with 1 to 5 substituents independently selected from the group consisting of lozen, C _6-10 aryl and C _6-10 aryloxy, wherein the substituted alkyl or substituted alkoxy is substituted with one or more halogens,
When the substituted phenyl has two or more alkoxy as a substituent, the two or more alkoxy may be optionally linked to each other to form one or more cyclic substituents;

R ² is substituted or unsubstituted phenyl, substituted or unsubstituted dibenzofuran, or a 5 to 6 membered substituted or unsubstituted hetero atom including at least one hetero atom selected from the group consisting of N, O and S Aryl,
Wherein the substituted phenyl, substituted dibenzofuran and substituted heteroaryl are each -CHO, -COOH, -C(O)-C _1-5 linear or branched alkyl, -COO-C _1-5 linear or branched Consisting of chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, cyano, and halogen Substituted with one or more substituents selected from the group, wherein the substituted alkyl or substituted alkoxy is substituted with one or more halogens; And

R ⁴ is substituted or unsubstituted phenyl, or substituted or unsubstituted phenyl-C _1-3 alkyl,
Wherein the substituted phenyl and substituted phenyl-C _1-3 alkyl are each substituted or unsubstituted C _1-5 linear or branched alkyl, substituted or unsubstituted C _1-5 linear or branched alkoxy, hydride It is substituted with one or more substituents selected from the group consisting of oxy, amino, nitro, cyano, and halogen, and the substituted alkyl or substituted alkoxy is substituted with one or more halogens.
The method of claim 1,
Any one of R ¹ and R ³ is -SH, -SC _1-3 linear or branched alkyl, -SO ₂ or -SO ₂ -C _1-3 linear or branched alkyl, and the other is unsubstituted Or substituted phenyl,
Here, the substituted phenyl is substituted or unsubstituted C _1-5 linear or branched alkyl, substituted or unsubstituted C _1-5 linear or branched alkoxy, hydroxy, amino, nitro, cyano, halo Is substituted with 1 to 5 substituents independently selected from the group consisting of lozen, phenyl and phenyloxy, the substituted alkyl or substituted alkoxy is substituted with one or more halogens,
When the substituted phenyl has two or more alkoxy as a substituent, the two or more alkoxy are optionally linked to each other to form one ring-type substituent, a stereoisomer thereof, or a pharmaceutical thereof Salt acceptable as.
The method of claim 1,
R ² is substituted or unsubstituted phenyl, unsubstituted dibenzofuran, or a 5-membered substituted or unsubstituted heteroaryl containing at least one hetero atom selected from the group consisting of N and O,
Wherein the substituted phenyl and substituted heteroaryl are each -CHO, -COOH, -C(O)-C _1-5 straight or branched chain alkyl, -COO-C _1-5 straight or branched chain alkyl, substituted or unsubstituted At least one selected from the group consisting of cyclic C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, cyano, and halogen Substituted with a substituent, the substituted alkyl or substituted alkoxy is substituted with one or more halogens; And

Wherein R ⁴ is substituted or unsubstituted phenyl, or substituted or unsubstituted benzyl,
Wherein the substituted phenyl and substituted benzyl are each substituted or unsubstituted C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, Cyano, and substituted with one or more substituents selected from the group consisting of halogen, characterized in that the substituted alkyl or substituted alkoxy is substituted with one or more halogens,
A compound, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
The method of claim 1,
Any one of R ¹ and R ³ is -SH, -S-CH ₃ , -SO ₂ or -SO ₂ -CH ₃ , and the other is unsubstituted or substituted phenyl,
Here, the substituted phenyl is substituted or unsubstituted C _1-5 linear or branched alkyl, substituted or unsubstituted C _1-5 linear or branched alkoxy, hydroxy, amino, nitro, cyano, halo Is substituted with 1 to 3 substituents independently selected from the group consisting of lozen, phenyl and phenyloxy, and the substituted alkyl or substituted alkoxy is substituted with one or more halogens,
When the substituted phenyl has two or more alkoxy as a substituent, the two or more alkoxy may be optionally linked to each other to form a substituent in the form of one ring;

R ² is substituted or unsubstituted phenyl, unsubstituted dibenzofuran,

,

,

, or

ego,
Wherein the substituted phenyl is each -CHO, -COOH, -C(O)-C _1-5 straight or branched chain alkyl, -COO-C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _{1- 5} straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, cyano, and substituted with one or more substituents selected from the group consisting of halogen, The substituted alkyl or substituted alkoxy is substituted with one or more halogens; And

Wherein R ⁴ is substituted or unsubstituted phenyl, or substituted or unsubstituted benzyl,
Wherein the substituted phenyl and substituted benzyl are each substituted or unsubstituted C _1-5 straight or branched chain alkyl, substituted or unsubstituted C _1-5 straight or branched chain alkoxy, hydroxy, amino, nitro, Cyano, and substituted with one or more substituents selected from the group consisting of halogen, characterized in that the substituted alkyl or substituted alkoxy is substituted with one or more halogens,
A compound, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
The method of claim 1,
The compound represented by Formula 1 is a compound selected from the following compound group, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:
(1) 5-(3,4-dichlorophenyl)-1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(2) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-p-tolyl-1H-pyrazole;
(3) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-nitrophenyl)-1H-pyrazole;
(4) 1-(3,5-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(5) 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(6) 5-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(7) 5-(4-chlorophenyl)-1-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(8) 1,5-bis(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(9) 1-(4-isopropylphenyl)-5-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(10) 5-(2,4-difluorophenyl)-1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyra Sol;
(11) 4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-5-(4-nitrophenyl)-1H-pyrazole;
(12) 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-nitrophenyl)-1-p-tolyl-1H-pyrazole;
(13) 1-(4-isopropyl-2-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-nitrophenyl)-1H-pyra Sol;
(14) 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-nitrophenyl)-1-o-tolyl-1H-pyrazole;
(15) 5-(biphenyl-4-yl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-(trifluoromethyl)phenyl)-1H- Pyrazole;
(16) 5-(biphenyl-4-yl)-1-(3,5-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(17) 1-(2,4-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-phenyl-1H-pyrazole;
(18) 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole;
(19) 1-(2-ethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole;
(20) 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1-(4-nitrophenyl)-1H-pyrazole;
(21) 1-(2,4-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole;
(22) 1-(2-chlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole;
(23) 1-(4-isopropyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(3-nitrophenyl)-1H-pyrazole;
(24) 5-(2,5-dimethoxyphenyl)-1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(25) 5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-(trifluoromethyl)phenyl)-1H -Pyrazole;
(26) 5-(2,5-dimethoxyphenyl)-1-(2-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(27) 1-(3,4-dichlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole ;
(28) 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(29) 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(30) 1-(3-chloro-4-methylphenyl)-5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(31) 5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-m-tolyl-1H-pyrazole;
(32) 1-(2,4-dimethylphenyl)-5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(33) 1-(4-isopropylphenyl)-5-(3-ethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(34) 1-(2-ethylphenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(35) 4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-5-(4-phenoxyphenyl)-1H-pyrazole;
(36) 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-phenoxyphenyl)-1H-pyrazole;
(37) 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-phenoxyphenyl)-1H-pyrazole;
(38) 4-(1H-imidazol-1-yl)-3-(methylthio)-5-(4-phenoxyphenyl)-1-p-tolyl-1H-pyrazole;
(39) 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(2,3,4-trichlorophenyl)-1H-pyra Sol;
(40) 1-(3-chloro-4-methylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-5-(2,3,4-trichlorophenyl)-1H -Pyrazole;
(41) 4-(1H-imidazol-1-yl)-3-(methylthio)-1-p-tolyl-5-(2,3,4-trichlorophenyl)-1H-pyrazole;
(42) 4-(1H-imidazol-1-yl)-1-(4-isopropylphenyl)-3-(methylthio)-5-(2,3,4-trichlorophenyl)-1H-pyra Sol;
(43) 4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-nitrophenyl)-5-(2,3,4-trichlorophenyl)-1H-pyrazole ;
(44) 1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(45) 1-(4-chlorophenyl)-4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(46) 5-(4-chlorophenyl)-1-(2-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylsulfonyl)-1H-pyrazole;
(47) 1,5-bis(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylsulfonyl)-1H-pyrazole;
(48) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylsulfonyl)-1H-pyrazole;
(49) 5-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1 -o-tolyl-1H-pyrazole;
(50) 1-(3,4-dichlorophenyl)-5-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)-4-(1H-imidazole-1- Yl)-3-(methylthio)-1H-pyrazole;
(51) 1-(3,5-dichlorophenyl)-5-(2,3-dihydrobenzo[b][1,4]dioxin-6-yl)-4-(1H-imidazole-1- Yl)-3-(methylthio)-1H-pyrazole;
(52) 5-(methylthio)-1,3,4-triphenyl-1H-pyrazole;
(53) 4-(4-methoxyphenyl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole;
(54) 3-(5-(methylthio)-1,3-diphenyl-1H-pyrazol-4-yl)benzonitrile;
(55) 1-(4-(5-(methylthio)-1,3-diphenyl-1H-pyrazol-4-yl)phenyl)ethanone;
(56) tert-butyl 3-(5-(methylthio)-1,3-diphenyl-1H-pyrazol-4-yl)benzoate;
(57) 4-(dibenzofuran-4-yl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole;
(58) 4-(furan-2-yl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole;
(59) 4-(3-fluorophenyl)-5-(methylthio)-1,3-diphenyl-1H-pyrazole;
(60) 5-(methylthio)-1,3-diphenyl-4,4'-bi(1H-pyrazole);
(61) 5-(methylthio)-1,4-diphenyl-3-p-tolyl-1H-pyrazole;
(62) 3-(5-(methylthio)-1-phenyl-3-p-tolyl-1H-pyrazol-4-yl)benzonitrile;
(63) 4-(4-methoxyphenyl)-5-(methylthio)-1-phenyl-3-p-tolyl-1H-pyrazole;
(64) 4-(4-methoxyphenyl)-5-(methylsulfonyl)-1,3-diphenyl-1H-pyrazole;
(65) 5-(methylsulfonyl)-1,3,4-triphenyl-1H-pyrazole;
(66) tert-butyl 3-(5-(methylsulfonyl)-1,3-diphenyl-1H-pyrazol-4-yl)benzoate;
(67) 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1-phenyl-1H-pyrazole;
(68) 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(69) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-phenyl-1H-pyrazole;
(70) 5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-phenyl-1H-pyrazole;
(71) 4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1-phenyl-1H-pyrazole;
(72) 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(73) 1-(2,6-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylsulfonyl)-1H-pyrazole;
(74) 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(4-methoxyphenyl)-3-(methylsulfonyl)-1H-pyrazole;
(75) 1-Benzyl-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(76) 1-Benzyl-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(77) 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-1-(4-methylbenzyl)-3-(methylthio)-1H-pyrazole;
(78) 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1-(4-nitrobenzyl)-1H-pyrazole;
(79) 1-(4-bromobenzyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(80) 4-(1H-imidazol-1-yl)-1-(4-methoxybenzyl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(81) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methylbenzyl)-3-(methylthio)-1H-pyrazole;
(82) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methoxybenzyl)-3-(methylthio)-1H-pyrazole;
(83) 5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1-(4-nitrobenzyl)-1H-pyrazole;
(84) 1-(4-bromobenzyl)-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(85) 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-1-(4-methylbenzyl)-3-(methylsulfonyl)-1H-pyrazole;
(86) 1-(4-bromobenzyl)-5-(3,4-dichlorophenyl)-4-(1H-imidazol-1-yl)-3-(methylsulfonyl)-1H-pyrazole;
(87) 1-(1-(2-ethylphenyl)-3-(methylthio)-5-phenyl-1H-pyrazol-4-yl)-1H-1,2,4-triazole;
(88) 1-(1-(4-chlorophenyl)-3-(methylthio)-5-phenyl-1H-pyrazol-4-yl)-1H-1,2,4-triazole;
(89) 1-(2-chlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(90) 1-(2,6-dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(91) 4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1-(o-tolyl)-1H-pyrazole;
(92) 1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1H-pyrazole;
(93) 4-(1H-imidazol-1-yl)-5-(2-methoxyphenyl)-3-(methylthio)-1-(o-tolyl)-1H-pyrazole;
(94) 5-(4-chlorophenyl)-1-(4-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(95) 1-(2,6-dichlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole ;
(96) 1-(3-chloro-4-methylphenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyra Sol;
(97) 5-(2,5-dimethoxyphenol)-1-(2,4-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole ;
(98) 5-(2,5-dimethoxyphenol)-1-(2,5-dimethylphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole ;
(99) 1-(4-chlorophenyl)-5-(2,4-difluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole;
(100) 5-(2,4-difluorophenyl)-4-(1H-imidazol-1-yl)-1-(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole ;
(101) 5-(2,4-difluorophenyl)-1-(2-fluorophenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole ; And
(102) 4-(1H-imidazol-1-yl)-1,5-bis(4-methoxyphenyl)-3-(methylthio)-1H-pyrazole.
As shown in Scheme 1 below,
Reacting a compound represented by Formula 2 with a compound represented by R ⁴ -NH-NH ₂ to obtain a compound represented by Formula 1'; And
A method for preparing a compound represented by Formula 1 of claim 1 comprising the step of obtaining a compound represented by Formula 1 from the compound represented by Formula 1'obtained in the above step:
[Scheme 1]

In Scheme 1 above,
R ¹ , R ² , R ³ and R ⁴ are as defined in claim 1; And
^{R 1 ', R 2',} R 3 ' and R ^4' is one of each of said R ^1, R ^2, R ³ and R ⁴ the same or ^{R 1 ', R 2',} R 3 ' and R ^4' The above may be independently defined differently ^{from the R 1} , R ² , R ³ and R ^4,
Here, the ^"case where R ¹ and the other, R ^{1 'wherein} R ¹ is a straight or branched chain alkyl -SH or -SC _1-3 R ¹ is a straight chain of -SO ₂ or -SO ₂ -C _1-3 or Branched chain alkyl,
^"If the R ³ and the other, R ^{3 'wherein} R ³ is -SH or -SC _1-3 straight or branched chain alkyl and R ³ is -SO ₂ or -SO ₂ -C _1-3 straight or branched chain Alkyl,
^"When the R ² and the other, R ^{2 'wherein} R ² is -Br, and R ² are as defined in claim 1,
^"When the R ⁴ and the other, R ^{4 'wherein} R ⁴ is -H, and R ⁴ are as defined in claim 1.
A pharmaceutical composition for preventing or treating mutant IDH-related diseases containing the compound represented by Formula 1 of claim 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient.
The method of claim 7,
A pharmaceutical composition for preventing or treating a disease related to a mutant IDH from inhibiting the activity of the mutant IDH1 or inhibiting the production of 2-HG.
The method of claim 7,
The mutant IDH-related disease, characterized in that cancer, pharmaceutical composition.
A health functional food composition for preventing or improving mutant IDH-related diseases containing the compound represented by Formula 1 of claim 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient.

Images