KR20200058319A - Chemotherapeutic and Pharmaceutical Compositions of Recombinant Bacillus Calmette-Guerin (BCG) including biosynthetic genes to avoid antimicrobial peptides for the Bladder Cancer therapy - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for the anticancer treatment for bladder cancer of recombinant Bacillus Calmette-Guérin (BCG) bacteria including antibacterial peptide evasive genes. The pharmaceutical composition has an excellent inhibitory effect of bladder cancer cells, and also can minimize side effects which can occur when injecting BCG in the bladder, thereby being able to be usefully used as an anticancer treatment for bladder cancer.

Description

Chemotherapeutic and Pharmaceutical Compositions of Recombinant Bacillus Calmette-Guerin (BCG) including biosynthetic genes to avoid antimicrobial peptides for the Bladder Cancer therapy}

The present invention relates to a pharmaceutical composition for anticancer treatment of bladder cancer of a recombinant Bacillus calmet-gerengin containing an antibacterial peptide evasion gene.

Bladder cancer is the 11th most frequent cancer worldwide, accounting for 3 to 4% of all malignant tumor patients. More than 200,000 new patients occur each year worldwide, of which more than 150,000 are male. Bladder cancer is classified into superficial bladder cancer, invasive bladder cancer, and metastatic bladder cancer according to the progress of cancer.

Among them, superficial bladder cancer is bladder cancer corresponding to Ta, carcinoma in situ (CIS), T1 in TNM stage, accounting for 70 to 80% of all bladder cancer, about 70% is Ta lesion, and the remaining 30% is T1 stage It is diagnosed, about 30% of which is grade 3 with high malignancy. Superficial bladder cancer is recurring in 50 to 75% of patients, and 20 to 30% of recurring cancers are reported to progress to higher stages or poorly differentiated tumors.

For the treatment of superficial bladder cancer, after confirming the stage according to transurethral resection, transurethral resection and intra-bladder BCG injection are generally performed according to the risk of recurrence and progression. Bacillus Calmette-Guerin (BCG) is a live vaccine that attenuated Mycobacterium bovis (M.bovis). It is widely used as an immunotherapeutic agent.

Until now, the specific mechanism of action of BCG's intra-bladder infusion therapy to show anticancer activity is unknown, but granulomatous inflammatory reactions caused by T cell-mediated immune responses are known to play an important role. . In other words, when injected into the bladder of BCG, in the bladder, BCG is recognized as a pathogen and the innate immune system is activated to defend against it, and in particular, the antibacterial peptides beta-defensin 2,3 and cathelicidin ( cathelicidin) is believed to induce BCG death.

However, the amount of BCG injected into the bladder is about 10 million (10 ⁷ ) CFU at a time, but in fact, the amount internalized in the bladder epidermis is observed to be less than 1%, and the effectiveness of BCG is very low due to the role of the innate immune system. Is known. In other words, in order to overcome the protective barrier of epithelial cells in the bladder, BCG, which is a biotuberculosis bacterium, must be injected into the bladder in an excessive amount, so minor side effects in 60 to 80% of patients during BCG infusion therapy are life threatening in 5% of patients. It is known to cause serious side effects. Due to these side effects, the patient's compliance with treatment is lowered, and the treatment is frequently stopped without sufficient treatment.

In addition, recurrence occurs in 50 to 90% of patients with intravesical BCG infusion therapy, and it is reported that 20% of patients progress to muscle-infiltrating bladder cancer, but secondary to patients who have failed BCG infusion therapy Treatment has not been developed yet.

Accordingly, the present inventors completed the present invention by conducting research to develop BCG having a high internalization rate.

Republic of Korea Patent Publication No. 10-2007-0101855

One object of the present invention is to provide a pharmaceutical composition for the treatment of bladder cancer anti-cancer, including a recombinant Bacillus Calmette-Guerin (BCG) expressing a Streptococcal inhibitor of complement (Sic) gene.

Another object of the present invention is a method for producing a recombinant Bacillus calmet-gerenic bacterium comprising electroporation of a recombinant expression vector containing a nucleotide sequence encoding a Sic gene and introducing it into Bacillus calmet-gerenic. Is to provide.

One aspect of the present invention provides a pharmaceutical composition for the treatment of bladder cancer anti-cancer, comprising a recombinant Bacillus Calmette-Guerin (BCG) expressing a Streptococcal inhibitor of complement (Sic) gene.

Recombinant BCG expressing the Sic gene of the present invention can avoid the antibacterial action of the antibacterial peptides HBD-2, HBD-3 and CAMP, exhibit high internalization rates for bladder cancer cells, and secrete anticancer cytokines. Since it can be increased, it can be effectively used to increase the efficacy of bladder cancer treatment and to prevent recurrence.

The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier included in the pharmaceutical composition of the present invention is commonly used in the manufacture of pharmaceuticals, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin , Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not limited. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (22th ed., 2013).

The pharmaceutical composition according to an embodiment of the present invention may be administered together with a substance exhibiting activity in the treatment and prevention of recurrence of one or more bladder cancers.

In addition, the pharmaceutical composition according to one embodiment of the present invention may be used alone or in combination with methods using surgery, hormone therapy, drug therapy and / or biological response modifiers for the treatment and prevention of recurrence of bladder cancer. .

The pharmaceutical composition of the present invention may contain various bases and / or additives necessary and appropriate for the formulation of the formulation, and non-ionic surfactants, silicone polymers, extender pigments, fragrances, preservatives within a range that does not impair the effect. , Fungicides, oxidation stabilizers, organic solvents, ionic or nonionic thickeners, softening agents, antioxidants, free radical disruptors, opacifiers, stabilizers, emollients, silicones, α-hydroxy acids, antifoaming agents, moisturizers , Vitamins, insect repellents, fragrances, preservatives, surfactants, anti-inflammatory agents, substance P antagonists, fillers, polymers, propellants, basicizing or acidifying agents, or coloring agents.

Suitable dosages of the pharmaceutical compositions of the invention are variously prescribed by factors such as formulation method, mode of administration, patient's age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion, and response sensitivity. Can be. The dosage of the pharmaceutical composition of the present invention may be 0.001 to 1000 mg / kg on an adult basis.

The pharmaceutical composition of the present invention can be administered parenterally, specifically in the bladder.

The pharmaceutical composition of the present invention may be administered in a variety of formulations when administered parenterally, the liquid preparations include suspensions, liquid solutions, emulsions, syrups, etc. Excipients may include, for example, wetting agent sweeteners, fragrances, preservatives, and the like. Specifically, formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions and lyophilized preparations. As the non-aqueous solvent and suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. In addition, calcium or vitamin D3 may be added to improve the efficacy of the therapeutic agent.

Such compositions may be presented in unit-dose (single serving) or multi-dose (several servings) containers, such as sealed ampoules and vials, and sterile liquid carriers, such as water for injection, just prior to use. Can be stored under freeze-drying conditions requiring only the addition of. Instant use and suspending agents can be prepared from sterile powders, granules and tablets.

According to one embodiment of the present invention, the bladder cancer may be superficial bladder cancer.

Intra-bladder BCG infusion therapy is a typical treatment method for superficial bladder cancer, but the currently used BCG has a low internalization rate and low resistance to antimicrobial peptides, and thus should be treated in excess, thereby causing a high incidence of side effects. Recombinant BCG expressing the Sic gene of the present invention exhibits a high internalization rate against bladder cancer cells, and has excellent resistance to antimicrobial peptides, so it is possible to treat BCG at a lower dose than that used in conventional BCG infusion therapy. The occurrence can be minimized.

Another aspect of the present invention is a method for producing a recombinant Bacillus calmet-gerenic bacterium comprising electroporation of a recombinant expression vector comprising a nucleotide sequence encoding a Sic gene and introducing it into Bacillus calmet-gerenic. to provide.

According to an embodiment of the present invention, the vector may be pMV306hsp.

When preparing the recombinant BCG expressing the Sic gene of the present invention, when the pMV306hsp vector containing the nucleotide sequence encoding the Sic gene is introduced into the BCG by electroporation, the production yield of the recombinant BCG is particularly excellent.

According to the pharmaceutical composition for the treatment of bladder cancer of a recombinant Bacillus calmet-gerenic bacterium containing an antimicrobial peptide evasion gene, the effect of suppressing bladder cancer cells is excellent, and side effects that may occur when injecting BCG in the bladder can be minimized. It can be useful for treatment.

FIG. 1 is a diagram showing a recombinant expression vector used to prepare a recombinant Bacillus Calmette-Guerin (BCG) expressing a streptococcal inhibitor of complement (Sic) gene.
2 is a photo confirming the expression of the sic gene by synthesizing cDNA after RNA extraction from the recombinant BCG of the present invention.
3 is a photograph confirming the survival rate of the recombinant BCG of the present invention for the antibacterial peptide according to the survival / kill assay.
4 is a graph showing the survival rate of the recombinant BCG of the present invention for the antimicrobial peptides identified according to the survival / kill assay.
Figure 5 is a photograph showing the internalization of the recombinant BCG of the present invention for the bladder cancer cell line 5637 and T24 cells.
6 is a graph showing the internalization rate of the recombinant BCG of the present invention.
7 is a graph showing the results of cell migration assay and the migrated THP-1 cells confirming the activity of increasing the THP-1 cell mobility of the recombinant BCG of the present invention.
8 is a graph showing the inhibitory activity of the recombinant BCG of the present invention against the bladder cancer cell lines 5637 and T24.
9 is a photograph showing the inhibitory activity of the recombinant BCG of the present invention against the bladder cancer cell line 5637.
10 is a graph showing the inhibitory activity of the recombinant BCG of the present invention against the bladder cancer cell line 5637.
11 is a graph comparing the rate of bladder cancer internalization between BCG and the recombinant BCG of the present invention in a stereotactic bladder cancer mouse model.
12 is a graph showing the internalization of the recombinant BCG of the present invention for mouse bladder cancer cells in a stereotactic bladder cancer mouse model.
13 is a photograph showing the inhibitory activity of the recombinant BCG of the present invention according to the in vivo luminescence measurement of mouse bladder cancer tissue.

Hereinafter, the present invention will be described in more detail through one or more embodiments. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1.Recombinant BCG (rBCG) preparation and method of analyzing the inhibitory effect of recombinant BCG on bladder cancer cells

1-1. Cell culture and reagent treatment

The 5637 and T24 human bladder cancer cell lines were purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in a constant temperature and humidity incubator at 37 ° C. and 5% CO ₂ , nutrients were supplied every 2-3 days, and cells reaching confluence were used. Recommended medium supplemented with 10% fetal bovine serum (FBS) (Gibco Laboratories, Gaithersburg, MD, USA) and 1% amphotericin B / streptomycin / penicillin (Gibco Laboratories) (recommended medium). As a result of evaluating the cell line with a PCR-based detection kit (Intron Biotechnology, Seongnam, Korea), it was confirmed that there was no mycoplasma contamination.

1-2. Plasmid structure

DNA encoding the Streptococcal inhibitor of complement (Sic) (GenBank: AY229858.1) gene was synthesized and cloned (Macrogen, Seoul, Korea). Sic expression vectors were constructed from pMV306 vectors using EcoRI and HpaI restriction enzymes (FIG. 1). Primer sequences used for cloning are shown in Table 1 below.

vector primer Primer sequence (5 '→ 3') Sequence number pMV306hsp Sic forward CGGGCTGCAG GAATTC ATGAAGATCAAGAAGAACATC SEQ ID NO: 1 reverse GATCGTACGCTA GTTAAC TCAGGTGGTCGACGGGGTG SEQ ID NO: 2

1-3. BCG culture

Middlebrook 7H9 liquid medium was prepared by mixing 7H9 powder (BD, Franklin Lakes, NJ, USA) with dH ₂ O and 0.2% glycerol (Sigma-Aldrich, St. Louis, MO, USA). After autoclaving and completely cooling the medium, filter-sterilized 0.05% Tween 80 (Sigma-Aldrich), and 10% OADC Enrichment (Sigma-Aldrich) or 10% ADC Enrichment (Sigma-Aldrich) were added. BCG was incubated for about 15 days in a 7H9 medium at 37 ° C. until the optical density of OD600 reached 2.0. Thereafter, BCG cells were diluted in PBS (phosphate buffered saline) to 1 × 10 ⁷ cells / ml showing a multiplicity of infection (MOI) of 100, and stored at −80 ° C. until use.

1-4. Preparation of recombinant BCG by electroporation

BCG cells were obtained by centrifugation at 3,000 x g for 7 minutes at room temperature and washed twice with PBS. A 2 mm gap cuvette (BTX, Holliston, MA, USA) was prepared by pre-cooling in ice for about 30 minutes. 1000 MOI of BCG was suspended in 100 μl of 7H9 liquid medium containing OADC (Sigma-Aldrich). Next, BCG was gently mixed with 2 μg of plasmid DNA in an autoclaved Eppendorf tube, and then the mixture was added to the prepared gap cuvette and electroporated using an ECM®399 Electroporation system at 2500 V (BTX) to generate the Sic gene. Recombinant BCG (rBCG-Sic) was prepared. Thereafter, the recombinant BCG was resuspended in 7H9 medium containing ADC and kanamycin (10 μg / ml) and incubated at 37 ° C. for 2 days.

1-5. CDNA synthesis by reverse transcription PCR

The recombinant BCG prepared in Example 1-4 was incubated at 37 ° C for 3 hours, then obtained by centrifugation at 3,000xg for 7 minutes at room temperature, and washed once with PBS. Total RNA was isolated from recombinant BCG strains using the TRIzol® Max Bacterial RNA Isolation Kit (Ambion, Austin, TX, USA), and the amount of total RNA was measured by absorbance quantitative analysis.

CDNA was synthesized by reverse transcription PCR (RT-PCR) using the primers of Table 2 below with 0.5 μg total RNA from the total RNA isolated, and the results were according to the manufacturer's instructions (Takara Bio, Otsu, Shiga, Japan). Analysis. To measure the efficiency of the recombinant BCG, 25ng of the synthesized cDNA was used as a template in the real-time PCR of Example 1-6.

primer Primer sequence (5 '→ 3') Sequence number Sic forward TCTGATTGGGGCCGATCT SEQ ID NO: 3 reverse ACCGAAGCCTGCCATGTA SEQ ID NO: 4 16S rRNA forward TCCCGGGCCTTGTACACA SEQ ID NO: 5 reverse CCACTGGCTTCGGGTGTT SEQ ID NO: 6

1-6. Measure the efficiency of recombinant BCG prepared by electroporation

In order to measure the amount of Sic gene expressed in the recombinant BCG prepared in Example 1-4, a quantitative method based on real-time PCR was performed, and the expression was expressed in recombinant BCG using primers specific to the Sic gene of Table 2. The amount of Sic gene was measured.

The composition of the PCR mixture (20 μl) is as follows: 1 × PCR buffer (0.2mM dNTP, 2.5mM MgCl 2, 1mg / ml BSA, 0.5 × SYBR Green I dye (SIGMA S9430), 0.25U Ex Taq HS), 0.4 μM forward primer, 0.4 μM reverse primer and 25 ng of template DNA. DNA amplification of the recombinant BCG was performed by repeating 42 cycles of 2 minutes at 95 ° C and 5 seconds at 98 ° C, 10 seconds at 98 ° C, 15 seconds at 65 ° C, and 40 seconds at 72 ° C. DNA amplification was performed three times in a 96-well optical plate for each sample. Real-time PCR was performed using the CFX96 Touch Real-Time PCR Detection System (Bio-rad Laboratories, Hercules, California). Controls without template DNA and positive control DNA were included in each test. To prepare a standard curve for the Sic gene, plasmid DNA was serially diluted (10 fold) to create a 6-point standard curve containing 1 pg to 100 ng of DNA in each reaction. To prepare a standard curve for recombinant BCG, the complementary DNA of BCG was serially diluted (10-fold) to prepare a 6-point standard curve containing 1 pg to 100 ng of DNA in each reaction. The R2 correlation of the two standard curves was 0.99. The efficiency of electroporation was calculated as the amount of Sic gene compared to 25 ng of the total complementary DNA used for real-time PCR, and the standard expression curve of the Sic gene was used to determine the expression amount of the Sic gene in recombinant BCG. In order to measure the efficiency of the electroporation method, real-time PCR was performed 10 times to determine the average value, and the standard error (S.E) was found to be 0.50.

1-7. BCG internalization analysis

The bladder cancer cells of Example 1-1 treated with BCG were harvested and resuspended in PBS containing 0.2% albumin, 0.02% Na-EDTA and 0.01% NaN ₃ . In order to distinguish between BCG-embedded cells and BCG-surface bound cells, the cells were incubated for 30 minutes at 4 ° C with a polyclonal rabbit anti-Mycobacterium tuberculosis antibody (1: 100). After incubation, the cells were washed and incubated with cyanine 5 (Cy-5) -conjugated goat anti-rabbit antibody (1:50) at 4 ° C for 30 minutes. Cells were washed and mounted on cover slides containing mounting medium. After the nuclei were counterstained with 4 ', 6-diamidino-2-phenylindole (DAPI) and covered with a cover glass, fluorescence was observed using a Zeiss LSM 510 laser scanning confocal microscope (Carl Zeiss, Oberkochen, Germany). In each experiment, 100 cells with nuclei (blue) stained with DAPI were counted at 1000 ×.

1-8. Cell viability and colony formation analysis

96-well plates were seeded with 5 × 10 ³ cells of Example 1-1 per well and treated with recombinant BCG or BCG of various concentrations of Examples 1-4. After 48 hours, cell viability was analyzed using the D-PlusTM CCK kit (Dongins, Seoul, Korea) according to the manufacturer's instructions. Colony formation analysis was performed at 30 MOI after recombinant BCG (rBCG-Sic) treatment. 1 × 10 ³ cells were re-inoculated 3 times in a 12-well plate and cultured in a complete medium for 14 days to allow colonies to form. Thereafter, colonies were fixed with 4% paraformaldehyde (Biosesang, Seongnam, Korea), stained with 0.1% crystal violet (Sigma-Aldrich), and then visually evaluated for the number of colonies, and colonies having a size of 50 µm or more. Was counted.

1-9. Cell migration analysis

Cells of Example 1-1 were inoculated in 24-well plates at 5 × 10 ⁴ cells / well in complete medium containing 10% FBS and 1% antibiotic. 24 hours after inoculation, cells were infected for 8 hours with recombinant BCG of Example 1-4 of 10 MOI. Then BCG was removed and serum-free medium was added. In serum-free medium, THP-1 cells (3 × 10 ⁵ ) were added to the upper chamber of a transwell (Corwell, Corning, NY, USA) and cultured for 2 hours. Before adding THP-1 cells to the upper chamber of the transwell, the chamber was used to equilibrate for 1 hour in serum free medium. The cells of the plate and the lower chamber were fixed with 4% paraformaldehyde (Biosesang), stained with 0.1% crystal violet (Sigma-Aldrich), and then the cells were identified.

1-10. ELISA

IL-6 (D6050), IL-12 (D1200), TNF-α (DTA00C) and INF-γDuo-set ELISA kit (HBD-2 (cat # 201-12-1937) from R & D Systems (Minneapolis, MN, USA) ; SunRed Bio, Shanghai, China), HBD-3 (cat # CSB-E14187h; CUSABIO, Houston, TX, USA), CAMP (cat # 201-12-3404; SunRed Bio) was used. Cells were seeded at 3 × 10 ⁵ cells / well in a 60 mm cell culture dish. After 24 hours, cells were infected with 30 MOI of BCG and recombinant BCG of Examples 1-4, respectively, and cultured for 72 hours. Thereafter, a cell culture supernatant was obtained and centrifuged at 2000-3000 rpm (1000 × g) for 10 minutes at 4 ° C. The obtained samples were stored immediately or stored at -80 ° C and analyzed according to the manufacturer's instructions, and the OD450 of the wells was measured using a microplate reader (SpectraMax i3x, Molecular Devices).

1-11. Survival / kill assay

HBD-2 (0.1 ng / ml), HBD-3 (0.5 ng / ml) in cells of Example 1-1 treated with BCG at a density of 2 x 10 ⁷ cells / 100 µL or recombinant BCG of Example 1-4 And CAMP (0.5 ng / ml) after 1 hour treatment, cell viability was measured using a bacterial live and dead assay kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions.

1-12. Statistical analysis

All data are expressed as the mean ± standard deviation (SD) of three or more separate 3 replicate experiments, and the data are compared using Student's t-test. P values less than 0.05 were considered statistically significant.

Example 2. Analysis method for internalization of bladder cancer of recombinant BCG in an animal model

2-1. Bladder cancer animal model construction and recombinant BCG treatment

In order to evaluate the internalization of recombinant BCG using the bladder cancer animal model, a request was made to the National Cancer Center to construct a stereotactic bladder cancer animal model, and the internalization of the recombinant BCG of BCG and Example 1-4 was compared. The bladder cancer animal model was constructed using BALB / c mice. Recombinant BCG, BCG, and three groups each of the control group induces bladder cancer in 20 mice in each group. Among them, the bladder cancer is generated twice in a week, 3 weeks over a period of 3 weeks. BCG or BCG was treated. Bladder cancer tissue was obtained after 3 weeks of treatment to evaluate the internalization of recombinant BCG and inhibition of bladder cancer. Meanwhile, no significant change was observed in the body weight of the mice during the experiment.

2-2. DNA extraction from mouse bladder cancer tissue

Total genomic DNA was isolated from mouse bladder cancer tissue using PureLink ™ Genomic DNA mini kit (invitrogen ™, Carlsbad, CA, USA), and the results were analyzed according to the manufacturer's instructions. Total amount of genomic DNA was measured by absorbance quantitative analysis method, and 50 ng of quantified DNA was used as a template in real-time PCR.

2-3. Measurement of internalization of recombinant BCG in mouse bladder cancer tissue

Quantitative real-time PCR-based methods were performed on the DNA of Example 2-2 to determine the amount of BCG internalized in mouse bladder cancer tissue. To detect BCG in bladder cancer tissue, BCG specific primers based on the heat shock protein gene (hsp65) were used. To amplify the DNA of BCG, the hsp65 fragment was targeted, and to amplify the mouse bladder cancer tissue DNA, the mouse GAPDH gene was targeted. The GAPDH specific primer of Table 3 (250 bp product) was designed with Primer-Blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast).

primer Primer sequence (5 '→ 3') Sequence number GAPDH forward GCTTAGGTTCATCAGG SEQ ID NO: 7 reverse TTCTTCGGTAGTGACA SEQ ID NO: 8

The composition of the PCR mixture (20 μl) is as follows: 1 × PCR buffer, 0.2mM dNTP, 2.5mM MgCl 2, 1mg / ml BSA, 0.5 × SYBR Green I dye (SIGMA S9430), 0.25U Ex Taq HS, 0.4 μM forward primer, 0.4 μM reverse primer and 50 ng template DNA. DNA amplification of BCG was performed by repeating 42 cycles of 95 min at 2 ° C and 5 sec at 98 ° C, then 10 sec at 98 ° C, 15 sec at 60 ° C and 40 sec at 72 ° C. DNA amplification of mouse cancer tissues was performed by repeating 42 cycles of 2 minutes at 95 ° C and 5 seconds at 98 ° C, 10 seconds at 98 ° C, 10 seconds at 45 ° C, and 40 seconds at 72 ° C. DNA amplification was performed three times in a 96-well optical plate for each sample. Real-time PCR was performed using the CFX96 Touch Real-Time PCR Detection System (Bio-rad Laboratories, Hercules, California). Controls without template DNA and positive control DNA were included in each test. To prepare a standard curve for BCG, the BCG DNA stock was serially diluted (10 fold) to create a 6-point standard curve containing 1 pg to 100 ng of DNA in each reaction. To prepare a standard curve for mouse bladder cancer tissue, the DNA of the untreated bladder cancer tissue group was serially diluted (10 times) to prepare a 6-point standard curve containing 1 pg to 100 ng of DNA in each reaction. Genomic DNA copy numbers were calculated using the amount of DNA and genomic size, and standard curves were used to determine the ratio of the number of BCG cells to mouse bladder cancer tissue in each sample.

2-4. Measurement of bladder cancer tissue luminescence in bladder cancer animal models

D-luciferin (Promega) was dissolved in 15 mg / ml of DPBS (Welgene) containing no Ca ²⁺ and Mg ²⁺ , and filtered to prepare a stock solution using a 0.22 μm syringe filter (BD). Luciferin solution (150 mg / kg in DPBS) was injected intraperitoneally into each mouse (200 μl / mouse). After 5 minutes, mice were anesthetized for 5 minutes using isoflurane (JW Pharma). The luminescence signal was read using IVIS200 (exposure time: auto, binning: 8, F / stop: 1). Signal intensity and body weight were measured every 3 to 4 days to monitor the ROI intensity. The luminescent images were displayed in photon mode with signal intensity expressed in average luminosity (p / sec / cm ² / sr). Data were analyzed using Living Image software (Caliper, PerkinElmer).

Example 3. Confirmation of the efficiency of recombinant BCG and recombinant BCG

The plasmid of Example 1-2 was introduced into BCG by electroporation to prepare recombinant BCG of Example 1-4. To confirm whether recombinant BCG (rBCG-Sic) expresses Sic, Example 1-5 was performed to extract total mRNA from recombinant BCG, and expression of recombinant DNA was measured. In addition, Example 1-6 was performed to measure the expression level of the Sic gene expressed in the recombinant BCG of Example 1-4.

As a result, a cDNA fragment corresponding to the Sic gene was detected (FIG. 2), and the expression level of the Sic gene was confirmed to be 23.6%, confirming the efficiency of the recombinant BCG.

Example 4. Confirmation of resistance of recombinant BCG to antibacterial peptide

To confirm that the recombinant BCG is resistant to the antimicrobial peptide (AMP), after treating the antibacterial peptides HBD-2, HBD-3 or CAMP according to Example 1-11, the survival rate of the recombinant BCG is analyzed. Did.

As a result, it was confirmed that the survival rate of BCG treated with HBD-2, HBD-3 or CAMP was significantly lower than that of recombinant BCG, thereby confirming high AMP resistance of recombinant BCG compared to BCG strains (FIGS. 3 and 4). .

Example 5. Confirmation of internalization of recombinant BCG in bladder cancer cells

To evaluate BCG internalization, Examples 1-7 were performed. 5637 and T24 cells were treated with 10 MOI of BCG or recombination, and internalization was assessed after 8 hours. Extracellular BCG was labeled with a fluorescent dye (FITC, green and Cy-5, red, combined, yellow), and intracellular BCG was labeled with FITC (green).

As a result, it was confirmed that the level of internalization was higher in recombinant BCG than in BCG (FIG. 5).

In addition, in order to determine the rate of BCG internalization in bladder cancer cells, Example 1-5 was performed to measure the expression of BCG 16S mRNA. The rate of internalization was determined as the ratio of BCG cells to human cells.

As a result, the internalization rates of BCG and recombinant BCG (10 or 30 MOI) were confirmed as shown in FIG. 6. The ratio at 10 MOI BCG (mean ± SD, 0.09 ± 0.01) was lower than 10 MOI rBCG-Sic (1.78 ± 0.148, p <0.01), confirming that the internalization rate of recombinant BCG was fast. The ratio of 10 MOI rBCG-Sic was similar to that of 30 MOI BCG (1.87 ± 0.185).

Example 6. Confirmation of the effect of recombinant BCG on cytokine production

To confirm whether the internalization of recombinant BCG for cancer cells increases, whether cytokine expression is increased or not was analyzed by performing Examples 1-10.

As a result of measuring the levels of IL-6, IL-12, TNF-α and INF-γ in bladder cancer cells after BCG and recombinant BCG treatment, as shown in Table 4 below, 5637 cells treated with rBCG-Sic were INF-γ Was highly secreted (p <0.05), and the secretion of IL-12 was high in 5637 and T24 cells (p <0.05).

division 5637 T24 BCG rBCG-Sic BCG rBCG-Sic Cytokine level
(Average ± standard deviation) IL-6 (pg / ml) 120.51 ± 0.14 120.22 ± 1.80 85.44 ± 1.25 82.19 ± 2.26 IL-12 (pg / ml) 115.68 ± 2.01 134.43 ± 0.20 91.13 ± 1.09 98.96 ± 1.63 TNF-α (pg / ml) 62.50 ± 2.26 68.50 ± 7.79 129.35 ± 17.94 151.59 ± 14.82 INF-γ (pg / ml) 83.86 ± 5.00 129.76 ± 0.43 93.29 ± 5.57 109.14 ± 2.00 Antibacterial peptide level
(Average ± standard deviation) HBD-2 (ng / ml) 4.08 ± 0.20 4.67 ± 0.11 3.54 ± 0.01 3.81 ± 0.18 HBD-3 (ng / ml) 11.25 ± 0.05 11.46 ± 0.32 10.62 ± 0.03 10.63 ± 0.10 CAMP (pg / ml) 15.77 ± 0.48 17.08 ± 0.17 14.35 ± 0.17 16.91 ± 0.20

Example 7. Confirmation of the effect of recombinant BCG on chemotaxis

To confirm the effect of recombinant BCG on chemotaxis, Example 1-9 was performed to evaluate the mobility of THP-1 cells before differentiation into monocytes.

As a result, it was confirmed that the higher migration rate of THP-1 cells in 5637 cells treated with recombinant BCG compared to 5637 cells treated with BCG. The number of mobile cells was higher in the BCG group (43.12 ± 2.90, p <0.05) compared to the control group (18.88 ± 2.90, p <0.05), and the rBCG-Sic (73.13 ± 4.88, p <0.05) group was higher than the BCG group. It was confirmed to indicate (Fig. 7).

Example 8. Confirmation of reduced viability of recombinant BCG-induced bladder cancer cells

To confirm the inhibitory effect of recombinant BCG on bladder cancer cells, Example 1-8 was performed to evaluate cell viability.

As a result, it was confirmed that the survival rates of 5637 and T24 bladder cancer cells treated with recombinant BCG were significantly decreased dose-dependently at 10 and 30 MOI, whereas the survival rates of BCG treated cells showed no dose-dependent difference (FIG. 8). .

Example 9. Confirmation of reduced colony formation in recombinant BCG-induced bladder cancer cells

To confirm the inhibitory effect of recombinant BCG on bladder cancer cells, Examples 1-8 were performed to analyze the colony forming ability of 5637 cells treated with recombinant BCG or BCG.

As a result, it was confirmed that the number and size of colonies formed after 16 days of treatment were significantly decreased in rBCG-Sic treated cells compared to BCG treated cells (FIGS. 9 and 10). Recombinant BCG and BCG showed a dose-dependent inhibitory effect on the colony forming capacity of 5637 cells (number of colonies per high power field, mean ± standard deviation), but 10 MOI of rBCG-Sic (67.75 ± 5.82 [control]] vs. 22 ± 2.62 [rBCG-Sic], p <0.05) showed significant inhibitory activity compared to the control and 30 MOI of BCG (67.83 ± 9.39 [control] vs. 18.25 ± 2.38 [BCG], p = 0.54). Did.

Example 10. Expression of recombinant BCG in bladder cancer tissue

To confirm that the recombinant BCG expresses Sic in bladder cancer tissue, after transforming the recombinant BCG (rBCG-Sic) prepared in Example 1-4 into bladder cancer cells through electroporation, Examples 1-5 and RNA was extracted in the same manner as in Example 1-6, cDNA was synthesized, and qRT-PCR was performed using the primers in Table 5 to measure mRNA levels, and it was performed in 10 repetitions.

primer Primer sequence (5 '→ 3') Sequence number pMV306-Sic forward TCTGATTGGGGCCGATCT SEQ ID NO: 9 reverse TACATGGCAGGCTTCGGT SEQ ID NO: 10

As a result, it was confirmed that the Sic gene is constantly expressed in the bladder cancer tissue (Table 6), and the reliability of the technique of the electroporation method to insert the gene in the present invention was confirmed, and the recombinant gene was expressed and functioned in the bladder cancer tissue. It was confirmed that can be performed.

Quantity (ng) persentage (%) 9.841411706 19.68282341 ± 0.993 18.10799632 36.21599264 ± 1.257 9.953734631 19.90746926 ± 0.997 9.895168954 19.79033791 ± 0.995 19.19489607 38.38979213 ± 1.283 11.37959809 22.75919619 ± 1.056 10.9949156 21.9898312 ± 1.041 4.140807192 16.56322877 ± 0.617 4.395001108 17.58000443 ± 0.642 2.331048339 9.324193358 ± 0.367

Example 11. Confirmation of bladder cancer internalization of recombinant BCG in a stereotactic bladder cancer mouse model

Bladder cancer was formed in the bladder of the mouse to more precisely observe the efficacy of recombinant BCG in vivo similar to that of the bladder cancer using an orthotopic bladder cancer mouse model as a more accurate stereotactic bladder cancer animal model. .

In order to confirm the permeation of BCG and recombinant BCG in tissues to exert the inhibitory effect of BCG on the formation of bladder cancer in a stereotactic bladder cancer mouse model, the ratio of the number of BCG cells to mouse bladder cancer tissue was measured according to Example 2-3. , The level of bladder cancer internalization of recombinant BCG was evaluated.

As a result, as time passed, the level of internalization showed a faster detection rate of DNA in recombinant BCG (rBCG-Sic) compared to BCG, and it was confirmed that the internalization into bladder cancer was increased in the recombinant BGC administration group compared to the existing BCG ( Fig. 11). That is, it was confirmed that the internalization of the recombinant BCG into bladder cancer was superior to that of the existing BCG.

Example 12. Confirmation of the inhibitory effect of recombinant BCG on bladder cancer in a stereotactic bladder cancer mouse model

In order to confirm the inhibitory effect of recombinant BCG on bladder cancer in a stereotactic bladder cancer mouse model, in the bladder cancer animal model of Example 2-1 according to Example 2-4, luminescence of bladder cancer tissue was performed 4 days, 7 days, 11 days after BCG administration. The size of the bladder cancer was analyzed by measuring on the 14th and 18th.

As a result, the increase rate of bladder cancer was lower in the PBS-administered group and the BCG-administered group than in the untreated control group, but it was confirmed that the proliferation of bladder cancer was significantly inhibited in the recombinant BCG (rBCG-Sic) -administered group (FIGS. 12 and 13). . That is, it was confirmed that the internalization of recombinant BCG into bladder cancer was superior to that of existing BCG, so that it was possible to effectively suppress bladder cancer.

Through the above results, the recombinant BCG strain of the present invention, in that the recombinant SG gene of the present invention not only exhibits the avoidance of AMP function and improved internalization activity for bladder cancer cells, but also increases the secretion of anticancer cytokines. It was confirmed that it is possible to minimize the side effects of injecting BCG in the bladder, because it can exhibit the effect of treating bladder cancer in a smaller amount than the existing BCG.

So far, the present invention has been focused on the embodiments. Those skilled in the art to which the present invention pertains will appreciate that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered in terms of explanation, not limitation. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent range should be construed as being included in the present invention.

<110> CHUNG ANG University industry Academic Cooperation Foundation <120> Chemotherapeutic and Pharmaceutical Compositions of Recombinant          Bacillus Calmette-Guerin (BCG) including biosynthetic genes to          avoid antimicrobial peptides for the Bladder Cancer therapy <130> PN180387-P1 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> pMV306hsp_Sic_forward <400> 1 cgggctgcag gaattcatga agatcaagaa gaacatc 37 <210> 2 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> pMV306hsp_Sic_reverse <400> 2 gatcgtacgc tagttaactc aggtggtcga cggggtg 37 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Sic_forward <400> 3 tctgattggg gccgatct 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Sic_reverse <400> 4 accgaagcct gccatgta 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 16S rRNA_forward <400> 5 tcccgggcct tgtacaca 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 16S rRNA_reverse <400> 6 ccactggctt cgggtgtt 18 <210> 7 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_forward <400> 7 gcttaggttc atcagg 16 <210> 8 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_reverse <400> 8 ttcttcggta gtgaca 16 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> pMV306-Sic_forward <400> 9 tctgattggg gccgatct 18 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> pMV306-Sic_reverse <400> 10 tacatggcag gcttcggt 18

Claims (4)

A pharmaceutical composition for the treatment of bladder cancer chemotherapy, including a recombinant Bacillus Calmette-Guerin (BCG) expressing a Streptococcal inhibitor of complement (Sic) gene.
The method of claim 1, wherein the bladder cancer is a superficial bladder cancer pharmaceutical composition for bladder cancer chemotherapy.
Electroporation of a recombinant expression vector containing a nucleotide sequence encoding a Sic gene, and introducing it into Bacillus calmet-gereng bacteria
Method for producing a recombinant Bacillus Calmet-Gereng bacteria comprising a.
The method of claim 3, wherein the vector is pMV306hsp.

Images