KR20200107140A - D-glutamate auxotrophic Escherichia coli and method of producing target product - Google Patents

Abstract

The present invention relates to D-glutamate auxotrophic mutant E. coli with a murI gene deleted, a method for preparing the same, and a method for producing a target material using the E. coli. According to the present invention, the D-glutamate auxotrophic E. coli has less revertants and maintains high plasmid stability and protein productivity to effectively produce useful products without the use of antibiotics, and thus the D-glutamate auxotrophic E. coli can be applied to clean production of useful products including proteins.

Description

D-glutamate auxotrophic Escherichia coli and method of producing target product}

The present invention relates to D-glutamate auxotrophic Escherichia coli, a method for preparing the same, and a method for producing a target substance using the Escherichia coli.

In most cases, known prokaryotic expression plasmids contain, in addition to one or several antibiotic resistance gene(s), an additional DNA sequence that is not necessary and imposes a burden on cellular metabolism. These sequences are multipurpose vectors such as DNA sequences generated during the cloning process, and origins of replication of specific phages for the synthesis of single strand DNA and specific promoters, for example, for the in vitro synthesis of mRNA. It includes DNA fragments that are the remnants of, and broadly includes incompletely replicated vector sequences that may cause undesirable plasmid recombination.

The presence of plasmids, especially expression vectors, places an additional metabolic burden on the cells. This provides the selection pressure to induce the generation of plasmid-free cells, which can be prevented by antibiotic selection.

The most commonly used selection marker for gene recombination of microorganisms is an antibiotic resistance gene. Host cells having an antibiotic resistance gene can grow in a medium supplemented with antibiotics that can be degraded by the corresponding antibiotic resistance gene product, but cells that do not have the antibiotic resistance gene are killed by antibiotics, so that microorganisms can be selected. However, in the case of antibiotics commonly used for screening such as ampicillin, tetracycline, kanamycin, and chloramphenicol, it may be a problem in producing (fermenting) the product, and the antibiotic resistance gene as described above is degraded by host cells in the continuous fermentation process. Or, the function disappears over time due to dilution due to an increase in the number of passages. In addition, antibiotics added to the medium are easily degraded by externally secreted antibiotic resistance gene products. Accordingly, the stability of the plasmid is weakened, and the amount of protein expressed by the introduced foreign gene is reduced. In addition, when a protein to be expressed is related to a food additive, a process of removing antibiotics added during the culture period is required for expression. In addition, the use of IPTG (isopropyl-β-D-thiogalactopyranoside), which is an expensive inducer for mass production of genetic materials, and the spread of antibiotic resistance genes into the natural world, have many problems.

As screening using antibiotic resistance genes causes environmental, regulatory and commercial problems as described above and is known to pose a potential risk for biological safety, auxotrophic selection markers have emerged as an alternative to antibiotic screening, but some laboratories and The research institute introduced limited auxotrophic markers to yeast ( Saccharomyces cerevisiae ) (KR 10-2002-0096574 A, etc.), but was not applied to industrial yeast, and Escherichia coli , which is widely used in the production of useful products. In the case of, several cases of failure to introduce auxotrophic markers have been reported, and even the developed strains are extremely limited in industrial application.

Under this background, the present inventors produced D-glutamate auxotrophic Escherichia coli as a result of intensive research efforts, and confirmed that the produced Escherichia coli has fewer reverting mutants and maintains high plasmid stability and protein productivity. In addition to confirming that a useful product can be produced, the present invention was completed by confirming that the method for producing D-glutamate auxotrophic E. coli of the present invention can be applied to various E. coli strains.

It is an object of the present invention to provide D-glutamate auxotrophic Escherichia coli.

Another object of the present invention is to provide a method for producing the E. coli.

Another object of the present invention is to provide a composition for producing a target substance, including the E. coli.

Another object of the present invention is to provide a method for producing a target substance, comprising the step of culturing the E. coli.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention can be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present invention belong to the scope of the present invention. In addition, it cannot be seen that the scope of the present invention is limited by the specific description described below.

In addition, those of ordinary skill in the art can recognize or ascertain using only routine experimentation a number of equivalents to the specific aspects of the invention described herein. Also, such equivalents are intended to be included in the present invention.

One aspect of the present invention provides a D-glutamate auxotrophic variant E. coli in which the murI gene is deleted.

Another aspect of the present invention provides a method for producing D-glutamate auxotrophic mutant E. coli, comprising the step of deleting the murI gene in E. coli.

The term "nutrition" as used herein refers to cells that have been modified to eliminate or reduce their ability to produce specific substances required for growth and metabolism. In contrast, "prototrophy" refers to cells capable of producing specific substances necessary for growth and metabolism. The term "D-glutamate auxotroph" of the present invention is a strain in which the ability to synthesize D-glutamate, an essential component of the cell wall, has been removed or decreased, and can grow in a medium from which D-glutamate is removed. No, it refers to a strain having selectivity capable of growing in a medium in which D-glutamate is present.

The term " murI gene" of the present invention is a gene encoding glutamate racemase, and is known as a gene essential for the biosynthesis of D-glutamate (J Bacteriol. 1993 May;175(10):2970-9.) . For information on glutamate racemase and the murI gene encoding it, sequence information can be obtained from GenBank of NCBI, a known database, specifically, the nucleotide sequence of SEQ ID NO: 1 or at least 80%, 90%, 95%, 96 %, 97%, 98%, or 99% may contain a nucleotide sequence having homology or identity.

In the present invention, the term "polynucleotide" has the meaning of comprehensively including DNA or RNA molecules, and nucleotides, which are basic structural units in polynucleotides, may include not only natural nucleotides but also analogs with modified sugar or base moieties.

Even if it is described as'polynucleotide having a nucleotide sequence described by a specific sequence number' in the present invention, if it has the same or corresponding activity as a polynucleotide consisting of the nucleotide sequence of the sequence number, some sequences are deleted, modified, It is obvious that polynucleotides having substituted or added nucleotide sequences can also be used in the present invention.

Homology and identity refer to the degree to which two given base sequences are related and can be expressed as a percentage.

The terms homology and identity of the present invention can often be used interchangeably.

The sequence homology or identity of conserved polynucleotides is determined by standard alignment algorithms, and the default gap penalty established by the program used can be used together. Substantially, homologous or identical sequences are generally in moderate or high stringent conditions along at least about 50%, 60%, 70%, 80% or 90% of the sequence or full-length. (stringent conditions) can be hybridized. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotide.

Whether any two polynucleotide sequences have homology, similarity or identity is determined, for example, in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: Can be determined using a known computer algorithm such as the "FASTA" program using default parameters as in 2444. Alternatively, as performed in the Needleman program (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) of the EMBOSS package, Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073) For example, homology, similarity or identity can be determined using BLAST, or ClustalW of the National Center for Biotechnology Information.

Homology, similarity or identity of polynucleotides can be found in, for example, Smith and Waterman, Adv. Appl. As known in Math (1981) 2:482, for example, Needleman et al. (1970), J Mol Biol. 48: 443 can be determined by comparing sequence information using a GAP computer program. In summary, the GAP program defines the total number of symbols in the shorter of two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). The default parameters for the GAP program are (1) a monolithic comparison matrix (contains values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps. Thus, as used herein, the term “homology” or “identity” refers to the relevance between sequences.

In addition, the polynucleotide of the present invention has various modifications to the coding region within a range that does not change the polynucleotide sequence due to the degeneracy of the codon or in consideration of the codon preferred in the organism to express the polynucleotide. This may be achieved, and may be included without limitation as long as it exhibits the same activity as the protein encoded by the polynucleotide of SEQ ID NO: 1, or the strain in which the corresponding polynucleotide is deleted shows auxotroph for a specific amino acid. In addition, a probe that can be prepared from a known gene sequence, for example, a complementary sequence for all or part of the nucleotide sequence, and hydride under stringent conditions to obtain the same activity as the protein encoded by the polynucleotide of SEQ ID NO: 1 It may be included without limitation as long as it is shown or the strain in which the corresponding polynucleotide is deleted exhibits an auxotroph for a specific amino acid. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. These conditions are known in the art, for example, between genes with high homology or identity, 40% or more, specifically 80% or more, 85% or more, 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically 99% or more, under the condition that genes having homology or identity are hybridized, and genes with lower homology or identity are not hybridized, or usually The washing conditions of southern hybridization of 60°C, 1XSSC, 0.1% SDS, specifically 60°C, 0.1XSSC, 0.1% SDS, more specifically 68°C, 0.1XSSC, 0.1% SDS. At the salt concentration and temperature, the conditions for washing once, specifically two to three times, can be enumerated.

Hybridization requires that two nucleic acids have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments that are complementary to the entire sequence.

Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.

The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art.

All of the gene or protein sequences referred to in the present invention may include a gene or protein sequence having 80% or more homology.

The term "gene deletion" of the present invention may be used interchangeably with terms such as gene deletion, deletion, and the like, and includes the expression of a target gene being reduced or eliminated to a lower level compared to the wild strain.

The gene deletion can be performed by any inactivation method known in the art. Specifically, the "loss of the murI gene" can be performed by a method of replacing the murI gene on the chromosome, specifically using the method of deleting a gene by homologous recombination, or a method in which is replaced by any other gene However, it is not limited thereto. Methods for causing homologous recombination are known in the art. In addition, the gene deletion may be performed by replacing the murI gene sequence with a polynucleotide or a marker gene from which some nucleic acid sequences have been deleted. The "partial nucleic acid sequence" may be different depending on the type of polynucleotide, specifically 1 to 300, more specifically 1 to 100, and even more specifically 1 to 50, but specifically limited thereto no. In addition, the gene deletion is performed by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution of the murI gene sequence, or a combination thereof, or an improved gene sequence to further inactivate or an improved gene sequence without activity. It can be replaced with, but is not limited thereto. In addition, the gene deletion is performed by inducing a mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof of the nucleic acid sequence so that the activity of the expression control sequence of the murI gene is further weakened. It can be performed by replacing with a nucleic acid sequence having an activity, but is not limited thereto. The expression control sequence may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling termination of transcription and translation.

The term "vector" of the present invention refers to a DNA product containing a nucleotide sequence of a polynucleotide encoding the protein of interest operably linked to a suitable control sequence so that the protein of interest can be expressed in a suitable host. Such regulatory sequences include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling termination of transcription and translation. Vectors can be transformed into a suitable host and then replicated or function independently of the host genome, and can be integrated into the genome itself.

The vector used in the present invention is not particularly limited as long as it is replicable in the host, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, and Charon21A can be used as a phage vector or cosmid vector, and as a plasmid vector, pBR system, pUC system, pBluescript II system , pGEM system, pTZ system, pCL system, pKD system, pT system, pET system, etc. can be used. For example, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pKD3, pT7, pKD46, pCP20, GESS (Korean Patent Registration No. 10-1222056) vectors, etc. may be used, but the present disclosure is not limited thereto.

The term "transformation" of the present invention refers to a series of operations in which a vector containing a polynucleotide encoding a protein of interest is introduced into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. . The polynucleotide introduced into the host cell may be in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide is a structure comprising all elements necessary for self-expression (promoter operably linked to the polynucleotide, transcription termination signal, ribosome binding site, translation termination signal, etc.) It may be introduced into a host cell in the form of an expression cassette, and the expression cassette may be in the form of an expression vector capable of self-replicating.

In addition, the term "operably linked" in the above means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the protein of interest of the present invention.

Methods of introducing the vector include calcium phosphate method, calcium chloride/rubidium chloride method, lithium acetate method, electroporation method, electroinjection method, chemical treatment method such as PEG, gene gun, etc. Methods widely used in the industry can be applied.

Any gene that causes the strain to exhibit D-glutamate auxotroph may be inserted at the location of the deleted murI gene of the strain. The gene inserted at the position of the deleted murI gene may be included without limitation as long as the strain exhibits auxotroph, specifically may be a gltS sequence, more specifically a mutated gltS sequence, and more specifically May be a mutant gltS ( mGltS ) sequence of WM335 , but is not limited thereto, and more specifically, may have a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 or more than 80% homology or identity thereto, Not limited. The insert any gene can be carried out simultaneously or in steps after step murI defect in which the defect murI.

On the other hand, the strain may exhibit D-glutamate auxotroph even if no other gene is inserted at the location of the defective murI gene. In one embodiment, the method for producing glutamate auxotrophic Escherichia coli of the present invention may further include a step of deleting the gene when replacing the murI gene with another gene. The gene deletion step may improve the stability of the plasmid in glutamate auxotrophic Escherichia coli.

The "D-glutamate auxotrophic E. coli" of the present invention is not limited as long as it is E. coli that can be used for the production of useful products, and specifically, may be an E. coli strain other than WM335, and more specifically BL21(DE3), SBA01 or It may be DH5α, and more specifically, it may be a DH5α strain, but is not limited thereto.

In one embodiment of the present invention, it was confirmed that D-glutamate auxotrophic DH5α was produced by replacing the murI gene of SEQ ID NO: 1 with the nucleotide sequence of SEQ ID NO: 3 (FIG. 2B), and in another embodiment of the present invention, the It was confirmed that D-glutamate auxotroph DH5α with improved plasmid stability was produced by additionally deleting the nucleotide sequence of SEQ ID NO: 3 in DH5α KI in which the murI gene of SEQ ID NO: 1 was replaced with the nucleotide sequence of SEQ ID NO: 3 , It was confirmed that D-glutamate auxotrophic Escherichia coli was produced through the murI defect. In addition, compared to the known glutamate auxotrophic WM335 E. coli strain, it was confirmed that the selectivity for the presence or absence of glutamate in various mediums was excellent, and such selectivity was maintained for a long time (FIG. 3), which can be usefully used compared to the existing strain Can be seen.

Another aspect of the present invention provides a composition for producing a target substance comprising E. coli of the present invention.

The composition may additionally include any suitable excipients commonly used in the preparation of the target substance, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffering agent, a stabilizer or an isotonic agent, etc. It is not.

Another aspect of the present invention provides a method for producing a target substance, comprising the step of culturing E. coli of the present invention.

The E. coli may be a vector containing a gene encoding a D-amino acid transferase (DAAT) and a target gene in the D-glutamate auxotrophic E. coli of the present invention.

The term "target gene" of the present invention refers to a gene encoding a target substance, and refers to encoding a polypeptide with a specific target nucleic acid to be transcribed. The target gene may be any gene desired by a person skilled in the art, and may be a gene derived from an exotic species or other strain other than the host strain, E. coli, or a gene in a modified form, but is not limited. Specifically, the target substance may be a protein, but is not limited thereto. In one embodiment of the present invention, a gene encoding an enzyme involved in bisabolol synthesis was used as a target gene.

The term "D-amino acid transferase" of the present invention is used interchangeably with "DAAT" and is an enzyme that enables the synthesis of D-glutamate. When a vector containing a gene encoding DAAT is introduced into a D-glutamate auxotroph, prototrophic strain of the D-glutamate auxotroph is restored, and growth is possible even in a medium in which D-glutamate does not exist. On the other hand, the host strains in which the gene encoding DAAT and the gene of interest are not successfully introduced are still in a state in which D-glutamate cannot be synthesized and cannot grow in a medium that does not contain D-glutamate. A vector including the gene and the gene of interest can be used as a marker for transformation, and the recombinant strain can be easily selected without antibiotics.

In one embodiment of the present invention, a gene encoding DAAT (nucleotide sequence of SEQ ID NO: 4) and green fluorescent protein in a D-glutamate auxotrophic strain produced by replacing the murI gene of SEQ ID NO: 1 with the nucleotide sequence of SEQ ID NO: 3 By introducing the vector containing the gene encoding the, it was confirmed that the target gene introduced strain can be selected without antibiotics (Figs. 5 and 6). In another embodiment of the present invention, a vector encoding DAAT and (-)-α-bisabolol synthase in a D-glutamate auxotrophic strain produced by replacing the murI gene of SEQ ID NO: 1 with the nucleotide sequence of SEQ ID NO: 3 Was introduced, and it was confirmed that the bisabolol production and cell growth were maintained high.These bisabolol production and cell growth rates were compared to the previously known D-glutamate auxotrophic strain WM335 strain as well as the strain using antibiotics as a marker. As it was confirmed that it is high (FIGS. 7 and 9), it can be seen that the D-glutamate auxotrophic strain of the present invention can be used for efficient production of the target substance.

The method for producing the target substance comprises the steps of culturing E. coli of the present invention; And it may be a method comprising the step of recovering the target material from the microorganism or medium.

The "culture" means growing the E. coli in an appropriately controlled environmental condition. The cultivation process of the present application may be made according to a suitable medium and culture conditions known in the art, and may be easily adjusted and used by those skilled in the art. The step of culturing the E. coli is not particularly limited thereto, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, or the like. At this time, the culture conditions are not particularly limited thereto, but a basic compound (eg, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) is used to provide an appropriate pH (eg, pH 5 to 9, specifically PH 6 to 8) can be adjusted. In addition, during cultivation, an antifoaming agent such as fatty acid polyglycol ester can be used to suppress the generation of air bubbles. In addition, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas is injected into the culture, or the anaerobic and microaerobic state To maintain, nitrogen, hydrogen or carbon dioxide gas may be injected without injection of gas. The culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, but is not limited thereto. The cultivation period may be continued until the production amount of the desired useful substance is obtained, specifically, the cultivation may be performed for about 10 to 160 hours, but is not limited thereto. In addition, the culture medium used is a carbon source such as sugar and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molase, starch and cellulose), fats and fats (e.g., soybean oil, sunflower seeds) Oil, peanut oil and coconut oil), fatty acids (such as palmitic acid, stearic acid and linoleic acid), alcohols (such as glycerol and ethanol) and organic acids (such as acetic acid) can be used individually or in combination. , Is not limited thereto.

The method can be readily determined by a person skilled in the art in an optimized medium and culture conditions known in the art. The step of recovering the target substance may be performed using a suitable method known in the art. For example, centrifugation, filtration, distillation, ion exchange chromatography, crystallization and HPLC may be used, but are not limited thereto.

In addition, the recovery step may include a purification process, and may be performed using a suitable method known in the art.

The D-glutamate auxotrophic Escherichia coli of the present invention has fewer revertants, maintains high plasmid stability and protein productivity, and can effectively produce useful products without the use of antibiotics, and can be applied to clean production of useful products including proteins. Do.

1 schematically shows the process of introducing a mutant gltS gene ( mGltS ) while deleting the murI gene using homologous recombination in E. coli DH5α strain. Since FRT sites exist on both sides of the CAT gene, the CAT gene is removed by flippase.
FIG. 2A shows the amplification product of 953bp in the D-glutamate auxotrophic candidate strain by performing PCR using pMurOut-F and pMurIn-R primers. M is a DNA marker and Neg is a wild type DH5α. 2B is a result of culturing the recombinant strain in an LB medium containing (+) or not (-) 50 μg/mL of D-glutamate for 24 hours.
FIG. 3 is a result of culturing DH5α KI or WM335 strain in LB, 2XYT, or TB medium containing (+) or not containing D-glutamate 50 μg/mL, and measuring OD ₆₀₀ values.
4 is a result of measuring the change in OD ₆₀₀ value over time by culturing the DH5α KI strain in an LB medium containing (+) or not containing (-) glutamate.
Figure 5 shows the GFP protein expression was confirmed after constructing the pT-GFP-DAAT plasmid without using an antibiotic in the DH5α KI strain. V: amplification from pT-GFP, I: amplification from pGESS-DAAT
Figure 6 is the growth and fluorescence according to the IPTG concentration of the DH5α KI strain (Antibiotic-free selection) introduced with the pT-GFP-DAAT plasmid or the wild-type DH5α strain (Antibiotics selection) introduced the pT-GFP plasmid containing the ampicillin resistance gene. It is a curve.
Figure 7 relates to the production of (-)-α-bisabolol using the DH5α KI strain, Figure 7A is a schematic diagram of the (-)-α-bisabolol production pathway and plasmid, Figure 7B is a low (-)-α-bisabolol Cell growth (OD ₆₀₀ ; bar graph) and (-)-α-bisabolol production (line graph) during the passage of the production strain will be measured, and Figure 7C is a high (-)-α-bisabolol production strain of Cell growth (OD ₆₀₀ ; bar graph) and (-)-α-bisabolol production (line graph) were measured during the subculture process.
8 is a measurement of single cell fluorescence of the GFP protein fluorescence of the strains of FIG. 7 using a flow cytometer.
Figure 9 relates to the production of (-)-α-bisabolol using WM335, the strain growth bar graph, (-)-α-bisabolol production amount is shown as a line graph. 9A is a measurement result of a low (-)-α-bisabolol-producing strain, and FIG. 9B is a measurement result of a high (-)-α-bisabolol-producing strain.
10 is a measurement of single cell fluorescence of the GFP protein of the strains of FIG. 9 using a flow cytometer.
FIG. 11 shows the reduction of the selection pressure in the D-glutamate-rich environment and the maintenance of stable plasmid using the removal of mGltS as a way to overcome this. Since FRT sites exist in both the mGltS gene and the CAT gene, the mGltS gene and the CAT gene are simultaneously removed by flippase .
Figure 12 is a measurement of the growth of the D-glutamate auxotrophic DH5α KI strain with or without D-glutamate in which mGltS and CAT genes were introduced between FRT sites.
13 shows a 481 bp amplification product by performing PCR using pMurOut-F and pMurOut-R primers on a strain from which mGltS and CAT were removed by expressing Flippase. In the DH5α KI strain from which mGltS and CAT were removed, the GFP protein expressed from the pT-GFP-DAAT plasmid was confirmed in an LB plate without antibiotics.
14 is a measurement of the growth of the BL21 (DE3) KI strain and the SBA01 KI strain according to the presence or absence of D-glutamate.

Hereinafter, the present invention will be described in more detail through examples and experimental examples. However, these Examples and Experimental Examples are for illustrative purposes only, and the scope of the present invention is not limited to these Examples and Experimental Examples.

Example 1: Bacterial Strains and Reagents

Hereinafter, the bacterial strains and reagents used in the examples of the present invention are as follows.

For cloning, plasmid maintenance, and (-)-α-bisabolol production, Escherichia coli DH5α or D-glutamate auxotrophic Escherichia coli DH5α (DH5α KI) strain was used. In addition, E. coli WM335 strain was additionally used for producing (-)-α-bisabolol. Unless otherwise indicated, Luria-Bertani (LB) medium (10 g/L tryptone, 5 g/L yeast extract and 10 g/L sodium chloride) was used for culture.

To confirm the nutritional requirements of E. coli D-glutamate, LB medium, 2X YT (16 g/L tryptone, 10 g/L yeast extract and 5 g/L sodium chloride) medium or terrific broth (TB) medium (12 g/L enzymatic casein digest, 24 g/L yeast extract, 9.4 g/LK ₂ HPO ₄ , 2.2 g/L KH ₂ PO ₄ and 1% (w/v) glycerol) were used.

For production of (-)-α-bisabolol, terrific broth medium containing glycerol (TBG) (12 g/L enzymatic casein digest, 24 g/L yeast extract, 9.4 g/LK) ₂ HPO ₄ , 2.2 g/L KH ₂ PO ₄ and 3.5% (w/v) glycerol) were used. SOC medium (20 g/L tryptone, 5 g/L yeast extract and 0.5 g/L sodium chloride, 2.4 g/L magnesium sulfate, 186 mg/L potassium chloride, 4 g/L) as a recovery medium after transformation Glucose) was used.

Ampicillin and chloramphenicol were used at concentrations of 100 μg/mL and 10 μg/mL. In addition, in the case of D-glutamate auxotroph E. coli, 50 µg/mL of D-glutamate was added if necessary.

For polymerase chain reaction (PCR), high-precision KOD-Plus-Neo polymerase (Toyobo, Osaka, Japan) was used as a standard protocol. All restriction enzymes and modifying enzymes were purchased from New England BioLabs (Ipswich, MA, USA).

Example 2: Plasmid construction

Hereinafter, a plasmid for use in the examples of the present invention was prepared as follows.

The pKI-mGltS-Cm plasmid required to construct D-glutamate auxotrophic Escherichia coli DH5α KI was constructed as follows. The plasmid backbone region was amplified from the pKD3/I- Sce I plasmid using pKI-VF and pKI-VR primers. The mutant gltS gene region was amplified using pKI-IF and pKI-IR primers from genomic DNA of E. coli WM335 strain. Thereafter, the two PCR products were combined by the Gibson assembly method (New England BioLabs (Ipswich, MA, USA)) according to the manufacturer's instructions.

The pKI -FRT-mGltS-Cm plasmid required to construct the D-glutamate auxotrophic Escherichia coli DH5α KI from which the mGltS gene was removed was constructed as follows. The first fragment was amplified from the pKI-mGltS-Cm plasmid using pFRT-VF and pFRT-VR primers, and the second fragment was amplified from the pKI-mGltS-Cm plasmid using pFRT-IF and pFRT-IR primers. Thereafter, the two PCR products were combined by the Gibson assembly method.

The green fluorescent protein expression plasmid pT-GFP was constructed as follows. The backbone portion of the pT-BBS plasmid was amplified with pTG-VF and pTG-VR primers, and the green fluorescent protein portion of the pK7 sfGFP plasmid was amplified with pTG-IF and pTG-IR primers. Thereafter, the two amplification products were linked by the Gibson assembly method.

In order to construct pT-GFP-DAAT in which the antibiotic resistance gene was replaced with a D-amino acid transferase (DAAT) gene in the pT-GFP plasmid, the backbone of the pT-GFP plasmid excluding the ampicillin resistance gene was pAF. -VF and pAF-VR primers were used to amplify, and the DAAT gene site of the pGESS-DAAT plasmid was amplified with pAF-IF and pAF-IR primers. Thereafter, the two amplification products were linked by the Gibson assembly method. The linked plasmid was transformed into an Escherichia coli DH5α KI strain, plated on an LB plate containing no antibiotics, and cultured overnight. After PCR was performed using the grown colonies with pAFout-F and pAF-IR primers, the recombination success rate was measured by confirming the amplification product of 981 bp.

To construct the pTM-BBS-IspA-DAAT-GFP plasmid, DAAT protein and green fluorescent protein regions were amplified from pGESS-DAAT plasmid using pDG-F and pDG-R primers, and the amplified fragment was cut with SbfI restriction enzyme. The pTM-BBS-IspA plasmid was ligated using the Gibson assembly method.

To construct pTM2-BBS-IspA-DAAT-GFP plasmid, pTM-BBS-IspA-DAAT-GFP plasmid was cut with XbaI to remove mevalonate pathway enzymes including mvaK1 derived from Staphylococcus aureus, and then pTM2-BBS- in the mevalonate pathway enzymes, including mvaK1 of Methanosarcina mazei-derived IspA obtained by cutting the plasmid with XbaI were connected by using T4 DNA ligase.

The primers and plasmids used are summarized in Tables 1 and 2 below.

primer Oligonucleotide sequence (5'→3') Display Sequence number pKI-VF gcgtcggaagtaaggtaccatggtaggtcc pKI-mGltS-Cm Plasmid 5 pKI-VR attgttttcgatttcgcgggatcgagatcc 6 pKI-IF cccgcgaaatcgaaaacaatcccgtggtag 7 pKI-IR tggtaccttacttccgacgctttttcattt 8 pFRT-VF ttcctattccggcgcgcctacctgtgacgg pKI-FRT-mGltS-Cm Plasmid 9 pFRT-VR ctatactttctagagaataggaacttcgatttcgcgggatcgagatcc 10 pFRT-IF ctattctctagaaagtataggaacttcgcgaaaacaatcccgtggtag 11 pFRT-IR taggcgcgccggaataggaactaactatat 12 pTG-VF cgaaaaataatctagagtcgacctgcaggc pT-GFP plasmid 13 pTG-VR ctttgctcatggtttaacctcctgtgtgaa 14 pTG-IF aggttaaaccatgagcaaaggtgaagaact 15 pTG-IR cgactctagattatttttcgaactgcggat 16 pAF-VF agcagcttaactgtcagaccaagtttactc pT-GFP-DAAT plasmid 17 pAF-VR gttccaacatactcttcctttttcaatatt 18 pAF-IF aaggaagagtatgttggaacaaccaatagg 19 pAF-IR ggtctgacagttaagctgctaaagcgtagt 20 pAFout-F ggcctttttgcgtttctaca 21 pDG-F taatctagagtcgacctgcaatccgccaacctggagaagg pSNA-MrBBS-IspA-DAAT-GFP Plasmid 22 pDG-R gccaagcttgcatgcctgcattacttgtacagcttgtcca 23 pMurKI-F accacgtcccaccgtgctggtgtttgactccggcgtcggtgggttgtcgg cgaaaacaatcccgtggtag Knock-in the gltS gene mutation at the murI gene location 24 pMurKI-R tcagcctaaaactgccagtttttcgagcgtttcgaagccgtaacgctgta ggaatacggttagccatttg 25 pMurKO-F accacgtcccaccgtgctggtgtttgactccggcgtcggtgggttgtcgg ggtccatatgaatatcctcc 26 pMurOut-F ggtgtgagcttgtgggatct 27 pMurOut-R gttgttccgtgtcagtggtg 28 pMurIn-R ggtgaagccataacgttcaa 29 pMurKI-FRT-F accacgtcccaccgtgctggtgtttgactccggcgtcggtgggttgtcgg ggatctcgatcccgcgaaat For removal by flippase after knock-in of the mutant gltS gene at the murI gene 30

name Explanation CRISPRi Plasmid pKD46 Plasmid expressing λ-Red recombinase, P _araB , Amp ^R pCP20 Plasmid expressing Flippase, Amp ^R , Cm ^R pKD3/I- Sce I PKD3 plasmid derivatives with I- Sce I restriction enzyme recognition sequences on both sides of the chloramphenicol resistance gene, Cm ^R , Amp ^R pT-BBS PTrc99A derivative containing codon-optimized Matricaria recutita MrBBS gene pK7 sfGFP Plasmid expressing superfolder GFP pTM-BBS-IspA PT -BBS plasmid containing E. coli ispA , S. aureus mvaK1 , S. pneumoniae mvaD , S. pneumoniae mvaK2 , E. coli idi , E. faecalis mvaE , E. faecalis mvaS pTM2-BBS-IspA PT -BBS plasmid containing E. coli ispA , M. mazei mvaK1 , S. pneumoniae mvaD , S. pneumoniae mvaK2 , E. coli idi , E. faecalis mvaE , E. faecalis mvaS pGESS-DAAT PGESSv4 derivatives containing the DAAT gene pKI-mGltS-Cm PKD3/I- Sce I plasmid derivative expressing mutant GltS protein and chloramphenicol resistance gene, Cm ^R , Amp ^R pKI-FRT-mGltS-Cm PKI-mGltS-Cm plasmid derivative, Cm ^R , Amp ^R , with FRT sites present on both mutant GltS protein and chloramphenicol resistance gene pT-GFP PTrc99A derivative expressing superfolder GFP pT-GFP-DAAT PT-GFP derivative expressing DAAT gene pTM-BBS-IspA-DAAT-GFP PTM-BBS-IspA derivative expressing DAAT gene and GFP pTM2-BBS-IspA-DAAT-GFP PTM2-BBS-IspA derivative expressing DAAT gene and GFP

Example 3: Preparation of D-glutamate auxotrophic strain

Homologous recombination was used to express the mutant GltS protein while deleting the murI gene of E. coli DH5α strain. The manufacturing method is briefly shown in FIG. 1.

Specifically, a region containing the mutant gltS and chloramphenicol resistance gene of the pKI-mGltS-Cm plasmid prepared in Example 2 was PCR-amplified using pMurKI-F and pMurKI-R primers. As a control, a region containing a chloramphenicol resistance gene was PCR-amplified using pMurKO-F and pMurKI-R primers. After amplification, bands of the correct size were respectively purified using Wizard® SV Gel and PCR Clean-Up system (Promega, Madison, WI, USA). The purified PCR fragment was treated with DpnI, and then purified once again using Wizard® SV Gel and PCR Clean-Up system. The purified PCR product was transformed into an E. coli DH5α strain transformed with pKD46 by electroporation.

Then, it was spread on LB medium containing 10 µg/mL of chloramphenicol and 50 µg/mL of D-glutamate, and cultured at 37°C overnight. Colonies were formed in E. coli transformed with the control PCR product of chloramphenicol resistance gene, whereas colonies were not formed in E. coli transformed with the mutant gltS and PCR products containing the chloramphenicol resistance gene. Of these, 7 grown colonies were selected and PCR-amplified with pMurOut-F and pMurIn-R primers in order to confirm whether they were mutant strains. As a result, it was confirmed that an amplification product of 953 bp including a part of mutant gltS was generated (FIG. 2A). Thereafter, as a result of culturing the selected strain in LB medium containing (+) or not containing 50 µg/mL glutamate (-), the strain producing the amplification product of 953 bp did not grow in the LB medium and D-glutamate was added. It was confirmed that it was selectively grown in one LB medium (Fig. 2B).

Through this, it was confirmed that the strain prepared by introducing the murI deletion and mutant gltS ( mGltS ) gene was a D-glutamate auxotrophic strain, and the pCP20 plasmid of Example 2 was introduced into the prepared D-glutamate auxotrophic strain to chloramphenicol. The DH5α KI strain was completed by removing the resistance gene.

Example 4: Confirmation of D-glutamate nutrient requirement of DH5α KI strain in complex medium

In order to confirm the D-glutamate auxotroph of the E. coli DH5α KI strain, the growth of the E. coli DH5α KI strain prepared in Example 3 in a complex medium was confirmed.

First, in order to confirm the cell growth of each complex medium, E. coli DH5α KI or WM335 strain (control) was streaked on an LB plate containing 50 μg/mL of D-glutamate and cultured overnight at 37°C and 200 rpm. Three single colonies (n=3) were inoculated into LB medium containing 50 µg/mL of D-glutamate, and cultured overnight at 37 degrees and 200 rpm. The cultured cells were centrifuged at 3,000 rpm for 20 minutes to remove the supernatant and then suspended in LB medium. 1% of the suspended cells were inoculated into 3 types of complex media (LB, 2X YT or TB) or 3 types of complex media (LB, 2X YT or TB) containing 50 µg/mL of D-glutamate, respectively, at 37 degrees, Incubated at 200 rpm. Cell growth was observed by measuring absorbance at a wavelength of 600 nm using a spectrophotometer (GE Healthcare) (FIG. 3).

As a result, DH5α KI maintained the selectivity for D-glutamate in all media for 24 hours of culture, and this selectivity was maintained for up to 48 hours in 2X YT medium and TB medium. On the other hand, the WM335 strain as a control group did not show selectivity for the presence or absence of D-glutamate in the LB medium, and the selectivity was remarkably low in the TB medium.

Next, in order to observe real-time cell growth, first, Escherichia coli DH5α KI was streaked on an LB plate containing 50 μg/mL of D-glutamate, and cultured overnight at 37°C and 200 rpm. Six single colonies (n=6) were each inoculated into LB medium containing 50 μg/mL of D-glutamate, and cultured overnight at 37°C and 200 rpm. The cultured cells were centrifuged at 3,000 rpm for 20 minutes to remove the supernatant and then suspended in LB medium. 1% of the suspended cells were inoculated into LB medium containing 50 µg/mL of LB or D-glutamate, and cultured at 37 degrees in a plate reader (Infinite 200 Pro, Tecan) to measure absorbance at a wavelength of 600 nm (FIG. 4).

As a result, it was confirmed that the DH5α KI strain grew well in the medium to which D-glutamate was added, whereas the DH5α KI hardly grew for about 30 hours in the medium without D-glutamate.

From the above results, the DH5α KI strain of the present invention maintains high selectivity for the presence or absence of D-glutamate in the medium for a long time regardless of the type of the complex medium, and in particular, the selectivity in 2X YT and TB medium is maintained for 48 hours or more. And, it can be seen that this selectivity is superior to the previously known D-glutamate auxotrophic strain, WM335 strain.

Example 5: Cloning of recombinant plasmid expressing green fluorescent protein (GFP) from which antibiotic resistance gene was removed using DH5α KI strain and confirmation of GFP expression

A recombinant plasmid expressing a GFP protein from which an antibiotic resistance gene was removed was constructed using the DH5α KI strain.

First, as described above in Example 2, the ampicillin antibiotic resistance gene in the pT-GFP plasmid was substituted with the DAAT gene, which is a transformation marker of the D-glutamate auxotrophic strain, through the Gibson assembly method, and then transformed into the DH5α KI strain. Incubated overnight on LB plates containing no antibiotics. As a result, it was confirmed that all the grown colonies successfully expressed the GFP protein, and 22 colonies were selected and PCR-amplified with pAFout-F and pAF-IR primers specific to the pT-GFP-DAAT plasmid. The amplification product of 981bp predicted in was formed (FIG. 5). As a result of sequencing the plasmids by separating the plasmids from 10 colonies, it was confirmed that the DAAT gene was present instead of the antibiotic resistance gene in all 10 colonies.

The DH5α KI strain introduced with the pT-GFP-DAAT plasmid prepared above (n=3) was inoculated into LB medium and cultured overnight at 37°C and 200 rpm. 1% of the cultured cells were inoculated in LB medium containing various concentrations of IPTG (0, 63, 125, 250, 500, 1000 μM) and cultured in a plate reader (Infinite 200 Pro, Tecan) at 37 degrees, while fluorescence and OD ₆₀₀ Was measured for 24 hours. As a control, the pT-GFP plasmid (including the ampicillin resistance gene) was introduced into the wild-type DH5α strain, and in a medium containing ampicillin and various concentrations of IPTG (0, 63, 125, 250, 500, 1000 μM) as described above. It was cultured (Fig. 6).

As a result, it was confirmed that the expression level of the fluorescent protein was regulated according to the amount of IPTG in the DH5α KI strain introduced with the pT-GFP-DAAT plasmid in the same manner as the DH5α strain transformed with the plasmid containing the antibiotic resistance gene, and cell growth was also problematic. It was confirmed that there was no.

Through this, it can be seen that by introducing the plasmid in which the DAAT gene is cloned into the DH5α KI strain of the present invention, it is possible to select E. coli including the recombinant plasmid and express the recombinant protein without antibiotics while maintaining the same effect as the existing strain.

Example 6: Production of useful products using D-glutamate nutrient demanding strain

(-)-Α-bisabolol ((-)-α-bisabolol) production experiment was performed to confirm whether useful products can be efficiently produced using the D-glutamate auxotrophic DH5α KI strain prepared in the above example. I did.

the bottom of the IPTG-inducible promoter of the plasmid pTRC99a (-) - MrBBS encoding the α- Ibiza bolrol synthase, Ipanema chamber diphosphate synthase involved in the ispA and mevalonate (mevalonate) channel encoding (farnesyl diphosphate synthase) The enzyme-encoding mvaE, mvaS, mvaK1, mvaK2, mvaD, and idi were cloned, and the DAAT and GFP-coding genes, which were selectable markers, were also cloned to produce a (-)-α-bisabolol production plasmid. The structure of the produced production plasmid is shown in Fig. 7A.

At this time, two types of (-)-α-bisabolol production plasmids were prepared. The pTM-BBS-IspA-DAAT-GFP plasmid expresses mvaK1 derived from Staphylococcus aureus , thus exhibiting low (-)-α-bisabolol productivity and pTM2 The -BBS-IspA-DAAT-GFP plasmid expresses mvaK1 derived from Methanosarcina mazei and exhibits high (-)-α-bisabolol productivity.

The prepared production plasmid was introduced into a DH5α KI strain or a control wild-type DH5α strain (n=3), and subcultured in TBG medium with or without ampicillin for 15 days (Fig. 7B) to grow cells (OD ₆₀₀ ). And (-)-α-bisabolol production was measured and averaged (Figs. 7B and 7C).

As a result, when cultured without the use of antibiotics in the DH5α KI strain containing the pTM-BBS-IspA-DAAT-GFP plasmid, while stably producing (-)-α-bisabolol for 15 days, the wild-type DH5α strain In the case of, even when antibiotics were used, the productivity of (-)-α-bisabolol decreased rapidly from P4 culture (FIG. 7B). In order to confirm whether this stable productivity is related to the ability to maintain the plasmid in the DH5α KI strain, fluorescence of the GFP protein expressed in the pTM-BBS-IspA-DAAT-GFP plasmid was measured on a single cell basis using a flow cytometer. As a result, it was confirmed that, while the plasmid was stably maintained for 15 days in the DH5α KI strain, even when antibiotics were used in the wild-type DH5α strain, cells containing no plasmid from P3 culture appeared (Fig. 8A).

In addition, the same experiment was performed using the pTM2-BBS-IspA-DAAT-GFP plasmid producing a high concentration of (-)-α-bisabolol. In this case, the mevalonate pathway, which is known to have cytotoxicity, is greatly activated, increasing the metabolic burden of cells bearing the production plasmid. As a result of the experiment, when cultured without antibiotics in DH5α KI strain, (-)-α-bisabolol was stably produced during P3, whereas in the case of wild-type DH5α strain, even when antibiotics were used, (-)-α-bisa Volol productivity was rapidly decreased from P3 culture (Fig. 7C). As a result of confirming the stability of the production plasmid through single-cell fluorescence analysis, the production plasmid remains stable for 15 days in the case of the DH5α KI strain, whereas cells without the plasmid rapidly increase from P3 culture even when antibiotics are used in the wild-type DH5α strain. It was confirmed that (Fig. 8B).

As another control, the plasmid was also introduced into the WM335 strain (n=3) (control group: wild-type DH5α strain) and subcultured for 12 days to measure cell growth and (-)-α-bisabolol production in the same manner (FIG. 9 ). .

As a result, when produced using the pTM-BBS-IspA-DAAT-GFP plasmid, only one of the three experimental samples stably produced (-)-α-bisabolol, whereas the two experimental samples were compared with the wild-type DH5α strain. More unstable, the productivity was lost from the P3 culture (Fig. 9A). Even when the pTM2-BBS-IspA-DAAT-GFP plasmid producing high concentration of (-)-α-bisabolol was used, only 1 out of 3 experimental samples in WM335 strain stably produced (-)-α-bisabolol (Fig. 9B). In addition, as a result of testing the stability of the production plasmid through single-cell fluorescence analysis, although the plasmid was continuously maintained for 12 days in the WM335 strain, when comparing the fluorescence intensity of single cells, the GFP protein expression was homogeneous in the wild-type DH5α strain. In the case of the WM335 strain, it was confirmed that the GFP protein expression pattern was largely different for each single cell and was overall heterogeneous (FIGS. 10A and 10B). This indicates that the DH5α strain is more suitable than the WM335 strain in the case of (-)-α-bisabolol production.

Through this, by introducing a plasmid in which the gene encoding the target product and the DAAT gene are cloned into the DH5α KI strain of the present invention, plasmid stability is maintained even after generations of E. coli, indicating that the target product can be efficiently produced. It can be seen that the strain of the invention can be usefully used in the production of various compounds.

Example 7: Preparation of a glutamate nutrient supplement with enhanced plasmid stability

As confirmed in Examples 5 and 6, a useful product can be produced when a plasmid in which the gene encoding the target product and the DAAT gene are cloned are introduced into the DH5α KI strain of the present invention.

In order to ensure that the plasmid can be stably maintained in an environment rich in D-glutamate, a strain in which mGltS, a transporter of D-glutamate, was removed from DH5α KI, that is, a strain in which murI was deleted from the wild-type DH5α strain was intended to be produced. To this end, when the FRT site, which is the flippase recognition sequence, is inserted outside both the mGltS gene and the CAT gene, the mGltS gene and the CAT gene are simultaneously deleted when the DAAT- expressing recombinant plasmid and the flippase-expressing plasmid are simultaneously transformed into this strain. . The manufacturing method is simply shown in FIG. 11.

First, PCR-amplified using pMurKI-FRT-F and pMurKI-R primers from the pKI-FRT-mGltS-Cm plasmid prepared in Example 2, and this amplification product was similar to Example 3, the murI gene of the E. coli DH5α strain chromosome It was confirmed that the D-glutamate auxotrophic strain was prepared by culturing after introducing mGltS and CAT genes at the location (FIG. 12). Thereafter, the pT-GFP-DAAT plasmid and pCP20 plasmid were introduced, and the FRT site was recombined by flippase expressed in the pCP20 plasmid to knock out mGltS and CAT genes, which were 481 bp using pMurOut-F and pMurOut-R primers. It was confirmed that the mGltS and CAT genes were successfully removed through the failure of the strain to grow in the plate containing the PCR amplification product of the size and chloramphenicol (FIG. 13). This strain was cultured at 37 degrees to remove the pCP20 plasmid, and it was confirmed that the pCP20 plasmid was removed through the failure of the strain to grow in the plate containing ampicillin (FIG. 13).

The thus prepared murI -deleted strain successfully expressed green fluorescent protein in LB medium (FIG. 13).

Through this, it can be seen that by knocking out the murI gene from the DH5α strain and simultaneously removing the CAT gene and the mGltS gene, it is possible to produce a D-glutamate nutrient demand strain with high plasmid stability without the use of antibiotics.

Example 8: Preparation of other E. coli-based D-glutamate nutrient requirements

In order to confirm that D-glutamate auxotrophic strain can be produced in E. coli other than E. No.: KCTC13040BP) according to the method of Example 4, D-glutamate auxotrophic BL21 (DE3) KI and SBA01 KI strains were prepared.

Thereafter, while culturing the D-glutamate auxotroph of the prepared E. coli BL21 (DE3) KI and SBA01 KI strains, using a plate reader (Infinite 200 Pro, Tecan) to measure the absorbance at a wavelength of 600 nm while incubating at 37 degrees in LB medium. (Fig. 14).

As a result, it was confirmed that BL21(DE3) KI and SBA01 KI strains were well grown in the medium to which D-glutamate was added, whereas both strains hardly grew for about 30 hours in the medium without D-glutamate.

From the above results, it can be seen that the method for producing D-glutamate auxiliaries of the present invention can be applied regardless of the type of E. coli.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description, and equivalent concepts thereof, are included in the scope of the present invention.

<110> KOREA RESEARCH INSTITUTE OF BIOSCIENCE AND BIOTECHNOLOGY <120> D-glutamate auxotrophic Escherichia coli and method of producing target product <130> KPA181603-KR <160> 30 <170> KoPatentIn 3.0 <210> 1 <211> 858 <212> DNA <213> Escherichia coli <400> 1 atggctacca aactgcagga cgggaataca ccttgtctgg cagctacacc ttctgaacca 60 cgtcccaccg tgctggtgtt tgactccggc gtcggtgggt tgtcggtcta tgacgagatc 120 cggcatctct taccggatct ccattacatt tatgctttcg ataacgtcgc tttcccgtat 180 ggcgaaaaaa gcgaagcgtt tattgttgag cgagtggtgg caattgtcac cgcggtgcaa 240 gaacgttatc cccttgcgct ggctgtggtc gcttgcaaca ctgccagtac cgtttcactt 300 cctgcattac gcgaaaagtt cgacttcccg gttgttggtg tcgtgccggc gattaaacct 360 gctgcacgtc tgacggcaaa tggcattgtc ggattactgg caacccgcgg aacagttaaa 420 cgttcttata ctcatgagct gatcgcgcgt ttcgctaatg aatgccagat agaaatgctg 480 ggctcggcag agatggttga gttggctgaa gcgaagctac atggcgaaga tgtttctctg 540 gatgcactaa aacgtatcct acgcccgtgg ttaagaatga aagagccgcc agataccgtt 600 gtattgggtt gcacccattt ccctctacta caagaagaac tgttacaagt gctgccagag 660 ggaacccggc tggtggattc tggcgcagcg attgctcgcc gaacggcctg gttgttagaa 720 catgaagccc cggatgcaaa atctgccgat gcgaatattg ccttttgtat ggcaatgacg 780 ccaggagctg aacaattatt gcccgtttta cagcgttacg gcttcgaaac gctcgaaaaa 840 ctggcagttt taggctga 858 <210> 2 <211> 1206 <212> DNA <213> Escherichia coli <400> 2 atgtttcatc tcgatacttt agcaacgctt gttgccgcaa cgctgacgtt gctgctcggg 60 cgtaagttgg tccattccgt ctcctttttg aagaaataca ccataccgga acctgttgcg 120 ggtggtttgt tggtggcgct ggcgctacta gtactgaaaa aaagcatggg ctgggaagtc 180 aactttgata tgtccctgcg cgatccgtta atgctggctt tcttcgccac cattggcctg 240 aacgccaaca ttgccagttt gcgtgccggt gggcgtgtgg ttggcatctt cttgattgtg 300 gttgttggtc tgttggtgat gcaaaatgcc attggcattg gtatggctag cttgttaggg 360 cttgatccgc tgatggggct gttggccggt tctattactc tttccggcgg tcacggtacg 420 ggcgctgcgt ggagtaaatt gttcattgaa cgttatggct tcaccaatgc gacggaagtg 480 gcgatggcct gtgcaacgtt cggtctggtg ctgggcggct tgattggcgg tccggtggcg 540 cgctatctgg tgaaacactc caccacgccg aacggtattc cggatgacca ggaagtcccg 600 acggcgtttg aaaagccgga tgtgggacgc atgatcacct cgttggtgct gattgaaact 660 atcgcgctga ttgctatctg cctgacggtg gggaaaattg ttgcgcaact tttggctggc 720 actgcttttg aactgccgac cttcgtctgt gtactgtttg ttggcgtgat tctgagcaac 780 ggtctgtcaa taatgggctt ttaccgcgtc tttgagcgtg cggtatccgt gctgggtaac 840 gtaagcttgt cgttgttcct ggcgatggcg ttgatggggc tgaaactgtg ggagctggct 900 tcgctggcgc tgccgatgct ggcgattctg gtggtacaga ccatcttcat ggcgttgtat 960 gccatcttcg ttacctggcg catgatgggc aaaaactacg atgcggcagt gctggctgcg 1020 ggtcactgtg gttttggcct cggtgcaacg ccaacggcaa tcgccaacat gcaggcgatc 1080 actgaacgct ttggcccgtc gcacatggcg tttttggtgg tgccgatggt cggtgcgttc 1140 tttatcgata tcgtcaatgc gctggtaatt aagttgtatt tgatgttgcc gatttttgcc 1200 ggttaa 1206 <210> 3 <211> 1206 <212> DNA <213> Escherichia coli <400> 3 atgtttcatc tcgatacttt agcaacgctt gttgccgcaa cgctgacgtt gctgctcggg 60 cgtaagttgg tccattccgt ctcctttttg aagaaataca ccataccgga acctgttgcg 120 ggtggtttgt tggtggcgct ggcgctacta gtactgaaaa aaagcatggg ctgggaagtc 180 aactttgata tgtccctgcg cgatccgtta atgctggctt tcttcgccac cattggcctg 240 aacgccaaca ttgccagttt gcgtgccggt gggcgtgtgg ttggcatctt cttgattgtg 300 gttgttggtc tgttggtgat gcaaaatgcc attggcattg gtatggctag cttgttaggg 360 cttgatccgc tgatggggct gttggccggt tctattacgc tttccggcgg tcacggtacg 420 ggcgctgcgt ggagtaaatt gttcattgaa cgttatggct tcaccaatgc gacggaagtg 480 gcgatgacct gtgcaacgtt cggtctggtg ctgggcggct tgattggcgg tccggtggcg 540 cgctatctgg tgaaacactc caccacgccg aacggtattc cggatgacca ggaagtcccg 600 acggcgtttg aaaagccgga tgtgggacgc atgatcacct cgttggtgct gattgaaact 660 atcgcgctga ttgctatctg cctgacggtg gggaaaattg ttgcgcaact tttggctggc 720 actgcttttg aactgccgac cttcgtctgt gtactgtttg ttggcgtgat tctgagcaac 780 ggtctgtcaa taatgggctt ttaccgcgtc tttgagcgtg cggtatccgt gctgggtaac 840 gtaagcttgt cgttgttcct ggcgatggcg ctgatggggc tgaaactgtg ggagctggct 900 tcgctggcgc tgccgatgct ggcgattctg gtggtacaga ccatcttcat ggcgttgtat 960 gccatcttcg ttacctggcg catgatgggc aaaaactacg atgcggcagt gctggctgcg 1020 ggtcactgtg gttttggcct cggtgcaacg ccaacggcaa tctccaacat gcaggcgatc 1080 actgaacgct ttggcccgtc gcacatggcg tttttggtgg tgccgatggt cggtgcgttc 1140 tttatcgata tcgtcaatgc gctggtgatt aagctgtatt taatgttgcc gatttttgcc 1200 ggttaa 1206 <210> 4 <211> 852 <212> DNA <213> Bacillus subtilis <400> 4 atgttggaac aaccaatagg agtcattgat tccggggttg gcggtttaac cgttgcgaag 60 gaaatcatga gacagctacc taaagaaaat attatctacg tcggggatac gaaacggtgt 120 ccttacgggc cgcgccctga agaagaggtg cttcaatata cgtgggagct gacgaattat 180 ttactcgaaa accaccacat caaaatgctc gtgatcgcct gtaatacagc aacagcgatc 240 gctttggatg acatccagcg cagcgtcggt ataccggtgg tcggagtcat ccagcctggt 300 gcgagagcag cgataaaagt gacggataat cagcatatcg gtgtcatcgg cacagagaat 360 acgattaaga gcaatgcata cgaagaagcg cttttggcat taaaccctga tttgaaggtt 420 gaaaaccttg cctgcccgct gcttgtgcct tttgtggaaa gcgggaagtt tctcgacaaa 480 acagcagacg agattgttaa aacctcgctg tatccgttaa aagacacatc aattgattcg 540 ctgattttag gctgcaccca ttaccctatt ttaaaagaag ccattcaaag atatatggga 600 gagcacgtaa acattatttc gtccggcgat gaaacagccc gggaagtcag cacaattctc 660 tcttataaag ggctgctgaa ccagtctccg attgccccgg atcatcagtt cctgacaaca 720 ggggcgcgtg atcagtttgc aaaaatcgca gacgattggt ttggccatga agtcgggcat 780 gtggaatgta tctcactgca agaaccgatt aaaagagcag caaacgacga aaactacgct 840 ttagcagctt aa 852 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pKI-VF <400> 5 gcgtcggaag taaggtacca tggtaggtcc 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pKI-VR <400> 6 attgttttcg atttcgcggg atcgagatcc 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pKI-IF <400> 7 cccgcgaaat cgaaaacaat cccgtggtag 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pKI-IR <400> 8 tggtacctta cttccgacgc tttttcattt 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pFRT-VF <400> 9 ttcctattcc ggcgcgccta cctgtgacgg 30 <210> 10 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> pFRT-VR <400> 10 ctatactttc tagagaatag gaacttcgat ttcgcgggat cgagatcc 48 <210> 11 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> pFRT-IF <400> 11 ctattctcta gaaagtatag gaacttcgcg aaaacaatcc cgtggtag 48 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pFRT-IR <400> 12 taggcgcgcc ggaataggaa ctaactatat 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pTG-VF <400> 13 cgaaaaataa tctagagtcg acctgcaggc 30 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pTG-VR <400> 14 ctttgctcat ggtttaacct cctgtgtgaa 30 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pTG-IF <400> 15 aggttaaacc atgagcaaag gtgaagaact 30 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pAF-VF <400> 16 cgactctaga ttatttttcg aactgcggat 30 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pAF-VF <400> 17 agcagcttaa ctgtcagacc aagtttactc 30 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pAF-VR <400> 18 gttccaacat actcttcctt tttcaatatt 30 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pAF-IF <400> 19 aaggaagagt atgttggaac aaccaatagg 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pAF-IR <400> 20 ggtctgacag ttaagctgct aaagcgtagt 30 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pAFout-F <400> 21 ggcctttttg cgtttctaca 20 <210> 22 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> pDG-F <400> 22 taatctagag tcgacctgca atccgccaac ctggagaagg 40 <210> 23 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> pDG-R <400> 23 gccaagcttg catgcctgca ttacttgtac agcttgtcca 40 <210> 24 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> pMurKI-F <400> 24 accacgtccc accgtgctgg tgtttgactc cggcgtcggt gggttgtcgg cgaaaacaat 60 cccgtggtag 70 <210> 25 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> pMurKI-R <400> 25 tcagcctaaa actgccagtt tttcgagcgt ttcgaagccg taacgctgta ggaatacggt 60 tagccatttg 70 <210> 26 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> pMurKO-F <400> 26 accacgtccc accgtgctgg tgtttgactc cggcgtcggt gggttgtcgg ggtccatatg 60 aatatcctcc 70 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pMurOut-F <400> 27 ggtgtgagct tgtgggatct 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pMurOut-R <400> 28 gttgttccgt gtcagtggtg 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pMurIn-R <400> 29 ggtgaagcca taacgttcaa 20 <210> 30 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> pMurKI-FRT-F <400> 30 accacgtccc accgtgctgg tgtttgactc cggcgtcggt gggttgtcgg ggatctcgat 60 cccgcgaaat 70

Claims (12)

A method for producing a D-glutamate auxotrophic variant E. coli, comprising the step of deleting the murI gene in E. coli.
The method of claim 1, wherein the preparation method comprises introducing gltS into the deleted murI gene locus, and the D-glutamate auxotrophic mutant E. coli.
The method of claim 2, wherein the gltS comprises the nucleotide sequence of SEQ ID NO: 3, D-glutamate auxotrophic mutant E. coli.
The method according to any one of claims 1 to 3, wherein the E. coli is BL21(DE3), SBA01 or DH5α strain, D-glutamate auxotrophic variant E. coli.
The method of claim 2, wherein the preparation method further comprises the step of depleting gltS. D-glutamate auxotrophic mutant E. coli.
D-glutamate auxotrophic variant E. coli in which the murI gene was deleted.
The method according to claim 6, wherein the mutant gltS of SEQ ID NO: 3 is introduced into the deleted murI locus of E. coli, D-glutamate auxotrophic mutant E. coli.
The method of claim 6, wherein the E. coli is BL21 (DE3), SBA01 or DH5α strain, D-glutamate auxotrophic mutant E. coli.
In the D-glutamate auxotrophic mutant Escherichia coli according to any one of claims 6 to 8, a mutant Escherichia coli to which D-amino acid transferase (DAAT) is further introduced.
A composition for producing a target substance, comprising the E. coli of claim 9.
Claim 9 comprising the step of culturing E. coli, a target substance production method.
The method of claim 11, wherein the target substance is a protein.

Images