KR20200099732A - Composition for early diagnosis of dengue virus infection comprising peptide derived from envelope domain Ⅲ of four serotype dengue virus as effective component and uses thereof - Google Patents

Abstract

The present invention relates to a composition for early diagnosis of dengue virus infection including a peptide derived from outer membrane protein domain III derived from each serotype of dengue virus as an active ingredient, and a use thereof.

Description

Composition for early diagnosis of dengue virus infection comprising peptide derived from envelope domain Ⅲ of four serotype dengue virus as effective component and comprising a peptide derived from dengue virus outer membrane protein domain Ⅲ as an effective component and uses thereof}

The present invention relates to a composition for early diagnosis of dengue virus infection, including a peptide derived from dengue virus outer membrane protein domain III as an active ingredient, and a use thereof.

Dengue disease is a disease that threatens public health worldwide, and is mainly caused by the four serotypes of dengue virus (DENV-1, -2, -3 and -4), and the outbreak of dengue disease has been dramatically in the last 10 years. Increased. Dengue diseases range from mild dengue fever to severe, life-threatening symptoms such as dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). Interest has also increased as the frequency of dengue infection increases, but there is no cure for dengue virus infection so far, and there are no vaccines available so far, so most treatment forms are only to relieve symptoms. The first infection confers immunity to the infected serotypes for life, but there is a problem that cross-immunity is not possible in the second infection to the dengue virus of another serotype, so it has a risk factor for DHF or DSS.

The need for early diagnosis of the disease helps in clinical management of symptoms. 70% of patients infected with dengue virus are asymptomatic, causing problems with blood transmission in tropical or subtropical countries.

Virus isolation and detection of virus RNA through RT-PCR (reverse transcription polymerase chain reaction) is a method mainly used for early diagnosis, but it is time-consuming, expensive, and requires skilled techniques. In addition, the genome of the dengue virus can be detected in the patient's blood for approximately 5 days after the onset of symptoms. The detection range of viral RNA is limited to 5 to 7 days from the initial infection, and when a patient feels symptoms and arrives at the hospital, it is often delayed to detect viral RNA.

The genome of the dengue virus is translated into a single polypeptide, and three structural proteins (C, prM/M and E) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B) are translated by viral and cellular proteases. And NS5). NS1 protein is a highly conserved glycoprotein, present in high concentrations in the serum of patients infected with dengue virus during the early clinical stages of the disease, and can be found from 1 to 9 days after the onset of mild fever in samples from patients with first or secondary infection. . However, cross-reactivity between flaviviruses in antibody assays has been reported. The outer membrane protein (envelope, E) is known to elicit an antibody neutralization reaction through domain III, and has been used for serological diagnosis of dengue virus through the determination of IgM. IgM against dengue virus reached detectable levels within 5 days of onset of symptoms in almost all patients with dengue virus infection and maintained a high level for about 2 weeks, whereas IgG was maintained throughout life from day 14 in patients with acute dengue infection. The diagnosis of IgM is important in the treatment of

The response of immunoglobulins to dengue virus showed high levels for the domains of each outer membrane protein, so that the domain III cross-reactive immunoglobulin population of the outer membrane protein was similarly variable, with IgM much greater than that of IgG. The outer membrane domain III protein of the dengue virus serotype 2 was evaluated as a material for a vaccine, but the detection of IgM, which can be distinguished from Zika, was limited due to its wide cross-reactivity. For the detection of dengue virus-specific IgM, the use of the outer membrane domain III protein of dengue virus serotype 1, expressed in the methylotrophic yeast Pichia pastoris , has been reported.

In the present invention, outer membrane domain III peptides derived from four serotypes expressed in E. coli were used for serological analysis for detection of IgM in patients with dengue infection.

On the other hand, Korean Patent Registration No.1763745 discloses'a monoclonal antibody against outer membrane domain III of four serotypes of dengue virus and its use', and Korean Patent Publication No. 2018-0096031 discloses a targeting dengue virus NS1. Although'a biochip for early detection of dengue virus and its manufacturing method using a peptide-derived molecular linker capable of highly specific and highly selective binding to a target biomarker' is disclosed, the peptide derived from the dengue virus outer membrane protein domain III of the present invention is effective. There is no description of a composition for early diagnosis of dengue virus infectious disease and its use, which is included as a component.

The present invention was derived from the above requirements, and the present inventors expressed the outer membrane protein domain III derived from each serotype of the dengue virus in E. coli, analyzed the amino acid sequence of the expressed recombinant peptide, and each through an epitope prediction program. High antigenic epitope sequence was analyzed in the peptides of, and as a result of indirect ELISA analysis in which each recombinant outer membrane protein domain Ⅲ peptide was coated with an antigen using clinical samples from patients infected with dengue virus, serotype 1 and serum of dengue virus When the recombinant outer membrane protein domain III peptide derived from type 3 was combined, it was confirmed that patients with dengue infection in the early stage of infection (2-4 days) can be effectively detected, thereby completing the present invention.

In order to solve the above problems, the present invention comprises one or more peptides selected from the group consisting of amino acid sequences of SEQ ID NOs: 9 to 12 derived from outer membrane protein domain III of each serotype of dengue virus as an active ingredient, dengue virus It provides a composition for early diagnosis of infectious disease.

In addition, the present invention provides a kit for early diagnosis of dengue virus infection comprising the composition as an active ingredient.

In addition, the present invention includes the step of reacting a biological sample isolated from a patient suspected of dengue virus infection with one or more peptides selected from the group consisting of the amino acid sequence of SEQ ID NO: 9 to SEQ ID NO: 12, information for diagnosis of dengue virus infection Provides a way to provide.

The method of the present invention provides an antigen having excellent sensitivity and specificity for enhancing the efficiency of diagnosis of acute dengue virus infection through an indirect ELISA method with excellent accessibility (availability).

1 is a result of expression and purification of the recombinant dengue virus outer membrane domain III, a is a diagram for domain III of each serotype-derived outer membrane protein, and b is a photograph of the result of SDS-PAGE gel loading of the purified recombinant protein and Western blot It is the result.
2 is a result of alignment of amino acid sequences of outer membrane domain III derived from dengue virus of four serotypes.
3 is a result of alignment of the recombinant dengue virus outer membrane domain III and the template amino acid sequence (original).
4 is a result of analyzing the epitope sequence of the recombinant dengue virus outer membrane domain III through three epitope prediction programs (ABCpred, BCPreds, IEDB-BepiPred). *: Refers to an epitope commonly identified in three independent programs.
5 is a result of analyzing the epitope through IEDB. Each number indicated in the figure of b means the following sequence, respectively: 1-1, DAP; 1-2, FSTQDEKGATQ; 1-3, PVNIEAEPPFGE; 2-1, EGDGSP; 2-2, TEKDRPVNIEAEPPFG; 3-1, KGEDAP; 3-2, VVTKKEEPVNIEAEPP; 3-3, E; 4-1, EGAGAP; 4-2, EPPFG; 4-3, E; 4-4, N.
6 is a result of performing ELISA using a clinical sample after coating the dengue virus. Nor-: Normal person (dengue negative) sample, VN-: Dengue infection suspected patient sample provided from Vietnam.
7 is a result of performing ELISA using a clinical sample after coating the recombinant outer membrane domain III. N-: normal person sample, VN-: dengue infection patient sample.
FIG. 8 shows the result of performing clinical verification through ELISA using a sample of a dengue infected patient, and calculating a threshold cut-off value through analysis of a receiver-operating characteristic (ROC) curve.

In order to achieve the object of the present invention, the present invention comprises one or more peptides selected from the group consisting of amino acid sequences of SEQ ID NOs: 9 to 12 derived from outer membrane protein domain III of each serotype of dengue virus as an active ingredient, It provides a composition for early diagnosis of dengue virus infection.

In the composition of the present invention, the amino acid sequences of SEQ ID NOs: 9 to 12 correspond to outer membrane protein domain III peptides derived from dengue virus serotypes 1, 2, 3 and 4, respectively, and each amino acid sequence is SEQ ID NO: 1 It is a peptide in which mutations have occurred in some amino acid residues in the original amino acid sequence (SEQ ID NOs: 5 to 8) translated from the coding sequence of each peptide consisting of the base sequences of 4 to 4 (FIG. 3).

The term “serotype” generally refers to different variations within the dengue virus. The four different dengue virus serotypes (DV1-4) comprising the dengue virus gene family differ from each other by approximately 25% to 40% at the amino acid level. The four serotypes of dengue virus vary in pathogenicity, but all of them are prevalent in Asia, Africa, Central America and South America.

In the composition for early diagnosis of dengue virus infection according to an embodiment of the present invention, when a peptide consisting of the amino acid sequence of SEQ ID NO: 9 and SEQ ID NO: 11 derived from the outer membrane protein domain III of dengue virus serotype 1 and serotype 3 is combined , The sensitivity of early diagnosis of dengue virus infection is increased (Table 4).

In the composition of the present invention, the peptide is characterized by detecting IgM in a biological sample isolated from a patient suspected of dengue virus infection, and the peptide acts as an antigen to determine dengue virus infection by antigen-antibody reaction. There is. IgM in a biological sample isolated from a patient suspected of having dengue virus infection is an immunoglobulin against dengue virus, and it is known that IgM is usually present in the serum 2 to 5 days after the onset of dengue.

The present invention also provides a kit for early diagnosis of dengue virus infection comprising the composition as an active ingredient.

The kit of the present invention may be in the form of an indirect ELISA (Enzyme-Linked ImmunoSorbent Assay) in a form in which at least one peptide selected from the group consisting of the amino acid sequence of SEQ ID NO: 9 to SEQ ID NO: 12 is coated as an antigen. It is not limited, and may include a conjugate in which the peptide of the present invention and a fluorescent material are combined.

In addition, the kit may further include a composition, solution, or device having one or more other components suitable for the analysis method.

The present invention also includes the step of reacting a biological sample isolated from a patient suspected of dengue virus infection with one or more peptides selected from the group consisting of the amino acid sequence of SEQ ID NO: 9 to SEQ ID NO: 12, information for diagnosing dengue virus infection Provides a way to provide.

In the method of the present invention, the'biological sample' is collected from a patient suspected of having dengue virus infection, and may preferably be serum, but is not limited thereto. The term'sample' is used as a target to be detected and has the same meaning as a sample or specimen.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

1. Cells and Viruses

Aedes albopictus clone C6/36 cells were purchased from ATCC (American Type Culture Collection, USA) (ATCC CRL-1660 ^TM ). C6/36 cells were 28-to-DMEM medium (Gibco Cat. It was cultured in an incubator at 30° C. and 5% carbon dioxide. Other tissue culture reagents were purchased and used from Life technologies (USA). The dengue virus strain used in the present invention is as follows.

Dengue virus used in the present invention Serotype source DENV-1 (hereafter DV 1) National Pathogen Resource Bank NCCP 41503 Genbank Accession: KP406803.1 DENV-2 (hereafter DV 2) KBPV-VR-29 Genbank Accession: KP406804 DENV-3 (hereafter DV 3) KBPV-VR-30 Genbank Accession: KP406805 DENV-4 (hereafter DV 4) KBPV-VR-31 Genbank Accession: KP406806

2. Reagent

Taq polymerase and PCR reagents were purchased from Takara (Japan), and E. coli BL21 (DE3) competent cells and pET21b(+) vector were purchased from Novagen (UK). Restriction enzyme and T4 DNA ligase enzyme are NEB (New England Biolabs, USA), HisPur ^TM Ni-NTA is Thermo Scientific (USA), LB liquid medium, sodium chloride, urea, guanidine hydrochloride, L-agginine and other reagents are Sigma. It was purchased and used from Aldrich (USA).

3. Human serum sample

Blood samples (n=30) of patients infected with dengue virus were collected from a dengue epidemic area in Vietnam, and samples of healthy healthy individuals (dengue negative) were collected from malaria-clean areas in Iksan area. The present invention was made with the approval of the Bioethics Committee of Wonkwang University Hospital (Approval No. 201603-BR-015). Dengue positive sera were assayed through the NS1 antigen kit (SD BIOLINE, USA). Four Zika virus-IgM positive sera were purchased from ABO Pharmacheuticals (USA) and used as negative samples.

4. Virus proliferation and titer measurement

When C6/36 cells grew to 70-90% of the plate area, they were infected with dengue virus with MOI (multiplicity of infection) 0.1. Virus adsorption was performed for 2 to 3 hours under conditions of 28 to 30° C. and 5% carbon dioxide, and the medium was shaken every 20 minutes. Thereafter, the virus mixture was removed and the cells were maintained in DMEM to which 2% FBS was added, and cultured at 37° C. and 5% carbon dioxide. After 7 days, the virus-containing medium was recovered from the cells and clarified by centrifugation at 4,000xg for 30 minutes. A fresh medium to which 2% FBS was added was added to the cells, and the above procedure was repeated to recover the virus supernatant on days 14 and 21 of the initial infection date. The supernatant was filtered through a 0.45 μm filter (GVS filter technology, USA), and ultracentrifugation of sucrose was performed. Virus titer (FFU) was obtained by performing a focus forming assay. Briefly, the virus supernatant was serially diluted 10 times, treated on a monolayer of Vero cells in a 24-well plate, reacted at 37°C for 2 hours, and infected cells containing 1.25% carboxylmethyl-cellulose (CMC). Incubated in the medium for an additional 72 hours. Thereafter, the medium was removed and the cells were washed three times with PBS to completely remove CMC, and then the cells were fixed with a 3.7% paraformaldehyde solution, followed by treatment with 0.1% Triton X-100 (permeabilization). Thereafter, blocking was performed with a solution containing 3% bovine serum albumin (BSA), 0.1% Tween 20 and 22.52 mg/ml glycine, and then anti-flavivirus group antigen 4G2 (Merck, Germany) was used as the primary antibody. After reacting at room temperature for 2 hours, reacted with horse-radish peroxidase (HRP)-conjugated anti-mouse IgG(H&L) (Abcam, UK) for 1 hour at room temperature, and the cells were washed 5 times with PBS and then H ₂ Visualized by reacting with O ₂ -diaminobenzidine.

5. Expression of recombinant outer membrane domain Ⅲ antigen

Reverse transcription of cDNA from dengue virus RNA was performed by PCR amplification. Information of the primers used in the PCR reaction is shown in Table 2 below, and the PCR reaction conditions are as follows: Initial denaturation 95°C for 5 minutes → denaturation 94°C for 30 seconds, binding 55°C for 45 seconds, and elongation 68°C for 45 seconds. 30 times → final elongation 68℃ for 7 minutes.

Primer information used in PCR reaction antigen Base sequence (5'→3') (SEQ ID NO) Restriction enzyme Product size DV1-rED Ⅲ F GGATCC GTCATATGTGATGTGC (13) Bam HI 304bp R CTCGAG TTTCTTGAACCAGCTTAGTTTC (14) Xho I DV2-rED Ⅲ F CC GGATCC CGCGCATCTTAAGTGCAGGCTGAGAATG (15) Bam HI 441bp R TTTA GCGGCCGC CCAGGCTGTGTCACCTAAAATGG (16) Not I DV3-rED Ⅲ F GGATCC GAGCTATGCAATGT (17) Bam HI 304bp R CTCGAG TTTCTTATACCAGTTGATTTTC (18) Xho I DV4-rED Ⅲ F GGATCC GAAGTTCTCAATTGACAAAG (19) Bam HI 286bp R CTCGAG CCCTTTCCTGAACCAAT (20) Xho I

After the PCR product was cloned into pET21b(+) vector, the vector was transformed into E. coli BL21 (DE3) strain, and the transformed E. coli strain was inoculated into a medium to induce expression of the recombinant protein. DV3-rED III protein was expressed in a water-soluble form, and DV1-, DV2- and DV4-rED III proteins were expressed in an insoluble form. Procedures such as induction of expression of recombinant protein and purification of protein expression using E. coli were performed through conventional methods.

6. ELISA (Enzyme-Linked ImmunoSorbent Assay)

In order to screen patient serum samples, an indirect ELISA was performed. Briefly, a recombinant outer membrane domain III protein (rED III, 1 μg/ml) derived from dengue virus (10 ⁶ FFU) or four serotypes was prepared in 50 mM bicarbonate buffer (pH 9.6), and each solution was prepared. Put into a 96-well polystyrene plate (NUNC, USA) was coated by reacting overnight at 4 ℃. Then, the plate was washed with PBS-T and blocked with 5% skim milk solution at 37°C. Thereafter, the plate was washed, and a human serum sample was diluted in a ratio of 1:100 (in PBS-T with 5% BSA), added to each well, and reacted at 37°C for 3 hours. Thereafter, after washing with PBS-T, HRP-conjugated anti-human IgM antibody was added to each well to react, washed 5 times with PBS-T, and TMB (3,3'5,5'-tetra Methyl benzidine) solution (Invitrogen) was added and reacted for 15 minutes in dark conditions. Finally, 0.18 M sulfuric acid was added to terminate the reaction, and absorbance was measured at 450 nm using a microplate reader (SpectraMax ^® M Series, Molecular Devices, USA).

7. Outer membrane domain Ⅲ sequence analysis and protein structure graphic

The amino acid sequences of rED III derived from four serotypes were multi-aligned using the BioEdit program (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). The three-dimensional structure of rED III was predicted using I-tasser (https://zhanglab.ccmb.med.umich.edu/I-TASSER/), and the Pymol program (http://www.pymol.org) was used. Was used to visualize.

8. Statistics processing

All resulting graphs were drawn using Graphpad Prism (version 5.0), and ROC (Receiver Operating Characteristic) curves and 95% confidence intervals were calculated for assay sensitivity and accuracy.

Example 1. Expression of recombinant outer membrane domain III protein

The gene encoding the recombinant outer membrane domain III protein (rED III) to be used as a diagnostic antigen was amplified through PCR using the primers shown in Table 2 (Fig. 1A). Each amplified product was cut with an appropriate restriction enzyme and cloned into pET21b(+) expression vector to obtain a final construct. Each of the expressed recombinant outer membrane domain III proteins was fused with a histidine tag (6×histidine), and each of the separated and purified recombinant proteins was analyzed through SDS-PAGE and Western blot (FIG. 1B). As a result, DV1-, DV2-, DV3- and DV4-rED III were identified as 13kDa, 18kDa, 13kDa and 12kDa, respectively.

Example 2. Sequence analysis of recombinant outer membrane domain III

In the outer membrane protein of the dengue virus, domain III has high immunity and has been used as an antigen in IgM ELISA, but has very specificity for each serotype. In order to determine the highest specific domain III among the four serotypes of the dengue virus, the amino acid sequences of the four recombinant proteins were analyzed (FIG. 2A). As a result, DV1- and DV3-rED III showed the highest sequence similarity (66%/87% identities/positives) (Fig. 2b). In addition, rED III expressed in E. coli was confirmed that mutations occurred in each original ED III protein sequence and some amino acid residues (FIG. 3).

Example 3. Analysis of antigenic epitopes in recombinant antigens

In order to predict potential epitope sequences within the outer membrane domain III, each sequence was analyzed through bioinformatics. As a result, DV1-rED III through three independent epitope prediction programs (ABCpred (threshold: 0.7), BCPreds (specificity: 75%), and immune epitope database and analysis resource [IEDB]-BepiPred (threshold 0.7)) DAP, FSTQDEKGATQ (SEQ ID NO: 21) and VNIEAEPPFGES (SEQ ID NO: 22) showed a common epitope, DV2-rED III showed a common epitope of EGDGSP (SEQ ID NO: 23) and TEKDRPVNIEAEPPFG (SEQ ID NO: 24), DV3-rED Ⅲ showed a common epitope of KGEDAP (SEQ ID NO: 25), VVTKKEEPVNIEAEPP (SEQ ID NO: 26) and E, and DV4-rED III showed a common epitope of EGAGAP (SEQ ID NO: 27), N and EPPFG (SEQ ID NO: 28). (Fig. 4). Interestingly, two identical epitopes (DAP and VNIEAEPP) were identified in DV1- and DV3-rED III, and one identical epitope (EPPFG) was identified in DV2- and DV4-rED III.

However, the epitope score of DV4-rED III was lower than that of other serotypes (FIG. 5A). After confirming the linear epitope candidates, the position of the epitope was analyzed in a three-dimensional structure. As a result, it was confirmed that the epitopes of DAP, FSTQDEKGATQ, and VNIEAEPPFGES of DV1-rED III were exposed to the surface than the rED III epitope of other serotypes (FIG. 5B).

Example 4. Clinical analysis of cohorts

Samples of patients with suspected dengue virus infection used in the present invention were provided between September and October 2017 from National Children Hospital in Vietnam, and the characteristics of a total of 26 patients are shown in Table 3 below.

Characteristics of patients with suspected dengue virus infection Total number of patients 26 people Mean age (standard deviation) 23.38 (17.91) Gender (Male:Female) 14:12 Symptoms at the time of sample collection Fever Date after onset (standard deviation) 2.6 (0.57) Seasonal cycle Sep. ~ Oct. 2017

All clinical samples had acute dengue fever and were confirmed positive by SD Rapid kit of Dengue NS1. All suspected dengue samples were collected from Hanoi (n=21), Bak Jang (n=3), Hanam (n=1) and Hai Duong (n=1) in Vietnam.

Example 5. ELISA analysis using clinical samples

In order to confirm whether the recombinant outer membrane domain III can detect IgM in patient serum as an antigen, ELISA analysis was performed using a clinical sample.

First, each serotype of dengue virus (10 ⁶ ffu/well) was coated on a 96-well polystyrene plate, and then the serum was diluted 1:100 and treated. As a result, as shown in FIG. 6, when DV1 was coated, 11 samples (VN6, 10, 12, 14, 17, 19, 20, 21, 23, 24, 25) out of 26 clinical samples than all negative samples. ), high absorbance was confirmed. In the case of DV2 coating, 13 of the 26 clinical samples (VN6, 8, 9,10, 12, 14, 17, 19, 20, 21, 23, 24, 25) were coated with DV3, and 26 8 of the clinical samples (VN6, 10, 17, 19, 20, 21, 24, 25) were coated with DV4, 7 of the 26 clinical samples (VN6, 14, 17, 19, 20) , 24, 25) showed higher absorbance than negative samples (22). Through the above results, it was found that DV2 is the most responsive to patient samples.

Then, each serotype-derived rED III was coated at a concentration of 1 μg/well to perform ELISA analysis. As a result, as shown in FIG. 7, when DV1-rED III was coated, 9 of 26 clinical samples (VN6, 8, 9, 12, 14, 19, 20, 21, 24) were, When DV2-rED Ⅲ is coated, 3 of 26 clinical samples (VN14, 19, 24) are obtained, and when DV3-rED Ⅲ is coated, 7 of 26 clinical samples (VN6, 10, 14, 17, 19, 20, 24) and when DV4-rED III was coated, 3 of 26 clinical samples (VN12, 14, 24) showed higher absorbance than negative samples (22), DV1 It was found that -rED III was the most responsive to patient samples.

Example 6. Clinical evaluation ability of recombinant antigen for diagnosis of dengue infection

The threshold cut-off value for dengue infection for the binary diagnosis process is DV1-, DV2-, DV3 through plotting all result values using Graphpad Prism and analyzing the receiver-operating characteristic (ROC) curve. -And DV4-rED III were determined to be 0.14, 0.15, 0.21, and 0.21, respectively (absorbance higher than the respective cut-off value was judged as positive, and if it was low, it was judged as negative). According to the ROC curve analysis, DV1-rED III showed the highest clinical sensitivity and specificity (Fig. 8). ROC curve analysis for DV1-rED III showed an area under-the-curve (AUC) value of 0.9541 (95% confidence interval: 0.9134 to 1.015) (p<0.0001), which indicates that DV1-rED III antigen was infected with dengue. This meant that the prediction was highly accurate. The DV1- and DV3-rED III recombinant proteins did not show reactivity in the ELISA assay for the samples of IgM positive patients for Zika virus (n=4) (FIG. 8B ). Table 4 below summarizes the ELISA results performed by coating each recombinant outer membrane domain III protein with an antigen.

Diagnosis performance of ELISA using recombinant outer membrane domain Ⅲ DV1-rED Ⅲ DV2-rED Ⅲ DV3-rED Ⅲ DV4-rED Ⅲ Combined result of
DV1- & DV3-rED Ⅲ responsiveness 69.23% (9/13) 23.07% (3/13) 53.84% (7/13) 23.07% (3/13) 84.61% (11/13) Specificity 100% (30/30) 100% (30/30) 100% (30/30) 100% (30/30) 100% (30/30)

Table 5 below summarizes the information and experimental results of the clinical samples used in the present invention.

The relationship between the date after disease onset and the diagnostic ability of the recombinant antigen was examined. On the second day after onset, 11 dengue NS1-positive samples were identified, and DV1 and DV2 viruses were able to detect IgM in the serum at a level of 45.45% (5/11). It was confirmed that the DV1-rED III antigen alone can detect dengue IgM in 4 samples (VN9, VN12, VN14, and VN20) out of 5 samples judged positive for infection by virus. Interestingly, DV1-rED III showed a positive reaction against the VN9 samples detected by DV2 virus, not DV1 virus.

On the third day after onset, 14 samples were identified as dengue NS1-positive, and 6 samples (VN10, VN17, VN19, VN21, VN24, and VN25) were confirmed positive in the DV1 and DV3 virus-based ELISA, resulting in 42.85% (42.85%) 6/14) level of detection ability was shown, and DV2 virus was able to detect VN8 samples in addition to the above 6 samples. In ELISA analysis using DV1- and DV3-rED III, IgM was detected in 5 out of 6 samples (VN10, VN17, VN19, VN21 and VN24) confirmed as positive in the virus-based ELSIA, showing a detection level of 83.3%. gave. In addition to the above samples, two (VN8 and VN21) samples were additionally detected in the analysis using DV1-rED III, and two (VN10 and VN17) samples were additionally detected in the analysis using DV3-rED III. In the analysis using DV1-, DV2- and DV3-rED III, samples of VN19 and VN24 were commonly detected.

On day 4, only one (VN6) sample was identified as dengue NS1-positive, and the sample was detected as positive in the dengue virus-based ELISA assay of all serotypes, and also in the ELISA assay using DV1- and DV3-rED III. It was confirmed as positive, but was not detected in ELISA analysis using DV2- and DV4-rED III.

Finally, virus-based ELISA showed a sensitivity of 50% (13/26) for NS1-positive samples, and for the 13 samples, DV1-rED III could detect 9 and DV3-rED III. It showed a sensitivity of 84.61% (11/13).

<110> Wonkwang University Center for Industry-Academy Cooperation <120> Composition for early diagnosis of dengue virus infection comprising peptide derived from envelope domain III of four serotype dengue virus as effective component and uses thereof <130> PN19034 <160> 28 <170> KoPatentIn 3.0 <210> 1 <211> 291 <212> DNA <213> Dengue virus <400> 1 tcatatgtga tgtgcacagg ctcattcaag ttagagaaag aagtggctga gacccagcat 60 ggaactgttc tggtgcaggt taaatatgaa ggaacagacg caccatgcaa gattcccttt 120 tcgacccaag atgagaaagg agcaacccag aatgggagat taataacagc caaccccata 180 gtcactgaca aagaaaaacc agtcaatatt gaggcagaac caccctttgg tgagagctac 240 atcgtggtag gagcaggtga aaaagctttg aaactaagct ggttcaagaa a 291 <210> 2 <211> 420 <212> DNA <213> Dengue virus <400> 2 gcgcatctta agtgcaggct gagaatggac aaactacagc ttaaagggat gtcatactct 60 atgtgtacag ggaagtttaa agtcgtgaag gaaatagcag aaacacaaca tggaacaata 120 gtcattagag tacaatatga aggagacggc tctccatgca agatcccttt tgagataatg 180 gatctggaaa aaagacatgt cttaggtcgt ctgattacag tcaacccaat tgtaacagaa 240 aaggacaggc cagtcaacat agaagcagaa cctccattcg gagacagcta cattatcata 300 ggagtggagc cgggacaact gaagcttaac tggttcaaga aaggaagttc tatcggtcaa 360 atgtttgaga caacaatgag aggagcgaaa agaatggcca ttttaggtga cacagcctgg 420 420 <210> 3 <211> 291 <212> DNA <213> Dengue virus <400> 3 agctatgcaa tgtgcttgag tagctttgtg ttgaagaaag aagtctccga aacgcagcat 60 gggacaatac tcattaaggt tgagtacaaa ggggaagatg caccctgcaa gattcctttc 120 tccacggagg atggacaagg aaaagctcac aatggcagac tgatcacagc caatccagtg 180 gtgaccaaga aggaggagcc tgtcaacatt gaggctgaac ctccttttgg agaaagtaac 240 atagtaattg gaattggaga caaagccctg aaaatcaact ggtataagaa a 291 <210> 4 <211> 273 <212> DNA <213> Dengue virus <400> 4 aagttctcaa ttgacaaaga gatggcagaa acacagcatg ggacaacagt ggtgaaagtc 60 aagtatgaag gtgctggagc tccgtgtaaa gtccccatag agataagaga tgtgaacaag 120 gaaaaagtgg ttgggcgtat catctcatcc acccctttgg ctgagaatac caacagtgca 180 accaacatag agttagaacc cccctttggg gacagctaca tagtgatagg cgttggaaac 240 agtgcattaa cactccattg gttcaggaaa ggg 273 <210> 5 <211> 97 <212> PRT <213> Dengue virus <400> 5 Ser Tyr Val Met Cys Thr Gly Ser Phe Lys Leu Glu Lys Glu Val Ala 1 5 10 15 Glu Thr Gln His Gly Thr Val Leu Val Gln Val Lys Tyr Glu Gly Thr 20 25 30 Asp Ala Pro Cys Lys Ile Pro Phe Ser Thr Gln Asp Glu Lys Gly Ala 35 40 45 Thr Gln Asn Gly Arg Leu Ile Thr Ala Asn Pro Ile Val Thr Asp Lys 50 55 60 Glu Lys Pro Val Asn Ile Glu Ala Glu Pro Pro Phe Gly Glu Ser Tyr 65 70 75 80 Ile Val Val Gly Ala Gly Glu Lys Ala Leu Lys Leu Ser Trp Phe Lys 85 90 95 Lys <210> 6 <211> 140 <212> PRT <213> Dengue virus <400> 6 Ala His Leu Lys Cys Arg Leu Arg Met Asp Lys Leu Gln Leu Lys Gly 1 5 10 15 Met Ser Tyr Ser Met Cys Thr Gly Lys Phe Lys Val Val Lys Glu Ile 20 25 30 Ala Glu Thr Gln His Gly Thr Ile Val Ile Arg Val Gln Tyr Glu Gly 35 40 45 Asp Gly Ser Pro Cys Lys Ile Pro Phe Glu Ile Met Asp Leu Glu Lys 50 55 60 Arg His Val Leu Gly Arg Leu Ile Thr Val Asn Pro Ile Val Thr Glu 65 70 75 80 Lys Asp Arg Pro Val Asn Ile Glu Ala Glu Pro Pro Phe Gly Asp Ser 85 90 95 Tyr Ile Ile Ile Gly Val Glu Pro Gly Gln Leu Lys Leu Asn Trp Phe 100 105 110 Lys Lys Gly Ser Ser Ile Gly Gln Met Phe Glu Thr Thr Met Arg Gly 115 120 125 Ala Lys Arg Met Ala Ile Leu Gly Asp Thr Ala Trp 130 135 140 <210> 7 <211> 97 <212> PRT <213> Dengue virus <400> 7 Ser Tyr Ala Met Cys Leu Ser Ser Phe Val Leu Lys Lys Glu Val Ser 1 5 10 15 Glu Thr Gln His Gly Thr Ile Leu Ile Lys Val Glu Tyr Lys Gly Glu 20 25 30 Asp Ala Pro Cys Lys Ile Pro Phe Ser Thr Glu Asp Gly Gln Gly Lys 35 40 45 Ala His Asn Gly Arg Leu Ile Thr Ala Asn Pro Val Val Thr Lys Lys 50 55 60 Glu Glu Pro Val Asn Ile Glu Ala Glu Pro Pro Phe Gly Glu Ser Asn 65 70 75 80 Ile Val Ile Gly Ile Gly Asp Lys Ala Leu Lys Ile Asn Trp Tyr Lys 85 90 95 Lys <210> 8 <211> 91 <212> PRT <213> Dengue virus <400> 8 Lys Phe Ser Ile Asp Lys Glu Met Ala Glu Thr Gln His Gly Thr Thr 1 5 10 15 Val Val Lys Val Lys Tyr Glu Gly Ala Gly Ala Pro Cys Lys Val Pro 20 25 30 Ile Glu Ile Arg Asp Val Asn Lys Glu Lys Val Val Gly Arg Ile Ile 35 40 45 Ser Ser Thr Pro Leu Ala Glu Asn Thr Asn Ser Ala Thr Asn Ile Glu 50 55 60 Leu Glu Pro Pro Phe Gly Asp Ser Tyr Ile Val Ile Gly Val Gly Asn 65 70 75 80 Ser Ala Leu Thr Leu His Trp Phe Arg Lys Gly 85 90 <210> 9 <211> 97 <212> PRT <213> Artificial Sequence <220> <223> DV1-rEDIII <400> 9 Ser Tyr Val Met Cys Thr Gly Ser Phe Lys Leu Glu Lys Glu Val Ala 1 5 10 15 Glu Thr Gln His Gly Thr Val Leu Val Gln Val Lys Tyr Glu Gly Thr 20 25 30 Asp Ala Pro Cys Lys Ile Pro Phe Ser Ser Gln Asp Glu Lys Gly Val 35 40 45 Thr Gln Asn Gly Arg Leu Ile Thr Ala Asn Pro Ile Val Thr Asp Lys 50 55 60 Glu Lys Pro Val Asn Ile Glu Ala Glu Pro Pro Phe Gly Glu Ser Tyr 65 70 75 80 Leu Val Val Gly Ala Gly Glu Lys Ala Leu Lys Leu Ser Trp Phe Lys 85 90 95 Lys <210> 10 <211> 140 <212> PRT <213> Artificial Sequence <220> <223> DV2-rEDIII <400> 10 Gly His Leu Lys Cys Arg Leu Arg Met Asp Lys Leu Gln Leu Lys Gly 1 5 10 15 Met Ser Tyr Ser Met Cys Thr Gly Lys Phe Lys Val Val Lys Glu Ile 20 25 30 Ala Glu Thr Gln His Gly Thr Ile Val Ile Arg Val Gln Tyr Glu Gly 35 40 45 Asp Gly Ser Pro Cys Lys Ile Pro Phe Glu Ile Met Asp Leu Glu Lys 50 55 60 Arg His Val Leu Gly Arg Leu Ile Thr Val Asn Pro Ile Val Thr Glu 65 70 75 80 Lys Asp Arg Pro Val Asn Ile Glu Ala Glu Pro Pro Phe Gly Asp Ser 85 90 95 Tyr Ile Ile Ile Gly Val Glu Pro Gly Gln Leu Lys Leu Asn Trp Phe 100 105 110 Lys Lys Gly Ser Ser Ile Gly Gln Met Phe Glu Thr Thr Met Arg Gly 115 120 125 Ala Lys Arg Met Ala Ile Leu Gly Asp Thr Ala Trp 130 135 140 <210> 11 <211> 97 <212> PRT <213> Artificial Sequence <220> <223> DV3-rEDIII <400> 11 Ser Tyr Ala Met Cys Leu Asn Thr Phe Val Leu Lys Lys Glu Val Ser 1 5 10 15 Glu Thr Gln His Gly Thr Ile Leu Ile Lys Val Glu Tyr Lys Gly Lys 20 25 30 Asp Ala Pro Cys Lys Ile Pro Phe Ser Thr Glu Asp Gly Gln Gly Lys 35 40 45 Ala His Asn Gly Arg Leu Ile Thr Ala Asn Pro Val Val Thr Lys Glu 50 55 60 Glu Glu Pro Val Asn Ile Glu Ala Glu Pro Pro Phe Gly Glu Ser Asn 65 70 75 80 Ile Val Ile Gly Ile Gly Asp Lys Ala Leu Lys Ile Asn Trp Tyr Arg 85 90 95 Lys <210> 12 <211> 91 <212> PRT <213> Artificial Sequence <220> <223> DV4-rEDIII <400> 12 Lys Phe Ser Ile Asp Lys Glu Met Ala Glu Thr Gln His Gly Thr Thr 1 5 10 15 Val Val Arg Val Lys Tyr Glu Gly Ala Gly Ala Pro Cys Lys Val Pro 20 25 30 Ile Glu Ile Arg Asp Val Asn Lys Glu Lys Val Val Gly Arg Ile Ile 35 40 45 Ser Ser Thr Pro Phe Ala Glu Tyr Thr Asp Ser Val Thr Asn Ile Glu 50 55 60 Leu Glu Pro Pro Phe Gly Asp Ser Tyr Ile Val Ile Gly Val Gly Asp 65 70 75 80 Ser Ala Leu Thr Leu His Trp Phe Arg Lys Gly 85 90 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ggatccgtca tatgtgatgt gc 22 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ctcgagtttc ttgaaccagc ttagtttc 28 <210> 15 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ccggatcccg cgcatcttaa gtgcaggctg agaatg 36 <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 tttagcggcc gcccaggctg tgtcacctaa aatgg 35 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ggatccgagc tatgcaatgt 20 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ctcgagtttc ttataccagt tgattttc 28 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 ggatccgaag ttctcaattg acaaag 26 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 ctcgagccct ttcctgaacc aat 23 <210> 21 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> DV1-EDIII_epitope <400> 21 Phe Ser Thr Gln Asp Glu Lys Gly Ala Thr Gln 1 5 10 <210> 22 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> DV1-EDIII_epitope <400> 22 Val Asn Ile Glu Ala Glu Pro Pro Phe Gly Glu Ser 1 5 10 <210> 23 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> DV2-EDIII_epitope <400> 23 Glu Gly Asp Gly Ser Pro 1 5 <210> 24 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> DV2-EDIII_epitope <400> 24 Thr Glu Lys Asp Arg Pro Val Asn Ile Glu Ala Glu Pro Pro Phe Gly 1 5 10 15 <210> 25 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> DV3-EDIII_epitope <400> 25 Lys Gly Glu Asp Ala Pro 1 5 <210> 26 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> DV3-EDIII_epitope <400> 26 Val Val Thr Lys Lys Glu Glu Pro Val Asn Ile Glu Ala Glu Pro Pro 1 5 10 15 <210> 27 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> DV4-EDIII_epitope <400> 27 Glu Gly Ala Gly Ala Pro 1 5 <210> 28 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> DV4-EDIII_epitope <400> 28 Glu Pro Pro Phe Gly 1 5

Claims (6)

A composition for early diagnosis of dengue virus infection, comprising as an active ingredient at least one peptide selected from the group consisting of amino acid sequences of SEQ ID NOs: 9 to 12 derived from outer membrane protein domain III of each serotype of dengue virus. The composition for early diagnosis of dengue virus infection according to claim 1, comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 9 and SEQ ID NO: 11 as an active ingredient. The composition for early diagnosis of dengue virus infection according to claim 1, wherein the peptide detects IgM in a biological sample isolated from a patient suspected of dengue virus infection. A kit for early diagnosis of dengue virus infection, comprising the composition of any one of claims 1 to 3 as an active ingredient. The kit according to claim 4, wherein the kit is an ELISA. A method for providing information for diagnosing dengue virus infection, comprising reacting a biological sample isolated from a patient suspected of having a dengue virus infection with one or more peptides selected from the group consisting of amino acid sequences of SEQ ID NOs: 9 to 12.

Images