KR20200137480A - Target nucleic acid detection kit comprising a target nucleic acid detection structure and signal amplification agent - Google Patents

Abstract

The present invention relates to a target nucleic acid detection kit comprising a target nucleic acid detection structure including a porous hydrogel microparticle and a probe immobilized on the microparticle, and a signal amplification agent including an amplification initiator and a plurality of hairpin adapters. The target nucleic acid multi-detection kit comprises an amplification initiator and a plurality of hairpin adapters to amplify a signal, thereby increasing detection efficiency, and also comprises the target nucleic acid detection structure to identify whether different targets are detected or not through a region where a signal occurs in a detection apparatus, thereby allowing simultaneous detection of multiple nucleic acids even when various types of nucleic acids are mixed, and also allowing the use of a single type of amplification initiator and a single type of hairpin adapter regardless of types of probe and nucleic acid. Accordingly, the multiple nucleic acid detection is possible in a time and cost-effective manner.

Description

Target nucleic acid detection kit comprising a target nucleic acid detection structure and signal amplification agent

Disclosed herein is a target nucleic acid detection kit including a target nucleic acid detection construct including a porous hydrogel microparticle and a probe immobilized on the microparticle, and a signal amplification agent including an amplification initiator and a plurality of hairpin adapters.

A technology has been developed to simultaneously analyze many target nucleic acids in one channel using a polymerase chain reaction (PCR). Solid-Phase PCR (Solid-Phase PCR) is a technology for simultaneously analyzing multiple target nucleic acids, and uses a primer or probe fixed on a solid surface. For example, a method of detecting miRNA using fluorescence by immobilizing a probe in a hydrogel is used, but this is because only one fluorescent dye reacts by binding to one probe that binds to the target nucleic acid. Due to its low intensity, it is difficult to determine the presence of target nucleic acids (Rapid microRNA profiling on encoded gel microparticles, Stephen C. Cahpin et al., Angewandte Chem International Edition, Volume 50, Issue 10). In addition, there is a method of detecting the target by amplifying the signal by immobilizing the enzyme in the hydrogel, but when the target binds to the probe in the hydrogel, the enzyme is bound and then a hydrophobic liquid is injected to confine the reactant in the hydrogel. Additional processing is required, resulting in poor time and cost efficiency, and difficulty in simultaneous multiplex detection (Sensitive and multiplexed on-chip microRNA profiling in oil-isolated hydrogel chambers, Lee H et al., Angew Chem Int Ed Engl. 2015) Feb 16;54(8):2477-81).

Meanwhile, as a conventional real-time PCR detection method, there is a method of using a double-stranded DNA binding dye, a double-labeled oligonucleotide, such as a hairpin primer, and a hairpin probe. However, the disadvantage of this real-time PCR is its limited complexing ability. Specifically, conventional real-time PCR techniques use a reporter fluorescent dye that is fluid in a solution, which requires the use of two or more fluorescent dyes that are spectrally distinguished for each detection reaction in a complex reaction to detect multiple target nucleic acids. To For example, in order to detect four target sequences, in addition to the control, equipment for distinguishing four different fluorochromes by spectral differentiation is required. This need not only limits the practical complexing capability, but increases cost as such equipment typically requires a source, detector and filter.

Hybridization Chain Reaction (HCR) was devised to overcome the problems of the prior art and to check only the mRNA expression at a specific location, but this is an amplification initiator and a hairpin adapter having different nucleotide sequences depending on the type of target nucleic acid. , And other types of fluorescent dyes, respectively, are inefficient in terms of time and cost, and multiple detection is difficult. In addition, the HCR is intended to detect multiple levels of mRNA in a living body, that is, in cells or embryos through signal amplification in situ, and it is difficult to derive a new reaction condition to perform it outside the body, for example, in a gel. have.

Accordingly, the present inventors have completed the invention of a target nucleic acid detection kit capable of simultaneously detecting multiple nucleic acids using the same type of amplification initiator and hairpin adapter, and the same type of fluorescent dye regardless of the type of target nucleic acid to be detected. .

Rapid microRNA profiling on encoded gel microparticles, Stephen C. Cahpin et al., Angewandte Chem International Edition, Volume 50, Issue 10. Sensitive and multiplexed on-chip microRNA profiling in oil-isolated hydrogel chambers, Lee H et al., Angew Chem Int Ed Engl. 2015 Feb 16;54(8):2477-81.

In one aspect, an object of the present invention, as a target nucleic acid detection kit, porous hydrogel microparticles; And a target nucleic acid detection construct including a probe of a target nucleic acid immobilized on the porous hydrogel microparticles, and an amplification initiator that is an oligonucleotide connected to the 3'end of the target nucleic acid; And a plurality of hairpin adapters, which are oligonucleotides including a tag at the 3'end, to provide a target nucleic acid detection kit.

In another aspect, an object of the present invention is a kit for detecting multiple target nucleic acids, comprising: at least one target nucleic acid detection construct comprising a porous hydrogel microparticle and a probe of a target nucleic acid immobilized on the porous hydrogel microparticle; And a reaction chip in which the target nucleic acid detection structure is arranged, and an amplification initiator that is an oligonucleotide connected to the 3'end of the target nucleic acid; And a signal amplification agent comprising a plurality of hairpin adapters, which are oligonucleotides including a tag at the 3'end, to provide a target nucleic acid multiple detection kit.

In another aspect, an object of the present invention is to prepare a solution for forming at least one target nucleic acid detection structure comprising a pre-polymer and a target nucleic acid probe; Discharging the structure-forming solution in the form of a three-dimensional structure and curing the structure to prepare the one or more target nucleic acid detection structures; And arranging each of the one or more target nucleic acid detection constructs in different regions of a microfluidic chip.

In another aspect, an object of the present invention is to inject a solution containing one or more target nucleic acids into the target nucleic acid detection device of the target nucleic acid multiple detection kit and incubate the same; Injecting the signal amplification agent of the target nucleic acid multiplex detection kit into the target nucleic acid detection device; Hybridization chain reaction (HCR) of the target nucleic acid; And injecting a fluorescent dye into the target nucleic acid detection device.

In one aspect, the present invention, porous hydrogel microparticles; And a target nucleic acid detection construct including a probe of a target nucleic acid immobilized on the porous hydrogel microparticles, and an amplification initiator that is an oligonucleotide connected to the 3'end of the target nucleic acid; And it provides a target nucleic acid detection kit comprising a signal amplification agent comprising; and a plurality of hairpin adapters (adaptors), which are oligonucleotides including a tag at the 3'end.

In another aspect, the present invention provides, at least one target nucleic acid detection construct comprising a porous hydrogel microparticle and a probe of a target nucleic acid immobilized on the porous hydrogel microparticle; And a reaction chip in which the target nucleic acid detection structure is arranged, and an amplification initiator that is an oligonucleotide connected to the 3'end of the target nucleic acid; And a signal amplification agent comprising a plurality of hairpin adapters, which are oligonucleotides including a tag at the 3'end.

In another aspect, the present invention comprises the steps of preparing a solution for forming at least one target nucleic acid detection construct comprising a pre-polymer and a probe of the target nucleic acid; Discharging the structure-forming solution in the form of a three-dimensional structure and curing the structure to prepare the one or more target nucleic acid detection structures; And arranging each of the one or more target nucleic acid detection constructs in different regions of a microfluidic chip.

In another aspect, the present invention provides a step of injecting a solution containing one or more target nucleic acids into the target nucleic acid detection device of the target nucleic acid multiple detection kit and incubating the same; Injecting the signal amplification agent of the target nucleic acid multiplex detection kit into the target nucleic acid detection device; Hybridization chain reaction (HCR) of the target nucleic acid; And injecting a fluorescent dye into the target nucleic acid detection device.

The present invention includes a target nucleic acid detection kit comprising a target nucleic acid detection structure in which a probe of a target nucleic acid is immobilized on a porous hydrogel microparticle, and a signal amplification agent comprising an amplification initiator that is an oligonucleotide and a plurality of hairpin adapters Thus, the target nucleic acid can be detected through signal amplification. In particular, the target nucleic acid multiple detection kit specifies target nucleic acid detection constructs containing probes for different target nucleic acids in different regions within the microfluidic chip. Even if these are mixed, multiple nucleic acids can be detected at the same time, and a single type of amplification initiator and a single type of hairpin adapter can be used regardless of the type of probe and target nucleic acid, enabling time and cost effective detection of multiple nucleic acids.

1A and 1B are a target nucleic acid detection kit comprising a target nucleic acid detection construct in which a probe of a target nucleic acid is immobilized on a hydrogel microparticle according to the present invention, and a signal amplification agent including an amplification initiator and a hairpin adapter (FIG. 1A) , And a target nucleic acid detection apparatus in which the structure is arranged on a microfluidic chip, and a target nucleic acid multiplex detection kit (FIG. 1B) including a signal amplification agent are used to schematically show the principle of amplifying and detecting a target nucleic acid.
2 is a diagram schematically showing a mold for manufacturing a microfluidic chip of the target nucleic acid multiplex detection kit according to the present invention.
3A is a diagram illustrating a process of curing a hydrogel while flowing a reaction solution into a microfluidic chip during the process of manufacturing the porous hydrogel microparticles according to the present invention.
3B shows a code region, a blank region (between the code region and the target reaction region in FIG. 3B) of each of the fluorescent code, blank, target nucleic acid detection 1 to 4, and blank hydrogel microparticles according to the present invention. , A target reaction region, and a blank region (area following the target reaction region) of the target nucleic acid multiplex detection kit specified in the target nucleic acid detection apparatus. The target reaction region of the reaction chip of the target nucleic acid multiple detection kit is divided according to the type of probe fixed to each of the hydrogel microparticles, and the right side of FIG. 3B shows that a different type of probe is fixed for each target reaction region. .
4 is a diagram schematically showing a soft lithography process for preparing a target nucleic acid detection construct according to the present invention.
5A is a schematic diagram showing the simultaneous detection of four miRNAs multiplexed using a target nucleic acid multiplex detection kit according to an embodiment of the present invention. The code of the reaction chip of the target nucleic acid multiple detection kit of FIG. 5A represents the code region, blank represents the blank region, and miR-124, miR-132, miR-146a and miR-155 represent the target reaction regions of each target nucleic acid. In addition, miR-124(-), 132(+), 146a(-), and 155(+) of FIG. 5A are miR-132-5p (miR-132 of FIG. 5A) as target nucleic acids according to an embodiment of the present invention. 5A) and miR-155-5p (corresponding to miR-155 in Fig. 5A) were injected into the target nucleic acid multiplex detection kit. Indicates that this has been detected.
Figure 5b is when the detection reaction was performed without signal amplification by using the target nucleic acid multiple detection kit according to an embodiment of the present invention, but adding only one type of biotin-treated hairpin adapter without adding an amplification initiator (Example 2 Is a diagram showing the results of the control group).
5C is a diagram showing a result of performing a detection reaction after signal amplification using an amplification initiator and a hairpin adapter according to the present invention.
6 is a diagram showing results of optimizing conditions to improve amplification and detection efficiency in a target nucleic acid detection process using a target nucleic acid detection kit according to an embodiment of the present invention. Figure 6a shows the signal amplification factor (HCR factor) when the buffer composition is different in the signal amplification process, and Figure 6b is the signal amplification factor according to the presence or absence of a vortex in the process of cleaning the structure during the signal amplification process (rinse). FIG. 6C shows a signal amplification coefficient according to a temperature condition during signal amplification, and FIG. 6D shows a signal amplification coefficient according to a signal amplification time.
7 is a diagram illustrating amplification and improvement of detection efficiency according to whether or not a medium is used when detecting a target nucleic acid using a target nucleic acid detection kit according to an embodiment of the present invention. The left diagram of FIG. 7A shows the three-dimensional problem in the complementary coupling process of the amplification initiator and the hairpin adapter in the conventional amplification method (control of Example 4) without using a medium, and the right diagram of FIG. 7A shows an embodiment of the present invention. It shows that the steric problem is solved when amplification and detection reactions are performed by adding a medium according to the method. Figure 7b is a photograph showing the results of performing amplification and detection reactions by adding a conventional amplification method (control of Example 4) and a medium, and Figure 7c is a diagram showing the result as a graph (the conventional HCR of the x-axis) Represents the control of Example 4, Avidin-HCR represents the result when the mediator of Example 4 was added, and the y-axis represents the signal amplification factor (HCR factor)).

Hereinafter, the present invention will be described in detail.

In one aspect, the present invention provides a target nucleic acid detection kit, comprising a target nucleic acid detection structure and a signal amplification agent, wherein the target nucleic acid detection structure includes porous hydrogel microparticles; And a probe of the target nucleic acid immobilized on the porous hydrogel microparticles, wherein the signal amplification agent includes an amplification initiator, which is an oligonucleotide connected to the 3'end of the target nucleic acid; And a plurality of hairpin adapters, which are oligonucleotides including a tag at the 3'end, wherein the hairpin adapter includes a nucleotide sequence of the amplification initiator or a nucleotide sequence of another hairpin adapter It provides a target nucleic acid detection kit comprising a sequence complementary to.

The target nucleic acid detection structure may include porous hydrogel microparticles. The porous hydrogel microparticles are not limited as long as they have a three-dimensional structure, and may be, for example, a plate type such as a disk, a post type, a spherical type, a hemispherical type, etc. have. In addition, the porous hydrogel microparticles may have, for example, an average particle size of 10 μm to 5000 μm, and more specifically, may have an average particle diameter of 100 μm to 3000 μm. The material of the porous hydrogel microparticles may be used without limitation as long as it is a pre-polymer capable of solidification, and specifically, polyethylene glycol-diacrylate (PEG-DA) or polyacrylamide (Polyacrylamide, PAAM) can be used.

The porous hydrogel microparticles may be porous structures including pores. The porosity of the microparticles may be 10 to 95% by volume, specifically 10 to 80% by volume, and more specifically 20 to 70% by volume based on the total volume of the structure. If it is out of the above range, porosity may decrease or the stability of the structure may become unstable.

The porous hydrogel microparticles are prepared by mixing a pre-polymer, a pore-inducing polymer, a photoinitiator, and purified water to prepare a prepolymer solution; Mixing the prepolymer solution and the solution containing the probe; And after loading the mixed solution into a microfluidic chip, forming the mixed solution into a desired shape. In this case, the volume ratio of the prepolymer solution and the solution including the probe may be 20 to 5:1. In the present specification, the term "pre-polymer" refers to a prepolymer in which the polymerization or polycondensation reaction is stopped at an appropriate stage in order to facilitate the molding process of the polymer. In the case of the present invention, molding before solidification It means a polymer in an easy-to-process state. The solution containing the probe may further include a functional group for immobilizing the probe to the structure.

The preparation step of the prepolymer solution may further include adjusting the size of the pores formed in the structure by modifying the molecular weight of the pore-inducing polymer included in the solution. At this time, the pore-inducing polymer may be, for example, polyethylene glycol (PEG), specifically PEG200, PEG300, PEG400, PEG600, PEG1000, PEG1500, PEG2000, PEG3000, PEG3350, PEG4000, PEG6000, PEG8000, PEG10000, PEG12000, PEG20000, PEG35000, PEG40000, etc. (manufacturer: Sigma-Aldrich) can be used. Depending on the molecular weight of the pore-inducing polymer, the target nucleic acid amplification or detection efficiency may vary.

The manufacturing method may further include cleaning the molded porous hydrogel microparticles. The cleaning step may include removing the probe that is not fixed inside the pores of the porous structure through washing, and may further include removing the pore inducing polymer.

The step of molding the mixed solution into a desired shape may include, as an embodiment, molding into a desired shape through a mask or a mold, or forming into a droplet shape and photocrosslinking, Through this, it can be manufactured into particles of various shapes and sizes.

The target nucleic acid detection construct may include a probe of a target nucleic acid immobilized on the porous hydrogel microparticles. The probe refers to a nucleic acid fragment such as RNA or DNA corresponding to a short number of bases to hundreds of bases capable of specific binding to a target nucleic acid, and is labeled so that the presence or absence of a specific miRNA can be confirmed, and oligo It can be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, and the like. The probe may be fixed inside the pores of the porous hydrogel microparticles. The probe may be 10 to 1000 base pairs (bp), specifically 20 to 50 base pairs, but the sequence type and sequence length of the probe may be modified without limitation depending on the target nucleic acid.

The target nucleic acid detection kit may include a signal amplification agent, and the target nucleic acid detection kit includes an amplification initiator that is an oligonucleotide linked to the 3'end of the target nucleic acid and a tag at the 3'end. ) May include a plurality of hairpin adapters (adaptors) that are oligonucleotides.

The amplification initiator is an oligonucleotide linked to the 3'end of the target nucleic acid, and may be 15 to 150 base pairs, specifically 15 to 100 base pairs, but the sequence type and sequence length of the amplification initiator may be modified without limitation.

The 3'end of the target nucleic acid and the amplification initiator may be a link between the 3'end of the target nucleic acid and the 5'end of the amplification initiator, and specifically, the 3'end of the target nucleic acid and the 5'end of the amplification initiator are chemically reacted. It may be connected by, and more specifically, the chemical reaction may be phosphorylation, but is not limited thereto.

Alternatively, the 3'end of the target nucleic acid and the amplification initiator may be a link between the 3'end of the target nucleic acid and the 3'end of the amplification initiator, but is not limited thereto.

The target nucleic acid detection kit may include a plurality of hairpin adapters, which are oligonucleotides including a tag at the 3'end, and the hairpin adapter is the base sequence of the amplification initiator or It may contain a base sequence complementary to the base sequence of another hairpin adapter. The hairpin adapter is an oligonucleotide having a hairpin structure, and is used to amplify a signal in order to increase the detection efficiency of the target nucleic acid. If the nucleic acid is detected without signal amplification, a very small amount of fluorescence is detected. It may be difficult to determine whether a nucleic acid is present, but when a signal is amplified using a target nucleic acid detection kit including the signal amplification agent, an amplification initiator and the hairpin adapter, the amount of fluorescence detected is very specific to the target nucleic acid. There is an excellent effect of increasing the target nucleic acid detection efficiency very high.

The hairpin adapter may include a sequence complementary to 5 to 80% of the nucleotide sequence of the amplification initiator, and specifically 5% or more, 10% or more, 15% or more, 20% or more of the nucleotide sequence of the amplification initiator, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, or a sequence that is complementary to 75% Can be, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30 of the base sequence of the amplification initiator % Or less, 25% or less, 20% or less, 15% or less, or may contain a sequence complementary to 10%, but maintains complementary binding with the amplification initiator to the extent that it does not affect the detection reaction or signal amplification of the target nucleic acid If possible, the number of complementary sequences is not limited.

In addition, the hairpin adapter included in the signal amplification agent of the target nucleic acid detection kit is two or more hairpin adapters, and the hairpin adapter may include a sequence complementary to 5 to 80% of the nucleotide sequence of the other hairpin adapter, Specifically, 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55 of the base sequence of other hairpin adapters % Or more, 60% or more, 65% or more, 70% or more, or may contain a sequence complementary to 75%, and 80% or less, 75% or less, 70% or less, 65% or less of the base sequence of other hairpin adapters , 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, or 10% or less However, the number of complementary sequences is not limited as long as it is capable of maintaining complementary binding with other hairpin adapters so as not to affect the detection reaction or signal amplification of the target nucleic acid.

The tag is included at the 3'end of the hairpin adapter to detect the presence or absence of a target nucleic acid, and specifically, a polynucleotide, a polypeptide, a peptide nucleic acid, a locked nucleic acid ), oligosaccharide, polysaccharide, antibody, affibody, antibody mimic, cell receptor, ligand, lipid, biotin ( biotin), avidin, streptavidin, extravidin, neutravidin, metal, and histidine may be one or more selected from the group consisting of, but the presence of a target nucleic acid As long as it is a substance that can detect whether or not, the type is not limited.

The target nucleic acid may include DNA, RNA, or a combination thereof. Specifically, the target nucleic acid may be a double-stranded nucleic acid, and more specifically, may be a double-stranded DNA. When the target nucleic acid is a double-stranded nucleic acid, the target nucleic acid injected into the target nucleic acid detection construct may be denatured into a single strand. Alternatively, the target nucleic acid may be specifically, a single-stranded nucleic acid, more specifically may be a single-stranded DNA or RNA, and the RNA may be more specifically miRNA (micro RNA).

The detection of the target nucleic acid may be detection by reaction between the tag and a fluorescent dye (dye), and the fluorescent dye is Cyber Green (SYBR green), Picogreen (Picogreen), Evagreen (Evagreen), Hoechst 33258 ( Hoechst 33258), Hoechst 33342, ethidium bromide, acridine orange, propidium iodide, mithramycin, TO-PRO- 3, it may be one or more selected from the group consisting of TOTO, YOYO, and YOPRO-1, but the type is not limited as long as the presence or absence of the target nucleic acid can be detected by reaction with the tag.

According to an embodiment of the present invention, when nucleic acid detection is performed without signal amplification (control), a very small amount of fluorescence is detected in the target nucleic acid region, which makes it very difficult to detect nucleic acids, whereas the amplification initiator and hairpin adapter of the present invention are included. When amplifying the signal using the signal amplification agent, the amount of fluorescent substance detected was significantly increased specifically for the target nucleic acid, and it was found that target nucleic acid detection was possible when amplifying the signal using a signal amplification agent (Example 2, 5b and 5c).

The signal amplification agent may further include a mediator that is an oligonucleotide sequentially including a first compound and a second compound at the 3'end. The mediator is an oligonucleotide comprising a first compound and a second compound in sequence at the 3'end, and is linked to the 3'end of the target nucleic acid complementarily bound to the probe, specifically for chemical reactions including phosphorylation. It is connected by, it may be to link the two between the target nucleic acid and the amplification initiator, and may be 15 to 150 base pairs, specifically 15 to 100 base pairs, but the sequence type and sequence length of the mediator can be modified without limitation. . When the mediator connects the target nucleic acid and the amplification initiator, when the amplification initiator includes a first compound at the 3'end, and the probe immobilized on the porous hydrogel microparticles and the target nucleic acid are complementarily bound, the target nucleic acid The 5'end of the mediator is connected to the 3'end of the mediator, and the second compound at the 3'end of the mediator and the first compound at the 3'end of the amplification initiator may be connected to selectively undergo a chemical reaction. According to an embodiment of the present invention, when the 5'end of the amplification initiator is connected to the 3'end of the target nucleic acid complementarily bound to the probe, a steric problem occurs when the 5'end of the hairpin adapter is connected to the 3'end of the amplification initiator. There is a problem that it is difficult to cause a chain reaction of a plurality of hairpin adapters, but if the mediator is additionally included, the second compound at the 3'end of the mediator and the first compound at the 3'end of the amplification initiator react, resulting in a plurality of hairpins. It was confirmed that the nucleotide sequence direction of the amplification initiator was reversed to facilitate the chain reaction of the adapter, thereby greatly increasing the amplification and detection efficiency of the target nucleic acid (Example 4 and FIGS. 7A to 7C).

The first compound may be included at the 3'end of the amplification initiator or the mediator, and chemically reacts with the second compound included at the 3'end of the mediator to form the 3'end of the mediator and the 3'end of the amplification initiator. It could be connecting. Specifically, the first compound may be at least one selected from the group consisting of biotin, dinitrophenyl (DNP) and digoxigenin (digoxigenin, DIG), and more specifically biotin, but the mediator If it is to connect the amplification initiator and the type is not limited.

The second compound may be included at the 3'end of the mediator, and chemically reacts with the first compound included at the 3'end of the amplification initiator to connect the 3'end of the mediator to the 3'end of the amplification initiator. Can be. Specifically, at least one selected from the group consisting of avidin, streptavidin, NeutrAvidin, anti-DNP antibody compound, and anti-DIG antibody compound It may be, and more specifically, it may be neutraavidin, but the type is not limited as long as the mediator and the amplification initiator are connected.

The detection of the target nucleic acid may include signal amplification by Hybridization Chain Reaction (HCR).

The signal amplification may be a signal amplification at 10 to 35°C, specifically 10°C or more, 12°C or more, 14°C or more, 16°C or more, 18°C or more, 20°C or more, 22°C or more, 24°C or more, Signal amplification at 26 ℃ or higher, 28 ℃ or higher, 30 ℃ or higher, 32 ℃ or higher or 34 ℃ or higher, and 35 ℃ or lower, 33 ℃ or lower, 31 ℃ or lower, 29 ℃ or lower, 27 ℃ or lower, 25 ℃ or lower , Signal amplification at 23°C or less, 21°C or less, 19°C or less, 17°C or less, 15°C or less, 13°C or less or 11°C or less, but is not limited thereto. According to an embodiment of the present invention, it was confirmed that the amplification and detection efficiency is the best when the temperature is at 24° C. than when the temperature is 37° C. or 55° C. when amplifying the signal (Example 3-3 and Fig. 6c).

The signal amplification may be a signal amplification of 4 hours or more, and specifically, signal amplification for 4 to 48 hours, more specifically 4 hours or more, 8 hours or more, 10 hours or more, 12 hours or more, 14 hours or more, 16 hours or more, 18 hours or more, 20 hours or more, 22 hours or more, 24 hours or more, 26 hours or more, 28 hours or more, 30 hours or more, 32 hours or more, 34 hours or more, 36 hours or more, 38 hours or more, 40 hours Signal amplification for more than, 42 hours or more, 44 hours or more, or 46 hours or more, and 48 hours or less, 46 hours or less, 44 hours or less, 42 hours or less, 40 hours or less, 38 hours or less, 36 hours or less, 34 Hours or less, 32 hours or less, 30 hours or less, 28 hours or less, 26 hours or less, 24 hours or less, 22 hours or less, 20 hours or less, 18 hours or less, 16 hours or less, 14 hours or less, 12 hours or less, 10 hours or less , Signal amplification for 8 hours or less or 6 hours or less, but is not limited thereto. According to an embodiment of the present invention, it was confirmed that the amplification and detection efficiency is the best when the signal amplification time is 12 hours or more than when the signal amplification time is 1 or 4 hours (Example 3-4 and Fig. 6D). The upper limit is not limited, but a signal amplification can be performed in 48 hours or less according to a typical signal amplification process.

In another aspect, the present invention comprises the steps of preparing a solution for forming a target nucleic acid detection construct comprising a pre-polymer and a probe of the target nucleic acid; And discharging the structure-forming solution in the form of a three-dimensional structure, and curing the structure to prepare the target nucleic acid detection structure. The description of the prepolymer, probe, and target nucleic acid detection kit is as described above.

In another aspect, the present invention is a target nucleic acid multiple detection kit, comprising a target nucleic acid detection device and a signal amplification agent, the target nucleic acid detection device is a porous hydrogel microparticles and a target nucleic acid immobilized on the porous hydrogel microparticles One or more target nucleic acid detection constructs comprising a probe of; And a reaction chip in which the target nucleic acid detection structure is arranged, wherein the signal amplification agent includes an amplification initiator which is an oligonucleotide connected to the 3'end of the target nucleic acid; And a plurality of hairpin adapters, which are oligonucleotides including a tag at the 3'end, wherein the hairpin adapter includes a nucleotide sequence of the amplification initiator or a nucleotide sequence of another hairpin adapter It provides a target nucleic acid multiple detection kit comprising a sequence complementary to. Descriptions of the porous hydrogel microparticles, target nucleic acid, probe, target nucleic acid detection structure, signal amplification agent, amplification initiator, hairpin adapter, and tag are as described above.

The target nucleic acid multiple detection kit may include one or more target nucleic acid detection constructs. The one or more target nucleic acid detection constructs may be one or more target nucleic acid detection constructs each including probes for different target nucleic acids.

The target nucleic acid multiple detection kit may include a signal amplification agent. The types of the amplification initiator and the hairpin adapter included in the signal amplification agent may be less than the type of the target nucleic acid or the type of the target nucleic acid detection construct. Alternatively, each of the base sequences of the amplification initiator or hairpin adapter included in the target nucleic acid multiple detection kit may be the same or different from each other. Alternatively, when the one or more target nucleic acid detection constructs included in the target nucleic acid multiple detection kit each include probes for different target nucleic acids, the type of amplification initiator or hairpin adapter included as a signal amplification agent of the kit is a target It may be equal to or less than the number of types of nucleic acids or types of probes for target nucleic acids. Specifically, even if the nucleotide sequences of probes included in the one or more target nucleic acid detection constructs included in the target nucleic acid multiple detection kit are different from each other, or the one or more target nucleic acid detection constructs of the target nucleic acid multiple detection kit are in different target nucleic acids. Even if each probe for the target nucleic acid is included, the base sequences of the amplification initiator or hairpin adapter included in the target nucleic acid multiple detection kit may be the same or different from each other. More specifically, if the five target nucleic acid detection constructs included in the target nucleic acid multiplex detection kit each include probes for five different target nucleic acids, an amplification initiator included in each target nucleic acid detection construct Alternatively, the base sequence of the hairpin adapter may be 1 to 4 types, or the base sequence of the amplification initiator may be 1 type, and the plurality of hairpin adapters may have 2 types of base sequence.

According to an embodiment of the present invention, a target nucleic acid detection kit in which 4 types of target nucleic acid detection constructs each including 4 types of probes for 4 types of different target nucleic acids are arranged in a reaction chip, wherein the signal of the kit The amplification agent may comprise one type of amplification initiator, and two types of hairpin adapters. When performing multiple nucleic acid detection using such a target nucleic acid detection kit, it is possible to determine whether or not a target nucleic acid is detected according to a specific position of each target nucleic acid detection construct. Therefore, it was confirmed that a single type of amplification initiator and a single type of hairpin adapter can be used regardless of the type of probe and the type of target nucleic acid, so that multiple nucleic acids can be detected more timely and cost-effectively (Example 2 and Fig. 5B. And Figure 5c).

The target nucleic acid detection kit includes the target nucleic acid detection construct; And a target nucleic acid detection device in which the target nucleic acid detection construct is positioned in different regions of the reaction chip according to the type of target nucleic acid. Specifically, the target nucleic acid multiple detection kit can simultaneously detect two or more target nucleic acids. In this multiple detection, one or more target nucleic acid detection constructs each including probes for different target nucleic acids are applied to different regions in the reaction chip. It may be detected by positioning.

According to an embodiment of the present invention, by specifying porous hydrogel microparticles in which probes for different target nucleic acids are fixed in the pores, respectively, to a specific region in the detection device, porous hydrogel microparticles including probes for target nucleic acids Fluorescence is detected only in a specific region where the particle is located, so that the presence or absence of the target nucleic acid can be confirmed.It was confirmed that even if several types of nucleic acids are mixed, multiple nucleic acids can be detected simultaneously by using the target nucleic acid multiple detection kit of the present invention ( Example 2 and Fig. 5c).

In another aspect, the present invention comprises the steps of preparing a solution for forming at least one target nucleic acid detection construct comprising a pre-polymer and a probe of the target nucleic acid; Discharging the structure-forming solution in the form of a three-dimensional structure and curing the structure to prepare the one or more target nucleic acid detection structures; And arranging each of the one or more target nucleic acid detection constructs in different regions of a reaction chip. The description of the prepolymer, target nucleic acid, probe, target nucleic acid detection construct, reaction chip, and target nucleic acid multiple detection kit is as described above.

In another aspect, the present invention provides a method comprising: injecting a solution containing at least one target nucleic acid into a target nucleic acid detection device including the at least one target nucleic acid detection construct of the target nucleic acid multiple detection kit; Amplifying a signal by hybridization chain reaction with the target nucleic acid; And injecting a fluorescent dye into the target nucleic acid detection device. The description of the target nucleic acid multiple detection kit, the target nucleic acid detection construct, the target nucleic acid detection device, the fluorescent dye, and the target nucleic acid detection are as described above.

The hybrid chain reaction step may be performed by adding 1 to 1000 mM sodium phosphate buffer. Specifically, it may be to add 1 to 1000 mM sodium phosphate buffer in the hybrid chain reaction step, the concentration of the sodium phosphate buffer may be 1 to 1000 mM, more specifically 1 mM or more, 10 mM or more, 50 mM or more, 100 mM or more, 200 mM or more, 300 mM or more, 400 mM or more, 500 mM or more, 600 mM or more, 700 mM or more, 800 mM or more, or 900 mM or more, and 1000 mM or less, 900 mM or more, 800 mM or less, 700 mM or less, 600 mM or less, 500 mM or less, 400 mM or less, 300 mM or less, 200 mM or less, 100 mM or less, 50 mM or less, or 10 mM or less, but is not limited thereto. According to an embodiment of the present invention, 5X saline-sodium citrate (SSC) buffer or PerfectHyb ^TM in the signal amplification step during target nucleic acid detection reaction When using the 100 mM sodium phosphate buffer than when using the Plus Hybridization buffer, the signal amplification factor (HCR factor) increased by about 2 to 4 times, confirming that the amplification and detection efficiency was the best (Example 3-1 and Fig. 6a).

The detection method may include a process of rinsing the target nucleic acid detection structure of the target nucleic acid detection device after the hybrid chain reaction step, and may not perform a vortex during the cleaning process. According to an embodiment of the present invention, when the detection reaction is performed without vortexing in the process of washing the porous hydrogel microparticles of the target nucleic acid detection kit or the target nucleic acid multiple detection kit after the signal amplification, the signal is compared with the vortex. The amplification factor (HCR factor) increased by about 2.5 times or more, confirming that the amplification and detection efficiency was more excellent (Example 3-2 and FIG. 6B).

Hereinafter, the configuration and effects of the present invention will be described in more detail with reference to examples. However, the following examples are provided for illustrative purposes only to aid understanding of the present invention, and the scope and scope of the present invention are not limited thereto.

[ Example 1] Target nucleic acid detection construct, and target nucleic acid detection comprising the same Kit And target nucleic acid multiple detection Kit Produce

(1) Preparation of reaction solution

To prepare porous hydrogel microparticles, first, PEG700 DA (average molecular weight 700, sigma-aldrich, SKU 455008) 20% v/v, PEG600 (average molecular weight 600, sigma-aldrich, SKU 87333) 40% v/v , 3X TE (100X concentrated Tris-EDTA buffer solution (Sigma-aldrich, SKU T9285)) 35% v/v and photoinitiator (Ciba Darocur 1173, CAS No. 7473-98-5) 5% v/v A hydrogel precursor was prepared. Using the mixed hydrogel precursor, a reaction solution was prepared as follows. In the following, the fluorescent code is a hydrogel precursor disposed in the fluorescent code region of the target nucleic acid detection device, the blank is a hydrogel precursor disposed in the blank region of the target nucleic acid detection device, and the target nucleic acid detection is a target nucleic acid. It refers to a hydrogel precursor disposed in a target nucleic acid detection region of a detection device. In addition, the following reaction solutions for detecting a target nucleic acid were prepared for each of four reaction solutions to include four types of probes.

-For fluorescent code: Hydrogel precursor and acrylate treated with 0.1~1 mg/mL of rhodamine B (Methacryloxyethyl thiocarbamoyl rhodamine B, Polysciences Inc., CAS No. 669775-30-8) 9: Mixed into 1

-For blank: Mixing hydrogel precursor and 1X TE at 9: 1

-For detection of target nucleic acid: A hydrogel precursor and an acrylate-treated 1 mM probe (Integrated Device Technology, Inc.) are mixed in a ratio of 9: 1

The sequence of the probe used in the process of preparing the reaction solution for detecting the target nucleic acid is as follows, where Acryd is an acrylic group, GATATATTTTA is a base sequence complementary to an amplification initiator, and ACCCCTATCACGATTAGCATTAA is a base sequence complementary to the target nucleic acid. , InvdT is an inverted dT to prevent decomposition or extension.

Base sequence of target nucleic acid

-Base sequence of target nucleic acid miR-124-5p: 5'-CGUGUUCACAGCGGACCUUGAU-3' (SEQ ID NO: 1)

-Base sequence of target nucleic acid miR-132-5p: 5'-ACCGUGGCUUUCGAUUGUUACU-3' (SEQ ID NO: 2)

-Base sequence of target nucleic acid miR-146a-5p: 5'-UGAGAACUGAAUUCCAUGGGUU-3' (SEQ ID NO: 3)

-Base sequence of target nucleic acid miR-155-5p: 5'-UUAAUGCUAAUCGUGAUAGGGGU-3' (SEQ ID NO: 4)

The base sequence of the probe (Integrated Device Technology, Inc.)

-Target nucleic acid (miR-124-5p) detection probe 1: 5'-Acryd-GATATATTTTAACCCCTATCACGATTAGCATTAA-3'-InvdT (SEQ ID NO: 5)

-Target nucleic acid (miR-132-5p) detection probe 2: 5'-Acryd-GATATATTTTAAGTAACAATCGAAAGCCACGGT-3'-InvdT (SEQ ID NO: 6)

-Target nucleic acid (miR-146a-5p) detection probe 3: 5'-Acryd-GATATATTTTAAACCCATGGAATTCAGTTCTCA-3'-InvdT (SEQ ID NO: 7)

-Target nucleic acid (miR-155-5p) detection probe 4: 5'-Acryd-GATATATTTTAACCCCTATCACGATTAGCATTAA-3'-InvdT (SEQ ID NO: 8)

(2) porosity Hydrogel Manufacture of microparticles and target nucleic acid detection device including the same

1) The reaction solutions were injected into respective inlets in the microfluidic chip in the order of fluorescence code, blank, target nucleic acid detection 1 to 4, and blank. In this case, the microfluidic chip was formed by using a mold having the structure of FIG. 2 in which an SU-8 photoresist having a height of about 50 um was placed on a wafer, and soft lithography was performed using polydimethylsiloxane (PDMS). It was manufactured by lithography) method.

2) When each of the reaction solutions is poured into the microfluidic chip, independent laminar flows are formed.At this time, pressure supply is stopped for less than 1 second to prevent the reaction solution from flowing, and within 1 second before the formed laminar flow is broken. By exposing the UV rays of 80 mJ/cm ² intensity passing through a photomask of a desired shape (for example, a square such as a dotted line in Fig. 3A), the hydrogel is cured according to the shape, and the injected reaction solution Accordingly, a total of 6 types of hydrogel microparticles were produced.

3) After that, the resulting microfluidic chip with each of the 6 kinds of microparticles is again poured into the microfluidic chip according to the kind of microparticles, and the reaction solution used for manufacturing each is flowed to collect the six kinds of microparticles, and the above 2) The process of was repeated.

4) And, the 6 kinds of microparticles collected after repeating the above process are transferred to 1X TET buffer (a buffer in which 1X TE buffer and 0.05% Tween 20 are mixed (CAS No. 9005-64-5)) above 2) After diluting the solution containing the cured hydrogel microparticles and the uncured reaction solutions produced in 10 times, vortexing at 2500 rpm for 10 seconds, and centrifuging at 6000 rpm for 2 minutes 30 seconds. Next, a process of rinsing was performed in the order of slowly pouring out only the upper buffer as much as the amount of 1X TET buffer put in before with a pipette, and the washing process was repeated three times to prepare hydrogel microparticles.

5) After that, the prepared hydrogel microparticles were put in the 1X TET solution and stored in a refrigerator.

A total of 6 types of hydrogel microparticles for fluorescent codes, blanks, 1 to 4 for detection of target nucleic acids, and blanks through the processes of 1) to 5) above, and target nucleic acids in which these particles are circulated for each type in the reaction chip A target nucleic acid detection device included in multiple kits was prepared. In particular, a reaction region for a specific target was specified on the reaction chip, and FIGS. 3B and 5 illustrate the target nucleic acid detection apparatus.

[ Example 2] Confirmation of simultaneous detection of multiple nucleic acids and comparison of detection effects according to signal amplification

Two different miRNA synthesis targets were detected in order to check whether simultaneous multiple detection is possible using the target nucleic acid multiple detection kit of Example 1 and to compare the detection effect according to whether or not signal amplification using a hairpin adapter The experiment was carried out.

Specifically, the target nucleic acid is miR-132-5p and miR-155-5p of Example 1, and the base sequences are the same as SEQ ID NOs: 2 and 4, respectively, and target nucleic acid detection in the target nucleic acid multiplex detection kit of Example 1 The probes included in the solution reaction solution are probes targeting each of miR-124-5p, miR-132-5p, miR-146a-5p, and miR-155-5p, and each nucleotide sequence is the same as in Example 1.

(1) hairpin adapter preparation

For target nucleic acid detection, first dilute 100 amol of miR-132-5p with the target nucleic acid solution, then dilute 5 uL of the miR-132-5p solution at a concentration of 0.02 nM, and 100 amol of miR-155-5p to the 0.02 nM concentration. 5 uL of miR-155-5p solution was heated at 95° C. for 5 minutes, then cooled at room temperature for 5 minutes, and prepared with 6 uM biotin-treated hairpin adapters 1 and 2 (respectively) with the following nucleotide sequence as a hairpin adapter. 2 uL each) was prepared by heating at 95° C. for 90 seconds and cooling at room temperature for 30 minutes (snap cooling).

Biotinized hairpin adapters 1 and 2

-Hairpin adapter 1: 5'-Biosg-GGC GGT TTA CTG GAT GAT TGA TGA GGA TTT ACG AGG AGC TCA GTC CAT CCT CGT AAA TCC TCA TCA-3' (SEQ ID NO: 9)

-Hairpin adapter 2: 5'-CCC CCC CCC CCC CCT CGT AAA TCC TCA TCA ATC ATC CAG TAA ACC GCC GAT GAT TGA TGA GGA TTT ACG AGG ATG GAC TGA GCT-bio-3' (SEQ ID NO: 10)

(2) hybrid chain reaction ( HCR )

Then, in each of the two 5 uL target nucleic acid solutions, 30 uL of 583 mM NaCl buffer and 10 uL of the four types of target nucleic acid detection hydrogel microparticles of Example 1 (target nucleic acid is Each of the 4 types of hydrogel microparticles for detection of target nucleic acids, miR-124-5p, miR-132-5p, miR-146a-5p, and miR-155-5p) was added to each of about 50 units to make a total of 50 uL.

Thereafter, incubation was performed under conditions of 55° C., 1500 RPM, and 90 minutes, and washed three times with 50 mM NaCl in 1X TET buffer. The washing includes a vortex for 10 seconds, centrifuge for 2.5 minutes, and then carefully pouring away the supernatant. Then, add 245 uL of Ligation master mix to 7.50 uL of left over sample, the Ligation master mix based on a total of 1000 uL, 100 μl (v/v) of 10x NE buffer, 891.1 μl ( v/v) of 1x TET, 2.5 μl of ATP (100uM), 2.4 μl of T4 DNA ligase (400,000 units/mL), and 4 μl of 10 μM amplification initiator, the base sequence of the amplification initiator is as follows. .

Amplification Initiator

-Amplification initiator: 5'-Phos-TAA AAT ATA TAA AAA AAA AAA ACC TCG TAA ATC CTC ATC AAT CAT CCA GTA AAC CGC C-3' (SEQ ID NO: 11)

Thereafter, ligation was performed under the conditions of 21.5°C, 1500 RPM, 30 min, washed 3 times with 100mM Phosphate buffer (pH 8.0) (vortex for 10 seconds, centrifuged for 2.5 minutes and then carefully poured out the supernatant), and a total of 50 1 uL of each of the prepared hairpin adapters 1 and 2 was added to the uL sample. Then, a hybrid chain reaction (HCR) was performed under the conditions of room temperature, 1000 RPM, and overnight (12 to 16 hours).

(3) hybrid chain reaction ( HCR ) After washing

Then, washed three times with 50mM NaCl in 1X TET buffer, in which case, after centrifugation for 2.5 minutes with vortex, the supernatant was carefully poured out and pipetted. Thereafter, 5.5 uL of SA-PE (0.1 mg/mL) was added, reacted under conditions of 21.5° C., 1000 RPM, and 30 min, and washed (centrifuged for 2.5 minutes by vortex and carefully poured out the supernatant and then pipetted). Next, fluorescence imaging was performed.

At this time, as a control, the miR-124 target probe, miR-132 target probe, miR-146a target probe, and miR-155 target probe were each immobilized in the pores of the porous microparticles. A kit including a target nucleic acid detection device fixed in the same manner as in Example 1 was used, and when performing the detection reaction of the control, only a biotinylated adapter that binds to the probe in the same manner as the amplification initiator was added without adding an amplification initiator. In this case, the probe to which the target nucleic acid is bound and the fluorescent dye are 1:1 combined and fixed. The base sequence of the biotin-treated adapter is as follows.

Biotinylated adapter

-Biotin-treated adapter: 5'-Phos-TAA AAT ATA TAA AAA AAA AAA A-Biotin-3' (SEQ ID NO: 12)

As a result of performing the detection reaction, as shown in FIG. 5C, fluorescence was detected only in the regions corresponding to miR-132-5p and miR-155-5p among the target reaction regions of the target nucleic acid detection device. Since it is fixed inside the pores of the microparticles and is located in a specific region in the detection device of the kit, it was found that even if several types of nucleic acids are mixed, multiple nucleic acids can be detected simultaneously by using the target nucleic acid multiple detection kit of the present invention.

In addition, as shown in FIGS. 5B and 5C, when nucleic acid detection was performed without signal amplification (control), a very small amount of fluorescence was detected in the target nucleic acid region, making it very difficult to detect nucleic acids, whereas the amplification initiator and hairpin of the present invention When amplifying a signal using an adapter, the detection amount of a fluorescent substance was significantly increased specifically for a target nucleic acid, and it was found that target nucleic acid detection was possible when amplifying a signal using an amplification initiator and a hairpin adapter. In particular, the amplification initiator and hairpin adapter used can use a single type of amplification initiator and a single type of hairpin adapter regardless of the type of probe and target nucleic acid specific to the target reaction region. This will be possible.

[ Example 3] Optimization of nucleic acid detection conditions

As confirmed in Example 2, since simultaneous multiplex detection was possible using the target nucleic acid multiplex detection kit prepared in Example 1, optimization of conditions to improve amplification and detection efficiency was performed as follows.

[ Example 3-1] Optimization of buffer composition

Using the target nucleic acid multiplex detection kit of Example 1, target nucleic acid detection was performed in the same manner as in Example 2, but in this case, the target nucleic acid is miR-124-5p, which is represented by the nucleotide sequence of SEQ ID NO: 1. , In order to derive an optimized buffer composition, 100 mM Phosphate buffer (pH 8.0), which is a buffer for the amplification reaction, was added to 100 mM sodium phosphate buffer (Sigma-Aldrich) (Example 3-1), 5X SSC (saline-sodium). citrate) buffer (Sigma-Aldrich) (Comparative Example 1-1), PerfectHyb ^TM The detection reaction was performed using Plus Hybridization buffer (Sigma-Aldrich) (Comparative Example 1-2), and the results are shown in FIG. 6A.

As shown in Figure 6a, it was confirmed that the amplification and detection efficiency of Example 3-1 using sodium phosphate as a buffer for the amplification reaction was the best.

[ Example 3-2] Vortex Amplification and detection efficiency with or without (vortex)

Using the target nucleic acid multiplex detection kit of Example 1, target nucleic acid detection was performed in the same manner as in Example 2, but in this case, the target nucleic acid is miR-124-5p, which is represented by the nucleotide sequence of SEQ ID NO: 1. , In the process of cleaning the hydrogel microparticles after signal amplification, which is the cleaning step after the (3) hybrid chain reaction of Example 2, vortexing (Comparative Example 2) or without vortexing ( Example 3-2) Each detection reaction was performed, and the results are shown in FIG. 6B.

As shown in FIG. 6B, when the detection reaction was performed without vortexing in the process of cleaning the porous hydrogel microparticles after signal amplification of Example 2, the signal amplification factor (HCR factor) was about 2.5 times compared to when vortexing. It was confirmed that the amplification and detection efficiency was more excellent by increasing the above.

[ Example 3-3] Optimization of amplification temperature conditions

The target nucleic acid detection was performed in the same manner as in Example 2 using the target nucleic acid detection device of Example 1, but in this case, the target nucleic acid was miR-124-5p, which was represented by the nucleotide sequence of SEQ ID NO: 1, Amplification of Example 2 for 12 hours at a temperature of 24°C (Example 3-3), 37°C (Comparative Example 3-1), and 55°C (Comparative Example 3-2), respectively, to derive optimized temperature conditions And detection detection reaction was performed, and the results are shown in FIG. 6C.

As shown in FIG. 6C, it was confirmed that the amplification and detection efficiency was the best when the amplification reaction was performed under a temperature condition of 24°C (Example 3-3).

[ Example 3-4] Optimization of amplification time

Using the target nucleic acid multiplex detection kit of Example 1, target nucleic acid detection was performed in the same manner as in Example 2, but in this case, the target nucleic acid is miR-124-5p, which is represented by the nucleotide sequence of SEQ ID NO: 1. , In order to derive the optimized amplification time, 1 hour (Comparative Example 4-1), 2 hours (Comparative Example 4-2), 4 hours (Example 3-4a), 8 hours (Execution Example 3-4b), 10 hours (Example 3-4c), 12 hours (Example 3-4d), 24 hours (Example 3-4e) was carried out the amplification and detection reaction of Example 2, the The results are shown in Figure 6d.

As shown in Figure 6d, compared to when the amplification reaction was performed for 1 hour or 2 hours (Comparative Examples 4-1 and 4-2), amplification and detection from when the amplification reaction was performed for 4 hours (Example 3-4a). When the efficiency was increased and the amplification reaction was performed for more than 12 hours (Example 3-4d), the amplification and detection efficiency was the best, and the amplification time was 8 to 24 hours (Example 3-4b to 3-4e). Confirmed that there was no significant difference in amplification and detection efficiency.

In general, using sodium phosphate as a buffer using the target nucleic acid multiple detection kit of Example 1, and performing the above for 12 hours or more under 24°C temperature condition without vortexing in the process of washing the hydrogel microparticles after signal amplification. When performing the signal amplification reaction of Example 2, it was confirmed that the amplification and detection efficiency was the best.

[ Example 4] Improvement of amplification efficiency using media

As confirmed in Example 2, the amplification and detection efficiency increased when an amplification initiator and a plurality of hairpin adapters were used, but as shown in the left figure of FIG. 7A, at the 3'end of the target nucleic acid complementarily bound to the probe. When the 5'end of the amplification initiator is connected, a steric problem occurs when the 5'end of the hairpin adapter is connected to the 3'end of the amplification initiator, so that a chain reaction of a plurality of hairpin adapters is difficult to occur. Therefore, in order to solve this steric problem, an attempt was made to solve the above problem by additionally including a mediator, which is an oligonucleotide, at the 3'end of the target nucleic acid.

Specifically, amplification and detection reactions were performed in the same manner as in Example 2 using the target nucleic acid detection construct and the target nucleic acid multiple detection kit prepared in Example 1, wherein the target nucleic acid was miR-124-5p. The mediator, which is an oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 1, and the following nucleotide sequence, was added, and the results are shown in FIGS. 7b and 7c.

Mediator

-Medium: 5'-Phos-TAA AAT ATA TAA AAA AAA AAA A-Biotin-3' (SEQ ID NO: 13)

The mediator sequentially contains biotin (Integrated Device Technology, Inc.) as a first compound and NeutrAvidin (Thermo Scientific, NeutrAvidin Protein) as a second compound at the 3'end, and the amplification initiator is also 3 'It contains biotin (Integrated Device Technology, Inc.) at the end. In this case, the control group performed amplification and detection reactions in the same manner as in Example 2 using the target nucleic acid detection construct and the target nucleic acid multiple detection kit prepared in Example 1, but without adding the above-described medium, At the 3'end, an amplification initiator containing no biotin and avidin was added.

As shown in FIGS. 7b and 7c, when amplification and detection reactions are performed by adding a mediator than a control without adding a mediator, the amount of fluorescence detected is greater, and the signal amplification factor (HCR factor) is about 2 times or more. Was. This means that when the amplification and detection reaction is performed by adding a mediator, the second compound at the 3'end of the mediator and the first compound at the 3'end of the amplification initiator react, so that a chain reaction of a plurality of hairpin adapters can easily occur. This is because the sequence direction was reversed. Therefore, it can be seen that the amplification and detection efficiency is greatly increased during amplification and detection reactions including a mediator including a first compound and a second compound at the 3'end and an amplification initiator including the first compound at the 3'end. there was.

<110> Korea Institute of Science and Technology <120> Target nucleic acid detection kit comprising a target nucleic acid acid detection structure and signal amplification agent <130> 18p459ind <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-124-5p <400> 1 cguguucaca gcggaccuug au 22 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-132-5p <400> 2 accguggcuu ucgauuguua cu 22 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-146a-5p <400> 3 ugagaacuga auuccauggg uu 22 <210> 4 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-155-5p <400> 4 uuaaugcuaa ucgugauagg ggu 23 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> miR-124-5p probe <400> 5 gatatatttt aacccctatc acgattagca ttaa 34 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> miR-132-5p probe <400> 6 gatatatttt aagtaacaat cgaaagccac ggt 33 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> miR-146a-5p probe <400> 7 gatatatttt aaacccatgg aattcagttc tca 33 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> miR-155-5p probe <400> 8 gatatatttt aacccctatc acgattagca ttaa 34 <210> 9 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> hairpin adapter 1 <400> 9 ggcggtttac tggatgattg atgaggattt acgaggagct cagtccatcc tcgtaaatcc 60 tcatca 66 <210> 10 <211> 84 <212> DNA <213> Artificial Sequence <220> <223> hairpin adapter 2 <400> 10 cccccccccc cccctcgtaa atcctcatca atcatccagt aaaccgccga tgattgatga 60 ggatttacga ggatggactg agct 84 <210> 11 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> amplification initiator <400> 11 taaaatatat aaaaaaaaaa aacctcgtaa atcctcatca atcatccagt aaaccgcc 58 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> adaptor treated with biotin <400> 12 taaaatatat aaaaaaaaaa aa 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mediator <400> 13 taaaatatat aaaaaaaaaa aa 22

Claims (21)

As a target nucleic acid detection kit,
It comprises a target nucleic acid detection construct and a signal amplification agent,
The target nucleic acid detection construct
Porous hydrogel microparticles; And
Includes; a probe of the target nucleic acid immobilized on the porous hydrogel microparticles,
The signal amplification agent
An amplification initiator which is an oligonucleotide linked to the 3'end of the target nucleic acid; And
Including; a plurality of hairpin adapters (adaptor); an oligonucleotide (oligonucleotide) including a tag (tag) at the 3'end,
The hairpin adapter includes a sequence complementary to the base sequence of the amplification initiator or the base sequence of another hairpin adapter, a target nucleic acid detection kit. The method of claim 1,
The probe is fixed within the pores of the porous hydrogel microparticles, target nucleic acid detection kit. The method of claim 1,
The linkage of the 3'end of the target nucleic acid and the amplification initiator is that the 3'end of the target nucleic acid and the 5'end of the amplification initiator are linked by phosphorylation. The method of claim 1,
The 3'end of the target nucleic acid and the amplification initiator are linked to each other. The 3'end of the target nucleic acid and the 3'end of the amplification initiator are linked. The method of claim 1,
The signal amplification agent further comprises a mediator that is an oligonucleotide sequentially comprising a first compound and a second compound at the 3'end, a target nucleic acid detection kit. The method of claim 5,
The amplification initiator includes a first compound at the 3'end,
When the probe and the target nucleic acid are complementarily bound to each other, the 5'end of the mediator is linked to the 3'end of the target nucleic acid,
The linkage of the 3'end of the target nucleic acid and the amplification initiator is that the second compound at the 3'end of the medium and the first compound at the 3'end of the amplification initiator are selectively linked by chemical reaction. . The method of claim 5,
The first compound is at least one selected from the group consisting of biotin, dinitrophenyl (DNP) and digoxigenin (DIG), a target nucleic acid detection kit. The method of claim 5,
The second compound is from the group consisting of avidin, streptavidin, NeutrAvidin, anti-DNP antibody compounds, and anti-DIG antibody compounds. One or more selected, target nucleic acid detection kit. The method of claim 1,
The tag is a polynucleotide, a polypeptide, a peptide nucleic acid, a locked nucleic acid, an oligosaccharide, a polysaccharide, an antibody, an affibody. , Antibody mimic, cell receptor, ligand, lipid, biotin, avidin, streptavidin, Extravidin, Nutra Vidin (neutravidin), metal (metal) and histidine (histidine) at least one selected from the group consisting of, target nucleic acid detection kit. The method of claim 1,
The detection of the target nucleic acid is by reaction between the tag and a fluorescent dye (dye), and the fluorescent dye is SYBR green, Picogreen, Evagreen, Hoechst 33258 ), Hoechst 33342, ethidium bromide, acridine orange, propidium iodide, mithramycin, TO-PRO-3, One or more, target nucleic acid detection kit selected from the group consisting of TOTO, YOYO and YOPRO-1. The method of claim 1,
The detection of the target nucleic acid includes a signal amplification by hybridization chain reaction (HCR), and the signal amplification is a signal amplification at 10 to 35° C., a target nucleic acid detection kit. The method of claim 1,
The detection of the target nucleic acid includes a signal amplification by a hybridization chain reaction (HCR), and the signal amplification is a signal amplification of 2 hours or more. The method of claim 1,
The porosity of the porous hydrogel microparticles is 10 to 95% by volume based on the total volume of the porous hydrogel microparticles, a target nucleic acid detection kit. As a target nucleic acid multiple detection kit,
It includes a target nucleic acid detection device and a signal amplification agent,
The target nucleic acid detection device
At least one target nucleic acid detection structure comprising a porous hydrogel microparticle and a probe of a target nucleic acid immobilized on the porous hydrogel microparticle; And
Including; a reaction chip (chip) in which the target nucleic acid detection structure is arranged,
The signal amplification agent
An amplification initiator which is an oligonucleotide linked to the 3'end of the target nucleic acid; And
Includes; a plurality of hairpin adapters, which are oligonucleotides including a tag at the 3'or 5'end,
The hairpin adapter comprises a sequence complementary to the base sequence of the amplification initiator or the base sequence of another hairpin adapter, a target nucleic acid multiple detection kit. The method of claim 14,
The target nucleic acid detection device includes one or more target nucleic acid detection constructs each including probes for different target nucleic acids. The method of claim 15,
The type of the amplification initiator and the hairpin adapter is less than the type of the target nucleic acid or the type of the target nucleic acid detection construct, target nucleic acid multiple detection kit. The method of claim 15,
The one or more target nucleic acid detection constructs are each located in different regions of the reaction chip according to the type of target nucleic acid. A method for preparing a target nucleic acid multiplex detection kit according to claim 14,
Preparing a solution for forming at least one target nucleic acid detection structure comprising a pre-polymer and a probe of the target nucleic acid;
Discharging the structure-forming solution in the form of a three-dimensional structure and curing the structure to prepare one or more target nucleic acid detection structures of claim 14; And
Arranging each of the one or more target nucleic acid detection constructs in different regions of a reaction chip. Injecting a solution containing one or more target nucleic acids into the target nucleic acid detection device of the target nucleic acid multiple detection kit according to any one of claims 14 to 17 and incubating the same;
Injecting the signal amplification agent of the target nucleic acid multiplex detection kit according to any one of claims 14 to 17 into the target nucleic acid detection device;
Hybridization chain reaction (HCR) of the target nucleic acid; And
Injecting a fluorescent dye into the target nucleic acid detection device; target nucleic acid detection method comprising a. The method of claim 19,
The hybrid chain reaction step is performed by adding 1 to 1000 mM sodium phosphate buffer. The method of claim 19,
The detection method is that the target nucleic acid detection method does not vortex in the process of washing the target nucleic acid detection structure of the target nucleic acid detection device after the hybrid chain reaction step.

Images