KR20200067296A - Retinoic acid receptor responder 1(RARRES1) gene knockout animal model and method for its production - Google Patents

Abstract

The present invention relates to a targeting vector including a portion of RARRES1 gene and sequences used for preparation of a conditional knockout animal model; an animal cell for constructing a tumor-forming animal model using the target vector; a tumor-forming RARRES1-/-animal model obtained using the animal cell; and preparation methods thereof, and methods for screening a cancer treatment substance using the animal model. To this end, a thorough study to determine a molecular mechanism has been performed to diagnose and predict prognosis of cancer, and as a result, it is found in an RAREES1-/-animal model that: spontaneous tumors are likely to develop; phosphorylation of CDK1 and cyclin B1 is increased and activity of CDK1-cyclin B1 complex is higher, which lead to particularly rapid tumor cell cycle progress due to proteolytical degradation; stem cellular cell proliferation has particularly increased; and at the same time, defect in mitosis is triggered and instability is caused during mitosis. All these findings confirmed that the RAREES1 is a critical factor in diagnosis of cancers and prediction of prognosis. Further, the RARRES1 is expected to be used in screening of cancer treatment substances and for development of medicament via relationship between the RARRES1 and CDK1-cyclin B1 complex, quantitative regulation of CDK1-cyclin B protein, and an increase of stem cellular cell proliferation.

Description

Retinoic acid receptor responder 1 (RARRES1) gene knockout animal model and method for its production}

The present invention relates to an RARRES1 gene knockout animal model, and more specifically, a targeting vector comprising a part of the RARRES1 gene and sequences used in the construction of a conditional knockout animal model, the targeting vector. It relates to an animal cell for the production of a tumorigenic animal model generated using, a tumorigenic RARRES1 ^-/- animal model obtained using the same, a method for manufacturing the same, and a screening method for cancer therapeutic substances using the same.

The term'tumor' refers to a mass that is abnormally grown by autonomous overgrowth of body tissue, and can be divided into a benign tumor and a malignant tumor. While benign tumors are relatively slow to grow and do not metastasize, malignant tumors grow rapidly as they infiltrate surrounding tissues and spread or metastasize to parts of the body, threatening life. Therefore, a malignant tumor can be thought of as having the same meaning as cancer. Cells, the smallest units that make up the body, normally divide and grow by the cell's own regulating function, and when they reach the end of their life or damage, they kill themselves to maintain an overall number balance. However, if there is a problem with the control function of these cells by various causes, abnormal cells that normally need to be killed will overproliferate. In some cases, they invade surrounding tissues and organs to form masses and destroy or modify existing structures. However, this condition can be defined as cancer.

In order to diagnose such cancer, X-ray examination often obtains shading for lung cancer or myeloma by simple imaging and tomography, and visceral cancer captures clues by observing various shades using contrast agents. In particular, in gastric cancer and colorectal cancer, the condition of the mucous membrane is checked by a double contrast method, and even minute lesions such as early gastric cancer and colorectal cancer are distinguished. Endoscopy As an endoscopy, endoscopy has been used for internal examination for a long time, but the scope of view with the naked eye was limited and did not help much in diagnosis. Therefore, currently, only the colon S is used. The development of a flexible fiberscope that can bend freely has played a large role in the diagnosis of various visceral cancers, especially early diagnosis. Biopsy through an endoscope is also possible, providing good clues for confirmation, and can be used for group examinations in addition to general hospital examinations, making it more useful in gastric cancer. Currently widely used in clinical trials include gastrofiberscope (flexible gastrofiberscope), colonoscopy (flexible colonofiberscope), rectal and S colonoscopy (sigmoidoscope). bronchoscope). Since G.N.Papanicolo discovered the characteristics of malignant tumor cells in the smear of uterine secretions as a cell diagnosis, it has revolutionized the collective screening and diagnosis of cervical cancer and especially early diagnosis. Currently, in addition to uterine cancer, it is used for secretions such as stomach, lung, prostate, breast, urinary tract, and pancreas, and cell diagnosis by puncture of the thyroid and breast is also widely used. Confirmation of cancer consists of histopathological microscopic examination of tissue fragments obtained through biopsy. There are methods for obtaining such tissues through an endoscopic method and surgical operations such as breast and vagina. Cancer can be diagnosed through such a diagnosis, but usually, when the cancer is first diagnosed, it is often already metastasized to surrounding tissues or distant metastasis occurs. As the survival rate of cancer patients is found late, the prognosis is poor, so early diagnosis This is very important. Therefore, it is very important to understand the onset and progression of cancer, but studies on the molecular mechanisms that induce the onset and effective diagnosis are insufficient.

On the other hand, the retinoic acid receptor responder 1 (RARRES1) gene was first identified as the most upregulated gene in the skin multiple culture (raft culture) by the synthetic retinoid tazarotene. This gene is found only in a few mammals and is an evolutionarily conserved gene among species. In humans, it is confined to the chromosome 3 q arm 25.32 locus. Alternatively, there are spliced transcript variants (alternatively spliced transcript variants) encoding two distinct isoforms. Subtype 1 (RARRES1-1) consists of 6 exons, encodes 294 proteins, subtype 2 (RARRES1-2) consists of 5 exons, and encodes 228 proteins. The C-terminal and 3'-non-translated regions (UTRs) were different forms between these two subtypes. The expression of RARRES1 in various tumor tissues and cell lines, including prostate, breast, lung, liver, colon cancer, gastric cancer, esophagus, nasopharynx, endometrial and head and neck cancers, often disappears or is silent, mostly due to hypermethylation of the promoter region.

Accordingly, there is a need for an effective diagnosis and treatment for cancer, and it is essential to establish a suitable animal model for developing biological samples necessary for research on the mechanism and treatment of such cancer. However, studies on the effects of RARRES1 on the diagnosis of cancer, the development of cancer cells, and progression, or animal models related thereto have not been completed.

Korea Registration Bulletin KR10-1348852

In order to achieve the object of the present invention as described above, the present invention is a first loxP (locus of X-over P1) site; Drug resistant gene sites; A gene segment comprising the third exon of the RARRES1 genomic gene; And a retinoic acid receptor responder 1 (RARRES1) targeting vector for constructing an oncogenic animal model for constructing an oncogenic animal model comprising a DNA sequence consisting of a sequence of a second loxP site. A tumorigenic RARRES1 ^+/N chimeric animal model prepared by injecting lysed animal cells into a blastocyst is provided.

The present invention also provides an oncogenic Rarres1 ^+/- animal model prepared by crossing the Rarres1 ^+/N chimeric animal model with an animal expressing cre recombinase.

In addition, the present invention comprises the steps of (a) preparing the RARRES1 ^+/N chimeric animal model; (b) crossing the chimeric animal model of step (a) to produce a RARRES1 ^+/- animal model; Provides an animal model producing method ^- and (c) the (b) step of RARRES1 ^+/- among the offspring obtained by mating an animal model RARRES1 ^{- / -} tumor formation including the step of selecting an animal model Rarres1 ^{- /.}

In addition, the present invention provides a tumor-forming Rarres1 ^-/- animal model prepared by the above production method.

In addition, the present invention comprises the steps of: (a) treating a candidate substance in a subject of tumor formation RARRES1 ^-/- animal model; (b) measuring the degree of phosphorylation of the subject's cyclin-dependent kinase 1 (Cyclin-dependent kinase 1; CDK1) and cyclin B1, measuring the amount or activity of the CDK1 and Cyclin B1 proteins, Measuring the expression or activity of Mist1 and LGR5, or measuring the activity of SPC (surfactant protein) positive cells; And (c) a candidate substance in which the degree of phosphorylation of CDK1 and Cyclin B1 is reduced, a candidate substance in which the amount or activity of CDK1 and Cyclin B1 protein is reduced, Mist1 (Muscle, intestine and stomach expression 1), compared to the untreated group of candidate substance. And selecting a candidate substance in which the expression or activity of LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5) is reduced, or a candidate substance in which the activity of SPC-positive cells is decreased as a tumor treatment substance. Provides a method of screening for therapeutic substances.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned can be clearly understood by those skilled in the art from the following description. There will be.

In order to achieve the object of the present invention as described above, the present invention is a first loxP (locus of X-over P1) site; Drug resistant gene sites; A gene segment comprising the third exon of the RARRES1 genomic gene; And a retinoic acid receptor responder 1 (RARRES1) targeting vector for constructing an oncogenic animal model for constructing an oncogenic animal model comprising a DNA sequence consisting of a sequence of a second loxP site. A tumorigenic RARRES1 ^+/N chimeric animal model prepared by injecting lysed animal cells into a blastocyst is provided.

In one embodiment of the present invention, before the first loxP (locus of X-over P1) site, a splicing acceptor (SA), β-galactosidase (βgal), and SV40 polyA It may include a DNA sequence consisting of a sequence of signal (pA).

In another embodiment of the present invention, the drug resistance gene site may be a neomycin resistance gene.

The present invention also provides an oncogenic Rarres1 ^+/- animal model prepared by crossing the Rarres1 ^+/N chimeric animal model with an animal expressing cre recombinase.

In one embodiment of the present invention, in the animal expressing the cre recombinase, a gene encoding the cre recombinase may be operably linked to a Zona pellucida 3 (Zp3) promoter.

In addition, the present invention comprises the steps of (a) preparing the RARRES1 ^+/N chimeric animal model; (b) crossing the chimeric animal model of step (a) to produce a RARRES1 ^+/- animal model; Provides an animal model producing method ^- and (c) the (b) step of RARRES1 ^+/- among the offspring obtained by mating an animal model RARRES1 ^{- / -} tumor formation including the step of selecting an animal model Rarres1 ^{- /.}

In one embodiment of the present invention, the animal may be a mouse.

In another embodiment of the present invention, the Rarres1 ^-/- animal model may cause tumors due to deletion of RARRES1.

In addition, the present invention provides a tumor-forming Rarres1 ^-/- animal model prepared by the above production method.

In one embodiment of the invention, the animal model may cause mitotic defects or resist mitotic stress.

In another embodiment of the invention, the animal model can induce somatic mutation.

In another embodiment of the present invention, the animal model may overexpress one or more genes selected from the group consisting of Ccnd1, Cdkn1a, Cdkn2A, Nanog, Psrc1, and Nup214 in the mitotic cell cycle.

The present invention comprises the steps of: (a) treating a candidate substance in a subject of tumor formation RARRES1 ^-/- animal model; (b) measuring the degree of phosphorylation of the subject's cyclin-dependent kinase 1 (Cyclin-dependent kinase 1; CDK1) and cyclin B1, measuring the amount or activity of the CDK1 and Cyclin B1 proteins, Measuring the expression or activity of Mist1 and LGR5, or measuring the activity of SPC (surfactant protein) positive cells; And (c) a candidate substance in which the degree of phosphorylation of CDK1 and Cyclin B1 is reduced, a candidate substance in which the amount or activity of CDK1 and Cyclin B1 protein is reduced, Mist1 (Muscle, intestine and stomach expression 1), compared to the untreated group of candidate substance. And selecting a candidate substance in which the expression or activity of LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5) is reduced, or a candidate substance in which the activity of SPC-positive cells is decreased as a tumor treatment substance. Provides a method of screening for therapeutic substances.

In one embodiment of the present invention, the subject may be separated from one or more selected from the group consisting of spleen cancer, thymic cancer, liver cancer, lung cancer, kidney cancer, thyroid cancer, small intestine cancer, stomach cancer, uterine cancer, and myeloid leukemia.

In another embodiment of the present invention, the tumor may be one or more selected from the group consisting of spleen cancer, thymic cancer, liver cancer, lung cancer, kidney cancer, thyroid cancer, small intestine cancer, stomach cancer, uterine cancer, and myeloid leukemia.

In another embodiment of the present invention, the Mist1, LGR5 or SPC may be a stem cell marker.

The present inventors have conducted extensive studies to reveal molecular mechanisms for diagnosis and prognosis of cancer, and are prone to spontaneous tumors in RAREES1 ^-/- animal models, increased phosphorylation of CDK1 and Cyclin B1, and combination of CDK1-Cyclin B1 complex. By confirming that the activity is high, it was confirmed that tumor cell cycle progression is unusually fast due to a decrease in protein resolution, especially stem cell proliferation is increased, and also causes mitosis defects and chromosomes are unstable during mitosis. As a result, it was confirmed that RAREES1 is an important factor for cancer diagnosis, prognosis prediction, and treatment. Furthermore, it is expected that the relationship between RARRES1 and CDK1-Cyclin B1 complex, quantitative control of CDK1-Cyclin B protein, and increase of stem cell cell proliferative ability can be used for screening therapeutic substances of cancer and for drug development purposes. do.

1A is a diagram showing a strategy for generating a target RARRES1 allele.
1B is a diagram confirming Rarres1 gene deficiency by extracting RNA from Rarres1 knockout embryo.
Figure 1c is a diagram confirming the deletion of Rarres1 exon 3 by extracting DNA with a Rarres1 knockout embryo.
1D is a diagram confirming the genotype of wild-type and Rarres1-deficient mice by PCR genotyping according to the method of Example 1-6 of the tail genomic DNA of the mouse.
1E shows cDNA prepared from RNA of RARRES1 ^+/+ , RARRES1 ^+/- , and RARRES1 ^-/- mouse embryo fibroblasts (MEFs), exon 1 (sense) exon 6 (antisense), and specific This is a diagram showing the expression of RARRES1 gene in different genotypes through RT-PCR according to the method of Example 1-1 using oligonucleotides.
Figure 1f is a diagram showing the results of analyzing the expression of RARRES1 through Western blot (Western blot) in the whole embryo on 13.5 days (E13.5).
1G is a diagram showing the results of LacZ staining according to Examples 1-8 in heterozygous embryos when embryos were 11.5 to 14.5 days (E11.5 to E14.5).
Figure 2 is a diagram showing the results of analyzing the phenotype of leukocytes isolated from bone marrow, spleen, and peripheral blood of wild-type, RARRES ^-/- mice of the same age (18 months of age).
3A is a diagram showing Kaplan-Meier cancer-free survival curves of wild-type, RARRES1 ^+/- , and RARRES1 ^-/- mice of the same age.
Figure 3b is a diagram showing the results of gross morphological and histological analysis of spontaneous tumors through hematoxylin and eosin staining in RARRES1 heterozygous and homozygous mice.
Figure 3c is a diagram showing the histological form of tumors naturally occurring in the stomach, liver, lungs and thyroid of RARRES1 ^-/- mice.
Figure 3d is a diagram showing the results of immunohistochemical staining for specific markers (CD3) of multiple lymphomas occurring in various organs of RARRES1 ^-/- mice.
Figure 3e is a diagram showing the results of immunohistochemical staining for specific markers (myeloperoxidase (MPO)) to determine the specific gravity of myeloid family cells in the bone marrow and spleen of wild-type mice and RARRES1 ^--- mice.
Figure 4 shows RARRES1 ^+/+ , RARRES1 ^+/- , and RARRES1 ^-/- at 21.5 months from 19 It is a diagram confirming the shape and relative weight of the spleen, liver, and kidney of a mouse.
Figure 5 is according to Examples 1-9 by [ ¹⁸ F] FDG in Wild type (WT) and Knockout (KO) mice This is a diagram of monitoring glucose intake through PET/CT imaging.
FIG. 6 is a diagram showing the results of immunoblotting according to Example 1-3 with cell lysates derived from wild-type or RARRES1-deficient MEF as indicated antibodies.
7A is a diagram showing the growth curve of each genotype obtained by sowing 2x10 ⁴ MEF cells per genotype and counting at the indicated time.
7B is a diagram showing the results of flow cytometry analysis according to Examples 1-5 of WT and KO MEF.
Figure 7c is a diagram showing the results of Western blot analysis of the indicated antibodies and WT and KO MEF cells treated as described in Figure 7b above.
7D shows RARRES1 ^+/+ and RARRES1 ^-/- It is a diagram showing the results of flow cytometry analysis according to Example 1-5 of MEF.
Figure 7e shows RARRES1 ^+/+ and RARRES1 ^-/- treated as described in Figure 7d above. This diagram confirms the expression and phosphorylation of CDK1 and Cylcin B1 proteins in MEF cells.
8A is a diagram confirming that an error occurred during mitosis in RARRES1 ^-/- MEF.
8B shows wild-type (WT) or RARRES1 ^-/- according to Example 1-7 on day 13.5 (E 13.5) after embryonic in vitro culture. This diagram confirms the results of staining embryonic fibroblasts with antibodies to α-tubulin (red), phalloidin (green), and DAPI (blue).
8C is a diagram showing representative pictures and quantitation of the errors in the cell division in WT and KO fibroblasts according to Example 1-7.
Figure 8d is a diagram showing the quantitative quantification of micronuclei cells showing H2AX staining among the whole micronuclei cells in WT and KO MEFs stained with antibodies and DAPI (blue) against H2AX (red) in FIG. 8a.
9A is a diagram showing the results of flow cytometry analysis according to Example 1-5 of WT and KO MEF treated with 50 and 100 ng/ml nocodazole or DMSO for 48 hours.
Figure 9b is a diagram showing the quantification of the sub-G1 DNA content through the PI-stained cells treated in Figure 9a.
Figure 9c is a view showing the results of measuring the total number of cells in the WT and KO MEF treated in Figure 9a.
9d is a diagram showing the results of Western blot analysis of PARP and Caspase3 proteins in MEF treated with nocodazole (50 and 100 ng/ml) for 40 hours.
Figure 10a is a diagram showing the results of histopathological analysis through liver and lung sections of normal or cancer-caught mice cut from WT or RARRES1 KO mice stained with phospho-Cyclin B1-Ser126, and phospho-CDK1-T161. .
Figure 10b is immunohistochemical for markers (ki67), CDK1, and phosphorylated Rb protein showing cell proliferation in serially sectioned sections of wild-type mice of the same age (18 months old) and RARRES1 ^+/- , RARRES1 ^-/- mouse lungs. It is the result of dyeing.
Figure 11a shows the results of immunohistochemical staining comparing the cell proliferative activity (positive for Ki67) of type 2 alveolar cells (positive for SP-C) in the lungs of wild-type mice and RARRES1 ^--- mice of the same age (18 months old). It is a diagram showing.
Figure 11b is a diagram showing a result of staining by immunohistochemistry for the wild type mice as above (stomach) specific to the top of which lack the RARRES1 mice known as a marker of long-specific stem cells and Mist1 LGR5.
Figure 11c is a diagram showing the results of immunohistochemical staining for Mist1 and CDK1 in the stomach of wild-type mice and RARRES1 ^+/- and RARRES1 ^-/- mice of the same age (18 months old).
11D is a diagram showing the results of a spheroid formation assay confirming how the characteristics of stem cells are changed when epithelial cells isolated from embryos of wild-type mice and RARRES1 ^-/- mice are treated with the CDK1 activity inhibitor RO3306.
Figure 11e is a diagram showing the numerical results of Figure 11d spheroid formation assay.
Figure 11f is a diagram showing the results of confirming the organoid formation to confirm the stem cell characteristics of the cells isolated from the top of the wild-type mouse and RARRES1 ^-/- mouse.
Figure 11g is a diagram showing the preparation of RNQ sequencing for lungs of 19 months (E19) and 10 months and 18 months after embryonic in vitro culture of wild-type mice and RARRES1 ^-/- mice.
12 is a diagram showing the results of analysis of the number of clones (CNV) analysis for each tumor sample.
13A is a diagram showing differentially expressed genes and upregulated genes involved in the WNT signal and mitotic pathway.
FIG. 13B is a diagram showing the estimated path activity from the pathway, as it was confirmed that WT compared to KO in the unfolded protein response (UPR) exhibits the opposite activity activated in the KO tumor.
13C is a diagram showing the mRNA expression state of Hspa8 in UPR and high binding affinity due to an IgG experiment.
13D is a diagram showing the results of gene aggregation enrichment analysis using differentially expressed genes.
14A is a diagram for examining characteristics of the genome for lung adenocarcinoma expressed in humans, and is a diagram showing CDK1 mRNA, protein expression, and correlation status.
14B is a diagram showing RARRES1 mRNA expression for each subtype.
14C is a diagram showing a low RARRRES1 group C1 showing down regulation in the cell cycle pathway.
14D is a diagram showing the estimation of the amount of lung cells using a mouse data set and human lung adenocarcinoma.
14E is a diagram analyzing gene expression characteristics for six subtypes of human lung cancer (TCGA LUAD).
15 is a diagram schematically showing a mechanism of causing cancer in mice deficient in the Rarres1 gene. In the absence of RARRES1, the abnormal activation of Cdk1, a cell division regulatory protein, causes abnormalities in the overall cell cycle, indicating that cancer may occur.

The present inventors have conducted extensive studies to reveal molecular mechanisms for diagnosis and prognosis of cancer, and are prone to spontaneous tumors in RAREES1 ^-/- animal models, confirming increased phosphorylation of CDK1 and Cyclin B1, and confirmed CDK1-Cyclin By confirming that the activity of the B1 complex is high, it was confirmed that tumor cell cycle progression was unusually fast, and it was confirmed that inducing mitosis defects and unstable chromosomes during mitosis, RAREES1 diagnosed cancer, predicted prognosis, and treated It was confirmed that it is an important factor to complete the present invention based on this.

Hereinafter, the present invention will be described in detail.

In one embodiment of the present invention, to determine the in vivo physiological function of RARRES1, conditional RARRES1 knockout (Knockout; KO) mice were induced (see Example 2).

In another embodiment of the present invention, RARRES1 ^+/+ (n=30) in a heterozygous RARRES1 heterozygous mouse (C57BL/6) to confirm that the tumor spontaneously forms in a RARRES1 knockout (KO) mouse. ), RARRES1 ^+/- (n=57), and a population of RARRES1 ^-/- (n=63) mice and observed up to 22 months showed that RARRES1 ^+/- and RARRES1 ^-/- mice spontaneously developed tumors more than RARRES1 ^+/+ mice. It has been found to be more susceptible, and RARRES1 ^+/- and RARRES1 ^-/- mice are unlike RARRES1 ^+/+ mice, including the spleen, thymus, liver, lungs, kidneys, thyroid, small intestine, stomach, endometrium and eyes. Different types of tumors could be confirmed (FIG. 3 ), and the size of organs including spleen, liver, and kidney were gradually increased according to genotype in 19-month-old mice (FIG. 4 ). In addition, according to Examples 1-9 Through PET/CT imaging, it was confirmed that the tumor occurred much earlier in the RARRES1 KO mouse than in the wild type (WT) mouse (FIG. 5 ), and it was confirmed that the tumor can be formed only by deletion of the RAREES1 gene (FIG. 5 ). See Example 4).

In another embodiment of the present invention, in order to confirm that CDK1-cyclin B1 complex formation and activation thereof in RARRES1 KO mice promote tumor formation, the embryos were wild-type in embryos 13.5 days after in vitro culture. And RARRES1-deficient MEF according to Example 1-7 and confirmed by Western blot, phosphorylation at residues threonine 14 and 161 of CDK1 was enhanced in KO MEFs but CDK1 expression was not changed in other MEF cells. , Rb protein was increased in KO MEFs, and another substrate of CDK1, Separase, was cleaved in KO cells, which confirmed that CDK1-Cyclin B1 activity appeared in the deletion of RARRES1 (FIG. 6 ). In addition, in order to determine whether an increase in CDK1-Cyclin B1 activity may affect cell growth of MEF cells, MEF cells were seeded in 6-well plates, and cell counts were counted daily for 5 days, resulting in RARRES1 ^-/- MEFs were confirmed to grow rapidly (FIG. 7A ), RARRES1 ^-/- In order to evaluate whether the enhanced tumor cell proliferation observed in MEFs is due to the progression of the altered cell cycle, a cell synchronization experiment according to Example 1-2 shows that RARRES1 ^-/- from the G1 to G2/M stages of the cell cycle It was confirmed that the cells progressed faster (FIG. 7B), and the expression of Cyclin E in WT cells peaked and decreased rapidly at 30 hours after serum stimulation, but in KO cells, Cyclin E peaked at 30 hours and slightly It was confirmed that the decrease (Fig. 7c). And, through FACS and Western blot analysis, it was confirmed that the termination of mitosis was faster in RARRES1 deficient cells compared to WT cells through a nocodazole-releasing method (FIG. 7D), and that of CDK1 in KO cells. Phosphorylation of the substrate Rb increased from 6 hours to 18 hours after release (FIG. 7E ), and when it was synthesized, it was confirmed that the activity of CDK1-Cyclin B1 was high in RARRES1 KO MEFs, compared with WT MEF. It was confirmed that the timing of cell cycle progression was inappropriate and fast (see Example 5).

In another embodiment of the present invention, as a result of observing several types of mitotic errors, to determine whether mitotic defects occur in RARRES1 deficient cells,

During mitosis of RARRES1 KO MEFs, it was confirmed that chromosome alignment was misaligned in KO cells and non-segregation of chromosomes occurred (FIGS. 8A and 8B ), and to determine whether knockdown of RARRES1 would affect chromosome stability, collemide. According to Examples 1-11 of RARRES1 ^+/+ and RARRES1 ^-/- MEFs cultured according to Examples 1-7 with (colcemide) As a result of analyzing metaphase spreads, more than 20% of RARRES1 ^-/- MEFs in the middle phase showed significant aneuploidy or ploidy, and histone variant H2AX (H2AX focal formation) in both the small nucleus and primary nuclei of RARRES1 deficient cells. As measured by the damage-dependent phosphorylation of, it was confirmed that significant DNA damage was found, and that the reason for increased chromosome non-isolation was related to the occurrence of DNA damage foci and aneuploids in RARRES1 deleted cells. (See Example 6).

In another embodiment of the present invention, MEF cells are treated with nocodazole or DMSO to determine how medicaments that induce mitotic stress such as nocodazole in RARRES1 KO MEFs affect RARRES1 KO MEFs. As a result of performing flow cytometry and cell counting according to Examples 1-5, cell death induced by nocodazole was significantly reduced dose-dependently in RARRES1 deletion MEFs (FIGS. 9A and B), and upon nocodazole treatment. There was no decrease in the number of cells than WT MEF (FIG. 9c), and in line with these results, it was confirmed that cleavage of PARP and Caspase3 was reduced in KO cells when compared to WT cells (FIG. 9d), and loss of RARRES1. Through it was confirmed that it caused resistance of the nocodazole treatment (see Example 7).

In another embodiment of the present invention, according to Examples 1-12 for phospho-Cyclin B1-Ser126 and phospho-CDK1-T161 in liver and lung cancers occurring in RARRES1 KO mice As a result of immunohistochemistry, tumor fragments of RARRES1-deficient mice were strongly stained with phospho-Cyclin B1-S126 and phosph-CDK1-T161, but these cells showed negative staining around the non-cancer cancer cells (FIG. 10A ). ), it was confirmed that the activity of Cdk1-Cyclin B1 in RARRES1 deficient mice is related to tumor development (see Example 8).

Therefore, the present invention is the first loxP (locus of X-over P1) site; Drug resistant gene sites; A gene segment comprising the third exon of the RARRES1 genomic gene; And a retinoic acid receptor responder 1 (RARRES1) targeting vector for constructing an oncogenic animal model for constructing an oncogenic animal model comprising a DNA sequence consisting of a sequence of a second loxP site. A tumorigenic RARRES1 ^+/N chimeric animal model prepared by injecting lysed animal cells into a blastocyst is provided.

In front of the first loxP (locus of X-over P1) site, in order of splicing acceptor (SA), β-galactosidase (βgal), and SV40 polyA signal (pA) The DNA sequence may further include, but is not limited to, the drug resistance gene site may be a neomycin resistance gene, but is not limited thereto.

All or part of the RARRES1 gene in the target vector is “floxed” according to the DNA sequence in mammals, particularly mice, except humans. Phloxed RARRES1 can remove functions by deletion, inversion, etc. in a manner that expresses Cre recombinase in transgenic animals. In addition, transgenic animals expressing tissue-specific CRE recombinase can tissue-specifically remove RARRES1 (knockout; KO).

The Cre-loxP system using the Cre recombinase and loxP is a known method of inserting a loxP site into a target target genome with a gene knockout system and expressing Cre recombinase to induce mutations in the target gene. When the target gene is floxed, the two loxP sites are inserted into the target gene at regular intervals, for example, in or around the intron region, and recombination occurs between the loxP sites in the presence of the Cre enzyme. Genes are deleted or inverted. The first and second loxP sites herein can flank all or part of the RARRES1 gene, resulting in the deletion of all or part of the RARRES1 activity in the presence of Cre. In the absence of Cre, the fluxed RARRES1 is not affected.

The full-length E. coli β-galactosidase (βgal) gene having the intron containing the splicing donor/splicing receptor (SA) derived from SV40, the polyadenylation signal (pA), and the eukaryotic translation initiation signal Containing pCMVβ is a mammalian reporter vector designed to express β-galactosidase in mammalian cells of the human cytomegalovirus progenitor gene promoter. pCMVβ expresses high levels of β-galactosidase and can be used as a reference plasmid when transfecting other reporter gene structures, and transfected using standard assays or staining to analyze β-galactosidase activity It can be used to optimize the protocol. Alternatively, the β-galactosidase gene has a Not I site at each end so that it can insert another gene into the pCMVβ vector backbone for expression in mammalian cells or a β-galactosidase fragment into another expression vector. It can be excised using, but is not limited to.

The neomycin resistance gene has a characteristic of filtering cells that are not inserted with a carrier, but is not limited thereto, because cells cannot live in an environment treated with neomycin without the gene.

The animal cells may preferably be embryonic stem cells (ES cells), and the embryonic stem cells may be obtained from preimplantation embryos, which are generally cultured in vitro. ES cells can be cultured using methods known in the art. The introduction of the target vector into embryonic stem cells can be performed by methods known in the art. For example, pronuclear microinjection, retrovirus mediated gene transfer, gene targeting, electroporation, semen mediated gene transfer, calcium phosphate/DNA coprecipitation and micro And injection methods (microinjection). After transfecting the embryonic stem cells, only the cells having the homozygous recombination are selected by culturing in a selection medium containing a specific antibiotic to select the embryonic stem cell clones showing resistance. In one embodiment according to the present invention, loxP is recombined with each other and deletion of exon 3 between them knocks out RARRES1. Transgenic animals can be prepared for expression of Cre recombinase. In this case, the Cre recombinase can be expressed in all cells of the transgenic animal or only in cells of a specific tissue.

In the present invention, after injecting the animal cells into the cyst, it can be implanted into a surrogate mother to provide a chimeric animal model, but is not limited thereto.

In addition, as another aspect of the present invention, an RARRES1 ^+/N chimeric animal model and an oncogenic RARRES1 ^+/- animal model prepared by crossing an animal expressing cre recombinase can be provided, and expressing the cre recombinase In the animal, the gene encoding cre recombinase may be operably linked to the Zona pellucida 3 (Zp3) promoter, but is not limited thereto.

The term "Zona pellucida 3", as used herein, is also known as Zona pellucida sperm-binding protein 3, zona pellucida glycoprotein 3, or sperm receptor, and is a ZP module containing protein encoded by the ZP3 gene in humans. ZP3 is, but is not limited to, a zona pellucida receptor that binds sperm at the beginning of fertilization.

In another aspect of the present invention, (a) preparing the RARRES1 ^+/N chimeric animal model; (b) crossing the chimeric animal model of step (a) to produce a RARRES1 ^+/- animal model; Provides an animal model producing method ^- and (c) the (b) step of RARRES1 ^+/- among the offspring obtained by mating an animal model RARRES1 ^{- / -} tumor formation including the step of selecting an animal model Rarres1 ^{- /.}

In addition, as another aspect of the present invention, a tumor-forming RARRES1 ^-/- animal model prepared by the above production method is provided.

In the animal model, RARRES1 may be deficient, causing tumors, mitotic defects, or resistant to mitotic stress, inducing somatic mutations, and Ccnd1, Cdkn1a, Cdkn2A, Nanog, in mitotic cell cycle. Genes such as Psrc1 or Nup214 may be overexpressed, but are not limited thereto.

In addition, the animal model may be manufactured using mammals other than humans, and the mammals other than humans may be monkeys, rats, mice, rabbits, dogs, primates, and the like, preferably muridae animals. However, it is not limited thereto.

In addition, as another aspect of the present invention, the present invention comprises the steps of: (a) treating a candidate substance in a subject of tumor formation RARRES1 ^-/- animal model; (b) measuring the degree of phosphorylation of the subject's cyclin-dependent kinase 1 (Cyclin-dependent kinase 1; CDK1) and cyclin B1, measuring the amount or activity of the CDK1 and Cyclin B1 proteins, Measuring the expression or activity of Mist1 and LGR5, or measuring the activity of SPC (surfactant protein) positive cells; And (c) a candidate substance in which the degree of phosphorylation of CDK1 and Cyclin B1 is reduced, a candidate substance in which the amount or activity of CDK1 and Cyclin B1 protein is reduced, Mist1 (Muscle, intestine and stomach expression 1), compared to the untreated group of candidate substance. And selecting a candidate substance in which the expression or activity of LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5) is reduced, or a candidate substance in which the activity of SPC (surfactant protein) positive cells is decreased as a tumor therapeutic substance. It provides a method for screening a tumor therapeutic material comprising a.

In addition, in the present invention, (a) treating the candidate substance in vitro on the subject; (b) measuring the degree of binding of the subject's cyclin-dependent kinase 1 (Cyclin-dependent kinase 1; CDK1) to cyclin B1; And (c) provides a screening method for a cancer treatment material, comprising the step of selecting a candidate substance for reducing the binding degree of CDK1 and Cyclin B1 as a cancer treatment substance, compared to a non-treatment group of candidate substances.

Measuring the degree of binding of the tissue retinoic acid receptor responder 1 (RARRES1) and CDK1 or Cyclin B1 in step (b); And the step (c) in which the binding degree of CDK1 and Cyclin B1 is reduced and the binding degree of RARRES1 and CDK1 or Cyclin B1 is increased may be selected as a cancer treatment substance, but the present invention is not limited thereto. In the end, in step (c), RARRES1 is combined with CDK1 or Cyclin B1 to inhibit CDK1-Cyclin B1 complex formation, but is not limited thereto.

In addition, the step (b) is polymerase chain reaction (PCR), microarray (microarray), northern blotting (northern blotting), western blotting (western blotting), enzyme immunoassay (ELISA), immunoprecipitation (immunoprecipitation) ), immunochemical staining (immunohistochemistry), or immunofluorescence staining (immunofluorescence) characterized in that the measurement using, but is not limited to.

In addition, the subject is characterized in that isolated from one or more selected from the group consisting of spleen cancer, thymic cancer, liver cancer, lung cancer, kidney cancer, thyroid cancer, small intestine cancer, stomach cancer, uterine cancer, and myeloid leukemia, but is not limited thereto. The subject may be one or more selected from the group consisting of tissue, cells, whole blood, blood, saliva, sputum, cerebrospinal fluid, and urine, but is not limited thereto.

In addition, the decrease in the degree of binding of the CDK1 and Cyclin B1 is characterized in that phosphorylation of the 126th serine of the Cyclin B1 protein is suppressed, but is not limited thereto, and the increase in the degree of binding between RARRES1 and CDK1 is 269~ Characterized in that the binding to CDK1 inactivated at the C-terminal site containing amino acid 294, but is not limited thereto.

In addition, the candidate substance is used to measure the amount or activity of unknown substances, CDK1 and Cyclin B1 proteins used in screening to measure the degree of phosphorylation, to measure the expression or activity of Mist1 and LGR5 Used for screening to measure the activity of unknown substances used, SPC (surfactant protein) positive cells, or the binding degree of CDK1 and Cyclin B1 or the binding degree of RARRES1 and CDK1 or Cyclin B1. Means an unknown substance, preferably one or more selected from the group consisting of compounds, microbial cultures or extracts, natural product extracts, nucleic acids, and peptides, but is not limited thereto, and the nucleic acids are aptamers , LNA (locked nucleic acid), PNA (peptide nucleic acid), and one or more selected from the group consisting of morpholino (morpholino).

In addition, measuring the degree of phosphorylation of the subject, measuring the amount or activity of CDK1 and Cyclin B1 proteins, measuring the expression or activity of Mist1 and LGR5, measuring the activity of SPC (surfactant protein) positive cells, or of the subject Measurement of the binding degree of CDK1 and Cyclin B1 or the binding degree of RARRES1 and CDK1 or Cyclin B1 is measured by polymerase chain reaction (PCR), microarray, northern blotting, western blotting, Enzyme immunoassay (ELISA), immunoprecipitation (immunoprecipitation), immunochemical staining (immunohistochemistry), or immunofluorescence staining (immunofluorescence) is characterized by measuring using, but is not limited to this.

In addition, the tumor may be selected from the group consisting of spleen cancer, thymic cancer, liver cancer, lung cancer, kidney cancer, thyroid cancer, small intestine cancer, stomach cancer, uterine cancer, and myeloid leukemia, but is not limited thereto.

In addition, the Mist1, LGR5, or SPC is a stem cell marker, preferably a stem cell marker isolated from a mouse. In addition, the Mist1, LGR5, or SPC can be isolated from various organs of a mouse, preferably, the Mist1 or LGR5 is a stem cell marker isolated from the mouse, and the SPC is a stem cell marker separated from the lung by the mouse, or It is not limited.

Hereinafter, preferred embodiments are provided to help understanding of the present invention. However, the following examples are only provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Experiment preparation and experiment method

1-1. RT-PCR

Total RNA was extracted from rat embryonic fibroblasts using TRIZOL reagent (Invitrogen) according to the manufacturer's instructions, and 1 ug of total RNA was converted into cDNA with Superscript® III reverse transcriptase (Invitrogen). Primers used were: Rarres1-F (GCGCTGCACTTCTTCAACTT), Rarres1-R (GCCATAGCTGATGCTTCCAT). Gapdh-F (TGCACCACCAACTGCTTA), Gapdh-R (GGATGCAGGGATGATGTTC), the primers yielded PCR products of predicted sizes of 653bp and 177BP.

1-2. Cell synchronizations (blood starvation and nocodazole release)

To synchronize rat embryonic fibroblasts (MEFs) with G0 phase, the cells were wiped four times with PBS and then incubated in a medium containing 0.1% fetal bovine serum (FBS) for 72 hours. Thereafter, the cells were switched to a normal medium containing 10% FBS to start the cell cycle, and cells were harvested at a specific time.

Nocodazole release was performed to monitor the end of the cell division. After incubating for 12 hours in a medium containing 80 ng/ml nocodazole in MEF grown to about 30-40%, the cells are wiped 4 times with PBS and then replaced with normal medium to exit the cell divider, and then for a specific time. Cells were harvested.

1-3. Immunoblotting

The cells were lysed in lysis buffer (20 mM Tris, pH7.4, 5 mM EDTA, 10 mM Na4P2O7, 100 mM NaF, 1% NP-40, 1 mM PMSF, 0.2% protease inhibitor cocktail and phosphatase inhibitor). Protein concentration of cell lysates was measured using the Pierce BCA Protein Assay kit (Pierce, Rockford, USA). Subsequently, the protein lysate was resuspended in the loading buffer, boiled for 5 minutes, then SDS-PAGE was performed and immunoblotting with the indicated antibody. Protein expression was detected by chemiluminescence using SuperSignal West Pico Chemiluminescent Substrate (Pierce).

1-4. Antibodies and reagents

The following main antibodies were used for immunoblotting according to Example 1-3, indirect immunofluorescence according to Examples 1-10: mouse monoclonal antibody against Cdc2/cdk1 (Santa cruz, sc-54,1/1000) ), cyclin B1 (Cell signaling, #4135, 1/2000), cyclin D1 (Santa cruz, sc-246, 1/1000), Rb (Cell signaling, #9309, 1/2000), histone H3-phospho-Ser 10 (abcam, ab14955, 1/500), β-actin, and α-tubulin (Sigma-Aldrich, 1/5000), γH2AX (Millipore, #05-636, 1/500). Rabbit polyclonal antibody Cdk1-phospho-Thr 14 (Abgent, AP7517d, 1/500), as well as Cdk1-phospho-Thr 161 (Cell signaling, #9114, 1/1000, phosphor-(ser) CDKs substrate(Cell signaling, #2324, 1/1000), cyclin B1 (Cell signaling, #4138,1/1000), cyclin B1-phospho-ser 126 (abcam, ab55184,1/1000), cyclin B1-phospho-ser 128 (Santa Cruz, sc-130591, 1/1000), cyclin B1-phospho-ser 133 (Cell signaling, #4133, 1/1000), cyclin B1-phospho-ser 147 (Cell signaling, #4131, 1/1000), separase (Abcam , ab3762, 1/1000), cyclin E (Santa cruz, sc-481, 1/1000), Rb-phospho-Ser 807,811 (Cell signaling, #9308, 1/1000), Cell signaling, #9542, 1 /1000), caspase3 (Cell signaling, #9602, 1/1000), Ki-67 (Abcam, ab15580, 1/3000) and goat antibody against RARRES1 (R&D systems, AF4255, 1/1000).Alexa Flour 488 phalloidin (Invitrogen) was used to stain F-actin, horseradish peroxidase-tagged secondary antibodies (Jackson Immuno Research Laboratories, Inc., West Grove, USA) were used. Other reagents used in this study were obtained from Sigma-Aldrich (St. Louis, USA) unless otherwise specified. In stock. All reagents were used according to the manufacturer's recommended protocol.

1-5. Flow cytometry

Cells were fixed with ice-cold 80% ethanol for cell cycle or sub-G1 DNA content analysis and stored at 4°C. It was stained with PBS containing 50 μg/ml propidium iodide (PI) and 100 μg ml RNase A for 30 minutes at 37°C. DNA content was analyzed by FACS Calibur cytometry, and results were analyzed by Cellquest software (Becton-Dickinson Immunocytometry Systems, San Diego, CA) and Modfit LT 3.3 software. At least 10000 cells per sample were analyzed.

1-6. Generation of RARRES1 knockout mice

ES cell clones (F07 and A05) for RARRES1 knockout mice were obtained through the knockout mouse project (KOMP). A beta-galactosidase (βgal) and a neomycin-resistant (ne) selection cassette were placed in intron 2 of the mouse RARRES1 gene. Chimeras were generated through blastocyst injection of ES cells, and embryonic stem chimeras were backcrossed to C57BL/6 strains to obtain heterozygous mice for RARRES1. All mice were used in the C57BL/6 genetic background, were housed in a pathogen-free barrier environment and maintained a normal diet. For genotyping of embryos and mice, primers KO-1F (CTGGGTTCTAGCCAGTTTACAGTT), Ex3-R (ACTCAGCTTTGGGTAGCATTAGTC), F4 (CAGTTGGTCTGGTGTCAAAAATAA), KO-2R (CTCAGGTTCTAGACTTCCCTGAAA) were used for primers 593 bp (wild-type) and 478 bp (wild bp) PCR product of the predicted size of the allele) was calculated.

1-7. Culture of mouse embryo fibroblasts and epithelial cells

Mouse embryonic fibroblasts (MEFs) and mouse embryonic epithelial cells (MEEs) were derived from a 13.5-day-old fetus as previously described. That is, after removing the head and internal organs, the embryo was washed with phosphate buffered saline (PBS), chopped, and treated with trypsin/EDTA to single cellize. Embryonic fibroblasts (MEFs) were resuspended in DMEM containing 10% FBS, 2 mM L-glutamine, 0.1 mM MEM nonessential amino acids, 55 uM beta-mercaptoethanol, 100 IU/ml penicillin, 100 ug/ml streptomysin. Cell media and reagents were obtained from GIBCO (Paisley, England). Embryonic epithelial cells (MEEs) are 1% FBS, 1 mg Insulin, 1 mg Hydrocortisone, 12.5 μg EGF, 10 mg Ascorbic acid, 10 mg Transferin, 14.1 mg Phosphoethanolamine, Na selenite, 1 μg Cholera toxin, 6.5 μg Triiodo thyronine, 35 Cultured in D-MEM/F-12 medium containing mg Bovine pituitary extract, Ethanolamine, 50 IU/ml penicillin, and 50 ug/ml streptomysin. The cells were cultured in a humid chamber at 37° C. 5% CO ₂ . After embryo disintegration, plating was considered passage 0. All experiments were performed using cells within passage 5 from 3 different batches. Genotyping PCR confirmed the MEF and MEEs genotype. At least three independently generated cell lines per genotype were used.

1-8. M. LacZ staining of mouse embryos

To visualize the expression of RARRES1, the expression of LacZ from the knockout allele was analyzed. Embryos from 11.5 (E11.5) to 14.5 (E14.5) days were fixed overnight on ice with 2% paraformaldehyde, washed with PBS, and stained solution (1 mg/ml X-gal [5 -bromo-4-chloro-3-indolyl-β-D-galactopyranoside], 1mM potassium ferricyanide, 1mM potassium ferrocyanide in washing buffer). The embryos were washed three times (20 minutes each) with washing buffer (2 mM MgCl ₂ , 0.01% deoxycholate, 0.02% NP-40, 0.1M sodium phosphate, pH 7.3), and resuspended overnight at 4° C. with 2% paraformaldehyde. Then dehydrated with 70% ethanol.

1-9. PET/CT imaging

All rats were fasted (only water) for at least 6 hours for PET/CT scans. After intravenous injection of 18F-fluorodeoxyglucose (FDG) (370MBq), axial raw data were obtained from a PET scanner. The acquisition time was about 20 minutes. The axial images were reconstructed with a Shepp-Logan filter (cutoff frequency, 0.35 cycles per pixel) and rearranged in terms of coronal and sagittal. The spatial resolution was 6.1±6.1±4.3 mm.

1-10. Immunofluorescence

MEF was fixed in PBS/3.7% paraformaldehyde for 10 minutes at room temperature (RT), permeated for 5 minutes in 0.2% PBS/Triton X-100, and blocked in PBS/3% BSA for 30 minutes at room temperature. Samples were incubated overnight at 4° C. with primary antibody. Then, 0.05% Tween-20/PBS was washed (3 times), the secondary antibody was incubated for 2 hours at RT, DAPI (0.5 ug/ml) for 5 minutes at RT, and then washed with PBS. The coverslips were mounted on a glass slide using Prolong Gold antifade reagent (Invitrogen) and observed with a confocal microscope (Zeiss 510 Meta, Carl Zeiss). For quantification of gamma-H2AX positive cells, at least 100 cells per MEF line were analyzed.

1-11. Metaphase spreading

To prepare for mid-term diffusion from MEF and analyze them through aneuploidy, MEFs in passage 5 were treated with 0.1 ug/ml Colcemide (GIBCO BRL) at 37° C. for 4-5 hours. After trypsin treatment, cells were centrifuged at 800 rpm for 10 minutes, resuspended in 5 ml of 0.075M KCl, and incubated at 37°C for 20 minutes. They were fixed in freshly prepared Carnoy solution (methanol: glacial acetic acid = 3:1) and then resuspended in the appropriate amount of Carnoy solution. The cell suspension was dropped on a microscope/glass slide and air dried. The chromosomes were visualized with DAPI (0.5 ug/ml) staining and analyzed under a confocal microscope (Zeiss 510 Meta, Carl Zeiss) using a 100X objective lens.

1-12. Immunohistochemistry (IHC)

Mice were sacrificed and their organs were placed in buffered formalin (10%) and fixed for ~24 hours and fitted with paraffin. Paraffin visceral tissue blocks were cut to a thickness of 4 μm and sections were dried at 56° C. for 1 hour. Immunohistochemical staining was performed using the automated staining apparatus Discovery XT (Ventana Medical System, Inc.Tucson Medical System, Inc., Tucson Arizona, USA) as follows. Sections were deparaffinized and rehydrated with EZ prep (Ventana) and washed with reaction buffer (Ventana). Antigen was recovered by heat treatment for 30 minutes at 90° C. in pH6.0 citric acid buffer (Ribo CC, Ventana) for Phopho-cyclin B1-Ser126, anti-phospho-Cdk1-Thr 161 and anti-Ki67.

1-13. Next-generation sequencing analysis for whole genome sequencing and RNA-Seq

WGS data was generated from the genomic DNA of each sample, and the genomic DNA was amplified and sequenced using HiSeq 2500. Trimmomatic v.0.36 was used to reduce low quality readings, and reduced readings were sorted by mm10 using BWA 0.7.13. Joint cleaning and post-sorting quality control was performed using GATK 3.5 and Picard 2.7.1. MuTect2 was used to identify somatic mutations for matching pairs of tumor and normal samples. In the absence of a matched normal sample, a variant call was made using each of the three non-matched normal samples as a control, and the variant called at least twice was selected. All somatic mutations were filtered to exclude germline variants called wild-type embryos and annotated using ANNOVAR 2016.2.1. According to GATK best practices, somatic cell replication number variants (CNV) were detected when all normal samples were used as normal panels. Sota Structural Variants (SV) was called using Manta v1.3.2. For incomparable tumor samples, SV calls were made to each of the three incomparable normal samples as a control and the crossing was selected. In addition, RNA-Seq low resolution reads were trimmed and aligned to mm10 and RefSeq gene model references using STAR 2.5.2b. Gene expression profiles were quantified using RSEM 1.3.0. The following comparison was tested to identify genes that change significantly over time in the knockout group compared to the wildtype group.

1. 3 time points in the knockout group (with 18 month old tumor sample), 2. 3 time points in the knockout group (with 18 month old normal sample), 3. 3 time points in the wild type group, 4. 18 month old Tumor and normal samples.

The R package'EBSeqHMM' was used to identify genes differentially expressed in the first three tests. The fourth test was conducted using the R package'limma'. Among the genes that were significant in the first test, genes that were not differentially expressed in the fourth test were filtered out, but the results were statistically significant in the second and third tests. Gene set enrichment analysis (GSEA) was performed on selected gene sets using DAVID 6.7, and pathway activity was assessed using gene set variation analysis (GSVA) with reference to the MSigDB HALLMARK pathway gene set.

In addition, the results of differential expression analysis through a protein-protein interaction (PPI) network were integrated. First, an experimentally verified protein interaction was added to the mouse BioGRID network to construct a PPI network. Based on the total p value calculated from the adjusted p-values in the first and fourth tests, the optimal sub-network was derived from the PPI network using the R package "BioNet". Again, GSEA was performed on genes in the optimal subnetwork.

1-14. Additional functional study using TCGA lung adenocarcinoma and comparison with lung single cell profile

Somatic mutations of RARRES1 from TCGA lung adenocarcinoma, CNVs, gene expression profiles and related pathways were investigated. Somatic mutation and CNV were induced from TCGA level3 data. Next, GSVA was used to estimate pathway activity for each cluster, and gene expression of key markers was examined from the gene expression profile. In addition, the protein and mRNA status of Cdk1 binding to RARRES1 was examined from a comparison of RPPA and gene expression. The rich state of normal and interstitial lung cells is estimated from the results of single cell mouse atlas (scMouse) lung tissue, defining 24 normal lung cells and their marker genes (Supple 1). Cell deconvolution was attempted using a mouse gene expression profile in 24 lung cells using the MCP-counter referencing the marker gene. Equivalent estimates were made in the TCGA lung adenocarcinoma expression profile and the average cell abundance for each subtype defined in the TCGA study was summarized.

1-15. Cell proliferation

Growth was confirmed using MEFs from a 13.5-day-old fetus. After placing 20,000 cells/well in 6 well plates, the number of cells was measured daily for 5 days from the next day. To investigate the cell survival response to the cell division inhibitor nocodazole, cells were grown by treating 50 and 100 ng/ml nocodazole for 48 hours. Thereafter, cells were detached by treatment with trypsin/EDTA, and then the number of cells was measured.

1-16. Live cell imaging

The day before, a retrovirus capable of expressing the H2B-separase sensor was infected with embryonic epithelial cells laid on a lab-tekⅡ chammber. After 3 days, fluorescence images were taken by inserting a total of three z-stacks at 5 min intervals using a microscope (Carl Zeiss, Germany) in a humidified incubator condition at 37° C. and 5% CO 2 inside the video microscope platform. After combining the z-stacks of the captured images, the fluorescence intensity in the chromosome for each image was measured using Zen 2 pro blue sofrware.

Example 2. Generation of RARRES1 knockout mice

To determine the in vivo physiological function of RARRES1, conditional RARRES1 knockout mice were derived from mouse embryonic stem (ES) cell clones (F07 and A05) against a knock out mouse project (KOMP). Target structures comprising a splicing acceptor (SA), β-galactosidase (βgal), and SV40 polyA signal (pA), followed by a phloxed neomycin-resistant cassette regulated by the β-actin promoter ( floxed neomycin-resistance cassette (neo)) was inserted into the intron 2 of the mouse RARRES1 gene. In addition, the third loxP is inserted and located in intron 3, and consequently, exon 3 is surrounded by two loxP sequences recognized and removed by cre recombinase (FIG. 1A ). RARRES1 ^+/N progeny were obtained by injecting correctly targeted ES clones into the blastocyst. RARRES1 ^+/- mice were made by crossing RARRES1 ^+/N males with transgenic females expressing the cre recombinase in the germ line, which is regulated by the mouse zona pellucida 3 (Zp3) promoter. In addition, the coverage of RARRES1 confirmed by sequencing of RARRES1 RNA-seq is shown in a table to confirm generation of knockout documents of Rarres1 (FIG. 1B). In addition, it was confirmed through whole genome sequencing that RARRES1 total mRNA expression was not normally performed due to deletion of the DNA exon3 sequence (FIG. 1C). As a result, it was confirmed that the RNA-seq coverage of the corresponding base sequence was 0.

Producing progeny ^through tail genome DNA of RARRES1 ^+/+ , RARRES1 ^+/- , and RARRES1 ^-/- MEFs (FIG. 1D) and PCR genotyping of RT-PCR according to the method of Example 1-1 (FIG. 1E ). One RARRES1 ^+/- mouse was validated by cross-analysis. At 13.5 days after embryonicity, Western blot analysis of whole embryo lysates did not decrease protein expression levels in RARRES1 ^+/- compared to RARRES1 ^+/+ , but levels of RARRES1 protein were lower in RARRES1 ^-/- embryos Appeared (Fig. 1f). Due to the fusion of RARRES1 and βgal, the expression of RARRES1 in RARRES1 ^+/- embryos can be easily monitored through LacZ staining according to Examples 1-8. As shown in Fig. 1g, RARRES1 exhibited limited expression in the whole embryo from 11.5 to 14.5 days after embryonication, and was mainly stained with LacZ according to 1-8 in practice around the forelimbs and hind limbs, and the eyes of the embryo. There was a weak staining.

In addition, in order to investigate the effect of RARRES1 knockout on embryonic lethality, heterozygotes and genotypes of embryos were cross-analyzed on day 13.5 and examined in infant mice. As can be seen in Table 1, 82 embryos and 165 newborn mice were present at the expected Mendel ratio. RARRES1 heterozygous mice and homozygous mice had normal appearance and health. Therefore, this target knockout of RARRES1 did not affect survival during embryonic development.

Next, RARRES1 ^- deficient mice were tested for infertility by crossing RARRES1 ^-/- females with RARRES1 ^+/- males or RARRES1 ^-/- males with RARRES1 ^+/- females. If the KO mouse, regardless of gender, has abnormal fertility, the offspring cannot be born. Newborn animals survived as predicted according to Mendel's genetic laws, and seemingly normal and healthy, suggesting that RARRES1-deficient mice have normal fertility (Table 2).

Example 3. Confirmation of non-lymphoid hematopoietic tumor of RARRES1 knockout mouse

Cells of bone marrow, spleen and terminal blood were extracted from the documents of genotypes of Rarres1 ^+/+ and Rarres1 ^-/- in order to confirm the possibility of nonlymphoid neoplasia formation in Rarres1 knockout mice (KO mice). This was reacted with the following antibodies in FACS buffer (1×PBS with 0.1% bovine calf serum and 0.05% sodium azide) at 4°C for 30 minutes-eFluor 450-conjugated anti-mouse hematopoietic lineage antibody cocktail [CD3 (17A2), CD45R (RA3-6B2), CD11b (M1/70), TER-119 (TER-119), Gr-1 (RB6-8C5)] (eBioscience, San Diego, CA, USA), eFluor 450-conjugated anti-Ly-6G (RB6-8C5, eBioscience), eFluor 450-conjugated anti-CD3ε (145-2C11, eBioscience), Alexa Fluor 488-conjugated anti-CD8α (53-6.7, eBioscience), phycoerythrin-cyanine7 (PE-Cy7)-conjugated anti-CD11b (M1/70, eBioscience) , allophycocyanin-eFluor 780 (APC-eFluor 780)-conjugated anti-CD11c (N418, eBioscience), APC-eFluor 780-conjugated anti-CD4 (GK1.5, eBioscience), Alexa Fluor 488-conjuaged anti-Sca-1 (D7, Biolegend, San Diego, CA, USA), PE-conjugated anti-CD45R (RA3-6B2, BioLegend), PE-conjugated anti-CD25 (PC61, BioLegend), Alexa Fluor 647-conjugated anti-CD117 (2B8, BioLegend), Alexa Fluor 647-conjugated anti-Ly-6c (HK1.4, BioLegend), PE-Cy7 conjugated anti-CD16/32 (93, BioLegend), PE-Cy7 conjugated anti-CD19 (6D5, BioLegend), Brilliant Violet 650 (BV650) -conjugated anti-CD11b (M1/70, BioLegend), BV650-conjugated anti-IA/IE (M5/114.15.2, BioLegend), BV650-conjugated anti-CD44 (IM7, BioLegend).

For intracellular staining, it was fixed with 4% paraformaldehyde for 20 minutes at room temperature. After fixation, washed with 1×PBS and secured cell permeability with 0.5% Triton X-100, and stained for 1 hour at room temperature with Alexa Fluor 647-conjugated anti-FOXP3 (MF-14, BioLegend). The stained cells were analyzed for the degree of fluorescence value with BD LSRFortessa (BD Bioscience, San Jose, CA, USA), and the results were analyzed using FlowJo software (TreeStar, Ashland, OR, USA). Through this, the c-Kit positive staining, Sca-1 tone staining cell group, known as the progenitor layer of myeloid cells, increased in the knockout documents group, and CMP (common myeloid progenitor) and GMP (granulocyte, monocyte progenitor) cells increased in the knockout spleen. Did. An increase in the number of myeloid cells in actual terminal blood was observed (FIG. 2 ).

Example 4. RARRES1 knockout (Knockout; KO) mice susceptible to spontaneous tumors

To confirm that tumors spontaneously form in RARRES1 KO mice, in heterozygous RARRES1 heterozygous mice (C57BL/6), RARRES1 ^+/+ (n=30), RARRES1 ^+/- (n=57), and a population of RARRES1 ^-/- (n=63) mice was formed and observed until 22 months. Animals were either autopsied immediately after death in the course of the experiment, or sacrificed with carbon dioxide suffocation and autopsied to find tumors in these mice.

After necropsy, the parenchymal organs of each mouse were immediately immobilized in 10% neutral formalin, and the fixed tissues were made into paraffin blocks and sections, and then hematoxylin/eosin staining was performed for histopathological examination. In histopathological examination of each organ, abnormal neoplasms, which are distinguished from normal histological structures, were defined as tumors. A neoplasm with metastatic findings was diagnosed as a malignant tumor.

As a result, we found that RARRES1 ^+/- and RARRES1 ^-/- mice are more susceptible to tumors spontaneously than RARRES1 ^+/+ mice. In addition, RARRES1 ^+/- and RARRES1 ^-/- mice develop different types of tumors than RARRES1 ^+/+ mice, including the spleen, thymus, liver, lung, kidney, thyroid, small intestine, stomach, endometrium and eyes Was confirmed (Table 3). In RARRES1 ^-/- mice, solid tumors in various major organs such as liver, lung, and gastric tumors occurred and solid tumors in the thyroid showed metastasis to the liver (Table 3 and FIGS. 3A, 3B, and 3C). . In addition, unlike RARRES1 ^+/+ mice, RARRES1 ^-/- mice have developed more advanced forms of T lymphocyte-derived lymphoma (T cell lymphoma) that have spread to various organs such as the thymus, kidney, and bladder. It was confirmed by histochemical staining (Table 3 and Figure 3d). In addition, it was confirmed by immunohistochemical staining for myeloperoxidase, a myeloid cell marker, that myeloid leukemia associated with bone marrow and spleen occurs more frequently in RARRES1 ^-/- mice (Fig. 3e). On the other hand, in this regard, the size of organs including spleen, liver, and kidney gradually increased according to genotype in 19-month-old mice (FIG. 4 ).

Also, RARRES1 ^+/+ (n=6), RARRES1 ^+/- (n=6), and RARRES1 ^-/- (n=6) according to Examples 1-9 for a population of mice Tumor growth was monitored using PET/CT, and the same mice were observed over two months from 6 to 15 months of age. According to Examples 1-9 [ ¹⁸ F] When FDG PET/CT imaging was used, it was not possible to distinguish the degree of mouse fludeoxyglucose (FDG) uptake between KO and WT mice until 10 months of age, but the age was similar to that of 10-month-old mice. Compared to wild type mice, FDG uptake intensity of RARRES1 deficient mice increased mainly around the spinal cord. At 14.5 months, the intensity of FDG uptake in the liver of RARRES1 KO mice was gradually improved when compared to WT mice (2/6 (33%)). According to Examples 1-9 PET/CT imaging showed that tumors started much earlier in RARRES1 KO mice than in WT mice (Fig. 5).

Overall, a causal relationship between knockdown of RARRES1 expression and cancer development was established, confirming that RARRES1 deletion alone is sufficient to cause tumorigenesis.

Example 5. Cell cycle progression through fine tyning regulatin of CDK1-Cyclin B1 activity in RARRES1 knockout (KO) mice

It was found that RARRES1 inhibits CDK1-cyclin B1 activity in mitosis, and RARRES1 KO mice increase tumor formation. In addition, Cyclin B1 transgenic mice were found to be very susceptible to tumors. Through this, in order to test whether activation of CDK1-cyclin B1, which is regulated by direct binding of RARRES1 for each component, promotes tumor formation in RARRES1 KO mice, the embryos were wild-typed in embryos 13.5 days after incubation for in vitro culture. RARRES1 deficient MEFs according to Examples 1-7 were prepared and western blots were performed. As expected, phosphorylation of CDK1 at threonine 14 and 161 residues was enhanced in KO MEFs, but CDK1 expression did not change in other MEF cells. In addition, Cyclin B1 phosphorylation (serine 126, 128, 133 and 147) was further accumulated when compared to WT counterparts in RARRES1 deficient MEFs. CDK activity was measured using an antibody against a phosphorylated CDK substrate that detects phospho-serine in the (K/R)(S*)PX(K/R) motif, the sequence of the CDK substrate, which is elevated in deficient MEF. did. Rb, which is phosphorylated in G1 and dephosphorylated, phosphorylated from S to M in the cell cycle, is the substrate of CDK1, and is phosphorylated by the active CDK1-cyclin B1 complex in mitosis. Rb protein was increased and phosphorylated in KO MEFs. Separase, another substrate of CDK1, is cleaved in KO cells, indicating that CDK1-Cyclin B1 activity appears due to the deficiency of RARRES1 (FIG. 6 ).

Next, we investigated whether the increase of CDK1-Cyclin B1 activity can affect the cell growth of MEF cells. MEF cells were seeded 3 times at a density of 2 x 10 ⁴ cells per 6-well plate cells and cell counts were counted daily for 5 days. Compared with RARRES1 ^{+ / +} cells, RARRES1 ^{- / -} MEFs grew faster (FIG. 7A ).

RARRES1 ^-/- To assess whether the enhanced tumor cell proliferation observed in MEFs is due to altered cell cycle progression, the G1 to G2/M phase, G2/M to G1 transition using the cell synchronization experiment according to Example 1-2 Studied. Serum stimulation (10% FBS) for up to 42 hours followed by serum starvation (0.1% FBS) for 72 hours compared to WT cells from G1 to G2/M stages of the cell cycle RARRES1 ^-/- It was shown that it progressed faster in the cells and lasted much longer in the G2/M phase (FIG. 7B ). The expression of Cyclin D, which was found to activate CDK4/6 during G1 period and bind to post-expression during G1 period and prepare for DNA synthesis, peaked in fresh medium from serum starvation of WT cells 24 hours after release, but this protein Expression was down-regulated during the overall period of KO cells. Activation of the CDK4/6-cyclin D complex inactivates Rb retinoblastoma of the G1 phase by multiple phosphorylation called'hypo-phosphorylation'. Rb phosphorylation peaked in both cell lines within 27 hours after serum stimulation. However, in cells lacking RARRES1, phosphorylation was maintained until 42 hours. Rb binds to the E2F transcription factor in the initial G1 stage, and hypo-phosphorylated Rb induces the release of E2F leading to the expression of cyclin E, which binds and activates CDK2, thereby causing Rb protein by hypo-phosphorylation Inactivation results in activation of the CDK2-cyclin E complex. Cyclin E expression in WT cells peaked at 30 hours after serum stimulation and decreased rapidly, but Cyclin E peaked at 30 hours and decreased slightly in KO cells (FIGS. 7C and 7D ). Using the nocodazole-releasing method combined with FACS and western blot analysis, it was found that the termination of mitosis was faster in RARRES1 deficient cells compared to WT cells (FIG. 7E ). This difference in cell cycle was accompanied by a difference in activation of CDK1 and Cyclin B1. KO cells enhanced the active phosphorylation of CDK1 (Threonine 161) and the phosphorylation of Cyclin B1 (Serine 126, 133 and 147). High CDK1 activity leads to the separation of sister staining powders by regulating the activity of the separating enzyme, but does not complete cytosolic division. The expression of the separating enzyme increased over the whole time, was cleaved by this activation after 18 hours, and phosphorylation of the substrate Rb, the substrate of CDK1 in KO cells, was improved from 6 hours to 18 hours after release (Fig. 7f), which was RARRES1 ^{− /-} indicates that the cells increased CDK1-Cyclin B1 activity. These results showed that the activity of the CDK1-Cyclin B1 complex was high in RARRES1 KO MEFs compared to WT MEF, indicating that the timing of cell cycle progression was inappropriate and fast.

Example 6. Loss of RARRES1 leading to mitotic defects and chromosomal instability

It was investigated whether mitosis defects occurred in RARRES1 deficient cells, thereby confirming the high activity of the CDK1-Cyclin B1 complex and the progress of the unregulated cell cycle. Several types of mitotic errors were observed, including misalignment chromosome, chromatin bridge, and lagging chromosome (FIG. 8A). According to Examples 1-10 As a result of analysis by immunofluorescence, it was confirmed that during mitosis of RARRES1 KO MEFs, misalignment of chromosomes and non-isolation of chromosomes occurred in KO cells (FIGS. 8B and 8C ).

Recently, chromosome separation errors in mitosis have been shown to cause chromosomal abnormalities including aneuploidy (numerical) and structural abnormalities (potential and deletion), so to determine whether knockdown of RARRES1 affects chromosome stability According to Examples 1-11 in RARRES1 ^+/+ and RARRES1 ^-/- MEFs according to Examples 1-7 cultured with colcemide Metaphase spreads were analyzed and chromosome numbers were determined. At 5 passages (P5), RARRES1 ^+/+ MEFs had almost normal karyotypes, but more than 20% of RARRES1 ^-/- MEFs in the mid-term showed significant aneuploidy or ploidy (Table 4).

The structural abnormality of MEF cells was investigated. RARRES1 deficient cells showed significant DNA damage as measured by damage-dependent phosphorylation of the histone variant H2AX (gamma-H2AX focal formation) in both the small and primary nuclei. Compared to this, gamma-H2AX merging was rarely found in WT MEF (FIGS. 8C and 8D). Taken together, it was confirmed that chromosome non-isolation can be increased by the occurrence of DNA damage foci and aneuploids in RARRES1 deleted cells.

Example 7. Nocodazole resistance in RARRES1 knockout (KO) cells

We determined how mitotic stress-inducing drugs such as nocodazole affect RARRES1 KO MEFs. MEF cells were treated with nocodazole (50 and 100 ng/ml) or DMSO for 48 hours, and flow cytometry and cell counting according to Examples 1-5 were performed. As a result, cell death induced by nocodazole was significantly decreased in dose-dependently in RARRES1 deficient MEFs (Figs. 9A and 9B), and cell number was not decreased by nocodazole treatment than WT MEF (Fig. 9C). . Consistent with these results, the cleavage of PARP and Caspase3 was reduced in KO cells compared to WT cells (FIG. 9D ), confirming that the loss of RARRES1 caused resistance of nocodazole treatment.

Example 8. Increased phosphorylation of CDK1 and Cyclin B1 in solid tumors of RARRES1-deficient mice

According to Examples 1-12 for phospho-Cyclin B1-Ser126 and phospho-CDK1-T161 in liver and lung cancers occurring in RARRES1 KO mice. Immunohistochemistry (IHC) was performed. These two antibodies were negatively stained in liver and lung sections of WT mice, but strongly stained with phospho-Cyclin B1-S126 and phosph-CDK1-T161 in tumor sections of RARRES1-deficient mice, and these antibodies were found around cancer cells other than cancer. It showed negative staining (FIG. 10A). These IHC results suggest that the activity of Cdk1-Cyclin B1 in RARRES1 deficient mice is associated with tumor development. On the other hand, RARRES1 ^+/- compared to the same age (18 months of age), subjected to immunohistochemical staining for the marker Ki67, CDK1, phosphorylated Rb protein representing the activation of the cell cycle in the mouse lung resulting in, RARRES1 ^{+ / +,} In RARRES1 ^-/- mice, a number of cells showing positive responses to the above three markers were observed (Fig. 10B).

Example 9. RARRES1 contributing to organ-blast cell homeostasis

Simultaneously using fluorescence fluorescence for type II pneumocyte marker surfactant protein C (SPC) and Ki67 indicating cell cycle activation in lung tissue obtained from mice of the same age (18 months old), respectively. As a result of immunohistochemical staining, the cell type with activated cell cycle was more frequently observed in RARRES1 ^-/- compared to RARRES1 ^+/+ (FIG. 11A ). Gastric specific stem cell markers Mist1, LGR5 (3 months old) in gastric tissue obtained from a 3 month old mouse (Fig. 11b) specifically deficient in RARRES1 and a 18 month old mouse deficient in RARRES1 in the whole body (Fig. 11c), or Mist1, CDK1 (18 months of age) with a fluorescence-immunohistochemical staining carried out the result, RARRES1 systemic specifically above multiple compared to the mice with the above specifically the control mice in all mice deficient in the enemy stem cells were observed ( 11B and 11C).

In the case of the spheroid-formation assay, as described above, advanced DMEM/F12 medium used for embryonic epithelial cell culture was used, and 2000 or 5000 cells per well in a 24 well plate were suspended in 300ul of medium. And seeded. The size and number of spheres formed were measured by adding 300ul of medium once every 3-4 days. In addition, it was confirmed how the sphere formed by varying the processing RO3306 inhibiting the CDK1 activity of the embryo epithelial cells from control mice and the mice are RARRES1. As a result, embryonic epithelial cells obtained in mice lacking RARRES1 were more active in the group not treated with RO3306 compared to control mice. On the other hand, in the group that inhibited the activity of CDK1 by treating RO3306, it was confirmed that the overall sphere formation was greatly reduced, and that the activity of CDK1 was an important factor for sphere formation. In addition, it was found that embryonic epithelial cells of the control mice hardly formed spheres, whereas embryonic epithelial cells obtained from mice lacking RARRES1 formed spheres, thus deficiency of RARRES1 increased CDK1 activity to maintain stem cell function. Could (Fig. 11d, 11e).

In the case of gastric organoid of the mouse, after removing the stomach of the mouse, separate the base of the stomach (fundus) and the pylorus (pylorus), put in 8 mM EDTA solution, and cut (chopping) at 4°C for 1 hour. Cultured for a while. Then, it was separated into a single cell through centrifugation and filtering. Then, after suspension with matrigel, it was seeded into a 48 well plate. After incubation at 37° C. for 5-10 minutes, the matrigel was hardened, and then a medium in which growth factor was added based on advanced DMEM/F12 media around the metrigel was added. Filled. Thereafter, the medium and growth factor were changed and maintained once every 2-3 days. As a result, it was confirmed that gastric organoids obtained from mice lacking RARRES1 in the stomach were formed faster than those obtained from control mice (see FIG. 11F ).

Example 10. Somatic cell transformation analysis using whole genome sequencing

As shown in Table 5, all non-silent somatic mutations were identified. In particular, the BRAF p.V637E mutation in mice was consistent with the target of the Vemurafenib human BRAF p.V600E variant. That means that the RARRES1 KO mouse model induces somatic mutations that can target. Bcl9l nonsynonymous (p.S898T) and Gnas (p.N964delinsNG) nonframeshift insertion were found in cancer-related genes. All somatic mutations are shown in Table 6.

Sample Chr Start End Ref Alt Gene. ExonicFunc AAChange refGene refGene refGene 6T chr6 39627783 39627783 A T Braf nonsynonymous SNV exon18:c.T1910A:p.V637E 4T chr2 174345439 174345439 - CGG Gnas nonframeshift insertion exon8:c.2891_2892insCGG:p.N964delinsNG 5T chr9 44507447 44507447 T A Bcl9l nonsynonymous SNV exon7:c.T2692A:p.S898T

Cell Marker Alveolar bipotent progenitor Krt8,Emp2,Aqp5,Sftpd,Sftpa1 Alveolar macrophage Ear2,Ear1,Cd68,Marco,Siglecf,Chil3,Pclaf,Marco,Siglecf,Ccna2 AT1 Cell Ager,Igfbp2,Hopx,Clic5,Pdpn AT2 Cell Sftpc,Sftpa1,Sftpb,Sfta2,Dram1 B Cell Cd79a,Ms4a1,Cd79b,Ighd,Cd19 Basophil Ccl4,Ccl3,Il6,Cd69,Cd200r3 Ciliated cell Ccdc153,Tmem212,1110017D15Rik,Foxj1,Ccdc17 Clara Cell Scgb1a1,Aldh1a1,Cyp2f2,Scgb3a1,Hp Conventional dendritic cell Gngt2,Lst1,Plac8,Itgb2,Cd68,Cd209a,Itgax,Cd74,H2-Eb1,Itgam,Fscn1,Ccl22,Nudt17,H2-M2,Syngr2 Dendritic cell Naaa,Irf8,Cd74,Itgax,Itgae Dividing cells Cdc20,Ube2c,Stmn1,Pclaf,Tubb5 Dividing dendritic cell Cd74,H2-Aa,H2-Ab1,Naaa,Ccnb2 Dividing T cells Thy1,Cd8b1,Cdk1,Cd3g,Cd3d Endothelial cell Eng,Kdr,Flt1,Cdh5,Pecam1,Car4,Kdr,Flt1,Cdh5,Pecam1,Vwf,Kdr,Flt1,Cdh5,Pecam1 Eosinophil granulocyte G0s2,Clec4d,S100a9,S100a8,Cd14 Ig-producing B cell Jchain,Igha,Igkc,Ighm,Igkv2-109 Interstitial macrophage C1qc,C1qa,Pf4,Cd74,Adgre1 Monocyte progenitor cell Elane,Mpo,Ctsg,Prtn3,Ms4a3 Neutrophil granulocyte Ngp,S100a9,S100a8,Cd177,Ly6g NK Cell Nkg7,Klra8,Klra4,Klrb1c,Klra13-ps Nuocyte Cxcr6,Icos,Thy1,S100a4,Il7r Plasmacytoid dendritic cell Ms4a6c,Plac8,Bst2,Irf7,Irf5 Stromal cell Dcn,Col3a1,Fgf10,Tcf21,Hoxa5,Inmt,Gsn,Fgf10,Tcf21,Hoxa5,Acta2,Myl9,Fgf10,Tcf21,Hoxa5 T Cell Trbc2,Cd8b1,Cd3d,Cd3g,Thy1

Somatic cell replication number variants (CNV) and structural variants (SV) of all mouse tumor samples (n = 5) occurred at low frequency in consideration of genome stable cancer. As shown in FIG. 12, amplification or deletion of segmentation-level CNV was not present in the tumor sample. Meanwhile, as shown in Table 7, 64 structural variants (SV) of somatic cells were identified in the tumor samples. Deletion (n = 27) and translocation (n = 32) occurred most frequently. In particular, the Cdkn1a deletion around chr17 region: 27975841-29991317 is present in the KO4T specimen.

SAMPLE CHROM1 POS1 CHROM2 POS2 SVCLASS GENE CANCERGENE INFO FORMAT TUMOR T18_KO2T chr12 111538547 chr12 111539406 Deletion Eif5 . END=111539406;SVTYPE=DEL;SVLEN=-859;CIGAR=1M859D;CIPOS=0,1;HOMLEN=1;HOMSEQ=G;SOMATIC;SOMATICSCORE=115 PR:SR 42,15:42,19 T18_KO2T chr12 111539685 chr12 111539798 Deletion Eif5 . END=111539798;SVTYPE=DEL;SVLEN=-113;CIGAR=1M113D;CIPOS=0,4;HOMLEN=4;HOMSEQ=AGGT;SOMATIC;SOMATICSCORE=71 PR:SR 10,0:51,20 T18_KO2T chr12 111539882 chr12 111540129 Deletion Eif5 . END=111540129;SVTYPE=DEL;SVLEN=-247;CIGAR=1M247D;SOMATIC;SOMATICSCORE=87 PR:SR 46,12:44,25 T18_KO2T chr12 111540571 chr12 111541704 Deletion Snora28,Eif5 . END=111541704;SVTYPE=DEL;SVLEN=-1133;CIPOS=0,1;CIEND=0,1;HOMLEN=1;HOMSEQ=G;SOMATIC;SOMATICSCORE=49 PR:SR 54,4:56,9 T18_KO2T chr12 111541844 chr12 111542150 Deletion Eif5 . END=111542150;SVTYPE=DEL;SVLEN=-306;CIGAR=1M306D;CIPOS=0,2;HOMLEN=2;HOMSEQ=GG;SOMATIC;SOMATICSCORE=85 PR:SR 41,1:39,19 T18_KO2T chr12 111542841 chr12 111543099 Deletion Eif5 . END=111543099;SVTYPE=DEL;SVLEN=-258;CIGAR=1M258D;SOMATIC;SOMATICSCORE=65 PR:SR 52,3:62,18 T18_KO2T chr12 111543262 chr12 111543524 Deletion Eif5 . END=111543524;SVTYPE=DEL;SVLEN=-262;CIGAR=1M262D;CIPOS=0,3;HOMLEN=3;HOMSEQ=AGG;SOMATIC;SOMATICSCORE=65 PR:SR 48,0:57,18 T18_KO2T chr12 111543659 chr12 111544526 Deletion Eif5 . END=111544526;SVTYPE=DEL;SVLEN=-867;CIGAR=1M867D;CIPOS=0,4;HOMLEN=4;HOMSEQ=AGGT;SOMATIC;SOMATICSCORE=96 PR:SR 59,4:53,27 T18_KO2T chr5 45985059 chr5 45986594 Deletion . END=45986594;SVTYPE=DEL;SVLEN=-1535;CIPOS=0,8;CIEND=0,8;HOMLEN=8;HOMSEQ=AGGAAGCT;SOMATIC;SOMATICSCORE=115 PR:SR 27,20:20,15 T18_KO2T chr5 121093327 chr5 151725086 Inversion . END=151725086;SVTYPE=INV;SVLEN=30631759;INV3;SOMATIC;SOMATICSCORE=33 PR:SR 51,2:50,2 T18_KO2T chr7 34328736 chr7 34329386 Deletion . END=34329386;SVTYPE=DEL;SVLEN=-650;CIGAR=1M650D;CIPOS=0,40;HOMLEN=40;HOMSEQ=TCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCT;SOMATIC;SOMATICSCORE=39 PR:SR 23,0:21,9 T18_KO2T chr7 55643415 chr12 111538242 Translocation Eif5 . SVTYPE=BND;MATEID=MantaBND:7051:10:11:0:0:0:1;SOMATIC;SOMATICSCORE=223;BND_DEPTH=41;MATE_BND_DEPTH=46 PR:SR 18,20:26,30 T18_KO2T chr7 55643426 chr12 111546484 Translocation Eif5 . SVTYPE=BND;MATEID=MantaBND:7051:9:11:0:0:0:0;IMPRECISE;CIPOS=-448,448;SOMATIC;SOMATICSCORE=101;BND_DEPTH=41;MATE_BND_DEPTH=38 PR 39,19 T18_KO2T chr7 55643556 chr12 111539298 Translocation Eif5 . SVTYPE=BND;MATEID=MantaBND:7051:1:11:0:0:0:1;IMPRECISE;CIPOS=-285,286;SOMATIC;SOMATICSCORE=51;BND_DEPTH=45;MATE_BND_DEPTH=44 PR 44,6 T18_KO4T chr17 16978502 chr17 17046447 Deletion . END=17046447;SVTYPE=DEL;SVLEN=-67945;IMPRECISE;CIPOS=-273,273;CIEND=-319,319;SOMATIC;SOMATICSCORE=61 PR 32,7 T18_KO4T chr17 27975841 chr17 29991317 Deletion Trp53cor1,Mir6969,Stk38,Clps,Cdkn1a,Fkbp5,Pim1,Ppard,Rpl10a,Srsf3,4930539E08Rik,Srpk1,Tcp11,Tead3,Tulp1,Anks1,Zfp523,Slc26a8,Def6,Cpne5,Cpne5,Cpne5 Clpsl2,Lhfpl5,Tbc1d22b,Pnpla1,Rab44,Mtch1,Rnf8,Kctd20,Armc12,Ccdc167,Ppil1,1810013A23Rik,Pxt1,Tmem217,Fance,Tbc1d22bos,Pi16,Cmtr1,1700030AgaRik Cdkn1a,Pim1,Srsf3,Fance END=29991317;SVTYPE=DEL;SVLEN=-2015476;CIPOS=0,5;CIEND=0,5;HOMLEN=5;HOMSEQ=TCCCA;SOMATIC;SOMATICSCORE=21 PR:SR 58,2:43,2 T18_KO4T chr3 95073759 chr10 81306111 Translocation Pip5k1a,Pip5k1c . SVTYPE=BND;MATEID=MantaBND:1714:0:1:0:0:0:1;IMPRECISE;CIPOS=-242,242;SOMATIC;SOMATICSCORE=18;BND_DEPTH=39;MATE_BND_DEPTH=38 PR 58,6 T18_KO4T chr6 90596933 chr6 90638559 Tandem-duplication Aldh1l1,Slc41a3 . END=90638559;SVTYPE=DUP;SVLEN=41626;CIPOS=0,1;CIEND=0,1;HOMLEN=1;HOMSEQ=C;SOMATIC;SOMATICSCORE=95 PR:SR 50,13:50,12 T18_KO4T chr6 122323813 chr6 122325457 Deletion Phc1 . END=122325457;SVTYPE=DEL;SVLEN=-1644;CIPOS=0,2;CIEND=0,2;HOMLEN=2;HOMSEQ=CT;SOMATIC;SOMATICSCORE=36 PR:SR 42,2:39,8 T18_KO4T chr7 16475870 chr7 16475933 Deletion Npas1 . END=16475933;SVTYPE=DEL;SVLEN=-63;CIGAR=1M63D;CIPOS=0,8;HOMLEN=8;HOMSEQ=GCCCGCGC;SOMATIC;SOMATICSCORE=74 PR:SR 1,0:15,13 T18_KO4T chr7 108528278 chr5 34913634 Translocation . SVTYPE=BND;MATEID=MantaBND:31880:0:3:0:0:0:0;IMPRECISE;CIPOS=-261,261;SOMATIC;SOMATICSCORE=58;BND_DEPTH=50;MATE_BND_DEPTH=40 PR 37,7 T18_KO4T chr7 119308417 chr13 84011843 Translocation . SVTYPE=BND;MATEID=MantaBND:9143:0:1:0:0:0:1;IMPRECISE;CIPOS=-281,281;SOMATIC;SOMATICSCORE=30;BND_DEPTH=39;MATE_BND_DEPTH=19 PR 62,6 T18_KO5T chr11 104535053 chr11 104536427 Deletion Cdc27 . END=104536427;SVTYPE=DEL;SVLEN=-1374;IMPRECISE;CIPOS=-186,186;CIEND=-185,186;SOMATIC;SOMATICSCORE=11 PR 45,4 T18_KO5T chr12 9077711 chr12 9184781 Tandem-duplication . END=9184781;SVTYPE=DUP;SVLEN=107070;CIPOS=0,2;CIEND=0,2;HOMLEN=2;HOMSEQ=GC;SOMATIC;SOMATICSCORE=92 PR:SR 49,11:42,9 T18_KO5T chr12 111538547 chr12 111539406 Deletion Eif5 . END=111539406;SVTYPE=DEL;SVLEN=-859;CIGAR=1M859D;CIPOS=0,1;HOMLEN=1;HOMSEQ=G;SOMATIC;SOMATICSCORE=55 PR:SR 38,7:25,5 T18_KO5T chr12 111539882 chr12 111540129 Deletion Eif5 . END=111540129;SVTYPE=DEL;SVLEN=-247;CIGAR=1M247D;SOMATIC;SOMATICSCORE=31 PR:SR 34,4:39,4 T18_KO5T chr12 111542841 chr12 111543099 Deletion Eif5 . END=111543099;SVTYPE=DEL;SVLEN=-258;CIGAR=1M258D;SOMATIC;SOMATICSCORE=45 PR:SR 34,0:32,6 T18_KO5T chr12 111543659 chr12 111544526 Deletion Eif5 . END=111544526;SVTYPE=DEL;SVLEN=-867;CIGAR=1M867D;CIPOS=0,4;HOMLEN=4;HOMSEQ=AGGT;SOMATIC;SOMATICSCORE=61 PR:SR 44,3:36,8 T18_KO5T chr14 95923489 chr14 95924636 Deletion . END=95924636;SVTYPE=DEL;SVLEN=-1147;CIPOS=0,2;CIEND=0,2;HOMLEN=2;HOMSEQ=TT;SOMATIC;SOMATICSCORE=46 PR:SR 19,2:11,5 T18_KO5T chr2 169539577 chr2 169540156 Inversion . END=169540156;SVTYPE=INV;SVLEN=579;CIPOS=0,11;CIEND=-11,0;HOMLEN=11;HOMSEQ=ACACACACACC;INV5;SOMATIC;SOMATICSCORE=16 PR:SR 44,2:33,2 T18_KO5T chr5 75143783 chr5 75145463 Deletion Gm19583 . END=75145463;SVTYPE=DEL;SVLEN=-1680;CIPOS=0,2;CIEND=0,2;HOMLEN=2;HOMSEQ=TA;SOMATIC;SOMATICSCORE=172 PR:SR 11,14:8,12 T18_KO5T chr6 143203342 chr1 40661555 Translocation Etnk1 Etnk1 SVTYPE=BND;MATEID=MantaBND:20826:0:1:0:0:0:0;SOMATIC;SOMATICSCORE=28;BND_DEPTH=34;MATE_BND_DEPTH=43 PR:SR 49,2:43,2 T18_KO5T chr7 55643330 chr12 111546658 Translocation Eif5 . SVTYPE=BND;MATEID=MantaBND:7387:2:3:0:0:0:0;IMPRECISE;CIPOS=-352,353;SOMATIC;SOMATICSCORE=84;BND_DEPTH=44;MATE_BND_DEPTH=36 PR 38,17 T18_KO5T chr7 55643415 chr12 111538242 Translocation Eif5 . SVTYPE=BND;MATEID=MantaBND:7387:0:2:0:0:0:0;SOMATIC;SOMATICSCORE=108;BND_DEPTH=41;MATE_BND_DEPTH=46 PR:SR 23,11:21,8 T18_KO5T chr7 108528280 chr5 34913636 Translocation . SVTYPE=BND;MATEID=MantaBND:32855:0:2:0:0:0:0;IMPRECISE;CIPOS=-258,259;SOMATIC;SOMATICSCORE=20;BND_DEPTH=50;MATE_BND_DEPTH=40 PR 45,5 T18_KO6T chr1 42137470 chr1 42137678 Deletion . END=42137678;SVTYPE=DEL;SVLEN=-208;CIGAR=1M208D;CIPOS=0,30;HOMLEN=30;HOMSEQ=CAGCAGAGTCTTGCCCAACACCCGCAAGGG;SOMATIC;SOMATICSCORE=35 PR:SR 18,3:27,7 T18_KO6T chr1 127908344 chr1 127908502 Deletion Rab3gap1 . END=127908502;SVTYPE=DEL;SVLEN=-158;CIGAR=1M158D;CIPOS=0,9;HOMLEN=9;HOMSEQ=CACACACAC;SOMATIC;SOMATICSCORE=13 PR:SR 17,0:33,5 T18_KO6T chr1 171070172 chr1 171077780 Deletion . END=171077780;SVTYPE=DEL;SVLEN=-7608;IMPRECISE;CIPOS=-537,537;CIEND=-332,333;SOMATIC;SOMATICSCORE=19 PR 247,11 T18_KO6T chr15 30984772 chr15 30986359 Tandem-duplication Ctnnd2 . END=30986359;SVTYPE=DUP;SVLEN=1587;IMPRECISE;CIPOS=-266,266;CIEND=-384,385;SOMATIC;SOMATICSCORE=10 PR 71,5 T18_KO6T chr18 9575535 chr14 13358092 Translocation Synpr . SVTYPE=BND;MATEID=MantaBND:11510:0:1:0:0:0:0;SOMATIC;SOMATICSCORE=32;BND_DEPTH=49;MATE_BND_DEPTH=44 PR:SR 92,2:83,2 T18_KO6T chr19 42469585 chr12 97249299 Translocation Gm38437 . SVTYPE=BND;MATEID=MantaBND:7967:0:2:0:0:0:1;IMPRECISE;CIPOS=-281,281;SOMATIC;SOMATICSCORE=20;BND_DEPTH=44;MATE_BND_DEPTH=66 PR 84,7 T18_KO6T chr3 19700070 chr11 91724710 Translocation . SVTYPE=BND;MATEID=MantaBND:5232:0:1:0:0:0:1;IMPRECISE;CIPOS=-257,258;SOMATIC;SOMATICSCORE=21;BND_DEPTH=50;MATE_BND_DEPTH=34 PR 81,10 T18_KO6T chr3 109622539 chr13 20487851 Translocation Vav3,Elmo1 Vav3 SVTYPE=BND;MATEID=MantaBND:8855:0:6:0:0:0:1;IMPRECISE;CIPOS=-258,258;SOMATIC;SOMATICSCORE=10;BND_DEPTH=49;MATE_BND_DEPTH=38 PR 48,6 T18_KO6T chr3 120703425 chr14 70715950 Translocation 6530403H02Rik,Xpo7 Xpo7 SVTYPE=BND;MATEID=MantaBND:12704:4:8:0:0:0:0;IMPRECISE;CIPOS=-236,237;SOMATIC;SOMATICSCORE=10;BND_DEPTH=49;MATE_BND_DEPTH=41 PR 85,5 T18_KO6T chr4 25544294 chr13 102567888 Translocation . SVTYPE=BND;MATEID=MantaBND:10932:0:1:0:0:0:0;SOMATIC;SOMATICSCORE=25;BND_DEPTH=56;MATE_BND_DEPTH=44 PR:SR 71,2:77,2 T18_KO6T chr4 125060132 chr12 97601280 Translocation Dnali1 . SVTYPE=BND;MATEID=MantaBND:7966:0:1:0:0:0:0;CIPOS=0,1;HOMLEN=1;HOMSEQ=G;SOMATIC;SOMATICSCORE=16;BND_DEPTH=44;MATE_BND_DEPTH=52 PR:SR 55,2:52,2 T18_KO6T chr5 33111812 chr1 126334627 Translocation Slc5a1,Nckap5 . SVTYPE=BND;MATEID=MantaBND:25541:0:2:0:0:0:1;IMPRECISE;CIPOS=-250,251;SOMATIC;SOMATICSCORE=10;BND_DEPTH=35;MATE_BND_DEPTH=48 PR 84,5 T18_KO6T chr5 81150341 chr5 81150535 Deletion Adgrl3 . END=81150535;SVTYPE=DEL;SVLEN=-194;CIGAR=1M194D;CIPOS=0,8;HOMLEN=8;HOMSEQ=TGTGTGTG;SOMATIC;SOMATICSCORE=10 PR:SR 27,2:34,4 T18_KO6T chr5 128099724 chr1 141912421 Translocation Tmem132d . SVTYPE=BND;MATEID=MantaBND:9003:0:1:0:0:0:0;SOMATIC;SOMATICSCORE=11;BND_DEPTH=54;MATE_BND_DEPTH=42 PR:SR 83,2:64,2 T18_KO6T chr6 90775745 chr13 65106495 Translocation Iqsec1,Mfsd14b . SVTYPE=BND;MATEID=MantaBND:9855:0:2:0:0:0:0;IMPRECISE;CIPOS=-229,230;SOMATIC;SOMATICSCORE=38;BND_DEPTH=66;MATE_BND_DEPTH=45 PR 76,6 T18_KO6T chr6 94897007 chr6 94897062 Deletion . END=94897062;SVTYPE=DEL;SVLEN=-55;CIGAR=1M1I55D;SOMATIC;SOMATICSCORE=13 PR:SR 2,0:18,8 T18_KO6T chr7 81108995 chr3 62201316 Translocation . SVTYPE=BND;MATEID=MantaBND:1:7082:12215:0:0:0:1;IMPRECISE;CIPOS=-271,272;SOMATIC;SOMATICSCORE=23;BND_DEPTH=50;MATE_BND_DEPTH=70 PR 49,6 T18_KO6T chr8 4479310 chr7 54004741 Translocation . SVTYPE=BND;MATEID=MantaBND:8256:9:10:0:0:0:0;IMPRECISE;CIPOS=-253,253;SOMATIC;SOMATICSCORE=11;BND_DEPTH=41;MATE_BND_DEPTH=53 PR 69,5 T18_KO6T chr8 57572028 chr14 63280308 Translocation Galnt7 . SVTYPE=BND;MATEID=MantaBND:1:8069:8070:0:1:0:1;SOMATIC;SOMATICSCORE=50;BND_DEPTH=47;MATE_BND_DEPTH=84 PR:SR 43,6:47,6 T18_KO6T chr9 60802071 chr18 35854024 Translocation Uaca,Cxxc5 . SVTYPE=BND;MATEID=MantaBND:8011:3:6:0:0:0:1;IMPRECISE;CIPOS=-244,244;SOMATIC;SOMATICSCORE=26;BND_DEPTH=39;MATE_BND_DEPTH=44 PR 86,10 T18_KO6T chrX 18640983 chr18 33772125 Translocation Gm14345,Gm14346,Gm10921 . SVTYPE=BND;MATEID=MantaBND:1:41100:41101:0:0:0:0;IMPRECISE;CIPOS=-270,271;SOMATIC;SOMATICSCORE=14;BND_DEPTH=29;MATE_BND_DEPTH=44 PR 65,6 T18_KO6T chrX 75637613 chr9 52949211 Translocation . SVTYPE=BND;MATEID=MantaBND:23533:1:2:0:0:0:1;IMPRECISE;CIPOS=-323,324;SOMATIC;SOMATICSCORE=20;BND_DEPTH=28;MATE_BND_DEPTH=60 PR 57,8 T18_KO7T chr17 50143150 chr14 12743313 Translocation Rftn1,Cadps . SVTYPE=BND;MATEID=MantaBND:13894:0:1:0:0:0:1;CIPOS=0,1;HOMLEN=1;HOMSEQ=G;SOMATIC;SOMATICSCORE=29;BND_DEPTH=55;MATE_BND_DEPTH=48 PR:SR 70,2:61,2 T18_KO7T chr18 25838191 chr12 117721570 Translocation Rapgef5 . SVTYPE=BND;MATEID=MantaBND:10175:2:5:0:0:0:1;IMPRECISE;CIPOS=-249,249;EVENT=MantaBND:10175:2:5:0:0:0:0;SOMATIC;SOMATICSCORE =0;JUNCTION_SOMATICSCORE=10;BND_DEPTH=55;MATE_BND_DEPTH=39 PR 54,5 T18_KO7T chr18 25838370 chr12 117721238 Translocation Rapgef5 . SVTYPE=BND;MATEID=MantaBND:10175:2:5:1:0:0:1;CIPOS=0,1;HOMLEN=1;HOMSEQ=G;SVINSLEN=85;SVINSSEQ=TGAATACTCACCACAGAAGAAGAATAAAGCCCTTTTCCACCAATTCAGTCTTAAGGAGAACTGGCTCCAGCAGAGAG 2:5:0:0:0:0;SOMATIC;SOMATICSCORE=0;JUNCTION_SOMATICSCORE=0;BND_DEPTH=50;MATE_BND_DEPTH=69 PR:SR 47,11:35,10 T18_KO7T chr19 17533464 chr16 27971791 Translocation Pcsk5 Pcsk5 SVTYPE=BND;MATEID=MantaBND:19884:0:1:0:0:0:1;CIPOS=0,1;HOMLEN=1;HOMSEQ=T;SOMATIC;SOMATICSCORE=25;BND_DEPTH=50;MATE_BND_DEPTH=62 PR:SR 77,2:76,2 T18_KO7T chr4 154211152 chr15 97566353 Translocation Megf6 . SVTYPE=BND;MATEID=MantaBND:2:9296:10229:1:0:0:0;IMPRECISE;CIPOS=-252,253;EVENT=MantaBND:2:9296:10229:0:0:0:0;SOMATIC;SOMATICSCORE =24;JUNCTION_SOMATICSCORE=0;BND_DEPTH=31;MATE_BND_DEPTH=47 PR 73,2 T18_KO7T chr4 154211357 chr15 97566889 Translocation Megf6 . SVTYPE=BND;MATEID=MantaBND:2:9296:10229:0:0:0:1;IMPRECISE;CIPOS=-391,391;EVENT=MantaBND:2:9296:10229:0:0:0:0;SOMATIC;SOMATICSCORE =24;JUNCTION_SOMATICSCORE=2;BND_DEPTH=69;MATE_BND_DEPTH=41 PR 39,4 T18_KO7T chr7 97887440 chr7 97887904 Deletion Pak1 Pak1 END=97887904;SVTYPE=DEL;SVLEN=-464;CIGAR=1M464D;CIPOS=0,7;HOMLEN=7;HOMSEQ=CTGGCCT;SOMATIC;SOMATICSCORE=16 PR:SR 64,0:51,6

Example 11. Investigation of gene expression profile and function

Gene expression profile analysis showed consistent characteristics within each case. When comparing tumors of KO tumor mice and normal samples (FDR <1.0e ^-05 ), differentially expressed genes were selected depending on the time factor (FDR <1.0e ^-04 ) described in the method after gene removal. . In addition, 1720 genes were selected as a DEG set by selecting a sub-network gene. As a result of gene set enrichment analysis (GSEA), the standard Wnt signal, cell cycle, and pathways involved in mitosis (FIG. 13A) were identified, and further unfolded protein response (UPR) was obtained. It has been shown to work in the opposite direction between KO and WT. Relatively, the UPR genes Ciar, Eif2s1, Hspa5, Hspa8 and Hsp90b1 were down regulated in KO normals than WT, but were highly expressed in KO tumors (FIG. 13B). In addition, as shown in Figure 13c, Hspa8 was confirmed as a binding protein with RARRES1 from IgG evidence. In the Wnt signal or mitotic cell cycle, Ccnd1, Cdkn1a, Cdkn2A, Nanog, Psrc1 and Nup214 were highly expressed in KO mouse tumor samples (FIG. 13D).

Cdk1 mRNA showed fold change XXX between KO tumor and KO normal. However, a comparison between TCGA LUAD RNA-Seq and RPPA confirmed a low correlation (XXX) between mRNA expression and protein abundance. Other than that, it was found that the strong binding potential of Cdk1-RARRES1 (FIG. 13C) was demonstrated through an IgG experiment.

Example 12. RARRES1 status in TCGA lung adenocarcinoma and lung cell abundance deconvolution

RARRES1 status was investigated in both DNA and RNA evidence of TCGA human lung adenocarcinoma (TCGA LUAD, n = 230). As shown in FIG. 14A, the Rarres1 variant was amplified by 1.3% CNV and there was no somatic mutation. In addition, as shown in Fig. 14B, Rarres1 mRNA expression was clearly different between the six TCGA LUAD subtype clusters. The C1 group belongs to Rarres1 low expression (log2 fold change = -1.52, T-test P- value = 5.58e ^-08 , FIGS. 14B and 14C ).

Gene expression profiles were used to estimate the presence of 24 known lung cells. The percentage of most cells was consistent with WT and KO status. However, alveolar type 2 (AT2) cells appeared to be extremely abundant only in KO tumor samples, but showed low concentrations in all other conditions (fold change between KO normal and KO tumors 2.8, Figure 14D). In addition, in the human TCGA LUAD, the C1 group had a high proportion of AT2 cells (fold change 2.7, Fig. 14D).

In addition, as shown in FIG. 14E, through the upper right graph, RARRES1 showed the lowest expression in the C1 group among human lung cancer subtypes, and through the left graph, it was the same as the mouse lung cancer model when estimating the amount of lung cells. Among the human lung cancer subtypes, the AT2 cell and the Alveolar bipotent progenitor were the highest in the C1 group, and through the histogram at the bottom right, the C1 group among the human lung cancer subtypes in the quantitative overall distribution histogram of the progenitor cells of the lung I could see that it appeared the highest.

The above description of the present invention is for illustration only, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified to other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the above-described embodiments are illustrative in all respects and not restrictive.

Claims (18)

A first loxP (locus of X-over P1) site; Drug resistant gene sites; A gene segment comprising the third exon of the RARRES1 genomic gene; And a retinoic acid receptor responder 1 (RARRES1) targeting vector for constructing an oncogenic animal model for constructing an oncogenic animal model comprising a DNA sequence consisting of a sequence of a second loxP site. Tumor-forming RARRES1 ^+/N chimeric animal model prepared by injecting animal cells into a cyst (blastocyst).
According to claim 1,
Before the first loxP (locus of X-over P1) site, in order of splicing acceptor (SA), β-galactosidase (βgal), and SV40 polyA signal (pA) A tumorigenic RARRES1 ^+/N chimeric animal model comprising a DNA sequence.
According to claim 1,
The drug-resistant gene site is characterized in that the neomycin resistance gene, tumorigenic RARRES1 ^+/N chimeric animal model.
An oncogenic RARRES1 ^+/- animal model prepared by crossing the RARRES1 ^+/N chimeric animal model of claim 1 with an animal expressing cre recombinase.
The method of claim 4,
In the animal expressing the cre recombinase, the gene encoding cre recombinase is operably linked with a Zona pellucida 3 (Zp3) promoter, an oncogenic RARRES1 ^+/- animal model.
A method for preparing an oncogenic RARRES1 ^-/- animal model comprising the following steps.
(a) preparing the RARRES1 ^+/N chimeric animal model of claim 1;
(b) crossing the chimeric animal model of step (a) to produce a RARRES1 ^+/- animal model; And
(c) selecting a RARRES1 ^-/- animal model from offspring obtained by crossing the RARRES1 ^+/- animal model of step (b).
The method of claim 6,
The animal is characterized in that the mouse, the manufacturing method.
The method of claim 6,
The RARRES1 ^-/- animal model is characterized in that the tumor is induced by the deletion of RARRES1.
The method of claim 6,
The tumor is characterized in that at least one selected from the group consisting of spleen cancer, thymic cancer, liver cancer, lung cancer, kidney cancer, thyroid cancer, small intestine cancer, stomach cancer, uterine cancer, and myeloid leukemia.
The tumor-forming RARRES1 ^-/- animal model produced by the method of claim 6.
The method of claim 10,
The animal model is for mitosis defect induction or mitosis stress resistance, characterized in that the tumor formation RARRES1 ^-/- animal model.
The method of claim 10,
The animal model is characterized in that it induces a somatic mutation, tumorigenic RARRES1 ^-/- animal model.
The method of claim 10,
The animal model is characterized by the overexpression of one or more genes selected from the group consisting of Ccnd1, Cdkn1a, Cdkn2A, Nanog, Psrc1, and Nup214 in the mitotic cell cycle, tumorigenic RARRES1 ^-/- animal model.
The method of claim 10,
The tumor is formed from at least one selected from the group consisting of splenic cancer, thymic cancer, liver cancer, lung cancer, kidney cancer, thyroid cancer, small intestine cancer, stomach cancer, uterine cancer, and myeloid leukemia, tumorigenesis RARRES1 ^-/- animal Model.
A method of screening for a tumor therapeutic material, comprising the following steps:
(a) treating the candidate material in a subject of tumor formation RARRES1 ^-/- animal model;
(b) measuring the phosphorylation degree of cyclin-dependent kinase 1 (CDC1) and cyclin B1 (Cyclin B1) in the subject,
Measuring the amount or activity of the CDK1 and Cyclin B1 proteins,
Measuring the expression or activity of Mist1 and LGR5, or
Measuring the activity of SPC (surfactant protein) positive cells; And
(c) compared to the untreated group,
Candidates with reduced phosphorylation levels of CDK1 and Cyclin B1,
Candidates with reduced amounts or activities of CDK1 and Cyclin B1 proteins,
Candidates with reduced expression or activity of Mist1 (Muscle, intestine and stomach expression 1) and LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5), or
The step of selecting a candidate substance for reducing the activity of SPC-positive cells as a tumor treatment substance.
The method of claim 15,
The subject is isolated from at least one selected from the group consisting of spleen cancer, thymic cancer, liver cancer, lung cancer, kidney cancer, thyroid cancer, small intestine cancer, stomach cancer, uterine cancer, and myeloid leukemia.
The method of claim 15,
The tumor is characterized in that at least one selected from the group consisting of spleen cancer, thymic cancer, liver cancer, lung cancer, kidney cancer, thyroid cancer, small intestine cancer, stomach cancer, uterine cancer, and myeloid leukemia.
The method of claim 15,
The Mist1, LGR5, or SPC is characterized in that the stem cell marker, screening method.

Images