KR20200094102A - Method for screening microorganism with high caprolactam productivity using riboswitch - Google Patents

Abstract

The present invention relates to a riboswitch for screening bacteria producing caprolactam in high yield, and a method for screening bacteria producing caprolactam in high yield. According to the present invention, when using the riboswitch and the method for screening bacteria producing caprolactam in high yield, caprolactam can be specifically and sensitively recognized by an aptamer specific to caprolactam, and a strain producing caprolactam at a high concentration can be quickly and easily selected, thereby increasing the price competitiveness of caprolactam production using microorganisms by using the same.

Description

Method for screening caprolactam productivity using riboswitch {Method for screening microorganism with high caprolactam productivity using riboswitch}

The present invention relates to a riboswitch for caprolactam high-producing bacteria screening and a method for screening high-producing caprolactam bacteria.

Bio-based production using microbial substrate metabolism is considered to be a new alternative to petroleum-based compound production. One of the main areas of this production method is the production of monomers. Caprolactam is a cyclic amide of 6-aminocaproic acid, which is mainly used for the production of nylon-6. Because caprolactam has great economic value, research has been conducted to develop a microorganism capable of producing caprolactam or a precursor thereof. However, the yield or production is still low, and further strain improvement is necessary.

The biosensor based on the genetic circuit can control the expression of a specific gene according to the concentration of metabolites in each cell. These biosensors enable screening of high-processing metabolites such as FACS (Fluorescence activated cell sorter) or artificial evolution. At this time, since the cells contain structurally similar compounds to the target metabolite, the biosensor should have high specificity for the target material. For example, an E. coli strain producing caprolactam may simultaneously produce caprolactam and valerolactam having only one carbon difference.

Recently, a lactam biosensor based on a transcription factor has been developed, but the sensor has a disadvantage that it cannot distinguish valerolactam and caprolactam.

On the other hand, when compared with the problems of protein-based sensor development, RNA-based sensors have various advantages in the development and utilization process. The process of developing an RNA aptamer that specifically reacts to a specific chemical is performed through an in vitro reaction that does not involve transformation, and thus, a specific aptamer can be found from a library much larger than that of a protein. Can. In addition, the RNA-based sensor has the advantage of reducing unnecessary metabolic burden on cells because it reacts directly with the target substance and does not involve additional protein expression.

Accordingly, the present inventors continued to study to solve the problems of the prior art as described above and to screen strains that produce high concentrations of caprolactam, and found that it is possible to screen high strains of caprolactam using riboswitches. Thus, the present invention has been completed.

Accordingly, an object of the present invention is to provide a caprolactam high-producing screening method and a riboswitch for screening high-producing caprolactam containing caprolactam aptamers, linkers and selectable marker genes.

In order to achieve the above object, the present invention provides a riboswitch for screening for caprolactam high-producing bacteria, including caprolactam aptamers, linkers and selectable marker genes.

In addition, the present invention comprises the steps of constructing a mutant strain library introduced with a riboswitch containing a caprolactam aptamer, a linker and a selectable marker gene; Culturing the mutant strain library, respectively; And selecting a mutant strain having a high survival rate from the cultured mutant strain library as a caprolactam high-producing strain mutant strain.

Using the riboswitch according to the present invention and a caprolactam high-producing screening method using the same, caprolactam can be specifically and sensitively recognized by an aptamer specific for caprolactam, and a strain producing caprolactam at a high concentration is fast It can be easily selected, and this can be used to increase the price competitiveness of caprolactam production using microorganisms.

1 is a diagram schematically showing the introduction of the overall caprolactam riboswitch development.
2 is a diagram showing the results of the caprolactam aptamer evolution process through SELEX.
3 is a schematic diagram of a caprolactam riboswitch library.
Figure 4 is a diagram showing the results of confirming the caprolactam-specific reactivity of 10 colonies obtained through the evolution of the constructed caprolactam sorbet library.
5 is a view showing the results confirming the reactivity of the selected caprolactam-specific riboswitch and caprolactam and its precursor, 6-aminocaproic acid.
FIG. 6 is a diagram showing caprolactam-dose response curves of caprolactam riboswitches according to the present invention according to caprolactam concentrations in vitro.
7 is a diagram showing a caprolactam-dose response curve of caprolactam riboswitch according to the present invention according to caprolactam concentration in vivo.
8 is a view showing the results of confirming the reactivity with other lactams having a difference in the number of carbon. (C4 = butyrolactam, C5 = valerolactam, C6 = caprolactam)
9 is a diagram showing the fluorescence value according to the percentage concentration of caprolactam in a medium mixed with caprolactam and valerolactam.
10 is a view showing the results confirming the possibility of cell growth control of caprolactam riboswitch according to the present invention.

Hereinafter, the present invention will be described in detail.

According to an aspect of the present invention, the present invention provides a riboswitch for screening for caprolactam high-producing bacteria.

In an embodiment of the present invention, the present invention relates to an RNA riboswitch that specifically recognizes caprolactam and regulates the expression level of a gene located downstream. The RNA aptamer that specifically binds to caprolactam was used as a library to prepare a base sequence of a group capable of being switched. Riboswitches specific to caprolactam and actually working were selected from the library. The riboswitch may include an aptamer characterized by specifically binding to caprolactam.

In the present invention, "Aptamer" is a single-stranded nucleic acid (DNA, RNA or modified nucleic acid) that has a stable tertiary structure in itself and is capable of binding to a target molecule with high affinity and specificity. Since the aptamer excavation technique called Systematic Evolution of Ligands by EXponential enrichment (SELEX) was first developed, many aptamers capable of binding to various target molecules ranging from low molecular organic substances, peptides, and membrane proteins have been continuously discovered. Aptamers are often compared to single antibodies due to their high affinity (usually pM level) and specificity, so they can be compared to single antibodies, and have a high potential as an alternative antibody, especially as "chemical antibodies."

In an embodiment of the present invention, the aptamer may be one that specifically binds to caprolactam, and preferably, the aptamer may be an aptamer composed of the nucleotide sequence of SEQ ID NO: 1. In addition, the aptamer may be a nucleic acid sequence having 80% or more homology to the nucleotide sequence of SEQ ID NO: 1, preferably a nucleic acid sequence having 90% or more homology, and most preferably 95% or more homology. It may be a nucleic acid sequence. In the present invention, "nucleic acid sequence having homology" means a similar nucleic acid sequence that shows the ability to bind caprolactam as having one to several nucleotides added, deleted or substituted to have a common sequence.

In an embodiment of the present invention, the riboswitch may further include a linker and a selectable marker gene.

In an embodiment of the present invention, the riboswitch is preferably arranged in the form of Structural Formula 1, but is not limited thereto.

[Structural Formula 1]

Caprolactam aptamer-linker-selection marker gene

In the present invention, "selective marker gene" means a gene used to select a cell that has cloned a desired gene in a gene recombination experiment or the like. As a selection marker gene, a mutant gene having a distinct phenotype (genotype) can be used, and preferably, a mutant gene that has become resistant to antibiotics can be used.

In an embodiment of the present invention, the selection marker gene may be an antibiotic resistance gene or a fluorescent protein, or a combination thereof, but is not limited thereto. Examples of the antibiotic resistance gene include chloramphenicol acetyltransferase, neomycin phosphotransferase II, aminoglycoside adenyltransferase, beta-lactamase, and tetA , and examples of the fluorescent protein include green fluorescent protein, CFP (cyan fluorescent protein), blue fluorescent protein (BFP), yellow fluorescent protein (YFP) and red fluorescent protein (RFP).

In the present invention, "linker" is a sequence for maintaining a gap between genes or proteins, and it is possible to control reactivity with a target material, etc., by adjusting the length of a linker.

In the embodiment of the present invention, the linker is preferably 8 to 12 bases consisting of a random sequence, more preferably 10 bases consisting of a random sequence, more preferably represented by the nucleotide sequence of SEQ ID NO: 2 10 bases, but is not limited thereto.

In an embodiment of the present invention, the riboswitch may be a riboswitch characterized by consisting of the nucleotide sequence of SEQ ID NO: 4.

According to another aspect of the present invention, constructing a mutant strain library introduced with a riboswitch comprising a caprolactam aptamer, a linker and a selectable marker gene; Culturing the mutant strain library, respectively; And selecting a mutant strain having a high survival rate from the cultured mutant strain library as a caprolactam high-producing strain mutant strain.

The riboswitch used in the screening method may include an aptamer represented by the nucleotide sequence of SEQ ID NO: 1, and may be a riboswitch represented by the nucleotide sequence of SEQ ID NO: 4, but is not limited thereto.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example 1. Selex for caprolactam aptamer diversification collection

1.1 Preparation of caprolactam binding matrix

Aminocaprolactam was immobilized on ECH Sepharose 4B according to the manufacturer's instructions. At this time, the amino caprolactam had a primary amine group added to caprolactam, and thus it was possible to fix the matrix. This fixed reaction requires a low pH. For the coupling reaction, the matrix and aminocaprolactam are added to distilled water at pH 4.5, and EDC (N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide hydrochloride) is finalized. It was added to a concentration of 0.1 M. Then, the mixture solution was incubated for 16 hours at room temperature while gently shaking. After the reaction, put in 20% ethanol and store in refrigeration.

1.2 Selection of caprolactam RNA aptamers

In order to make it possible for aptamers having various sequences to be included, a large amount of PCR and in vitro transcription were performed based on the Selex template strand having specific primer binding sites at both ends. Specifically, a DNA template was prepared with SELEX_F and SELEX_R primers for PCR amplification using Phusion DNA polymerase (New England Biolabs, Ipswich, MA) and 1.5 nmol of SELEX_Template oligonucleotide. For the amplified DNA pool, T7 RNA polymerase (New England Biolabs) was used. RNA was treated with DNase I (Takara Bio Inc., Nojihigashi, Japan) and then purified by polyacrylamide gel electrophoresis. 3 nmol of the RNA pool was dissolved in 1 mL selective buffer (50 mM Tris-HCl and 100 mM KCl, pH 7.4), then denatured by heat at 95°C for 10 minutes, refolded, and then cooled to room temperature for 20 minutes. MgCl ₂ was added to the RNA solution to a final concentration of 10 mM, and the solution was stabilized at room temperature for 15 minutes. The RNA pool was mixed with 1 mL of caprolactam-coupled matrix on a polypropylene column (Qiagen, Hilden, Germany) and incubated overnight at room temperature with rotation. For negative selection, a matrix without caprolactam was used in round 4. The RNA-matrix mixture is filtered through an in-column filter of a polypropylene column, and the remaining columns are washed with 10 column volumes of wash buffer (50 mM Tris-HCl, 100 mM KCl, 10 mM MgCl ₂ , pH 7.4). Did. The matrix was then mixed with 2 mL of elution buffer (25 mM Tris-HCl, 300 mM NaCl, 5 mM EDTA, 4 M urea, pH 7.4) and heated to 95° C. to elute RNA. The flow-through from the elution step was precipitated using ethanol, and the RNA concentration was measured at 260 nm using a UV-1700 spectrophotometer (Shimadzu, Kyoto, Japan). The eluted RNA was reverse transcribed using SuperScript III and SELEX_R. cDNA was amplified by PCR using SELEX_RT_T7 and SELEX_R as primers. The amplified DNA was used as a template for RNA preparation in the next round for aptamer selection. The fraction washed in the fourth round was used instead of the eluted fraction in round 5. The base sequences of the primers used in this Example are shown in Table 1, and the overall process of this experiment is schematically shown in FIG. 1, and the results of this experiment are shown in FIG.

name Sequence (5'-3') SELEX_Template (SEQ ID NO: 5) tcagctggacgtcttcgaat(N)60tgtcaggagctcgaattccctatagtgagtcgtatta SELEX_F (SEQ ID NO: 6) taatacgactcactataggga SELEX_R (SEQ ID NO: 7) tcagctggacgtcttcgaat SELEX_RT_T7 (SEQ ID NO: 8) taatacgactcactatagggaattcgagctcctgaca

As shown in Fig. 2, 3.34% of the RNA aptamer pool finally recovered in the tenth time reacted with caprolactam.

Example 2. Caprolactam riboswitch library construction

The riboswitch plasmid library was constructed by cloning the RNA pool obtained from Example 1 into the backbone plasmid pRibo_NC. The vector plasmid (pRibo_NC) is phosphorylated at the 5'terminal and contains the BsaI restriction enzyme site CapApt_N10_R(5'-gtcactggtctcgcctt(N)10tcagctggacgtcttcgaat-3', SEQ ID NO: 9) and CapApt_F(5'-ggtcactggtctcgagcgggaattcgagctctgaga Produced by PCR amplification using the primer set of 10). PCR products were ligated using the Quick Ligation kit (New England Biolabs, Ipswich, MA) and transformed into E. coli Mach1-T1R cells. The RNA pool obtained from Example 1 was reverse transcribed after 10 rounds, and the reverse transcribed sequence was amplified using NCapApt_N10_R and CapApt_F primers. The amplified RNA pool was digested using the BsaI restriction enzyme region. It was connected to the backbone plasmid using the Quick Ligation kit. The resulting riboswitch library was transformed into E. coli DH10B recipient cells and then recovered, and the recovered library was transformed into E. coli W3110 recipient cells.

Example 3. Preparation and selection of caprolactam riboswitch library

3.1 Preparation of caprolactam riboswitch library

The riboswitch library constructed in Example 2 was prepared using the characteristics of the tetracycline resistance gene ( tetA ).

Caprolactam riboswitch was prepared by the upstream aptamer pool of tetA-sgfp containing two selective marker genes in the backbone plasmid, which is shown in FIG. 3.

3.2 Caprolactam riboswitch library Optimal group selection

The optimal library selection process was performed in mediums with low, medium, and high caprolactam concentrations, respectively. In the'Low'and'Mid' medium, negative selection was performed. In the'High' medium, a positive selection was performed. At this time, according to the characteristics of the lower gene tetA gene, the library was screened using nickel chloride as a negative selection and tetracycline as a positive selection.

In order to confirm the activity of the caprolactam-dependent gene, an experiment was performed using the reporter gene tetA-sgfp . For selection of each group of libraries, all riboswitch libraries were transformed with E. coli W3110 cells. The transformed E. coli W3110 cells were cultured by calculating the OD ₆₀₀ value to be 0.2 in the M9 minimal medium containing 34 μg/ml chloramphenicol. When the OD ₆₀₀ value of the culture medium became 1, the transformed E. coli W3110 cells were inoculated to a final OD ₆₀₀ value of 0.2. At this time, the medium used was hereinafter referred to as CM9. All cultures were performed at 37°C and 200 rpm. When the OD ₆₀₀ value of the inoculated culture medium was 1, the culture medium was inoculated in CM9 medium containing 10 μM NiCl ₂ so that the final OD ₆₀₀ value was 0.01, and cultured until the OD ₆₀₀ value was 0.5. This is a screening of a library of negative selection that is performed for the first time in a medium without caprolactam, and after culturing the culture, the culture medium is washed and then transferred to a new M9 minimal medium containing 10 mg/L caprolactam so that the final OD ₆₀₀ value is 0.05. Cultured. This is to adapt the medium with caprolactam at a concentration of 10 mg/L. When the final OD ₆₀₀ value of the culture medium was 0.5, the transformed E. coli W3110 cells were transferred to the mixed medium so that the final OD ₆₀₀ value was 0.01. The mixed medium is obtained by adding CM9 medium (containing 10 μM NiCl ₂ ) to a new CM9 minimal medium containing 10 mg/L caprolactam. The inoculated transformed E. coli W3110 cells were negatively selected, and the library was selected.

In the same manner as above, this time, the culture medium was washed and then transferred to a new CM9 minimal medium containing 100 mg/L caprolactam so that the final OD ₆₀₀ value was 0.05. When the final OD ₆₀₀ value of the culture medium was 0.5, the transformed E. coli W3110 cells were transferred to the mixed medium so that the final OD ₆₀₀ value was 0.01. The mixed medium is obtained by adding CM9 medium (containing 10 μM NiCl ₂ ) to a new CM9 minimal medium containing caprolactam at 100 mg/L. Libraries were selected by negative selection of inoculated cells.

Finally, after washing the culture medium, the caprolactam was transferred to a new CM9 minimal medium containing 1000 mg/L to move the final OD ₆₀₀ to 0.05. When the final OD ₆₀₀ value of the culture medium is 0.5, 50 μg/ml tetracycline is additionally added to a new CM9 minimal medium containing 1000 mg/L caprolactam, and then transferred to a final OD ₆₀₀ value of 0.01. The library was selected through a selection process.

After the completion of all screening procedures, it was diluted and plated in LB solid medium containing 34 μg/ml chloramphenicol. Each plated solid medium was incubated overnight at 37° C. and cultured in CM9 medium formed of individual colonies and containing caprolactam at a concentration of 10 mM, or CM9 medium that was not present at all. After the culture, the fluorescence was measured after washing the culture medium, and the same amount of OD ₆₀₀ was measured and divided to normalize the actual fluorescence value.

The OD ₆₀₀ value of each E. coli cells during all screening procedures was measured using a UV-1700 spectrophotometer, and the culture of each individual colony was performed using BioscreenC MBR. The fluorescence intensity was measured using a VICTOR3 1420 Multilabel Counter, and the fluorescence measurement was measured for 1 second with a 486 nm excitation filter and a 535 nm emission filter. The results are shown in FIG. 4. In addition, a schematic diagram of the selected E. coli colony caprolactam riboswitch library is shown in FIG. 3.

As shown in FIG. 4, colonies 7 having the highest fold activity value among the colonies of the E. coli strain were selected. The selected colony No. 7 includes a caprolactam aptamer represented by the nucleotide sequence of SEQ ID NO: 1, a linker represented by the nucleotide sequence of SEQ ID NO: 2 and a selectable marker gene represented by the nucleotide sequence of SEQ ID NO: 3. The entire sequence of riboswitches is arranged in the order of'caprolactam aptamer-linker-selective marker gene' and is represented by the nucleotide sequence of SEQ ID NO:4. The selection marker gene contains 30 nt of the 5'-UTR and tetA genes.

Example 4. Validation of selected caprolactam riboswitches

4.1 Confirmation of reactivity with precursor 6-aminocaproic acid

The reactivity of caprolactam riboswitch to 6-aminocaproic acid, known as a precursor in the caprolactam producing strain, was confirmed. Specifically, the experiment was conducted in CM9 medium, and E. coli containing caprolactam riboswitch was cultured in a medium to which 6-aminocaproic acid was added or caprolactam was added. First, E. coli containing caprolactam riboswitch is cultured in CM9 medium for 24 hours, diluted in a ratio of 1/100 in CM9 medium, re-inoculated, cultured for 8 hours, and the initial OD ₆₀₀ value in CM9 medium It was inoculated to be 0.05. Subsequently, 6-aminocaproic acid or caprolactam was added to the medium and cultured for 8 hours, followed by measuring the OD ₆₀₀ value and fluorescence of the culture medium to measure the expression level of the subgene, and the results are shown in FIG. 5.

As shown in FIG. 5, it was confirmed that E. coli containing caprolactam-specific riboswitch in the medium to which caprolactam was added has increased gene expression. In contrast, gene expression was not increased in the medium treated with 6-aminocaproic acid.

4.2 Confirmation of the expression level of the lower gene of riboswitch and reactivity with other lactams

OD ₆₀₀ values and fluorescence were measured in CM9 medium containing various concentrations of caprolactam in order to confirm the expression level of the lower gene of the caprolactam riboswitch. At this time, the dose response curve according to the caprolactam concentration outside the living body is shown in Fig. 6, and the dose response curve according to the caprolactam concentration inside the living body is shown in Fig. 7.

Reactivity between selected riboswitches and substances having different carbon numbers was confirmed, such as butyrolactam and valerolactam. The experiment was conducted in CM9 medium, and the experimental group included caprolactam riboswitch in a medium to which butyrolactam and valerolactam were added and caprolactam were added, respectively, which had a difference in carbon number. E. coli was being cultured.

First, E. coli containing caprolactam riboswitch was cultured in CM9 medium for 24 hours, diluted in a ratio of 1/100 in CM9 medium, re-inoculated, and cultured for 8 hours. Then, the E. coli was inoculated in CM9 medium so that the initial OD ₆₀₀ value was 0.05. Subsequently, butyrolactam, valerolactam, and caprolactam were added to the medium and cultured for 8 hours, followed by measuring the OD ₆₀₀ value and fluorescence of the culture medium to measure the expression level of the subgene. At this time, each expression level was measured for various lactam concentrations in the living body, and the results are shown in FIG. 8.

As shown in FIG. 8, first, it was confirmed that the difference in the concentration of various lactams in the living body was not large, and thus there was no significant difference in the cell's acceptance of various lactams. Could. The above results indicate that the riboswitch prepared in Example 3 expresses the gene at least 2 times more strongly when caprolactam is present than when other lactams are present.

Additionally, when producing the actual caprolactam producing strain, the specificity of valerolactam, which can be produced simultaneously, was confirmed. As before, E. coli containing caprolactam riboswitch was cultured in CM9 medium for 24 hours, diluted in a ratio of 1/100 in CM9 medium, re-inoculated, and cultured for 8 hours. Then, the E. coli was inoculated in CM9 medium so that the initial OD ₆₀₀ value was 0.05. Subsequently, caprolactam and valerolactam were cultured for 8 hours in the medium added at the ratios of (0:100), (25:75), (50:50), (75:25), and (100:0), respectively. Then, the OD ₆₀₀ value and fluorescence of the culture were measured to measure the expression level of the subgene. The results are shown in FIG. 9.

As shown in FIG. 9, it was confirmed that the expression level of the subgene increased linearly as the ratio of caprolactam increased. Therefore, it was confirmed that the gene expression level in the caprolactam production strain can reflect the caprolactam production amount.

Example 5. Confirmation of the possibility of cell growth regulation of caprolactam riboswitch

Caprolactam-specific riboswitches are regulated by caprolactam, and since the sub gene contains the tetA gene, it was confirmed that it can actually be used as an artificial evolution tool. Specifically, Escherichia coli containing caprolactam riboswitch was cultured in CM9 medium to which different concentrations of tetracycline were added to media to which different concentrations of caprolactam were added. E. coli containing caprolactam riboswitch was cultured in CM9 medium for 24 hours, diluted in a ratio of 1/100 in CM9 medium, re-inoculated, cultured for 8 hours, and the initial OD ₆₀₀ value in CM9 medium was 0.05. It was inoculated to be. Then, various concentrations of caprolactam and tetracycline were added to the medium and cultured for 8 hours. The OD ₆₀₀ value of the culture medium was measured during the culture to calculate the growth rate of the strain under each condition, and the results are shown in FIG. 10.

As shown in FIG. 10, it was confirmed that the growth rate of cells decreased slightly as the amount of caprolactam increased due to the toxicity of caprolactam itself in the medium without tetracycline. However, in the medium with tetracycline added, the growth rate was high when a high concentration of caprolactam was added. In particular, the concentration of caprolactam selected was adjusted according to the change in tetracycline concentration. When tetracycline was present at 80 μg/ml, the cells did not grow only in the medium without caprolactam, whereas when tetracycline was added at a higher concentration (150, 300 μg/ml), the minimum caprolactam concentration for growth gradually increased. . As a result, when the riboswitch prepared in Example 3 is used as an evolutionary tool in various caprolactam-producing strain libraries, the concentration of tetracycline can be simply changed to adjust the selected concentration.

Overall, the present inventors prepared caprolactam riboswitches, and confirmed that the riboswitches can recognize caprolactam specifically and sensitively. This means that the caprolactam high-producing bacteria can be screened using the ribo switch.

As described above, since a specific part of the present invention has been described in detail, it is obvious to those skilled in the art that this specific technique is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Therefore, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> POSTECH ACADEMY INDUSTRY FOUNDATION <120> Method for screening microorganism with high caprolactam productivity using riboswitch <130> Postech1.69P-1 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> caprolactam aptamer <400> 1 gggaattcga gctcctgaca gcacaatttg cctacagcgt taagacacga aaaagcacaa 60 ttagacactt acatgtgtgg attcgaagac gtccagctga 100 <210> 2 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> linker <400> 2 actagccgga 10 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Selectable marker gene <400> 3 aaggagcatc tatgaaatct aacaatgcgc tcatcgtcat c 41 <210> 4 <211> 151 <212> DNA <213> Artificial Sequence <220> <223> riboswitch <400> 4 gggaattcga gctcctgaca gcacaatttg cctacagcgt taagacacga aaaagcacaa 60 ttagacactt acatgtgtgg attcgaagac gtccagctga actagccgga aaggagcatc 120 tatgaaatct aacaatgcgc tcatcgtcat c 151 <210> 5 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> SELEX_Template <400> 5 tcagctggac gtcttcgaat ntgtcaggag ctcgaattcc ctatagtgag tcgtatta 58 <210> 6 <211> 37 <212> RNA <213> Artificial Sequence <220> <223> SELEX_F <400> 6 taatacgact cactataggg aattcgagct cctgaca 37 <210> 7 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> SELEX_R <400> 7 tcagctggac gtcttcgaat 20 <210> 8 <211> 37 <212> RNA <213> Artificial Sequence <220> <223> SELEX_RT_T7 <400> 8 taatacgact cactataggg aattcgagct cctgaca 37 <210> 9 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> CapApt_N10_R <400> 9 gtcactggtc tcgccttntc agctggacgt cttcgaat 38 <210> 10 <211> 37 <212> RNA <213> Artificial Sequence <220> <223> CapApt_F <400> 10 ggtcactggt ctcgagcggg aattcgagct cctgaca 37

Claims (8)

Riboswitch for screening of caprolactam high-producing bacteria, including caprolactam aptamers, linkers and selectable marker genes.
According to claim 1,
The caprolactam aptamer is represented by the nucleotide sequence of SEQ ID NO: 1, a riboswitch for caprolactam high-producing bacteria screening.
According to claim 1,
The selection marker gene is a tetA gene, a riboswitch for screening for caprolactam high-producing bacteria.
According to claim 1,
The riboswitch is to be arranged in the form of Structural Formula 1, riboswitch for screening caprolactam high-producing bacteria.
[Structural Formula 1]
Caprolactam aptamer-linker-selection marker gene
According to claim 1,
The riboswitch is represented by the nucleotide sequence of SEQ ID NO: 4, riboswitch for screening for high-producing caprolactam.
(a) constructing a mutant library introduced with a riboswitch containing a caprolactam aptamer, a linker and a selectable marker gene;
(b) culturing the mutant strain library, respectively; And
(c) selecting a high-survivability mutant strain from the cultured mutant strain library as a caprolactam high-producing strain mutant strain.
The method of claim 6,
The caprolactam aptamer is represented by SEQ ID NO: 1, caprolactam high-producing bacteria screening method.
The method of claim 6,
The riboswitch is represented by the nucleotide sequence of SEQ ID NO: 4, a method for screening for high-producing caprolactam.

Images