KR20200096165A - Composition for inhibiting endotrophin activity comprising an inhibitor of endotrophin cleavage enzyme and uses thereof - Google Patents

Abstract

The present invention relates to a composition for inhibiting endotrophin activity comprising an inhibitor of an endotrophin cleavage enzyme, and uses thereof. The composition can be used for the treatment of obesity, diabetes, liver disease as well as cancer by inhibiting the production and activity of ETP, which is mainly expressed in mast cells.

Description

Composition for inhibiting endotrophin activity comprising an inhibitor of endotrophin cleavage enzyme and uses thereof {Composition for inhibiting endotrophin activity comprising an inhibitor of endotrophin cleavage enzyme and uses thereof}

It relates to a composition for inhibiting endotropin activity including an inhibitor of an endotropin cleavage enzyme and a use thereof.

Obesity, which has recently increased rapidly, is deeply related to the onset and progression of cancer. Obesity is known to cause various metabolic diseases, including diabetes and cardiovascular disease, and is also known as a major risk factor for various cancers including breast cancer, uterine cancer, liver cancer, and colon cancer. It is very important to investigate the mechanism of metabolic stress induced during obesity or diabetes and how changes in adipokine secreted from adipocytes affect the progression of cancer at a molecular level. In obese cancer patients, cancer growth and metastasis are fast, and clinical results are known that the recurrence rate after treatment with anticancer drugs is higher than that of normal weight patients. This may be attributed to obesity or diabetes as providing certain environmental factors that promote cancer progression.

Endotrophin (ETP) is a protein produced when the C-terminal propeptide of the alpha3 chain of type VI collagen secreted from adipocytes is cleaved, and is known as a link between obesity and cancer. When ETP is activated, the effect of remarkably promoting endothelial cell migration and angiogenesis appears. When obesity and diabetes are induced, the amount of ETP increases in adipocytes and can promote inflammatory and fibrotic reactions. In particular, it has been confirmed that overexpression of ETP in the cancer microenvironment in breast cancer animal models can increase cancer growth and metastasis (JCI 122(11):4243-56, 2012), and cisplatin, an anticancer drug. ) A mechanism has also been proposed to explain the resistance and anticancer effects that are increased when cisplatin and TZD (rosiglitazone) are simultaneously treated (EMBO Molecular Medicine 5(6):935-48, 2013).

Recently, various studies explaining the above-described correlation between obesity and cancer, in particular, how the interaction between adipocytes and cancer cells regulates the metabolic processes of different cells are actively in progress. Among these, there is a need to develop a new therapeutic agent using ETP and its inhibitors.

One aspect is to provide a composition for inhibiting endotropin activity comprising an inhibitor of an endotrophin cleavage enzyme.

Another aspect is to provide a pharmaceutical composition for preventing or treating obesity, diabetes, cancer or liver disease comprising an inhibitor of an endotropin cleavage enzyme as an active ingredient.

Another aspect is to provide a health functional food for preventing or improving obesity, diabetes, cancer or liver disease comprising an inhibitor of an endotropin cleavage enzyme as an active ingredient.

Another aspect is to provide a kit for screening an endotropin activity inhibitor comprising an inhibitor of an endotropin cleavage enzyme as an active ingredient.

Another aspect is the step of adding a candidate endotropin activity inhibitor to a biological sample isolated from the subject; Measuring the expression level of the endotropin protein; And when the expression level of the protein is decreased than before the addition of the candidate substance, determining that the candidate substance is an inhibitor of endotropin activity to provide a method for screening an endotropin activity inhibitor.

One aspect provides a composition for inhibiting endotropin activity, including an inhibitor of an endotrophin (ETP) cleavage enzyme. The endotropin is a protein produced by cleavage of the C-terminal propeptide of the Col6a3 protein secreted from adipocytes. In one embodiment, the C-terminus of the Col6a3 protein may be a C2-C5 domain represented by SEQ ID NO: 1. The enzyme may be an extracellular matrix metal-containing proteolytic enzyme (Matrix metalloproteinase, MMP). The MMP has a tissue remodeling function and may physiologically play a role in tumor metastasis, embryogenesis, and wound healing. Structurally, most MMPs may have a catalytic domain, a carboxyterminal hemopexin-like domain (hemopexin domain), and a prodomain that is cleaved during enzyme activation. In one embodiment, the MMP is MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP -14, MMP-15, MMP-16, MMP-17 MMP-18, MMP-19, MMP-20, MMP-21, MMP-22, MMP-23, MMP-24, and MMP-25 It may be one or more selected.

As used herein, the term "enzyme inhibitor" may be used interchangeably with the term enzyme inhibitor and refers to a substance that reduces the reaction rate of an enzyme. In one embodiment, the inhibitor is 2-thioxo-5({5-[3[(trifluoromethyl)phenyl]-2-furyl]methylene}1,3-thiazolidin-4-one ( 2-thioxo-5-({5-[3-(trifluoromethyl)phenyl]-2-furyl}methylene)-1,3-thiazolidin-4-one), 2-chloro-N-(6-methyl-2, 3,4,9-tetrahydro-1H-carbazol-1-yl)acetamide (2-chloro-N-(6-methyl-2,3,4,9-tetrahydro-1H-carbazol-1-yl) acetamide), 4,4'-(4,4'-biphenyldiyldiimino)bis(4-oxo-2-buteneonic acid)(4,4'-(4,4'-biphenyldiyldiimino)bis(4- oxo-2-butenoic acid)), 3-amino-5-(4-nitrobenzylidine)-2-thioxo-1,3-thiazolidin-4-one (3-amino-5-(4 -nitrobenzylidene)-2-thioxo-1,3-thiazolidin-4-one), 6-bromo-3-[3-(3-nitrophenyl)acryloyl]-4-phenyl-2(1H)-quinoli Non (6-bromo-3-[3-(3-nitrophenyl)acryloyl]-4-phenyl-2(1H)-quinolinone), 3-[(4-bromo-2-chlorophenyl)amino]1-phenyl -2-propen-1-one (3-[(4-bromo-2-chlorophenyl)amino]-1-phenyl-2-propen-1-one), 2-(N-benzyl-4-methoxyphenyl Sulfonamido)-5-((diethylamino)methyl)-N-hydroxy-3-methylbenzamide (2-(N-benzyl-4-methoxyphenylsulfonamido)-5-((diethylamino)methyl)-N- hydroxy-3-methylbenzamide) or a combination thereof The inhibitor may inhibit the activity of the MMP protein, thereby inhibiting the cleavage of the Col6a3 protein, that is, the production of the endotropin protein.

As used herein, the term "cleavage" refers to cleavage of the peptide bond of the endotropin protein formed by cleavage while the Col6a3 protein is secreted outside the cell, and the cleavage site or domain is an enzyme for cleaving the peptide site of the endotropin protein It means a polypeptide sequence having an appropriate activity. As used herein, the term "cutting site" or "cutting predicted site" refers to a part of the amino acid of the Col6a3 protein that is cleaved to produce an endotropin protein. In one embodiment, the cleavage site of the endotropin protein may be between amino acids 3097 and 3098 of the C2-C5 domain represented by SEQ ID NO: 1.

Another aspect provides a pharmaceutical composition for preventing or treating obesity, diabetes, cancer or liver disease, comprising an inhibitor of an endotropin cleavage enzyme as an active ingredient. Details of the endotropin cleavage enzyme inhibitor are as described above. In one embodiment, the liver disease may be hepatitis, liver fibrosis, alcoholic liver disease, or a combination thereof.

Pharmaceutical compositions for the prevention or treatment of obesity, diabetes, cancer or liver disease according to one aspect, respectively, according to a conventional method, oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, It may be formulated and used in the form of suppositories and sterile injectable solutions, and may include suitable carriers, excipients, or diluents commonly used in the preparation of pharmaceutical compositions for formulation.

As the carrier or excipient or diluent, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, undecided And various compounds or mixtures including vaginal cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

In the case of formulation, it can be prepared using diluents or excipients such as fillers, weight agents, binders, wetting agents, disintegrants, and surfactants that are usually used.

Solid preparations for oral administration may be prepared by mixing at least one excipient, such as starch, calcium bonate, sucrose or lactose, gelatin, and the like with the endotropin cleavage enzyme inhibitor. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used.

Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. may be included. .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous agents, suspensions, emulsions, lyophilized formulations, and suppositories. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyloleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerol gelatin, and the like can be used.

The preferred dosage of the pharmaceutical composition for the prevention or treatment of obesity, diabetes, cancer or liver disease according to one aspect varies depending on the patient's condition, weight, degree of disease, drug form, route and duration of administration, but appropriately by those skilled in the art. Can be chosen. However, for a desirable effect, it may be administered at 0.0001 to 2,000 mg/kg per day, preferably 0.001 to 2,000 mg/kg. Administration may be administered once a day, or may be divided several times. However, the scope of the present invention is not limited by the dosage.

The pharmaceutical composition for the prevention or treatment of obesity, diabetes, cancer or liver disease according to an aspect may be administered to mammals such as mice, mice, livestock, and humans by various routes. All modes of administration can be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

Another aspect provides a health functional food for preventing or improving obesity, diabetes, cancer or liver disease, comprising an inhibitor of an endotropin cleavage enzyme as an active ingredient. Details of the inhibitor of the endotropin cleavage enzyme are as described above.

In the health functional food for the prevention or improvement of obesity, diabetes, cancer or liver disease according to an aspect, when the inhibitor of the endotropin cleavage enzyme is used as an additive of a health functional food, it is added as it is or other food or food ingredient It can be used together, and can be suitably used according to a conventional method. The mixing amount of the active ingredient can be appropriately determined according to each purpose of use, such as prevention, health or treatment.

Formulations of health functional foods may be in the form of powders, granules, pills, tablets, capsules, as well as general foods or beverages.

The type of food is not particularly limited, and examples of foods to which the substance can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, and dairy products including ice cream. , Various soups, beverages, teas, drinks, alcoholic beverages and vitamin complexes, and may include all foods in the usual sense.

In general, when preparing food or beverage, the inhibitor of the endotropin cleavage enzyme may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less based on 100 parts by weight of the raw material. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above range, and the present invention has no problem in terms of safety in terms of using a fraction from a natural product. It can also be used in the above amount.

Among the health functional foods according to an aspect, the beverage may contain various flavoring agents or natural carbohydrates as an additional component, like a conventional beverage. The natural carbohydrates described above may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumatin and stevia extract, synthetic sweeteners such as saccharin and aspartame can be used. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, health functional foods for the prevention or improvement of obesity, diabetes, cancer or liver disease according to one aspect include various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protection It may contain colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages. In addition, the composition for improving sleep of the present invention may contain pulp for the production of natural fruit juice, fruit juice beverage and vegetable beverage. These ingredients can be used independently or in combination. The ratio of these additives is not limited, but it is generally selected from 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food of the present invention.

Another aspect provides a kit for screening an endotropin activity inhibitor comprising an inhibitor of an endotropin cleavage enzyme. Details of the endotropin cleavage enzyme inhibitor are as described above. In one embodiment, the kit may be an ELISA (Enzyme-linked immunosorbent assay) kit, a protein chip kit, a rapid kit, or a multiple reaction monitoring (MRM) kit.

In addition, the endotropin activity inhibitor screening kit may further include one or more other component compositions, solutions, or devices suitable for the assay method. For example, the kit may be a kit for screening that includes essential elements necessary for performing LISA. ELISA kits contain antibodies specific for the protein. Antibodies are antibodies with high specificity and affinity for endotropin proteins and little cross-reactivity with other proteins, and are monoclonal antibodies, polyclonal antibodies, or recombinant antibodies. In addition, the ELISA kit may contain an antibody specific for a control protein. Other ELISA kits include reagents capable of detecting bound antibodies, such as labeled secondary antibodies, chromophores, enzymes (e.g., conjugated with antibodies) and their substrates or antibodies capable of binding. Other materials may be included. In addition, for example, the kit may be a rapid kit including essential elements necessary to perform a rapid test in which an analysis result can be known. The rapid kit contains antibodies specific for the protein. Antibodies are antibodies with high specificity and affinity for endotropin proteins and little cross-reactivity with other proteins, and are monoclonal antibodies, polyclonal antibodies, or recombinant antibodies. In addition, the rapid kit may include an antibody specific for a control protein. Other rapid kits include reagents that can detect bound antibodies, for example, nitrocellulose membranes in which specific antibodies and secondary antibodies are immobilized, membranes bound to beads bound to antibodies, absorption pads and sample pads, etc. It may contain substances and the like. In addition, for example, the kit may be a multiple reaction monitoring (MRM) kit, which is an MS/MS mode that includes essential elements necessary to perform mass spectrometry. SIM (Selected Ion Monitoring) is a method of using ions generated by colliding once at the source part of the mass spectrometer, whereas MRM selects a specific ion from the once broken ions and selects another MS source continuously connected. This is a method of using ions obtained from among them after passing through one more time to collide. Through the MRM (Multiple reaction monitoring) analysis methods, it is possible to compare the protein expression level of a normal control, or the same individual with the protein expression level in obesity, diabetes, cancer and/or liver disease, and It is possible to screen whether a candidate substance inhibits endotropin activity by judging whether or not a significant increase or decrease in the amount of expression from the type 6 gene to the endotropin protein is increased.

Another aspect is the step of adding a candidate endotropin activity inhibitor to a biological sample isolated from the subject; Measuring the level of expression or activity of the endotropin protein; And determining that the candidate substance is an inhibitor of endotropin activity when the expression level of the protein is lower than before the addition of the candidate substance, a method for screening an endotropin activity inhibitor. Details of the endotropin activity inhibitor are as described above.

The subject may have obesity, diabetes, cancer and/or liver disease, and may be particularly obese. The individual may include a vertebrate, a mammal, or a human ( Homo sapiens ). In addition, the biological sample may be tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.

The candidate substance is a substance that is expected to exhibit an effect as a substance that inhibits the activity of endotropin or an inhibitor of an endotropin cleavage enzyme. For example, an arbitrary substance, a molecule, an element ), a compound, an entity, or a combination thereof. For example, it may include proteins, polypeptides, small organic molecules, polysaccharides, polynucleotides, and the like. It may also be a natural product, a synthetic compound or a chemical compound, or a combination of two or more substances. In one embodiment, the candidate material is 2-thioxo-5({5-[3[(trifluoromethyl)phenyl]-2-furyl]methylene}1,3-thiazolidin-4-one (2-thioxo-5-({5-[3-(trifluoromethyl)phenyl]-2-furyl}methylene)-1,3-thiazolidin-4-one), 2-chloro-N-(6-methyl-2 ,3,4,9-tetrahydro-1H-carbazol-1-yl)acetamide (2-chloro-N-(6-methyl-2,3,4,9-tetrahydro-1H-carbazol-1-yl )acetamide), 4,4'-(4,4'-biphenyldiyldiimino)bis(4-oxo-2-buteneonic acid)(4,4'-(4,4'-biphenyldiyldiimino)bis(4 -oxo-2-butenoic acid)), 3-amino-5-(4-nitrobenzylidine)-2-thioxo-1,3-thiazolidin-4-one (3-amino-5-( 4-nitrobenzylidene)-2-thioxo-1,3-thiazolidin-4-one), 6-bromo-3-[3-(3-nitrophenyl)acryloyl]-4-phenyl-2(1H)-qui Nolinone (6-bromo-3-[3-(3-nitrophenyl)acryloyl]-4-phenyl-2(1H)-quinolinone), 3-[(4-bromo-2-chlorophenyl)amino]1- Phenyl-2-propen-1-one (3-[(4-bromo-2-chlorophenyl)amino]-1-phenyl-2-propen-1-one), 2-(N-benzyl-4-methoxy Phenylsulfonamido)-5-((diethylamino)methyl)-N-hydroxy-3-methylbenzamide (2-(N-benzyl-4-methoxyphenylsulfonamido)-5-((diethylamino)methyl)-N -hydroxy-3-methylbenzamide) or a combination thereof The measurement of the expression level of the endotropin protein is, for example, western blotting, dot blotting, and enzyme-linked immunoassay. immunosorbent assay), radioactive immunoassay (RIA), room Four immunodiffusion methods, octeroni immune diffusion methods, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation, complement fixation analysis, flow cytometry (FACS) or protein chip method, etc. may be used. Measurement of the level of the endotropin protein activity is, for example, measuring angiogenesis, cell mobility, epithelial mesenchymal transition (EMP), increase in fibrosis, etc. by endotropin in a cell line. Can be. In one embodiment, the activity level of endotropin was measured using a luciferase enzyme activity assay.

Another aspect provides an endotropin activity inhibitor screening system.

The endotropin activity inhibitor refers to a substance that is expected to exhibit an effect as a substance that inhibits the production or activity of endotropin or an inhibitor of an endotropin cleavage enzyme. In one embodiment, the system includes a cell line transformed with a recombinant vector containing an IL-1b gene into which 5 to 15 amino acid sequences are inserted. The recombinant vector may include a fluorescent protein gene. The fluorescent protein is luciferase, green fluorescent protein (GFP), modified green fluorescent protein, enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP), Enhanced red fluorescent protein (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), indigo fluorescent protein (CFP), and enhanced It may be selected from the group consisting of indigo blue fluorescent protein (ECFP).

Another aspect is the step of recombining the IL-1b gene and the fluorescent protein gene into which 5 to 15 amino acid sequences are inserted to form a transformed cell; Culturing the transformed cells in a medium; And it provides a method for screening an endotropin activity inhibitor comprising the step of measuring the fluorescence of the fluorescent protein. The inserted amino acid sequence may be an endotropin cleavage site. In one embodiment, the IL-1b gene may further include an amino acid sequence represented by SEQ ID NO: 7 or an amino acid sequence represented by SEQ ID NO: 8. Before the step of measuring the fluorescence of the fluorescent protein, it may include processing an endotropin activity inhibitor candidate material. When the fluorescence level of the fluorescent protein is decreased by the candidate substance than before the addition of the candidate substance, it may be determined that the candidate substance is an endotropin activity inhibitor. Details of the candidate material are as described above.

Therefore, the screening system according to one aspect and the screening method using the same are biosensors for searching for substances that inhibit the activity of endotropins, and are useful for the development of therapeutic agents for obesity, diabetes, cancer and/or liver disease related to the protein. It can be a tool.

The composition for inhibiting endotropin activity comprising an inhibitor of an endotropin cleavage enzyme according to an aspect can be used in the treatment of obesity, diabetes as well as cancer by inhibiting the production and activity of endotropin mainly expressed in mast cells. I can. In addition, the composition can prevent hepatitis and liver fibrosis by inhibiting the interaction of hepatocytes and non-hepatocytes by endotropin in the course of liver damage, and thus can be used as a customized therapeutic agent for liver disease.

1 shows a process of analyzing a cleavage site through amino acid sequence analysis after separating an endotropin protein.
Figure 2a shows the results of separating the endotropin-binding protein from breast cancer cells using the APEX system and identifying the binding protein using LC-MS/MS equipment in order to separate and identify the protein that binds to the endotropin protein. It is a picture.
2B is a diagram showing the results of identifying endotropin-binding proteins for 25,000 human proteins using a human protein chip to separate and identify proteins that bind to endotropin proteins.
3A is a result of confirming whether the binding protein candidate group MMP2 actually binds to endotropin by immunoprecipitation and Western blot.
3B is a result of confirming whether the binding protein candidate group MMP9 actually binds to endotropin by immunoprecipitation and Western blot.
Figure 4a is a diagram showing a luciferase control system and a luciferase screening system for screening for inhibitors of the MMP protein activity.
4B is a diagram illustrating whether the screening system is operated by expressing each system of FIG. 4A into cells.
5 shows the results of measuring the activity between MMP proteins using a system constructed using a luciferase assay.
6 is a result of verifying the activity of the MMP protein inhibitor using the luciferase system.
7A is a result of screening a compound that inhibits the activity of the MMP1 protein.
7B is a result of screening a compound that inhibits the activity of the MMP9 protein.
7C is a result of screening a compound that inhibits the activity of the MMP16 protein.

Hereinafter, preferred embodiments are provided to help understanding of the present invention. However, the following examples are only provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Analysis of amino acid sequence of endotrophin (ETP)

Type 6 collagen (type VI) protein is composed of A1, A2, and A3 chains, and when a monomer consisting of the three chains forms a tetramer, it is secreted outside the cell. At this time, the C5 domain of the A3 chain It is ETP that was cut out. In this example, the amino acid sequence of ETP cleaved from type 6 collagen protein was analyzed.

First, the Col6a3 gene was transformed into HEK-293T cells using a gene recombination method understood by those skilled in the art, and then type 6 collagen protein was expressed to generate ETP. Specifically, the C2-C5 sequence corresponding to the 2619 to 3177th amino acid sequence of the Col6a3 protein was inserted into the PRA-GFP vector to prepare a C2-C5 expression vector. Thereafter, the C2-C5 expression vector was transformed into HEK-293T cells to determine whether the protein was secreted outside the cell. At this time, the generated ETP was separated using a FLAG-tag. In order to confirm the successful expression of the recombinant protein, N-terminal sequence analysis was performed by requesting Life Science Lab. As a result, it was confirmed that between amino acids 3097 and 3098 of the collagen protein was cleaved. In addition, site-direct mutagenesis was used to confirm whether the cleavage site of the collagen protein was consistent with the above analysis results. Specifically, leucine, which is the 3097th amino acid, and methionine, which is the 3098th amino acid, was substituted with alanine using the primers shown in Table 1 below. At this time, amino acids were substituted using the quikchange II site-directed mutagenesis kit (Agilent Technologies).

Sequence number Primer sequence SEQ ID NO: 2 Forward 5'CTAGTTCAACCATCAATGCAATGGTGAGCACAGAACC 3' SEQ ID NO: 3 Reverse 5'GGTTCTGTGCTCACCATTGCATTGATGGTTGAACTAG 3' SEQ ID NO: 4 Forward 5'CTAGTTCAACCATCAATCTAGCGGTGAGCACAGAACCATTGG 3' SEQ ID NO: 5 Reverse 5'CCAATGGTTCTGTGCTCACCGCTAGATTGATGGTTGAACTAG 3'

As a result of replacing both leucine and methionine with alanine, it was confirmed that the production of ETP protein was inhibited.

1 shows a process of analyzing a cleavage site through amino acid sequence analysis after separating an endotropin protein.

As shown in Figure 1, it can be seen that the ETP protein is produced by cleavage between the 3097th amino acid and the 3098th amino acid of the Col6a3 protein.

Example 2. Identification of binding protein binding to ETP and confirmation of binding

2-1. Identification of binding proteins

As confirmed in Example 1, the ETP protein was generated by cleaving a specific site of Col63a, so the binding protein that binds to ETP was expected to be a protein involved in the production or activity of ETP. Therefore, in this example, the following three methods were used to screen for binding proteins that bind to ETP.

(1) APEX system

The APEX system is a proximity-labeling based system. APEX is a single form of ascorbate peroxidase (APEX) reporter derived from peas or soybeans. In the above technique, biotin-phenol (BP) is biotin-phenoxylized through an oxidation catalytic reaction in the presence of hydrogen peroxide in APEX protein expressed in living cells, resulting in biotinylation of surrounding proteins. Using the above system, a clone labeled APEX on ETP was transformed into 4T-1 cells, which are mouse breast cancer cells, overexpressed, and then treated with BP and hydrogen peroxide to biotinylate the protein bound to ETP. The biotinylated protein was purified with streptavidin-bead and then identified using mass spectrometry.

(2) Use of ETP antibody

ETP binding protein was isolated from human embryonic kidney cells using an ETP antibody. Specifically, a clone having FLAG attached to ETP was transformed into HEK-293T cells and overexpressed, and then ETP was isolated and purified with FLAG-tag. Then, the binding protein was identified using mass spectrometry.

(3) Using human protein chips

After ETP was expressed in HEK-293T cells, it was separated and purified with FLAG-tag. After that, the analysis was requested to Jinon Biotech to identify ETP-binding proteins for about 25,000 human proteins using a human protein chip.

Figure 2a is a schematic diagram showing the result of the identification of the endotropin-binding protein using the APEX system.

2B is a diagram showing the result of identifying an endotropin-binding protein using a human protein chip.

As a result, MMP1, MMP2, MMP9, and MMP16 were able to be secured as candidate groups for ETP-binding proteins.

2-2. Confirmation of binding to ETP protein

Immunoprecipitation and Western blot were used at the cell line level to confirm whether the binding protein candidate group obtained in Example 2-1 actually binds to ETP. Specifically, after the FLAG-tag was added to the human MMP2 and MMP9 genes, HEK-293T cells were transformed with the ETP gene to express MMP and ETP proteins. After extracting the expressed proteins, the MMP protein was purified using FLAG beads. At this time, when the ETP proteins bind to the MMP protein, the ETP protein is purified together with the MMP protein. Whether or not the purified MMP2 protein and MMP9 protein can bind to ETP with each other was confirmed by Western blot using FLAG antibody and ETP antibody, respectively.

3A is a result of confirming whether the binding protein candidate group MMP2 actually binds to endotropin by immunoprecipitation and Western blot.

3B is a result of confirming whether the binding protein candidate group MMP9 actually binds to endotropin by immunoprecipitation and Western blot.

3A and 3B, it can be seen that MMP-2 and MMP-9 bind to ETP.

Example 3. MMP protein activity inhibitor screening system construction and confirmation

3-1. Screening system construction

When the activity of the MMP protein discovered in Example 2 is inhibited, the production of ETP can be inhibited. In this example, a system for screening a compound or natural product capable of inhibiting the activity of the MMP protein was constructed.

First, in order to construct the screening system, gene recombination was performed by inserting the cleavage site of ETP cut by the MMP protein into the IL-1b gene as shown in FIG. 4A.

Figure 4a is a diagram showing a luciferase control system and a luciferase screening system for screening for inhibitors of the MMP protein activity. The gene of Mouse IL-1b was purchased and prepared from addgene (USA), and a pGL4 luciferase reporter vector (promega) was used. PRL-N-pro-ILb-C-pro-ILb was cloned into pGL4 luciferase reporter vector using PCR, and then a luciferase control system was constructed. In addition, the PRL-N-pro-ILb-ETP cleavage site-C-pro-ILb was cloned into the pGL4 luciferase reporter vector in the same manner as described above to construct a luciferase screening system. At this time, 7 amino acids (LMMVSTEP) or 12 amino acids (SSTINLMVSTEP) were additionally inserted into the ETP cleavage site.

Next, it was confirmed whether or not the screening system was operated by expressing the screening system constructed above into cells.

4B is a diagram illustrating whether the screening system is operated by expressing each system of FIG. 4A into cells.

Luciferase is an enzyme involved in bioluminescence and is widely used as a reporter gene for the regulation or function of genes or screening for physiologically active substances. In addition, IL-1b proteins are characterized by aggregation with each other while being expressed. In general, when the protein is expressed, it does not exhibit luciferase activity, and thus, the function of the screening system was confirmed by measuring the luciferase activity using the characteristic of the IL-1b protein aggregation.

When measuring the luciferase activity after adding Gaussia Luciferase (Gluc) gene to the end of the IL-1b gene, the luciferase activity was observed even when Coelenterazine, the substrate of Gluc, was added due to the aggregation of IL-1b protein. Cannot be displayed. However, when an ETP cleavage site is added to the middle of the IL-1b gene, the IL-1b protein is cleaved by MMP after protein expression, and the aggregation phenomenon between the cleaved IL-1b proteins disappears, so that Gluc is active. Therefore, when coelenterazine is added, it has luciferase activity.

That is, the screening system according to an aspect can not only measure the activity of MMP proteins, but also identify whether or not the ETP protein is cleaved through luciferase activity measurement, thereby identifying drugs that regulate the activity of MMP proteins. In addition, unlike conventional systems that measure the activity of luciferase by destroying cells, the screening system according to an aspect has the advantage of being able to easily measure luciferase activity by attaching a signal peptide to each protein secreted outside the cell. .

3-2. Checking the operation of the screening system

It was confirmed whether the screening system constructed in Example 3-1 was operated by the MMP protein. Specifically, 200 ng of the control luciferase system prepared in Example 3-1 and 40 ng of the β-galactosidase expression gene per well in 12 wells were added to 100 ng of an MMP precursor (Pro-MMP) or an MMP activator (ca-MMP). ) HEK-293T cells were transformed with 100 ng. At this time, 7 amino acids (LMVSTEP) or 12 (SSTINLMVSTEP) amino acids of the ETP cleavage predicted site were inserted into the IL-1b gene. A control gene that did not insert the ETP cleavage predicted site was transformed into cells in the same way. After culturing the transformed HEK-293T cell line in a serum free medium for 24 hours, each medium was obtained. Thereafter, the same volume (50 μl) of the medium was reacted with a solution of coelenterazine (1.43 μM, 500× stock) to measure absolute luciferase activity. Thereafter, β-galactosidase expressed in each of the transformed HEK-293T cell lines was standardized and luciferase activity was measured to confirm the operation of the screening system.

5 shows the results of measuring the activity between MMP proteins using a system constructed using a luciferase assay. A is a result of measuring the activity of MMP proteins using a system in which 7 amino acids (LMVSTEP) of the predicted ETP cleavage site are inserted between IL-1b proteins. Each of the precursor MMP (Pro-MMP), activator MMP (ca-MMP), or control-expressing gene was transformed into cells, and then luciferase activity was measured. As a result, it was confirmed that the system was activated by the MMP1, MMP2, MMP9 and MMP16 proteins. In B, the luciferase activity was measured in the same manner as in A, except that 12 amino acids (SSTINLMVSTEP) of the ETP cleavage expected site were inserted between the IL-1b protein. As a result, it was confirmed that the system was activated by the MMP1, MMP2, MMP9 and MMP16 proteins. That is, the luciferase activity is exhibited by the MMP1, MMP2, MMP9, and MMP16 proteins, indicating that the protein inhibits the activity of ETP.

6 is a result of verifying the activity of the MMP protein inhibitor using the luciferase system. MMP9 protein inhibitor 2-(N-benzyl-4-methoxyphenylsulfonamido)-5-((diethylamino)methyl)-N using a system in which 7 amino acids (LMVSTEP) of the expected ETP cleavage site are inserted between IL-1b proteins. After treatment with -hydroxy-3-methylbenzamide (CAS 1177749-58-4), luciferase activity was measured.

As a result, it can be confirmed that the luciferase activity is inhibited by the MMP9 inhibitor, and it is expected that novel bioactive substances that inhibit the MMP protein can be screened using the luciferase system.

Example 4. Screening of inhibitors of MMP protein activity

Compounds that inhibit the activities of MMP1, MMP9 and MMP16 were screened based on the screening results in Examples 2 and 3-2. The activity of the MMP protein was measured using a system in which 12 amino acids (SSTINLMVSTEP) of the ETP cleavage expected site were inserted between IL-1b proteins. Each activator (ca-MMP) or control-expressing gene was transformed into cells, and then the physiologically active compound was treated to a final concentration of 10 μM and cultured for 24 hours. By measuring the luciferase activity of the cultured cells, it was confirmed whether the treated bioactive compound acts as an inhibitor of the MMP protein.

7A is a result of screening a compound that inhibits the activity of the MMP1 protein. As shown in Figure 7a, compound #1014 ('2-thioxo-5-({5-[3-(trifluoromethyl)phenyl]-2-furyl}methylene)-1,3-thiazolidin-4-one) is MMP1 It was confirmed that it significantly inhibited the activity of the protein.

7B is a result of screening a compound that inhibits the activity of the MMP9 protein. As shown in FIG. 7B, it was confirmed that the treated bioactive compound did not significantly inhibit the activity of the MMP9 protein.

7C is a result of screening a compound that inhibits the activity of the MMP16 protein. As shown in Figure 7c, #123(2-chloro-N-(6-methyl-2,3,4,9-tetrahydro-1H-carbazol-1-yl)acetamide), #901('4,4' -(4,4'-biphenyldiyldiimino)bis(4-oxo-2-butenoic acid)), #998('3-amino-5-(4-nitrobenzylidene)-2-thioxo-1,3-thiazolidin-4- one), #1030('6-bromo-3-[3-(3-nitrophenyl)acryloyl]-4-phenyl-2(1H)-quinolinone) and #1128('3-[(4-bromo-2- It was confirmed that five compounds including chlorophenyl)amino]-1-phenyl-2-propen-1-one) significantly inhibited the activity of the MMP16 protein.

That is, the compound identified by the screening system according to an aspect significantly inhibits the activity of MMP proteins, and thus can inhibit the production and/or activity of endotropin.

The above description of the present invention is for illustration only, and those skilled in the art to which the present invention pertains can understand that the present invention can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative and non-limiting in all respects.

<110> UNIST(ULSAN NATIONAL INSTITUTE OF SCIENCE AND TECHNOLOGY) <120> Composition for inhibiting endotrophin activity comprising an inhibitor of endotrophin cleavage enzyme and uses thereof <130> PN131225 <150> KR 10-2019-0013755 <151> 2019-02-01 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 559 <212> PRT <213> Artificial Sequence <220> <223> Col6a3_C2-C5 domain <400> 1 Asp Met Ala Phe Ile Leu Asp Ser Ala Glu Thr Thr Thr Leu Phe Gln 1 5 10 15 Phe Asn Glu Met Lys Lys Tyr Ile Ala Tyr Leu Val Arg Gln Leu Asp 20 25 30 Met Ser Pro Asp Pro Lys Ala Ser Gln His Phe Ala Arg Val Ala Val 35 40 45 Val Gln His Ala Pro Ser Glu Ser Val Asp Asn Ala Ser Met Pro Pro 50 55 60 Val Lys Val Glu Phe Ser Leu Thr Asp Tyr Gly Ser Lys Glu Lys Leu 65 70 75 80 Val Asp Phe Leu Ser Arg Gly Met Thr Gln Leu Gln Gly Thr Arg Ala 85 90 95 Leu Gly Ser Ala Ile Glu Tyr Thr Ile Glu Asn Val Phe Glu Ser Ala 100 105 110 Pro Asn Pro Arg Asp Leu Lys Ile Val Val Leu Met Leu Thr Gly Glu 115 120 125 Val Pro Glu Gln Gln Leu Glu Glu Ala Gln Arg Val Ile Leu Gln Ala 130 135 140 Lys Cys Lys Gly Tyr Phe Phe Val Val Leu Gly Ile Gly Arg Lys Val 145 150 155 160 Asn Ile Lys Glu Val Tyr Thr Phe Ala Ser Glu Pro Asn Asp Val Phe 165 170 175 Phe Lys Leu Val Asp Lys Ser Thr Glu Leu Asn Glu Glu Pro Leu Met 180 185 190 Arg Phe Gly Arg Leu Leu Pro Ser Phe Val Ser Ser Glu Asn Ala Phe 195 200 205 Tyr Leu Ser Pro Asp Ile Arg Lys Gln Cys Asp Trp Phe Gln Gly Asp 210 215 220 Gln Pro Thr Lys Asn Leu Val Lys Phe Gly His Lys Gln Val Asn Val 225 230 235 240 Pro Asn Asn Val Thr Ser Ser Pro Thr Ser Asn Pro Val Thr Thr Thr 245 250 255 Lys Pro Val Thr Thr Thr Lys Pro Val Thr Thr Thr Thr Lys Pro Val 260 265 270 Thr Thr Thr Thr Lys Pro Val Thr Ile Ile Asn Gln Pro Ser Val Lys 275 280 285 Pro Ala Ala Ala Lys Pro Ala Pro Ala Lys Pro Val Ala Ala Lys Pro 290 295 300 Val Ala Thr Lys Met Ala Thr Val Arg Pro Pro Val Ala Val Lys Pro 305 310 315 320 Ala Thr Ala Ala Lys Pro Val Ala Ala Lys Pro Ala Ala Val Arg Pro 325 330 335 Pro Ala Ala Ala Ala Ala Lys Pro Val Ala Thr Lys Pro Glu Val Pro 340 345 350 Arg Pro Gln Ala Ala Lys Pro Ala Ala Thr Lys Pro Ala Thr Thr Lys 355 360 365 Pro Met Val Lys Met Ser Arg Glu Val Gln Val Phe Glu Ile Thr Glu 370 375 380 Asn Ser Ala Lys Leu His Trp Glu Arg Ala Glu Pro Pro Gly Pro Tyr 385 390 395 400 Phe Tyr Asp Leu Thr Val Thr Ser Ala His Asp Gln Ser Leu Val Leu 405 410 415 Lys Gln Asn Leu Thr Val Thr Asp Arg Val Ile Gly Gly Leu Leu Ala 420 425 430 Gly Gln Thr Tyr His Val Ala Val Val Cys Tyr Leu Arg Ser Gln Val 435 440 445 Arg Ala Thr Tyr His Gly Ser Phe Ser Thr Lys Lys Ser Gln Pro Pro 450 455 460 Pro Pro Gln Pro Ala Arg Ser Ala Ser Ser Ser Thr Ile Asn Leu Met 465 470 475 480 Val Ser Thr Glu Pro Leu Ala Leu Thr Glu Thr Asp Ile Cys Lys Leu 485 490 495 Pro Lys Asp Glu Gly Thr Cys Arg Asp Phe Ile Leu Lys Trp Tyr Tyr 500 505 510 Asp Pro Asn Thr Lys Ser Cys Ala Arg Phe Trp Tyr Gly Gly Cys Gly 515 520 525 Gly Asn Glu Asn Lys Phe Gly Ser Gln Lys Glu Cys Glu Lys Val Cys 530 535 540 Ala Pro Val Leu Ala Lys Pro Gly Val Ile Ser Val Met Gly Thr 545 550 555 <210> 2 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Leucine <400> 2 ctagttcaac catcaatgca atggtgagca cagaac 36 <210> 3 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Leucine <400> 3 ggttctgtgc tcaccattgc attgatggtt gaactag 37 <210> 4 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Methionine <400> 4 ctagttcaac catcaatcta gcggtgagca cagaaccatt gg 42 <210> 5 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Methionine <400> 5 ccaatggttc tgtgctcacc gctagattga tggttgaact ag 42 <210> 6 <211> 77 <212> PRT <213> Artificial Sequence <220> <223> ETP <400> 6 Thr Glu Pro Leu Ala Leu Thr Glu Thr Asp Ile Cys Lys Leu Pro Lys 1 5 10 15 Asp Glu Gly Thr Cys Arg Asp Phe Ile Leu Lys Trp Tyr Tyr Asp Pro 20 25 30 Asn Thr Lys Ser Cys Ala Arg Phe Trp Tyr Gly Gly Cys Gly Gly Asn 35 40 45 Glu Asn Lys Phe Gly Ser Gln Lys Glu Cys Glu Lys Val Cys Ala Pro 50 55 60 Val Leu Ala Lys Pro Gly Val Ile Ser Val Met Gly Thr 65 70 75 <210> 7 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> ETP cleavage site 1 <400> 7 Leu Met Val Ser Thr Glu Pro 1 5 <210> 8 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> ETP cleavage site 2 <400> 8 Ser Ser Thr Ile Asn Leu Met Val Ser Thr Glu Pro 1 5 10

Claims (14)

Endotropin (endotrophin) composition for inhibiting endotropin activity comprising an inhibitor of cleavage enzyme. The composition of claim 1, wherein the enzyme is an extracellular matrix metal-containing proteolytic enzyme (Matrix metalloproteinase, MMP). The method according to claim 2, wherein the MMP is MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP- 14, selected from the group consisting of MMP-15, MMP-16, MMP-17 MMP-18, MMP-19, MMP-20, MMP-21, MMP-22, MMP-23, MMP-24, and MMP-25 A composition comprising one or more. A pharmaceutical composition for preventing or treating obesity, diabetes, cancer or liver disease, comprising an inhibitor of endotropin cleavage enzyme as an active ingredient. The pharmaceutical composition of claim 4, wherein the enzyme is an extracellular matrix metal-containing proteolytic enzyme (Matrix metalloproteinase, MMP). The method of claim 5, wherein the MMP is MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP- 14, selected from the group consisting of MMP-15, MMP-16, MMP-17 MMP-18, MMP-19, MMP-20, MMP-21, MMP-22, MMP-23, MMP-24, and MMP-25 A pharmaceutical composition comprising one or more. The pharmaceutical composition of claim 4, wherein the cleavage enzyme decreases the activity of endotropin. The pharmaceutical composition of claim 4, wherein the liver disease is at least one selected from hepatitis, liver fibrosis, and alcoholic liver disease. Health functional food for preventing or improving obesity, diabetes, cancer or liver disease, comprising an inhibitor of endotropin cleavage enzyme as an active ingredient. Kit for screening an inhibitor of endotropin activity comprising an inhibitor of an endotropin cleavage enzyme. The screening kit of claim 10, wherein the kit is an ELISA (Enzyme-linked immunosorbent assay) kit, a protein chip kit, a rapid kit, or a multiple reaction monitoring (MRM) kit. Adding a candidate endotropin activity inhibitor to the biological sample isolated from the individual;
Measuring the level of expression or activity of the endotropin protein; And
When the expression level of the protein is decreased compared to before the addition of the candidate substance, the method for screening an endotropin activity inhibitor comprising the step of determining that the candidate substance is an endotropin activity inhibitor. The method of claim 12, wherein the expression level of the protein is western blotting, dot blotting, enzyme-linked immunosorbent assay, radioactive immunoassay (RIA), radioimmunoassay, and octero. A screening method that uses the immunity diffusion method, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation, complement fixation method, flow cytometry (FACS) or protein chip method. The method of claim 12, wherein the candidate material is 2-thioxo-5({5-[3[(trifluoromethyl)phenyl]-2-furyl]methylene}1,3-thiazolidin-4-one ( 2-thioxo-5-({5-[3-(trifluoromethyl)phenyl]-2-furyl}methylene)-1,3-thiazolidin-4-one), 2-chloro-N-(6-methyl-2, 3,4,9-tetrahydro-1H-carbazol-1-yl)acetamide (2-chloro-N-(6-methyl-2,3,4,9-tetrahydro-1H-carbazol-1-yl) acetamide), 4,4'-(4,4'-biphenyldiyldiimino)bis(4-oxo-2-buteneonic acid)(4,4'-(4,4'-biphenyldiyldiimino)bis(4- oxo-2-butenoic acid)), 3-amino-5-(4-nitrobenzylidine)-2-thioxo-1,3-thiazolidin-4-one (3-amino-5-(4 -nitrobenzylidene)-2-thioxo-1,3-thiazolidin-4-one), 6-bromo-3-[3-(3-nitrophenyl)acryloyl]-4-phenyl-2(1H)-quinoli Non (6-bromo-3-[3-(3-nitrophenyl)acryloyl]-4-phenyl-2(1H)-quinolinone), 3-[(4-bromo-2-chlorophenyl)amino]1-phenyl -2-propen-1-one (3-[(4-bromo-2-chlorophenyl)amino]-1-phenyl-2-propen-1-one) and 2-(N-benzyl-4-methoxyphenyl Sulfonamido)-5-((diethylamino)methyl)-N-hydroxy-3-methylbenzamide (2-(N-benzyl-4-methoxyphenylsulfonamido)-5-((diethylamino)methyl)-N- hydroxy-3-methylbenzamide) is any one or more selected from the group consisting of a screening method.

Images