KR20200088061A - Chimeric and humanized - Google Patents

Abstract

Provided are a chimeric and humanized antibody that specifically recognizes an α5β1 integrin, and a method of using the antibody to reduce or inhibit angiogenesis in tissues. Also provided is a method of determining a therapeutically acceptable dosage of a pharmaceutical composition comprising an antibody and the same.

Description

Chimeric and humanized antibodies against integrins that regulate angiogenesis {Chimeric and humanized}

The present invention provides chimeric and humanized antibodies specifically recognizing α5β1 integrins, and methods of using the antibodies to reduce or inhibit angiogenesis in tissues. Also provided are methods of determining a therapeutically acceptable dose of the antibody, and pharmaceutical compositions comprising the same.

Angiogenesis is the process by which new blood vessels are formed. Angiogenesis, also called neovascularization, usually occurs during embryogenesis and development, and is fully developed during wound healing and placental development.

It happens in organisms. In addition, angiogenesis includes ocular diseases such as diabetic retinopathy and macular degeneration due to angiogenesis; Tissue inflammation related conditions such as rheumatoid arthritis and inflammatory bowel disease; And grow

Angiogenesis in tumors occurs in a variety of pathological conditions, including cancer, which provides tumor cells with a pathway for tumor cells to metastasize to every corner of the body, as well as oxygen and nutrients to tumor cells. Millions of people around the world suffer from these diseases,

Considerable effort has been made to understand the mechanisms involved in angiogenesis in order to develop methods for detecting and inhibiting these undesirable angiogenesis.

Angiogenesis occurs in response to stimulation by one or more known growth factors, and may also relate to others as factors not yet specified. Endothelial cells, cells that line mature blood vessels, do not usually proliferate. However, the right one

In response to the pole, endothelial cells become activated and begin to multiply and migrate to unvascularized tissue to form new blood vessels. In some cases, progenitor cells are activated and differentiate into endothelial cells forming new blood vessels.

Blood vessels are surrounded by extracellular matrix. In addition to stimulation by growth factors, angiogenesis depends not only on endothelial cell interactions, but also on their interaction with the extracellular matrix. Activation of endothelial cells by growth factors, migration to extracellular matrix, and extracellular phase

The interaction between the vaginal and endothelial cells depends on the cell surface receptors expressed by the endothelial cells. These cell surface receptors, including growth factor receptors and integrins, specifically interact with specific molecules.

In pathological conditions such as age-related macular degeneration and diabetic retinopathy, a decrease in oxygen availability to the retina causes hypoxic conditions that stimulate the secretion of angiogenic growth factors such as vascular endothelial growth factor (VEGF). This secretion induces abnormal migration and proliferation of endothelial cells into the eye tissue. This leads to angiogenesis of ocular tissues, each of which can lead to corneal scarring, retinal detachment and accumulation of fluid in the choroid, which can adversely affect vision and lead to blindness.

Angiogenesis is also associated with the progression and exacerbation of inflammatory diseases, including psoriasis, rheumatoid arthritis, osteoarthritis, and inflammatory growth diseases such as ulcerative colitis and Crohn's disease. In inflammatory arthritis disease, for example, surrounding the joint

Lymphocyte entry into the site stimulates angiogenesis in the synovial lining. This increased vascular structure provides a means for greater influx of white blood cells that promote the destruction of cartilage and bone in the joint. Angiogenesis in inflammatory bowel disease is intestinal

Has a similar effect.

The growth of capillaries into atherosclerotic plaques in the heart arteries presents another pathological condition associated with growth factor-induced angiogenesis. Blood-filled plate rupture and bleeding may occur due to excessive blood flow to the angiogenic plate and clot

Release of (blood clot) can lead to myocardial infarction.

The involvement of angiogenesis in a variety of diseases such as cancer, ocular disease and inflammatory diseases has led to efforts to elucidate methods to specifically inhibit angiogenesis as a means of treating these diseases. In cancer patients, target tumor cells as well as

For methods such as currently used chemotherapy that damage or kill cells that normally proliferate in cells, such as blood cells, epithelial cells, and intestinal lumen, the treatment method may provide substantial benefits. have. The non-specific killing by chemotherapeutic agents has good side effects, and can often lead to unacceptable patient incidence or mortality. In fact, undesirable side effects associated with cancer treatment often limit the treatment a patient can receive.

The present invention provides chimeric and humanized anti-α5β1 integrin antibodies with improved properties over existing anti-α5β1 integrin antibodies. The present invention also provides pharmaceutical compositions comprising novel antibodies, and disease states for tissues aggravated by angiogenesis.

I provide an improved way to treat damage.

The chimeric and humanized antibodies of the invention have a longer half-life than conventional forms and are less antigenic when administered to humans.

The improvement is depicted schematically in FIG. 2 and involves humanizing it by altering the framework and constant regions of the murine anti-α5β1 integrin (IIA1) antibody.

Humanized antibodies are commonly used in human therapy and have three or more potential advantages. First, it interacts better with the human immune system, such as by complement-dependent cytotoxicity (CDC) or antibody-dependent cellular cytotoxicity (ADCC).

Destroy enemy cells more efficiently. Second, the human immune system should not recognize the antibody as foreign. Third, the half-life in the human circulatory system will be similar to that of naturally occurring antibodies even when fewer, less frequent medications are administered.

Structurally, humanized antibodies typically have constant and skeletal (FR) origins of human origin, and complementary domain regions (CDRs) derived from the antibodies of animals that produce anti-α5β1 integrin antibodies.

Structurally, chimeric antibodies have variable-chain regions derived from the antigens of animals that produce anti-α5β1 integrin antibodies, and human-derived constant chains.

Functionally, both chimeric and humanized anti-α5β1 integrins antibodies specifically recognize α5β1 integrins and prevent α5β1 integrins from interacting with their receptors.

Various methods for making humanized and chimeric anti-α5β1 integrin antibodies are provided herein. “Humanized” antibodies are typically from mouse, rat, hamster, rabbit, or other species, having human constant and/or variable region domains or specific variations.

It is a chimeric or mutant monoclonal antibody. Techniques for generating “humanized” and “chimeric” anti-α5β1 integrin antibodies are well known to those skilled in the art and can be found in references and patents cited herein.

Preparation of recombinant chimeric and humanized anti-α5β1 integrin antibodies, and Fab fragments derived therefrom. The antibodies of the present invention were prepared to immunize animals with α5β1 integrin or to induce anti-α5β1 antibody production with peptides derived therefrom. . The lymphatic tissue expressing the antibody was isolated and nucleic acids encoding the heavy and light chains of the anti-α5β1 integrin antibody were purified. Next, the purified nucleic acid was recombinantly engineered (according to a method well known in the prior art) to prepare specific chimeric, humanized, short chain, Fab or Fab2 antibodies capable of recognizing α5β1 integrins.

The recombinant engineered nucleic acid was used to make anti-α5β1 integrin antibody producing cells. The cells produce monoclonal antibodies that inhibit or prevent α5β1 integrins from binding to their receptors, resulting in inhibition of angiogenesis in sensitive tissues.

Did.

A production cell and nucleic acid encoding, preparation of anti-α5β1 integrin antibody

To produce recombinant chimeric and humanized anti-α5β1 integrin antibodies, the nucleic acid encoding non-human anti-α5β1 integrin antibody must first be isolated. These are typically derived from α5β1 integrins produced in animals, eg mice, or from them

It is carried out by immunizing the animal with peptides of the antigens obtained.

Typically, mice are immunized by injecting twice intraperitoneally with about 50 μg of protein antibody per animal. Serum of immunized mice is expressed by immunohistochemistry or immunocytology and expressed polypeptide on any host system expressing the polypeptide.

Can be tested for antibody activity. By immunohistochemistry, the active antibodies of the present invention can be identified using avidin-peroxidase and chromogenic peroxidase materials followed by biotin conjugated anti-mouse immunoglobulin.

The preparation of such reagents is sold, for example, by Zymed Corp San Francisco, Calif. Mice with serum containing a identifiable active antibody according to the present invention can be killed after 3 days and their spleens are removed for fusion and hybridoma production.

All. The positive supernatant of the hybridoma can be confirmed using a general analysis method used in the prior art, for example, Western blot analysis.

Thereafter, the nucleic acid encoding the required antibody chain can be isolated, for example, by using hybridoma mRNA or spleen mRNA as a template for PCR amplification of heavy and light chain genes [Huse, et al., Science 246:1276. (1989)]

Nucleic acids for the production of both antibodies and intracellular antibodies can be derived from murine monoclonal hybridomas using this technique [Richardson J H, et al., Proc Natl Acad Sol USA 92:3137-3141 (1995); Biocca S, et al., Biochem and Biophys

Res Comm, 197:422-427 (1993) Mhashilkar, AM, et al., EMBO J 14:1542-1551 (1995)] The hybridoma provides a reliable source of well-characterized reagents for antibody construction and its Characterized by the reactivity and affinity of the epitope

Especially useful after. Isolation of nucleic acids from isolated cells is further described [Clackson, T, et al., Nature 352:624-628 (1991) (spleen) and Portolano, S, et al., supra; Barbas, C F, et al., supra; Marks, J D, et al., supra; Barbas, C F, et al., Proc Natl Acad Sci

USA 88:7978-7982 (1991) (human peripheral vascular lymphocytes).

Preparation of B Recombinant Antibody Humanized forms of non-human (eg, murine) are immunoglobulins and their fragments that contain minimal sequences derived from immunoglobulin chains or non-human deferred globulin (eg, Fv, Fab, Fab' , F(ab')2, or other antigen-binding subsequences of an antibody A humanized antibody is a residue that forms the complementarity determining region (CDR) of a recipient with desirable specificity, affinity and capacity. Non-human species (donor antibodies) such as human immunoglobulins (receptor antibodies), which are replaced by residues from the CDRs of a mouse, rat, or rabbit, some examples of which are non-human corresponding to the Fv framework residues of human immunoglobulins. Residues are replaced with humanized antibodies, which also have residues that are not found in the transplanter and in the inserted CDR or framework sequence.

Can be included. Generally, the humanized antibody will comprise substantially at least one, typically two, all of the variable domains, wherein all or substantially all CDR regions correspond to non-human immunoglobulins, and all or substantially all FRs.

The site is a sequence that matches that of the immunoglobulin. In addition, it will be optimal for the humanized antibody to contain at least a portion of an immunoglobulin constant region (Fc), typically a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechnann et al.,

Nature, 332:323-329 (1988); And Presta, Curr Op Struct Biol., 2:593-596 (1992)] Methods for generating humanized antibodies are well known and fully described in the prior art (eg, Queen et al., US Patent No: 5,530,101; 5,585,089; 5,693,761; 5,693,762; 6,180, 370 (each of which is incorporated by reference in its entirety)

Antibodies can be humanized using a variety of techniques known in the prior art, including: CDR-grafting (EP239,400; PCT application WO 91/09967; US Patent No. 5,225,539; 5,530, 101 and 5,585,089 ), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Mol Immunol., 28:489-498 (1991); Studnicka et al., Prot Eng 7805-814 (1994); Roguska et al. , Proc Natl Acad Sci. 91:969-973 (1994), and chain shuffling (US Pat. No. 5,565,332), all of which are incorporated by reference in their entirety.

Numerous methods have been described for the production of recombinant chimeric antibodies. Controlled rearrangement of antibody domains linked via protein disulfide bonds can be used to form chimeric antibodies (Konieczny et al., Haematologia, 14(1):95-99, 1981) recombination

DNA technology can also be used to construct gene fusions between the light and heavy chain variable regions of mouse antibodies and the DNA sequences encoding the constant domains of light and heavy chains of human antibodies (Morrison et al., Proc Natl Acad Sci USA, 81(21) ): 6851-6855,

1984; Morrison, Science 229:1202-1207 (1985); Oi et al., BioTechniques 4:214-221 (1986); Gillies et al., J Immunol. Methods 125: 191-202 (1989); US Patent 5,807,715; 4,816,567; And 4,816,397, incorporated herein by reference in its entirety)

The DNA sequence encoding the antigen-binding portion or complementarity determining region of the murine monoclonal antibody can be transplanted by molecular methods into DNA sequences encoding the skeletons of the heavy and light chains of human antibodies (Jones et al., Nature, 321 ( 6069):522-525, 1986;

Riechmann et al., Nature, 332(6162):323-327, 1988) said expressed recombinant products are called "new forms" or humanized antibodies, and the antigen recognition sites of the light or heavy chain of human antibodies and monoclonal antibodies of murine , CDR framework.

Another method for producing humanized antibodies is described in US Pat. No. 5,639,641, incorporated by reference. The method provides humanized rodent antibodies with improved therapeutic efficacy because they are displayed on the human surface at various sites through regeneration. Stay on the way

Uh: (1) The arrangement of the positions of the variable regions of a heavy and light chain in a pool is created to provide a framework for the heavy and light chain variable region backbones exposed by a set of locations, where the arrangement positions for all variable regions Is at least about 98% identical; (2) A set of amino acids

The variable region framework surface of the heavy and light chains to which the residue has been exposed was defined as a rodent antibody (or its framework); (3) The variable region framework surface of the heavy and light chains exposed with one set of amino acid residues is almost the same as that of rodents on the surface exposed with one set of amino residues.

Confirmed; (4) a set of heavy and light chain variable region backbone surfaces exposed with a set of amino acid residues defined in step (2) except for amino acids within 5 원자 atoms at any residue of the complementarity determining site of the rodent antibody As defined in (3)

The set of amino acid residues is replaced by exposed heavy and light chain variable region backbone surfaces; And (5) said humanized rodent antibody with binding specificity.

Methods of making similar humanized antibodies are described in US Pat. No. 5,693,762, each of which is incorporated herein by reference; 5,693,761; 5,585,089; And 5,530, 101. The methods include one or more complementarity determining sites (CDR's), and donor immunoglobulins and acceptors

It involves making a humanized immunoglobulin having amino acids that can be added to the skeleton region of the human immunoglobulin. Each humanized immunoglobulin chain is usually a donor immunoglobulin backbone to which the CDR's are added and capable of interacting with the CDR's.

Of amino acids, for example, as predicted by molecular modeling, is effective for binding affinity, including one or more amino acids that are immediately adjacent to or within 3 km of the CDRs in the donor immunoglobulin. The light and heavy chains are described in U.S. Patent 5,693,762; 5,693, 761;

5,585,089 and 5,530,101 can be devised by randomly mixing any of the various location criteria, or by using all of them. When mixed with intact antibodies, the humanized immunoglobulin is substantially non-antibody in the human body and is native to the antigen.

Against the donor immunoglobulin, it retains substantially the same affinity.

Additional methods for making humanized antibodies are described in U.S. Patent Nos. 5,565,332 and 5,733,743, incorporated by reference. The method was combined with the concept of humanized antibodies with the phagemid library detailed herein. As a general rule, the above method

The sequence of the antigen-binding site of the antibody and the number of antibodies directly corresponding to the important antigen were used. Thus, for a single rodent antibody, a sequence comprising a portion of the antigen binding site of the antibody can be generated by combining a complete antigen binding site.

Can bind to various repertoires of antibody sequences

The antigen binding site produced by this method is different from that generated by CDR grafting, where only a portion of the sequence of the original rodent antigen will be contacted with the antigen in a similar way.

The selected human sequence will be different in sequence and can contact the antigen in a different way at that of the original binding site. However, binding to a portion of the sequence by sending it to the antigen, and the constraints imposed by the shape of the antigen and its antigen-binding site, are identical sites

It will establish a new contact of the human sequence to the original epitope. Thus, the method is called "epitope imprinted selection" (EIS).

Starting with animal antibodies, one process results in the selection of antibodies that are partial human antibodies. The antibody can be sufficiently similar to the sequence of a human antibody used after direct treatment or alteration of several important residues. Construction of rodents of antibodies selected as human sequences

Sequence differences between components can be minimized by replacing human sequence residues with their other residues, for example, by site directed mutagenesis of individual residues, or by CDR grafting of a complete loop. However, the complete human sequence

Antibodies can also be produced. Thus, EIS provides a method for producing partially or fully human antibodies that bind to the same epitope as animal or partially human antibodies individually. In EIS, the repertoire of antibody fragments is attached to the surface and antigen of the threaded phage.

By binding phage, it can be expressed on a gene encoding a fragment having a selected antigen-binding activity.

Methods of additional human antibodies designed for use in the present invention are described in U.S. Patents 5,750,078, each incorporated herein by reference; 5,502,167, 5,705,154; 5,770,403; 5,698,417; 5,693,493; 5,558,864; 4,935, 496; And

4,816,567.

The techniques described for the preparation of single chain antibodies (US Pat. No. 4,946,778) can be applied to prepare single chain humanized antibodies of α5β1 integrins.

Additional embodiments of the invention include pharmaceutical compositions comprising therapeutic antibodies described herein. These compositions enhance the absorption or localization of the therapeutic component, reduce inflammation, or vice versa, providing local relief.

Agonists.

Antibodies of the invention useful for reducing or inhibiting angiogenesis associated with α5β1 integrin expression or pharmaceutical compositions containing such antibodies can be used to treat any pathological condition characterized by at least partially angiogenesis.

Such agents are, for example, oral or intravenous, intramuscular, subcutaneous, intraorbital, intracapsular, intrasynovial, intraperitoneal, intracisternal or intracisternal. , Including parenteral, including passive or active absorption through the skin using, for example, a skin patch or transderma1 iontophoresis

It will be apparent to those skilled in the art that it can be administered by various routes. Moreover, the antibody can be administered orally or topically by injection, intubation via suppository, where intubation is, for example, an ointment containing the antibody.

It can be passive, by direct application of an ointment or powder, or can be active, for example with nasal sprays or inhalants. The antibody can also be administered as a topical spray, if desired, in which case one component of the composition is a suitable propellant. The pharmaceutical composition can also be incorporated into liposomes, microspheres or other polymer matrices, if desired (Gregoriadis, Liposome Technology, Vol 1 (CRC Press, Boca Raton, Fla 1984), which is incorporated herein by reference). Liposomes, such as those composed of phospholipids or other lipids, are non-toxic, physiologically acceptable metabolic carriers that are relatively easy to manufacture and administer.

Angiogenesis associated with α5β1 integrin expression occurs locally, for example in the retina of an individual with diabetic retinopathy, or has, for example, rheumatoid arthritis or metastatic malignant tumor Personally

So, it can happen more systemically. Because the angiogenic site may be localized or more systemically scattered, one skilled in the art will, in part, select a specific route of administration and method of administration of the therapeutic antibody of the invention based on this factor.

to be.

For example, in individuals with diabetic retinopathy, where angiogenesis associated with α5β1 integrin expression is locally present in the retina, the agent can be formulated into a pharmaceutical composition convenient for use as an eye drop that can be administered directly to the eye. have. Compare this

Thus, in an individual with metastatic carcinoma, the agent may be formulated into a pharmaceutical composition that can be administered intravenously, orally, or in another way to distribute the agent systemically. Accordingly, the antibodies of the present invention can be, for example, by various routes.

Uh, it can be administered intravenously, orally or directly to the site to be treated, for example directly into neoplastic tumors; If the pathological condition includes the eye, through eye drops; Or, if the condition includes a joint, it may be administered intrasternally.

The therapeutic antibody is administered in an effective amount in an individual, which is sufficient to prevent α5β1 integrin from specifically binding to its specific ligand. Generally, agonist antagonists are administered in an amount of about 00001 to 100 mg per kg body weight, but this will vary somewhat depending on the application. Those skilled in the art will be able to determine the effective dosage range for a given treatment based on the results of the efficacy trials discussed above. Estimates of the amount to be administered can be appropriately adjusted depending on the case, for example, when the agent is to be administered locally.

The preferred method of administering the antibodies of the invention is by direct injection into the blood, intravenously or into an injured joint or tissue. For example, when the retinal tissue is damaged, the therapeutic antibody of the present invention is injected into the injured eye into the vitreous body.

(intravitreally) can be injected. The surprising result of the present invention is that treatment performed on one eye (assuming both eyes are injured) results in a clinically beneficial effect on both eyes. The newly formed blood vessels are "leakage" and appear to cause the antibodies applied to the first eye to migrate into the second eye as they pass into the bloodstream to which they are transported. When applied to the eye in this way, the dosage is preferably less than 5 μM, more preferably 05 to 2 μM and most preferably 01 to 10

μM. If directed, treatment may take multiple dosage forms, over a given area or period. Administration in multiple forms can all be the same, or can be independently determined and applied. These results also treat injuries related to neoangiogenesis in which angiogenesis of the damaged tissue is inhibited or prevented, including applying an effective amount of a therapeutic antibody systemically (eg, by intravenous injection). Triggered an additional method.

All publications and patent applications cited in this specification are incorporated herein by reference, as if each individual publication or patent application was specifically individually indicated to be incorporated by reference.

Although the present invention has been described in some detail through description and examples for clarity and understanding, it is understood in the art that certain changes and changes can be added thereto without departing from the spirit and scope of the appended claims in view of the teachings of the present invention. It will be apparent to those skilled in the art.

As can be understood from the specifications provided above, the present invention has a variety of applications. Accordingly, the following examples are provided for purposes of illustration and are not intended to be understood as limitations on the invention in any way. Those skilled in the art are not great.

It will be readily appreciated that various parameters can be varied or changed to produce essentially similar results.

Example 1-Construction of M200 chimerism from mouse IIA1 anti-α5β1 integrin

This example describes the construction of the chimeric antibody M200.

A Cloning of the various mouse anti-human α5β1 integrin antibodies, heavy (VH) and light (VL) domains of IIA1 (Pharmingen, San Diego CA) from the starting DNA sequence IIA1 hybridoma cDNA of the IIA1 and 200-4 VH and VL domains And sequenced as part of the initial construct of the 200-4 antibody. 3 shows the cDNA sequence of the IIA1 VH (SEQ ID NO: 13) and VL (SEQ ID NO: 14) domains. 200-4 mice/human from IIA1

During the construction of the chimeric IgG4 antibody, silent XhoI restriction enzyme cleavage sites (CTCGAG) (SEQ ID NO: 33) were introduced into four framework regions of both IIA1 VH and VL. Found in the expression constructs DEF38 IIA1/human G4 chimeric and NEF5 IIA1/K chimeric

The DNA sequences of 200-4 VH (SEQ ID NO: 15) and VL (SEQ ID NO: 17) including these silent XhoI sites as shown are shown in FIG. 4. These 200-4 VH and VL sequences were used as starting points for all subsequent recombinant DNA manipulations.

B M200 VH and VL small-exon design expression plasmids DEF38 IIA1/human G4 chimeric and 200-4 VH and VL domains in NEF5 IIA1/K chimeric, intron

Without intervention, it fuses directly to their contiguous constant domains through silent XhoI sites. Functional donors at the 3'end of the variable coding region, to prepare these variable domains that can be fused to the desired antibody expression vector based on genomic DNA

It was necessary to design a'small-exon' that regenerates the adhesion sites. Through sequence comparison, it was found that the VH and VL regions of IIA1 utilize JH4 and JK1 segments of mice, respectively; Thus the small-exons, the VH and VL domains

It was designed to regenerate the natural murine JH4 and JK1 donor junction sites following the last amino acid in phosphorus. In addition, the XhoI site was removed to recover the backbone 4 sequences as found in the original IIA1 hybridoma. The small-exons

The following restriction enzyme cleavage sites were flanked: 5'and 3'XbaI sites (TCTAGA) for VH small-exon (SEQ ID NO:34), and 5'MluI (ACGCGT) for VL small-exon (SEQ ID NO: : 35) and 3'XbaI (TCTAGA) (SEQ ID NO: 34)

Recombinant antibody variable domains sometimes include unwanted alternative mRNA conjugation sites, which in turn can lead to alternating conjugated mRNA species. These sites are, in theory, present in the variable domains of murine, while heterologous cells and/or keys

It may only be active at new receptor sites from the merinary constant region. This unwanted alternative conjugation can be eliminated using codon degeneracy, which removes potential alternative conjugation sites while leaving the encoded amino acid sequence unchanged.

Can. To detect any potential alternative junction sites in the M200 VH and VL mini-exons, a junction site prediction program from the Center for Biological Sequence Analysis at the Technical University of Denmark (http://

The initial designs were analyzed using wwwcbsdtudk/services/NetGene2/). For both 200-M small-exons, correct donor junctions were identified; Potential alternative donor junction sites are the CDR3 and VL cattle of the VH mini-exon.

Detected in CDR1 of type-exon. To eliminate the possibility of these conjugation sites being used, a single silent base pair change was made to the small-exon design. For the VH design, GGT is silenced with GGA in Glycine 100 (Kabat numbering).

Codon changes; For VL constructs, GTA to GTC in Valine 29 was silently codon changed. In both cases, these silent changes eliminated potential secondary junction donor signals in the V-genes.

Final for M200 VH and VL mini-exons (SEQ ID NOs: 19, 21) with flanking restriction enzyme cleavage site, murine donor junction site, 200-4 XhoI site removed and potential alternative donor junction site removed The design is shown in FIG. 5.

C M200 VH mini-exon and plasmid p200-MH PCR-based mutation using 200-4 expression plasmid DEF38 IIA1/human G4 chimerism as starting point for construction, mini-exon for designed M200 VH, as shown in Figure 5A. To build. In summary, primer #110 (5' TTTTCTAGACCACCATGGCTGTCCTGGGGCTGCTT-3') (SEQ ID NO: 36) (which anneals to the 5'end of the 200-4 VH signal sequence to add the Kozak sequence and XbaI site) and primer #104 (5'-TTTTCTAGAGGTTGTGAGGAC

Using the TCACCTGAGGAGACGGTGACTGAGGT-3') (SEQ ID NO: 37) (which anneals to the 3'end of the 200-4 VH to add the XbaI site), the 200-4 VH region from the DEF38 IIA1/human G4 chimerism Was amplified. The 469 bp PCR fragment was cloned into pCR4Blunt-TOPO vector (Invitrogen) and confirmed by DNA sequencing to generate plasmid p200M-VH-21. This intermediate plasmid was then used in the second PCR mutation reaction to remove the potential mutation junction site in CDR3 and add the murine JH4 donor junction site to the 3'end of the VH coding region. Two complementary primers leading to a codon change from GGT to GGA in glycine 100 (Kabat numbering) in CDR3 of the M200 VH, #111 (5'-TGGAACTTACTACGGAATGACTA CGACGGGG-3') (SEQ ID NO: 38) and #112 (5' -CCCCGTCGTAGTCATTCCGTAGTAAGTTCCA-3') (SEQ ID NO: 39) was designed. Primers #110 and #112 were used in PCR reactions to generate 395 bp fragments from the 5'end of the M200 VH mini-exon, primers #111 and #113 (5'-TTTTCTAGAGGCCATTCTTACCTGAGGAGACGGTGACTGAGGT-3') (SEQ ID NO: 40 ), a 101 bp fragment was generated from the 3'end of the M200 VH mini-exon. The two PCR products were gel purified on 15% low melting agarose, then collected and conjugated in the final PCR reaction using primers #110 and #113. The final 465 bp PCR product was purified, digested with XbaI, and then cloned into vector pHuHCg4D digested with XbaI and treated with shrimp alkaline phosphatase. The final plasmid, p200-M-H (Figure 6) was DNA sequenced to ensure that it was the correct sequence for the 200-M VH mini-exon between the XbaI sites and to demonstrate the correct orientation of the XbaI-XbaI insertion.

D M200 VL mini-exon and plasmid p200-M-L construction As a starting point, a PCR-based variant using 200-4 expression plasmid NEF5 IIA1/K was constructed to construct a mini-exon for designed M200 VL as shown in FIG. 5B. Primer #101 (5' TTTACGCGTCC

ACCATGGATTTTCAGGTGCAGATT-3') (SEQ ID NO: 41) (which anneals to the 5'end of the signal sequence to add the Kozak sequence and MluI site), and primer #102 (5'-TTTTCTAGATTAGGAAAG TGCACTTACGTTTGATTTCCAGCTTGGTGCC-3') (SEQ ID NO: No. 42) (this is annealed to the 3'end of the 200-4 VL to add the XbaI site) to amplify the VL region from NEF5-IIA1-K. The 432 bp PCR fragment was cloned into pCR4Blunt-TOPO vector (Invitrogen) and confirmed by DNA sequencing to generate plasmid p200M-VL-33. This intermediate plasmid was then used in a second PCR mutation reaction to remove potential mutation junction sites in CDR1 and added a mouse JK1 donor junction site to the 3'end of the VL coding region. Two complementary primers #114 (5'- TGCCAGTTCAAGTGTCAGTTCCAATTACTTG-3') (SEQ ID NO: 43) and #115 (5'-

CAAGTAATTGGAACTGACACTTGA ACTGGCA-3') (SEQ ID NO: 44) was designed to direct the codon change from GTA to GTC at Valine 29 (Kabat numbering) in CDR1 of the VL domain. Primers #101 and #115 were used for PCR reactions to generate VL cattle.

A 182 bp fragment was generated from the 5'end of the type-exon and 3 of the VL small-exon by separate PCR reactions using primers #114 and #116 (5'-TTTTCTAGACTTTGGATTCTACTTAC GTTTGATTTCCAGCTTGGTGCC-3') (SEQ ID NO: 45). '' A 280 bp fragment was generated from the end. The two PCR products were gel purified on 15% low melting agarose, then collected and conjugated in the final PCR reaction using primers #101 and #116. The final 431 bp PCR product was purified, digested with MluI and XbaI, and then cloned into the light chain expression vector pHuCkappargptdE digested with MluI and XbaI. To ensure that it is the correct sequence for the VL small-exon between the MluI and XbaI sites, the final

The plasmid, p200-M-L (FIG. 7) was DNA sequenced.

Combination of E plasmids p200-MH and p200-ML and preparation of final expression plasmid p200-M through it To express M200 from a single plasmid, p200-MH and p200-ML were digested with EcoRI and total IgG4 of p200-MH The plasmid p200-M (FIG. 8) was linked by linking the EcoRI fragment with the heavy chain gene into the EcoRI linearized p200-ML.

Produced. An endotoxin-free Plasmid Maxi-prep Kit (Qiagen) was used to prepare a large-scale p200-M plasmid sample without endotoxin from 25 L of E coli culture. The plasmid structure was verified by restriction enzyme mapping using enzymes BamHI, XbaI and FspI. The entire coding region for M200 VH, VL, Cκ, and Cγ4 was demonstrated by DNA sequencing. The DNA sequences for the complete M200 heavy chain (SEQ ID NO: 23) and M200 light chain (SEQ ID NO: 24) are shown in Figure 9. The corresponding amino acid sequences for the complete M200 heavy chain (SEQ ID NO: 25) and M200 light chain (SEQ ID NO: 26) are shown in Figure 10.

Example 2-Generation of Fab fragment F200 from M200

This example describes preparing Fab fragment F200.

Fab fragments are produced by enzymatic cleavage from M200 IgG starting material. The buffer of the starting IgG is replaced with 20 mM sodium phosphate, 20 mM N-acetyl cysteine pH 70. Soluble papain enzyme was added and the mixture was brought to 37°C.

Stand for 4 hours. After enzyme digestion, the mixture is passed through a Protein A column to remove Fc fragments and uncleaved IgG. Sodium tetrathionate is added to 10 mM and incubated at room temperature for 30 minutes. Finally, this sample

The F200 solution is calculated by replacing the buffer of 20 mM with 20 mM sodium phosphate, 100 mM sodium chloride, and pH 74.

Because it is a Fab fragment, the F200 light chain DNA and amino acid sequences are identical to the M200 light chain. The complete F200 heavy chain DNA (SEQ ID NO: 27) and amino acid (SEQ ID NO: 28) sequences are shown in FIG. 11.

Example 3-In vitro endothelial cell proliferation inhibition by M200

This example describes the effect of M200 antibody on endothelial cell proliferation.

M200 is a functional monoclonal blocking antibody highly specific for α5β1 integrin.

HUVECs were inoculated in 96-well plates at a concentration of 5000 cells per well in the presence of various antibodies (M100, M200, anti-VEGF or control IgG) at the concentrations shown in FIG. 14. Plates were either 10 μg/ml fibronectin or 01% poly-L-lysine (PLL)

Pre-treated with me and blocked with 2% heat denatured BSA. Cells were grown in serum-free media containing approximately 2 ng/ml of VEGF, bFGF or both. 4 days after plating, tetrazolium salt, MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium

Bromide) assay was used to assess total cell viability (eg Wasserman & Twentyman, "Use of acolorimetric microtiter (MTT) assay in determining the radiosensitivity of cells from murine solid tumors," Int J

Radiat Oncol Biol Phys 15(3):699-702 (1988); Romijn, JC, Verkoelen, CF, Schroeder, FH, "Application of the MTT assay to human prostate cancer cell lines in vitro: establishment of test conditions and assessment of

Hormone-stimulated growth and drug-induced cytostatic and cytotoxic effects," see Prostate 12(1):99-110 (1988)). Data was subtracted and normalized against controls lacking antibodies. And

Ita represents three separate experiments.

As shown in FIG. 14, HUVEC growth was inhibited by M200 in a dose dependent manner for both PLL and fibronectin (040 nM; maximum inhibition rate 80%), control IgG had no effect. Moreover, M100 (M200 is derived

Mouse antibody) shows the same ability against cell growth inhibition.

Importantly, as shown in Figure 14, the high affinity, sensory blocking anti-VEGF mAb, HuMV833 (KD = 584 x 10-11 nM) shows significantly less HUVEC growth inhibition under all tested conditions (45 nM ; Maximum inhibition rate 40%) M200 and HuMV833

Attempts to co-use cells did not result in increased inhibitory response.

For the data shown in Figure 15A, higher concentrations of VEGF (50 ng/ml) were included in the HUVEC proliferation assay for fibrinogen as described above. 15A, HUVEC proliferation on VEGF-stimulated fibrinogen

Is inhibited by M200 to a degree similar to that of HuMV833. Accordingly, the effect of inhibiting M200-mediated cell proliferation was evident even at elevated, growth stimulation levels of VEGF (50 ng/ml).

Both high affinity antibodies were elevated for the M200 genotype region and were determined to block binding of M200 to α5β1 integrin. Two anti-genotype mAbs (10 μg/ml) were included in the HUVEC proliferation assay described above, of HUVEC growth

The effect on M200-dependent inhibition was evaluated. Both mAbs can inhibit the dose of M200 (1 μg/ml) that inhibits HUVEC proliferation. As shown in 15B, the inhibitory activity of M200 was completely reversed by anti-genotype mAbs against M200.

All.

Collectively, the results suggest that M200 still inhibits HUVEC proliferation through a mechanism that overlaps that of the anti-VEGF antibody HuMV833, which is still different in some respects.

Example 4-M200 effect on epithelial cell survival This example describes the effect of M200 antibody on epithelial cell survival.

Antibodies to specific integrins can induce cell death in vitro and in vivo. Recently, as measured by Annexin V staining, caspase-3 cleavage and DNA fragmentation, the functional blocking α5β1 mAb is apoptosis in cultured human epithelial cells

(apoptosis) (Kim, et al., 2002)

Similar annexin V staining was performed on HUVECs grown by exposure to M200 or HuMV833. HUVEC grown in serum-free medium (containing VEGF and bFGF, except where indicated) is M200 (10 μg/ml), HuMV833 (10 μg/ml)

Or staurosporin (5 μM, positive control). Cell death was evaluated by staining with Annexin V-alexa488 (green) and Hoechst 33258 (blue), followed by fluorescence microscopy (fluorescence microscopic images are shown in Figure 16A). At the same time, cells

Death was assessed by flow cytometry 16 hours after plating (Figure 16B).

As shown in Figures 16A and 16B, cells attempted with M200 showed increased Annexin V staining, while those attempted with HuMV833 did not. Accordingly, M200 promotes cell death in epithelial cells, in contrast to HuMV833.

appear.

In addition, the effect of M200 was compared against senescent cells versus proliferating cells. After plating HUVECs, in the presence of serum and growth factors (center panel), grow to fuse (left panel) or log phase growth, or upon removal of serum and growth factors (right)

Panel). In each case, cells were untreated (control) or incubated with M200 (10 μg/ml) or staurosporin (5 μM) for 16 hours and stained with Annexin V-alexa488.

As shown in FIG. 17, M200 induced cell death in dividing HUVEC, but HUVEC did not age due to contact inhibition or removal of growth factors. The above results suggest that M200 selectively promotes cell death in proliferating epithelial cells.

Example 5-In vitro Inhibition of Tube Formation F200 This example describes a tube formation assay demonstrating inhibition of angiogenesis in vitro by F200. HUVEC in human serum and growth

Mixture of factors (assay in FIG. 18A contains medium supplemented with 001 mg/ml rTGF-α or 01 mg/ml of VEGF and HGF; assay in FIG. 18B supplements only 01 mg/ml VEGF alone Cultured medium; the assay in FIG. 18C shows 01 mg/ml bFGF

Mixed with fibrin mass (fibrinogen and α-thrombin) as a single cell suspension together with medium containing only supplements)

Made from). Test antibodies were added to the medium at the indicated concentrations. Over 96 hours, single cell HUVECs began to migrate and contact other cells and matrices, forming a cord and eventually a three-dimensional tubular structure.

The degree of tube formation was quantified after fixation with 4% formaldehyde after 6 days and staining with Alexa488-phalloidin. As shown in the images and graphs of the average fluorescence shown in Figure 18, tube formation was significantly inhibited in the presence of F200. Inhibition of tube formation is growth phosphorus

Now, it was observed in the presence of VEGF, HGF and a mixture of the two and rTGFα.

Example 6-In vivo inhibition of CNV in the original eye by M200 and F200

This example describes the effect of M200 and F200 Fab on vascular development after laser trauma to the macula of the original eye. Background literature describing the study of choroidal angiogenesis in animal models includes: S Ryan, "The Development of an

Experimental Model of Subretinal Neovascularization in Disciform Macular Degeneration," Transactions of the American Ophthalmological Society 77: 707-745 (1979); SJ Ryan, "Subretinal Neovascularization: Natural

History of an Experimental Model,"Archives of Ophthalmology 100: 1804-1809 (1982); MJ Tolentino et al.,

"Angiography of Fluoresceinated Anti-Vascular Endothelial Growth Factor Antibody and Dextrans in Experimental Choroidal Neovascularization," Archives of Ophthalmology 118: 78-84 (2000)

Claims (7)

Purification method of pH-sensitive anti-α5β1 integrin antibody comprising the following steps:
(a) absorbing the antibody onto the antibody affinity matrix bound to the substrate; And
(b) eluting the antibody from the substrate-binding antibody affinity matrix using an elution solution having a pH of about 30 to about 55. The method of claim 1, further comprising: (c) recovering the purified antibody. The method of claim 1, wherein the pH of the elution solution is from about 33 to about 55. The method of claim 1, wherein the pH of the elution solution is from about 35 to about 55. The method of claim 1, wherein the pH of the elution solution is from about 35 to about 42. The method of claim 1, wherein the pH of the elution solution is from about 42 to about 55. The heavy chain variable region and sequence number of claim 1, wherein the antibody has a sequence selected from the group consisting of SEQ ID NOs: 2-6, 16 and 20.
No.: A method comprising a light chain variable region independently selected from the group consisting of 8-12, 18 and 22.

Images