KR20210022409A - Peptide having activities of skin whitening and uses thereof - Google Patents

Peptide having activities of skin whitening and uses thereof Download PDF

Info

Publication number
KR20210022409A
KR20210022409A KR1020190101882A KR20190101882A KR20210022409A KR 20210022409 A KR20210022409 A KR 20210022409A KR 1020190101882 A KR1020190101882 A KR 1020190101882A KR 20190101882 A KR20190101882 A KR 20190101882A KR 20210022409 A KR20210022409 A KR 20210022409A
Authority
KR
South Korea
Prior art keywords
peptide
group
composition
skin whitening
melanin
Prior art date
Application number
KR1020190101882A
Other languages
Korean (ko)
Other versions
KR102265434B1 (en
Inventor
정용지
김은미
이응지
Original Assignee
(주)케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)케어젠 filed Critical (주)케어젠
Priority to KR1020190101882A priority Critical patent/KR102265434B1/en
Publication of KR20210022409A publication Critical patent/KR20210022409A/en
Application granted granted Critical
Publication of KR102265434B1 publication Critical patent/KR102265434B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/06Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/02Preparations for care of the skin for chemically bleaching or whitening the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02PCLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00Technologies relating to chemical industry
    • Y02P20/50Improvements relating to the production of bulk chemicals
    • Y02P20/55Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Dermatology (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Birds (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Cosmetics (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present application relates to a peptide having skin whitening activity and a use thereof, and provides a peptide consisting of the amino acid sequence of SEQ ID NO: 1, a composition for skin whitening comprising the peptide, a cosmetic composition comprising the composition for skin whitening, and a pharmaceutical composition for preventing or treating melanin hyperpigmentation disorders comprising the composition for skin whitening.

Description

피부 미백 활성을 갖는 펩타이드 및 이의 용도{Peptide having activities of skin whitening and uses thereof}Peptide having activities of skin whitening and uses thereof {Peptide having activities of skin whitening and uses thereof}

본 출원은 피부 미백 활성을 갖는 펩타이드 및 이의 용도에 관한 것이다. The present application relates to a peptide having skin whitening activity and a use thereof.

피부색을 결정하는 인자에는 기본적으로 인종과 지역, 성별, 나이에 따른 차이를 제외하면, 기미, 주근깨, 및 자외선 노출로 인한 태닝이 있으며, 그 밖에도 전체적인 색소침착, 여드름, 흉터, 각질의 분포 상태와 혈액순환, 스트레스, 및 건강상태 등이 있다. 상기의 인자들 중에서 색소 침착은 피부색을 결정하는 주요한 인자로 알려져 있다. Factors that determine skin color basically include spots, freckles, and tanning caused by exposure to UV rays, excluding differences according to race, region, sex, and age.In addition, overall pigmentation, acne, scars, and keratin distribution and Blood circulation, stress, and health conditions. Among the above factors, pigmentation is known as a major factor determining skin color.

피부색에 영향을 주는 색소로는 멜라닌, 멜라노이드, 카로틴, 헤모글로빈, 및 카로티노이드 등이 있으며, 피부, 모발 및 눈의 다양한 색깔이 이들 색소에 의해 결정된다. 이들 중 피부의 색을 결정하는 가장 중요한 색소는 멜라닌으로서, 구체적으로, 멜라닌의 양과 분포에 의해 피부색이 결정된다. 멜라닌은 피부 표피 밑에 멜라닌 형성 세포(Melanocyte)라고 불리는 세포에서 생성되며, 피부의 신진대사에 의해 각질 표면으로 이동하여 떨어져 나간다. 피부색에 관계없이 멜라닌 형성 세포의 수는 거의 동일하지만, 단지 멜라닌이 생성되는 양과 종류, 분포가 다르기 때문에 피부색이 차이가 나는 것이다.Pigments that affect skin color include melanin, melanoids, carotene, hemoglobin, and carotenoids, and various colors of skin, hair and eyes are determined by these pigments. Among these, the most important pigment that determines the color of the skin is melanin, specifically, the skin color is determined by the amount and distribution of melanin. Melanin is produced in cells called melanocytes under the skin's epidermis, and moves to the surface of the keratin by metabolism of the skin and falls off. Regardless of the skin color, the number of melanin-forming cells is almost the same, but only because the amount, type, and distribution of melanin is different, the skin color is different.

피부에서 티로신(Tyrosine)이 티로시나아제(Tyrosinase)라는 인체 효소에 의해 도파(DOPA)로 전환되고, 계속되는 일련의 산화과정을 통해 최종적으로 흑갈색의 중합체인 멜라닌이 생성된다. 멜라닌이 필요 이상으로 많이 생기게 되면 기미나 주근깨, 점 등과 같은 과색소침착증을 유발하여 미용상으로 좋지 않은 결과를 가져오게 된다. 한편, 최근 레져 인구의 증가로 인해 외부에서 활동하는 것을 즐기는 사람들이 많아지면서, 자외선에 의한 멜라닌 색소 침착을 막고자 하는 요구가 늘어나고 있는 실정이다. In the skin, tyrosine is converted to DOPA by a human enzyme called tyrosinase, and melanin, a dark brown polymer, is finally produced through a series of oxidation processes. When more melanin is produced than necessary, it causes hyperpigmentation such as spots, freckles, and spots, resulting in poor cosmetic results. Meanwhile, as the number of people who enjoy activities outside due to the recent increase in the leisure population is increasing, there is an increasing demand to prevent melanin pigmentation caused by ultraviolet rays.

이러한 기술적 배경 하에서, 멜라닌 형성 세포의 활성 저해, 티로시나아제의 활성 저해 등과 같은 기작을 통하여, 과도한 멜라닌 생성을 막는 미백제의 개발에 대한 다각적인 연구가 진행되고 있으나(한국 공개특허 제10-2019-0050058호), 아직은 미비한 실정이다.Under this technical background, various studies on the development of whitening agents that prevent excessive melanin production through mechanisms such as inhibition of the activity of melanin-forming cells and inhibition of tyrosinase activity are being conducted (Korean Patent Laid-Open Patent No. 10-2019- 0050058), the situation is still incomplete.

일 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 제공하는 것이다. One aspect is to provide a peptide consisting of the amino acid sequence of SEQ ID NO: 1.

다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 피부 미백용 조성물을 제공하는 것이다. Another aspect is to provide a composition for skin whitening comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

또 다른 양상은 상기 피부 미백용 조성물을 포함하는 화장료 조성물을 제공하는 것이다. Another aspect is to provide a cosmetic composition comprising the composition for skin whitening.

또 다른 양상은 상기 피부 미백용 조성물을 포함하는 멜라닌 색소 과다 침착 질환의 예방 또는 치료용 약제학적 조성물을 제공하는 것이다. Another aspect is to provide a pharmaceutical composition for preventing or treating melanin hyperpigmentation disease comprising the composition for skin whitening.

본 출원의 다른 목적 및 이점은 첨부한 청구범위 및 도면과 함께 하기의 상세한 설명에 의해 보다 명확해질 것이다. 본 명세서에 기재되지 않은 내용은 본 출원의 기술 분야 또는 유사한 기술 분야 내 숙련된 자이면 충분히 인식하고 유추할 수 있는 것이므로 그 설명을 생략한다.Other objects and advantages of the present application will become more apparent by the following detailed description in conjunction with the appended claims and drawings. Details not described in the present specification are omitted because they can be sufficiently recognized and inferred by those skilled in the technical field of the present application or in a similar technical field.

본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.Each description and embodiment disclosed in the present application can be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present application belong to the scope of the present application. In addition, it cannot be considered that the scope of the present application is limited by the specific description described below.

일 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 제공한다. One aspect provides a peptide consisting of the amino acid sequence of SEQ ID NO: 1.

본 명세서에서 사용되는 용어, "펩타이드"는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형의 분자를 의미할 수 있다. 상기 펩타이드는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술(solid-phase synthesis techniques; Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)) 또는 액상 합성 기술 (US 등록특허 제5,516,891호)에 따라 제조될 수 있다. 본 발명자들은 생물학적으로 유효한 활성을 갖는 펩타이드를 개발하고자 예의 노력한 결과, 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 규명하였다. 여기서, 상기 생물학적으로 유효한 활성은 (a) 멜라닌 생성의 억제; (b) 티로시나아제 활성의 억제; 및 (c) MITF, 티로시나아제, 또는 TRP1 발현의 억제와 같은 특성으로부터 선택되는 어느 하나 이상을 나타내는 것일 수 있다. 따라서, 상기 펩타이드는 피부 미백을 위한 용도, 멜라닌 색소 과다 침착 질환의 예방 또는 치료를 위한 용도로 활용될 수 있다. As used herein, the term "peptide" may refer to a linear molecule formed by bonding of amino acid residues to each other by a peptide bond. The peptides are chemically synthesized methods known in the art, in particular solid-phase synthesis techniques; Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase. Peptide Synthesis, 2nd.ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid synthesis technology (US Patent No. 5,516,891). As a result of diligently making efforts to develop a peptide having biologically effective activity, the present inventors have identified a peptide consisting of the amino acid sequence of SEQ ID NO: 1. Here, the biologically effective activity is (a) inhibition of melanin production; (b) inhibition of tyrosinase activity; And (c) MITF, tyrosinase, or inhibition of TRP1 expression. Accordingly, the peptide may be used for skin whitening, for preventing or treating melanin hyperpigmentation diseases.

상기 펩타이드는 화학적 안정성, 강화된 약리 특성(반감기, 흡수성, 역가, 효능 등), 변경된 특이성(예를 들어, 광범위한 생물학적 활성 스펙트럼), 감소된 항원성을 획득하기 위하여, 펩타이드의 N- 또는 C-말단에 보호기가 결합되어 있을 수 있다. 일 구체예에 있어서, 상기 펩타이드의 N-말단은 아세틸기(acetyl group), 플루오레닐메톡시카르보닐기(fluoreonylmethoxycarbonyl group), 포르밀기(formyl group), 팔미토일기(palmitoyl group), 미리스틸기(myristyl group), 스테아릴기(stearyl group), 부톡시카르보닐기(butoxycarbonyl group), 아릴옥시카르보닐기(allyloxycarbonyl group) 및 폴리에틸렌글리콜(polyethylene glycol; PEG)로 이루어진 군으로부터 선택되는 어느 하나의 보호기와 결합될 수 있고; 및/또는 상기 펩타이드의 C-말단은 아미노기(amino group, -NH2), 삼차 알킬기(tertiary alkyl group) 및 아자이드(azide, -NHNH2)로 이루어진 군으로부터 선택되는 어느 하나의 보호기와 결합될 수 있다. 또한, 상기 펩타이드는 선택적으로, 표적화 서열, 태그 (tag), 표지된 잔기, 반감기 또는 펩타이드 안정성을 증가시키기 위한 특정 목적으로 제조된 아미노산 서열도 추가적으로 포함할 수 있다. In order to obtain chemical stability, enhanced pharmacological properties (half-life, absorption, titer, efficacy, etc.), altered specificity (e.g., broad biological activity spectrum), and reduced antigenicity, the peptide is N- or C- A protecting group may be attached to the terminal. In one embodiment, the N-terminus of the peptide is an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, and a myristyl group. group), stearyl group, butoxycarbonyl group, aryloxycarbonyl group, and polyethylene glycol (PEG). ; And/or the C-terminus of the peptide is combined with any one protecting group selected from the group consisting of an amino group (amino group, -NH 2 ), a tertiary alkyl group, and azide (-NHNH 2 ). I can. In addition, the peptide may optionally further include a targeting sequence, a tag, a labeled residue, a half-life, or an amino acid sequence prepared for a specific purpose to increase the stability of the peptide.

본 명세서에서 사용되는 용어, "안정성"은 생체 내 단백질 절단효소의 공격으로부터 상기 펩타이드를 보호하는 인 비보 안정성뿐만 아니라, 저장 안정성 (예컨대, 상온 저장 안정성)도 의미할 수 있다.As used herein, the term "stability" may mean not only in vivo stability that protects the peptide from attack by protein cleavage enzymes in vivo, but also storage stability (eg, room temperature storage stability).

다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 피부 미백용 조성물을 제공한다. Another aspect provides a composition for skin whitening comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

상기 펩타이드에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다.Among the terms or elements mentioned in the description of the peptide, the same as those already mentioned are as described above.

본 명세서에서 사용되는 용어, "피부 미백"은 멜라닌 색소의 합성을 저해함으로써 피부 톤을 밝게 할뿐만 아니라, 자외선, 호르몬 또는 유전에 기인한 피부의 색소 과다 침착을 개선하는 것으로 해석될 수 있다. 여기서, 상기 피부의 색소 과다 침착은 주근깨, 기미, 노인 흑색점, 갈색 반점 또는 검버섯 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. As used herein, the term "skin whitening" may be interpreted as not only brightening skin tone by inhibiting the synthesis of melanin pigment, but also improving hyperpigmentation of skin due to ultraviolet rays, hormones, or genetics. Here, the hyperpigmentation of the skin may include freckles, melasma, black spots in the elderly, brown spots or age spots, but is not limited thereto.

본 명세서에서 사용되는 용어, "개선"은 상태의 완화 또는 치료와 관련된 파라미터, 예를 들면 증상의 정도를 적어도 감소시키는 모든 행위를 의미할 수 있다.As used herein, the term "improvement" may mean all actions of at least reducing the severity of symptoms, such as a parameter related to amelioration or treatment of a condition.

종래의 기능성 펩타이드는 유효한 생물학적 활성에도 불구하고 펩타이드 자체의 크기로 인해, 표적 조직 또는 세포에 효과적으로 유입되지 못하거나 반감기가 짧아 단기간에 체내에서 소멸되는 단점을 보여 주었다. 반면, 일 실시예에 따른 미백용 조성물은 10개 이하의 아미노산으로 이루어진 펩타이드를 유효성분으로 포함하며, 이에 따라, 유효 성분의 피부 침투율 등이 매우 우수하고, 예를 들어, 국소적으로 피부에 도포하는 경우, 유효한 피부 미백 효과를 얻을 수 있다. Conventional functional peptides exhibited a disadvantage that they could not effectively enter target tissues or cells due to the size of the peptide itself, or have a short half-life, and thus disappear in the body in a short period of time, despite the effective biological activity. On the other hand, the composition for whitening according to an embodiment contains a peptide consisting of 10 or less amino acids as an active ingredient, and thus, the skin penetration rate of the active ingredient is very excellent, for example, topically applied to the skin. If so, effective skin whitening effect can be obtained.

일 실시예에 따르면, 상기 펩타이드는 멜라닌의 생성, 예를 들어 여성 호르몬에 의해 유도된 멜라닌의 생성과 티로시아나제 활성을 유의적으로 억제할 수 있었다. 또한, 상기 펩타이드는 멜라닌 생성과 관련된 인자인 MITF, 티로시나아제, 또는 TRP1의 발현을 억제할 수 있었다. 따라서, 상기 펩타이드는 피부 미백용 조성물의 유효성분으로 활용될 수 있다. According to one embodiment, the peptide was able to significantly inhibit the production of melanin, for example, the production of melanin and tyrosyanase activity induced by female hormones. In addition, the peptide was able to inhibit the expression of MITF, tyrosinase, or TRP1, which are factors related to melanogenesis. Therefore, the peptide can be used as an active ingredient in a composition for skin whitening.

또 다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 피부 미백용 화장료 조성물을 제공한다. Another aspect provides a cosmetic composition for skin whitening comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

상기 펩타이드에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다.Among the terms or elements mentioned in the description of the peptide, the same as those already mentioned are as described above.

상기 화장료 조성물은 상기 펩타이드의 화장품학적 유효량(cosmetically effective amount); 및/또는 화장품학적으로 허용되는 담체를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.The cosmetic composition comprises a cosmetically effective amount of the peptide; And/or a cosmetically acceptable carrier, but is not limited thereto.

본 명세서에서 사용되는 용어 "화장품학적 유효량"은 상기 화장료 조성물의 피부 미백 효능을 달성하는 데 충분한 양을 의미한다.The term "cosmetically effective amount" as used herein means an amount sufficient to achieve the skin whitening effect of the cosmetic composition.

상기 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 제한되는 것은 아니다. 예를 들어, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.The cosmetic composition may be prepared in any formulation conventionally prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing, oils , Powder foundation, emulsion foundation, wax foundation, and spray may be formulated, but are not limited thereto. For example, it may be prepared in the form of a flexible lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.

상기 화장료 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the formulation of the cosmetic composition is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide are used as carrier components. Can be.

상기 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 예를 들어, 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the formulation of the cosmetic composition is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier component. For example, in the case of a spray, additional chlorofluoro Propellants such as hydrocarbon, propane/butane or dimethyl ether.

상기 화장료 조성물의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르를 포함할 수 있다.When the formulation of the cosmetic composition is a solution or emulsion, a solvent, a solubilizing agent or an emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

상기 화장료 조성물의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등 이 이용될 수 있다.When the formulation of the cosmetic composition is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, micro Crystalline cellulose, aluminum metahydroxide, bentonite, agar or tracant, and the like may be used.

상기 화장료 조성물의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the formulation of the cosmetic composition is a surfactant containing cleansing, as a carrier component, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid Amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters may be used.

상기 화장료 조성물에 포함되는 성분은 유효 성분으로서의 펩타이드와 담체 성분 이외에, 화장료 조성물에 통상적으로 이용되는 성분들을 포함하며, 예를 들어, 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제를 포함할 수 있다.Ingredients included in the cosmetic composition include ingredients commonly used in cosmetic compositions, in addition to peptides and carrier ingredients as active ingredients, and, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments, and perfumes. Phosphorus adjuvants may be included.

또 다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 화장료 조성물을 개체의 피부에 도포하는 단계를 포함하는, 피부 미백방법을 제공한다. Another aspect provides a skin whitening method comprising the step of applying a cosmetic composition comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient to the skin of an individual.

상기 화장료 조성물에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다.Among the terms or elements mentioned in the description of the cosmetic composition, the same as those already mentioned are as described above.

본 명세서에서 사용되는 용어, "적용하는", "투여하는", 및 "도포하는"은 상호교환적으로 사용되고 일 실시예에 따른 조성물을 원하는 부위로의 적어도 부분적 국소화를 초래하는 것, 또는 투여 경로에 의해 개체 내로 일 실시예에 따른 조성물의 배치하는 것을 의미할 수 있다. As used herein, the terms “applying”, “administering”, and “applying” are used interchangeably and result in at least partial localization of a composition according to an embodiment to a desired site, or route of administration. It may mean disposition of the composition according to an embodiment into the subject by.

또 다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 멜라닌 색소 과다 침착 질환 예방 또는 치료용 약제학적 조성물을 제공한다. Another aspect provides a pharmaceutical composition for preventing or treating melanin hyperpigmentation disease comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

상기 펩타이드에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다.Among the terms or elements mentioned in the description of the peptide, the same as those already mentioned are as described above.

본 명세서에서 용어, "예방"은 상기 조성물의 투여로 질병의 발병을 억제 또는 지연시키는 모든 행위를 의미한다.As used herein, the term "prevention" refers to any action that suppresses or delays the onset of a disease by administration of the composition.

본 명세서에서 용어, "치료"는 질병을 앓거나 또는 질병이 발병할 위험이 있는 개체에게, 상기 개체의 상태(예를 들면, 하나 이상의 증상)의 개선, 질병 진행의 지연, 증상 발생의 지연 또는 증상 진행의 둔화 등을 포함한 효과를 제공하는 임의의 형태의 치료를 의미한다. 따라서, 상기 "치료" 및 "예방"은 증상의 치유 또는 완전한 제거를 의미하도록 의도되지 않는다.As used herein, the term "treatment" refers to an individual suffering from or at risk of developing a disease, improving the condition (eg, one or more symptoms) of the individual, delaying the progression of the disease, delaying the onset of symptoms, or It refers to any form of treatment that provides an effect, including slowing the progression of symptoms, and the like. Thus, the "treatment" and "prevention" are not intended to mean cure or complete elimination of symptoms.

상기 "개체"는 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는, 인간 또는 비-인간인 영장류, 생쥐(mouse), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.The "individual" refers to a subject in need of treatment of a disease, and more specifically, refers to a mammal such as a human or non-human primate, mouse, dog, cat, horse, and cow.

상기 약제학적 조성물에 의한 예방 또는 치료 대상 질병인, "멜라닌 색소 과다 침착 질환"은 멜라닌 색소가 과다하게 생성되어 피부에 침착되는 질환을 총칭하는 것일 수 있으며, 예를 들어, 기미, 주근깨, 노인성 색소반, 또는 일광흑색종(solar lentigines)일 수 있으나, 이에 제한되는 것은 아니다. The disease to be prevented or treated by the pharmaceutical composition, "melanocyte hyperpigmentation disease" may be a generic term for a disease in which melanin pigment is excessively produced and deposited on the skin, for example, spots, freckles, senile pigments It may be half, or solar lentigines, but is not limited thereto.

상기 약제학적 조성물은 상기 펩타이드의 약제학적 유효량(pharmaceutically effective amount); 및/또는 약제학적으로 허용되는 담체를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.The pharmaceutical composition comprises a pharmaceutically effective amount of the peptide; And/or a pharmaceutically acceptable carrier, but is not limited thereto.

본 명세서에서 사용되는 용어 "약제학적 유효량"은 상기 약제학적 조성물의 멜라닌 색소 과다 침착 질환 예방 또는 치료 효능을 달성하는 데 충분한 양을 의미할 수 있다.The term "pharmaceutically effective amount" as used herein may mean an amount sufficient to achieve the effect of preventing or treating melanin hyperpigmentation disease of the pharmaceutical composition.

상기 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.The pharmaceutically acceptable carrier is commonly used in the formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but are not limited thereto. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

상기 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있으나, 이에 제한되는 것은 아니다.The pharmaceutical composition may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components, but is not limited thereto.

상기 약제학적 조성물은 경구 또는 비경구, 바람직하게는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 근육 주입, 정맥 내 주입, 피하 주입, 복강 주입, 국소 투여, 경피 투여 등으로 투여할 수 있으나, 이에 한정되는 것은 아니다.The pharmaceutical composition may be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, it may be administered by intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, topical administration, transdermal administration, etc. , But is not limited thereto.

상기 약제학적 조성물의 투여량은 1일당 0.0001 내지 1000 ug(마이크로그램, 0.001 내지 1000 ug, 0.01 내지 1000 ug, 0.1 내지 1000 ug, 또는 1.0 내지 1000 ug일 수 있으나, 이에 제한되는 것은 아니며, 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다.The dosage of the pharmaceutical composition may be 0.0001 to 1000 ug per day (micrograms, 0.001 to 1000 ug, 0.01 to 1000 ug, 0.1 to 1000 ug, or 1.0 to 1000 ug, but is not limited thereto, and the formulation method , Mode of administration, patient's age, weight, sex, pathological condition, food, administration time, route of administration, excretion rate and response sensitivity.

상기 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.The pharmaceutical composition is prepared in a unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person having ordinary knowledge in the art, or It can be manufactured by being enclosed in a multi-volume container.

상기 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나, 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 및/또는 안정화제를 추가적으로 포함할 수 있다.The formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant and/or a stabilizer.

또 다른 양상은 치료학적 유효량의 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 약제학적 조성물을 개체에 투여하는 단계를 포함하는, 멜라닌 색소 과다 침착 질환을 예방 또는 치료하는 방법을 제공한다. Another aspect provides a method for preventing or treating melanin hyperpigmentation disease comprising administering to an individual a pharmaceutical composition comprising a therapeutically effective amount of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient. .

상기 약제학적 조성물에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다.Among the terms or elements mentioned in the description of the pharmaceutical composition, the same as those already mentioned are as described above.

또 다른 양상은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 유효성분으로 포함하는 피부 미백용 식품 조성물을 제공한다. Another aspect provides a food composition for skin whitening comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

상기 펩타이드에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다. Among the terms or elements mentioned in the description of the peptide, the same as those already mentioned are as described above.

상기 식품 조성물에 함유된 유효성분으로서의 펩타이드의 함량은 식품의 형태, 소망하는 용도 등에 따라 적절하게 비제한적으로 선택될 수 있으며, 예를 들어, 전체 식품 중량의 0.01 내지 15 중량%로 첨가할 수 있다. 또한 예를 들어, 건강 음료 조성물은 100 ml를 기준으로 0.02 내지 10 g, 바람직하게는 0.3 내지 1 g의 비율로 첨가할 수 있다.The content of the peptide as an active ingredient contained in the food composition may be appropriately selected, without limitation, depending on the form of the food, the desired use, etc., and, for example, may be added in an amount of 0.01 to 15% by weight of the total food weight. . In addition, for example, the health beverage composition may be added in an amount of 0.02 to 10 g, preferably 0.3 to 1 g, based on 100 ml.

일 양상에 따른 펩타이드에 의하면, 멜라닌의 생성과 티로시아나제 활성을 유의적으로 억제할 뿐만 아니라, 멜라닌 생성 관련 인자들의 발현을 억제함으로써, 우수한 피부 미백 효과를 나타낸다. According to the peptide according to an aspect, not only significantly inhibits the production of melanin and tyrosyanase activity, but also exhibits excellent skin whitening effect by inhibiting the expression of factors related to melanogenesis.

일 양상에 따른 펩타이드에 의하면, 멜라닌의 생성과 티로시아나제 활성을 유의적으로 억제할 뿐만 아니라, 멜라닌 생성 관련 인자들의 발현을 억제함으로써, 피부의 멜라닌 색소 과다 침착 질환을 완화 또는 개선하는데 적용할 수 있다. According to the peptide according to an aspect, it can be applied to alleviate or ameliorate melanin hyperpigmentation disorders of the skin by significantly inhibiting the production of melanin and tyrosyanase activity, as well as inhibiting the expression of factors related to melanogenesis. I can.

따라서, 일 양상에 따른 펩타이드는 피부 미백용 조성물 또는 멜라닌 색소 과다 침착 질환 예방 또는 치료용 약제학적 조성물의 유효성분으로 활용될 수 있다. Therefore, the peptide according to an aspect may be used as an active ingredient in a composition for skin whitening or a pharmaceutical composition for preventing or treating melanin hyperpigmentation disease.

도 1은 서열번호 1의 아미노산 서열로 이루어진 펩타이드를 B16F10 세포에 첨가한 후, 멜라닌의 생성 감소를 확인한 결과이다.
도 2는 상기 펩타이드를 B16F10 세포에 첨가한 후, 티로시나아제의 활성 감소를 확인한 결과이다.
도 3은 상기 펩타이드를 B16F10 세포에 첨가한 후, 멜라닌 생성 관련 유전자인 MITF, 티로시나아제, 및 TRP1의 발현 억제를 확인한 결과이다.
도 4은 상기 펩타이드를 B16F10 세포에 첨가한 후, 멜라닌 생성 관련 단백질인 MITF, 티로시나아제, 및 TRP1의 발현 억제를 확인한 결과이다.
도 5는 상기 펩타이드를 B16F10 세포에 첨가한 후, beta-estradiol에 의해 유도된 멜라닌의 생성 감소를 확인한 결과이다.
1 is a result of confirming a decrease in melanin production after adding a peptide consisting of the amino acid sequence of SEQ ID NO: 1 to B16F10 cells.
2 is a result of confirming the decrease in tyrosinase activity after adding the peptide to B16F10 cells.
3 is a result of confirming the inhibition of the expression of MITF, tyrosinase, and TRP1, which are genes related to melanogenesis after addition of the peptide to B16F10 cells.
4 is a result of confirming the inhibition of the expression of MITF, tyrosinase, and TRP1, which are proteins related to melanogenesis after addition of the peptide to B16F10 cells.
5 is a result of confirming the decrease in melanin production induced by beta-estradiol after adding the peptide to B16F10 cells.

이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

실시예 1. 펩타이드의 합성 Example 1. Synthesis of Peptide

자동 펩타이드 합성기(Milligen 9050, Millipore, 미국)를 이용하여 하기의 [표 1]에 기재된 서열번호 1의 아미노산 서열을 갖는 펩타이드를 합성하고, C18 역상 고성능액체크로마토그래피(HPLC)(Waters Associates, 미국)를 이용하여 이들 합성된 펩타이드를 순수 분리하였다. 컬럼은 ACQUITY UPLC BEH300 C18 (2.1 ㎜ Х 100 ㎜, 1.7㎛, Waters Co, 미국)을 이용하였다.Using an automatic peptide synthesizer (Milligen 9050, Millipore, USA) to synthesize a peptide having the amino acid sequence of SEQ ID NO: 1 shown in the following [Table 1], C18 reverse phase high performance liquid chromatography (HPLC) (Waters Associates, USA) These synthesized peptides were purely isolated using. As a column, ACQUITY UPLC BEH300 C18 (2.1 mm Х 100 mm, 1.7 μm, Waters Co, USA) was used.

서열번호Sequence number 서열 (5'->3')Sequence (5'->3') 1One QHYFHYPRTQHYFHYPRT

실시예 2. 멜라닌 생성 억제 효과 확인 Example 2. Confirmation of melanin production inhibitory effect

마우스 흑색종 세포인 B16F10 세포를 6-웰 플레이트에 5×104 cells/well의 밀도로 시딩한 후, 이를 16 시간 동안 배양하였다. 이후, 배양 배지를 2% 혈청이 포함된 배지로 교체한 뒤, 여기에 멜라닌의 생성을 촉진하기 위하여, 200ng/ml의 α-MSH(α-melanocyte-stimulating hormones)를 첨가하였으며, 이와 함께, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 각각을 10μM, 50μM, 100μM, 또는 200μM로 첨가한 뒤, 이를 72시간 동안 배양하였다. 이후, 배양된 세포를 1N의 NaOH로 용해시킨 뒤, 450 nm에서의 흡광도를 측정하였다. 한편, 대조군으로 미처리군(Con)을 사용하였고, 음성 대조군으로 α-MSH 만을 첨가한 군, 양성 대조군으로 피부 미백제로 알려진 Arbutin (200μM, 500μM) 및 α-MSH를 첨가한 군을 사용하였다. B16F10 cells, which are mouse melanoma cells, were seeded in a 6-well plate at a density of 5×10 4 cells/well, and then cultured for 16 hours. Thereafter, after replacing the culture medium with a medium containing 2% serum, 200 ng/ml of α-MSH (α-melanocyte-stimulating hormones) was added thereto to promote the production of melanin, and with this, the sequence Each of the peptides consisting of the amino acid sequence of number 1 was added in an amount of 10 μM, 50 μM, 100 μM, or 200 μM, and then incubated for 72 hours. Thereafter, the cultured cells were dissolved with 1N NaOH, and the absorbance at 450 nm was measured. On the other hand, an untreated group (Con) was used as a control, a group to which only α-MSH was added as a negative control, and a group to which Arbutin (200 μM, 500 μM) and α-MSH, known as skin whitening agents, and α-MSH were added as a positive control were used.

그 결과, 도 1에 나타낸 바와 같이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 첨가에 의해, 농도 의존적으로 멜라닌의 생성이 감소됨을 확인하였다. As a result, as shown in Fig. 1, by the addition of the peptide consisting of the amino acid sequence of SEQ ID NO: 1, it was confirmed that the production of melanin was reduced in a concentration-dependent manner.

실시예 3. 티로시나아제 활성 억제 효과 확인Example 3. Confirmation of tyrosinase activity inhibition effect

마우스 흑색종 세포인 B16F10 세포를 6-웰 플레이트에 5×104 cells/well의 밀도로 시딩한 후, 이를 16 시간 동안 배양하였다. 이후, 배양 배지를 2% 혈청이 포함된 배지로 교체한 뒤, 여기에 200ng/ml의 α-MSH를 첨가하였으며, 이와 함께, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 각각을 1μM, 10μM, 20μM, 40μM, 60μM, 80μM, 또는 160μM로 첨가한 뒤, 이를 72시간 동안 배양하였다. 아이스 위에 상기 6-웰 플레이트를 위치시키고, 차가운 PBS로 2회 세척한 후, 여기에 1% triton X-100가 함유된 0.1M 인산 나트륨 버퍼 (pH 6.8, 용해 버퍼)를 첨가하여 세포를 용해시켰다. 이후, 상기 웰 플레이트에 존재하는 세포를 scrapping하여 1.5ml tube에 모은 뒤, 이를 Vortexing하고 15,000 rpm에서 10분간 원심분리하여 상층액을 수득하였다. 이후, 상층액 내 단백질을 정량하여, 일정량의 단백질이 포함되도록 조정한 뒤, 여기에 버퍼를 첨가하여, 총 90ul의 시료를 96-웰 플레이트 상에 분주하였다. 또한, 상기 플레이트에서, 실험 시료, Blank 시료, 양성 대조군 시료는 하기 표 2에 나타낸 바와 같이 준비하였다. B16F10 cells, which are mouse melanoma cells, were seeded in a 6-well plate at a density of 5×10 4 cells/well, and then cultured for 16 hours. Thereafter, after replacing the culture medium with a medium containing 2% serum, 200 ng/ml of α-MSH was added thereto, and with this, each of the peptides consisting of the amino acid sequence of SEQ ID NO: 1 was 1 μM, 10 μM, 20 μM, After the addition of 40 μM, 60 μM, 80 μM, or 160 μM, it was incubated for 72 hours. The 6-well plate was placed on ice, washed twice with cold PBS, and then 0.1M sodium phosphate buffer (pH 6.8, lysis buffer) containing 1% triton X-100 was added thereto to lyse the cells. . Thereafter, the cells present in the well plate were scrapped and collected in a 1.5 ml tube, vortexed, and centrifuged at 15,000 rpm for 10 minutes to obtain a supernatant. Thereafter, the protein in the supernatant was quantified, adjusted to contain a certain amount of protein, and then a buffer was added thereto, and a total of 90 ul of a sample was dispensed onto a 96-well plate. In addition, in the plate, an experimental sample, a blank sample, and a positive control sample were prepared as shown in Table 2 below.

실험 시료Experimental sample Blank 시료Blank sample 양성 대조군 시료Positive control sample 시료sample 90μl90μl -- -- 버퍼buffer -- 90μl90μl 90μl90μl 버섯 티로시나아제
(0.1 mg/ml)
Mushroom tyrosinase
(0.1 mg/ml)
-- -- 10μl10μl

이후, 각각의 시료에 20μL의 10mM L-DOPA를 첨가한 뒤, 37℃에서 1시간 배양 후, 475 nm에서의 흡광도를 측정하였다. 한편, 대조군으로 미처리군(Con)을 사용하였고, 음성 대조군으로 α-MSH 만을 첨가한 군, 양성 대조군으로 Arbutin (200μM, 500μM) 및 α-MSH를 첨가한 군을 사용하였다. Thereafter, 20 μL of 10 mM L-DOPA was added to each sample, followed by incubation at 37° C. for 1 hour, and absorbance at 475 nm was measured. Meanwhile, an untreated group (Con) was used as a control, a group to which only α-MSH was added as a negative control, and a group to which Arbutin (200 μM, 500 μM) and α-MSH were added as a positive control were used.

그 결과, 도 2에 나타낸 바와 같이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 첨가에 의해, 티로시나아제 활성이 억제됨을 확인하였다. As a result, as shown in FIG. 2, it was confirmed that tyrosinase activity was inhibited by the addition of a peptide consisting of the amino acid sequence of SEQ ID NO: 1.

실시예 4. 멜라닌 생성 관련 유전자의 발현 억제 효과 확인Example 4. Confirmation of the effect of inhibiting the expression of genes related to melanogenesis

마우스 흑색종 세포인 B16F10 세포를 6-웰 플레이트에 5×104 cells/well의 밀도로 시딩한 후, 이를 16 시간 동안 배양하였다. 이후, 배양 배지를 2% 혈청이 포함된 배지로 교체한 뒤, 여기에 200ng/ml의 α-MSH를 첨가하였으며, 이와 함께, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 각각을 10μM, 50μM, 또는 100μM로 첨가한 뒤, 이를 72시간 동안 배양하였다. 상기 배양된 세포로부터 mRNA를 추출한 뒤, cDNA synthesis kit & PCR pre-mix (Intron, Korea)를 사용하여, 상기 추출된 mRNA를 역전사시킴으로써 각각의 cDNA를 합성하였다. 이후, 상기 cDNA와 MITF, Tyrosinase, 및 TRP1 프라이머를 사용하여 중합효소연쇄 반응(polymerase chain reaction: PCR)을 수행하였다. 한편, 대조군, 음성 대조군 및 양성 대조군은 실시예 2과 동일한 군을 사용하였으며, 본 실시예에서 사용한 프라이머의 뉴클레오타이드 서열은 하기 표 3과 같다. B16F10 cells, which are mouse melanoma cells, were seeded in a 6-well plate at a density of 5×10 4 cells/well, and then cultured for 16 hours. Thereafter, after replacing the culture medium with a medium containing 2% serum, 200 ng/ml of α-MSH was added thereto, and with this, each of the peptides consisting of the amino acid sequence of SEQ ID NO: 1 was 10 μM, 50 μM, or 100 μM. After addition, it was incubated for 72 hours. After extracting the mRNA from the cultured cells, each cDNA was synthesized by reverse transcription of the extracted mRNA using a cDNA synthesis kit & PCR pre-mix (Intron, Korea). Thereafter, a polymerase chain reaction (PCR) was performed using the cDNA and MITF, Tyrosinase, and TRP1 primers. Meanwhile, the same group as in Example 2 was used as the control, negative control, and positive control, and the nucleotide sequences of the primers used in this example are shown in Table 3 below.

프라이머명Primer name 서열 (5'->3')Sequence (5'->3') 서열번호Sequence number MITFMITF 정방향Forward direction CCAGCCTGGCGATCATGTCATCCAGCCTGGCGATCATGTCAT 22 역방향Reverse GGTCTGGACAGGAGTTGCTGGGTCTGGACAGGAGTTGCTG 33 TyrosinaseTyrosinase 정방향Forward direction GGCCAGCTTTCAGGCAGAGGGGCCAGCTTTCAGGCAGAGG 44 역방향Reverse TGGTGCTTCATGGGCAAAATTGGTGCTTCATGGGCAAAAT 55 TRP1TRP1 정방향Forward direction TCTGTGAAGGTGTGCAGGAGTCTGTGAAGGTGTGCAGGAG 66 역방향Reverse CCGAAACAGAGTGGAAGGTTCCGAAACAGAGTGGAAGGTT 77 GAPDHGAPDH 정방향Forward direction GGTGTGAACGGATTTGGCCGTATTGGGTGTGAACGGATTTGGCCGTATTG 88 역방향Reverse CCGTTGAATTTGCCGTGAGTGGAGTCCGTTGAATTTGCCGTGAGTGGAGT 99

그 결과, 도 3에 나타낸 바와 같이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 첨가에 의해, 멜라닌 생성 관련 유전자인 MITF, Tyrosinase, 및 TRP1의 발현이 억제됨을 확인하였다. As a result, as shown in Figure 3, by the addition of the peptide consisting of the amino acid sequence of SEQ ID NO: 1, it was confirmed that the expression of melanogenesis-related genes MITF, Tyrosinase, and TRP1 was suppressed.

실시예 5. 멜라닌 생성 관련 단백질의 발현 억제 효과 확인 Example 5. Confirmation of the effect of inhibiting the expression of proteins related to melanogenesis

마우스 흑색종 세포인 B16F10 세포를 6-웰 플레이트에 5×104 cells/well의 밀도로 시딩한 후, 이를 16 시간 동안 배양하였다. 이후, 배양 배지를 2% 혈청이 포함된 배지로 교체한 뒤, 여기에 200ng/ml의 α-MSH를 첨가하였으며, 이와 함께, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 각각을 10μM, 50μM, 100μM, 또는 200μM로 첨가한 뒤, 이를 72시간 동안 배양하였다. 이후, 배양된 세포를 용해한 뒤, MITF, Tyrosinase, 및 TRP-1에 대한 항체(santacruz biotechnology, USA)를 사용하여 웨스턴 블롯을 수행하였다. 한편, 대조군, 음성 대조군 및 양성 대조군은 실시예 2과 동일한 군을 사용하였다. B16F10 cells, which are mouse melanoma cells, were seeded in a 6-well plate at a density of 5×10 4 cells/well, and then cultured for 16 hours. Thereafter, after replacing the culture medium with a medium containing 2% serum, 200 ng/ml of α-MSH was added thereto, and with this, each of the peptides consisting of the amino acid sequence of SEQ ID NO: 1 was 10 μM, 50 μM, 100 μM, Alternatively, after addition to 200 μM, it was incubated for 72 hours. Thereafter, after lysing the cultured cells, Western blot was performed using antibodies against MITF, Tyrosinase, and TRP-1 (santacruz biotechnology, USA). Meanwhile, the same group as in Example 2 was used as the control, negative control and positive control.

그 결과, 도 4에 나타낸 바와 같이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 첨가에 의해, 멜라닌 생성 관련 단백질인 MITF, Tyrosinase, 및 TRP-1의 발현이 억제됨을 확인하였다. As a result, as shown in Figure 4, by the addition of the peptide consisting of the amino acid sequence of SEQ ID NO: 1, it was confirmed that the expression of the melanogenesis-related proteins MITF, Tyrosinase, and TRP-1 was suppressed.

실시예 6. 여성호르몬에 의해 유도된 멜라닌 생성 억제 효과 확인 Example 6. Confirmation of the inhibitory effect of melanin production induced by female hormones

기미, 주근깨 등과 같은 멜라닌 색소 과다 침착 질환은 여성호르몬의 변화에 의해 유발되는 것으로 알려져 있다. 이에, 본 실시예에서는 여성호르몬에 의해 유도된 멜라닌의 생성에 서열번호 1의 아미노산 서열로 이루어진 펩타이드가 미치는 영향을 확인하고자 하였다. 구체적으로, 마우스 흑색종 세포인 B16F10 세포를 6-웰 플레이트에 5×104 cells/well의 밀도로 시딩한 후, 이를 16 시간 동안 배양하였다. 이후, 배양 배지를 2% 혈청이 포함된 배지로 교체한 뒤, 여기에 멜라닌의 생성을 촉진하기 위하여, 5μM의 beta-estradiol을 첨가하였으며, 이와 함께, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 각각을 10μM, 50μM, 또는 100μM로 첨가한 뒤, 이를 72시간 동안 배양하였다. 이후, 배양된 세포를 1N의 NaOH로 용해시킨 뒤, 450 nm에서의 흡광도를 측정하였다. 한편, 대조군으로 미처리군(Con)을 사용하였고, 음성 대조군으로 beta-estradiol 만을 첨가한 군, 양성 대조군으로 피부 미백제로 알려진 Arbutin (200μM, 500μM) 및 beta-estradiol을 첨가한 군을 사용하였다. It is known that melanin hyperpigmentation disorders such as spots and freckles are caused by changes in female hormones. Thus, in this example, the effect of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 on the production of melanin induced by female hormones was examined. Specifically, mouse melanoma cells, B16F10 cells, were seeded in a 6-well plate at a density of 5×10 4 cells/well, and then cultured for 16 hours. Thereafter, after replacing the culture medium with a medium containing 2% serum, 5 μM of beta-estradiol was added thereto to promote the production of melanin, and with this, each of the peptides consisting of the amino acid sequence of SEQ ID NO: 1 After the addition of 10 μM, 50 μM, or 100 μM, it was incubated for 72 hours. Thereafter, the cultured cells were dissolved with 1N NaOH, and the absorbance at 450 nm was measured. On the other hand, an untreated group (Con) was used as a control, a group to which only beta-estradiol was added as a negative control, and a group to which Arbutin (200 μM, 500 μM) and beta-estradiol, known as skin whitening agents, were added as a positive control.

그 결과, 도 5에 나타낸 바와 같이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 첨가에 의해, 농도 의존적으로 멜라닌의 생성이 감소됨을 확인하였다. As a result, as shown in Figure 5, by the addition of the peptide consisting of the amino acid sequence of SEQ ID NO: 1, it was confirmed that the production of melanin was reduced in a concentration-dependent manner.

상기 실험 결과를 종합하면, 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드는 피부의 미백 효능을 지니고 있음을 알 수 있었다. In summary, it was found that the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment has skin whitening effect.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.The above description of the present invention is for illustrative purposes only, and those of ordinary skill in the art to which the present invention pertains will be able to understand that other specific forms can be easily modified without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative and non-limiting in all respects.

<110> CAREGEN CO., LTD. <120> Peptide having activities of skin whitening and uses thereof <130> P1908KR_PN127142KR <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> peptide 1 <400> 1 Gln His Tyr Phe His Tyr Pro Arg Thr 1 5 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MITF_F <400> 2 ccagcctggc gatcatgtca t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MITF_R <400> 3 ggtctggaca ggagttgctg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tyrosinase_F <400> 4 ggccagcttt caggcagagg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tyrosinase_R <400> 5 tggtgcttca tgggcaaaat 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRP1_F <400> 6 tctgtgaagg tgtgcaggag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRP1_R <400> 7 ccgaaacaga gtggaaggtt 20 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 8 ggtgtgaacg gatttggccg tattg 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 9 ccgttgaatt tgccgtgagt ggagt 25 <110> CAREGEN CO., LTD. <120> Peptide having activities of skin whitening and uses thereof <130> P1908KR_PN127142KR <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> peptide 1 <400> 1 Gln His Tyr Phe His Tyr Pro Arg Thr 1 5 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MITF_F <400> 2 ccagcctggc gatcatgtca t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MITF_R <400> 3 ggtctggaca ggagttgctg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tyrosinase_F <400> 4 ggccagcttt caggcagagg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tyrosinase_R <400> 5 tggtgcttca tgggcaaaat 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRP1_F <400> 6 tctgtgaagg tgtgcaggag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRP1_R <400> 7 ccgaaacaga gtggaaggtt 20 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 8 ggtgtgaacg gatttggccg tattg 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 9 ccgttgaatt tgccgtgagt ggagt 25

Claims (8)

서열번호 1의 아미노산 서열로 이루어진 펩타이드. A peptide consisting of the amino acid sequence of SEQ ID NO: 1. 청구항 1에 있어서, 상기 펩타이드의 N-말단은 아세틸기(acetyl group), 플루오레닐메톡시카르보닐기(fluoreonylmethoxycarbonyl group), 포르밀기(formyl group), 팔미토일기(palmitoyl group), 미리스틸기(myristyl group), 스테아릴기(stearyl group), 부톡시카르보닐기(butoxycarbonyl group), 아릴옥시카르보닐기(allyloxycarbonyl group) 및 폴리에틸렌글리콜(polyethylene glycol; PEG)로 이루어진 군으로부터 선택되는 어느 하나의 보호기와 결합된 것인, 펩타이드. The method according to claim 1, wherein the N-terminus of the peptide is an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, and a myristyl group. ), stearyl group, butoxycarbonyl group, aryloxycarbonyl group, and polyethylene glycol (PEG). Peptide. 청구항 1에 있어서, 상기 펩타이드의 C-말단은 아미노기(amino group, -NH2), 삼차 알킬기(tertiary alkyl group) 및 아자이드(azide, -NHNH2)로 이루어진 군으로부터 선택되는 어느 하나의 보호기와 결합된 것인, 펩타이드. The method according to claim 1, wherein the C-terminus of the peptide is any one protecting group selected from the group consisting of an amino group (-NH 2 ), a tertiary alkyl group, and an azide (-NHNH 2) Which is bound, the peptide. 청구항 1에 있어서, 상기 펩타이드는 하기와 같은 특성으로부터 선택되는 어느 하나 이상을 나타내는 것인, 펩타이드:
(a) 멜라닌 생성의 억제;
(b) 티로시나아제 활성의 억제; 및
(c) MITF, 티로시나아제, 또는 TRP1 발현의 억제.
The peptide of claim 1, wherein the peptide exhibits any one or more selected from the following properties:
(a) inhibition of melanogenesis;
(b) inhibition of tyrosinase activity; And
(c) inhibition of MITF, tyrosinase, or TRP1 expression.
청구항 1 내지 4 중 어느 한 항의 펩타이드를 유효성분으로 포함하는 피부 미백용 조성물. A composition for skin whitening comprising the peptide of any one of claims 1 to 4 as an active ingredient. 청구항 5의 피부 미백용 조성물을 포함하는 화장료 조성물. A cosmetic composition comprising the composition for skin whitening of claim 5. 청구항 5의 피부 미백용 조성물을 포함하는 멜라닌 색소 과다 침착 질환의 예방 또는 치료용 약제학적 조성물. A pharmaceutical composition for preventing or treating melanin hyperpigmentation disease comprising the composition for skin whitening of claim 5. 청구항 7에 있어서, 상기 멜라닌 색소 과다 침착 질환은 기미, 주근깨, 노인성 색소반, 또는 일광흑색종(solar lentigines)인 것인, 약제학적 조성물. The pharmaceutical composition of claim 7, wherein the melanin hyperpigmentation disease is melasma, freckles, senile pigment spots, or solar lentigines.
KR1020190101882A 2019-08-20 2019-08-20 Peptide having activities of skin whitening and uses thereof KR102265434B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190101882A KR102265434B1 (en) 2019-08-20 2019-08-20 Peptide having activities of skin whitening and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190101882A KR102265434B1 (en) 2019-08-20 2019-08-20 Peptide having activities of skin whitening and uses thereof

Publications (2)

Publication Number Publication Date
KR20210022409A true KR20210022409A (en) 2021-03-03
KR102265434B1 KR102265434B1 (en) 2021-06-15

Family

ID=75151244

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190101882A KR102265434B1 (en) 2019-08-20 2019-08-20 Peptide having activities of skin whitening and uses thereof

Country Status (1)

Country Link
KR (1) KR102265434B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024106823A1 (en) * 2022-11-18 2024-05-23 (주)케어젠 Peptide having skin whitening activity and use thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011116090A1 (en) * 2010-03-17 2011-09-22 Abbott Research B.V. Anti-nerve growth factor (ngf) antibody compositions
JP2015110601A (en) * 2003-12-24 2015-06-18 アボット・110・ベーフェー Humanized anti-NGF antibody
KR20170073821A (en) * 2015-12-18 2017-06-29 (주)케어젠 Peptide for Skin Whitening and Use Thereof
KR20180019972A (en) * 2016-08-17 2018-02-27 (주)진셀팜 Peptide with high whitening activity, and uses thereof
KR101849725B1 (en) * 2016-06-09 2018-04-18 주식회사 루비크라운 Peptides with melanogenesis-inhibiting activity and compositions thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015110601A (en) * 2003-12-24 2015-06-18 アボット・110・ベーフェー Humanized anti-NGF antibody
WO2011116090A1 (en) * 2010-03-17 2011-09-22 Abbott Research B.V. Anti-nerve growth factor (ngf) antibody compositions
KR20170073821A (en) * 2015-12-18 2017-06-29 (주)케어젠 Peptide for Skin Whitening and Use Thereof
KR101849725B1 (en) * 2016-06-09 2018-04-18 주식회사 루비크라운 Peptides with melanogenesis-inhibiting activity and compositions thereof
KR20180019972A (en) * 2016-08-17 2018-02-27 (주)진셀팜 Peptide with high whitening activity, and uses thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024106823A1 (en) * 2022-11-18 2024-05-23 (주)케어젠 Peptide having skin whitening activity and use thereof

Also Published As

Publication number Publication date
KR102265434B1 (en) 2021-06-15

Similar Documents

Publication Publication Date Title
KR102299411B1 (en) Peptide having activities of skin whitening and uses thereof
JP7323707B2 (en) Peptide having skin condition improving activity and use thereof
JP7323706B2 (en) Peptide having hair growth promoting activity and use thereof
US11453700B2 (en) Peptide having activities of skin whitening and uses thereof
JP7323705B2 (en) Peptide having hair growth promoting activity and use thereof
KR102265434B1 (en) Peptide having activities of skin whitening and uses thereof
KR20230099483A (en) Peptide having activities of skin condition improvement and uses thereof
KR20230099480A (en) Peptide having activities of skin condition improvement and uses thereof

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant