KR20200044366A - Novel Bacillus velezensis KD1 Strain having High Proteolysis Ability and Antimicrobial Activity - Google Patents

Abstract

The present invention relates to a novel Bacillus velezensis KD1 strain isolated from soybean paste, having excellent proteolysis ability and antimicrobial activity. The present invention is excellent in proteolysis ability and antimicrobial activity, and thus can suppress the generation and growth of microorganisms for food in the process of manufacturing fermented foods such as soy sauce and soybean paste, thereby capable of being favorably utilized in the manufacture of safe fermented foods.

Description

Novel Bacillus velezensis KD1 Strain having High Proteolysis Ability and Antimicrobial Activity

The present invention relates to a novel Bacillus belensis KD1 strain having excellent protein resolution and antibacterial activity isolated from miso.

Traditional fermented foods in Korea are manufactured by natural fermentation by natural microorganisms introduced from raw materials or air by adding and mixing subsidiary materials to main raw materials without adding seed germ (starter).

In the study of microbial spawning, in Japan, excellent yeast is selected to improve the quality of sake, a local sake, and research and commercialization of yeast processing products suitable for mass production and high utilization are in progress. And improving the strain by using genetic engineering techniques, and conducting research to apply the genome information of the bacteria to the fermentation industry. In addition, brand products (Japanese sake, Chinese mahotai, silver wine, European wine, dry gin, etc.) have been developed in the world through the use of excellent seed germination and fermentation technology to develop world-class sake through modernization and quality. , South America rum, tequila, vodka, etc.).

Currently, the technology of the domestic fermentation industry is mostly accumulated experience-based know-how based on the field, and the technology development process with expertise is not systematized, and it is difficult to create economic value such as rapid industrialization of bio-industry materials and increase in exports. There are many cases. Due to the lack of excellent biological resources and seed development in Korea, a large amount of royalties are paid every year in exchange for the use of overseas biological resources, and even in the production of our own fermented foods such as rice wine, soy sauce and vinegar, They are paying huge fees abroad. In other words, the systematic research and development and management of fermented foods are insufficient, so most fermented seeds and food materials depend on imports. Therefore, the need to develop regional and national technologies has been raised through the modernization of the traditional bio food industry, the meaning of inheriting and developing our food culture, and the biorecycling of indigenous genetic resources.

Thus, the present inventors have completed the present invention by conducting research on the discovery of strains that can be used for the production of a safe fermented food with excellent antibacterial activity and the like.

Republic of Korea Patent Publication No. 10-2014-0148488

One object of the present invention is to provide a Bacillus velezensis KD1 strain (Accession Number KACC 92236P) having excellent protein resolution and antibacterial activity.

Another object of the present invention is to provide a composition for fermentation of food comprising at least one selected from the group consisting of Bacillus belgency KD1 strain, cultures of the strains, concentrates of the strains or cultures, and dried products thereof.

Another object of the present invention is a composition for inhibiting microorganisms for food, comprising at least one selected from the group consisting of Bacillus belensis KD1 strain, cultures of the strains, concentrates of the strains or cultures, and dried products thereof as an active ingredient. Is to provide

One aspect of the present invention provides a Bacillus velezensis KD1 strain (Accession Number KACC 92236P) having excellent protein resolution and antibacterial activity.

The Bacillus velezensis KD1 strain of the present invention was isolated from miso, and the KD1 strain was deposited with the National Academy of Agricultural Science on July 06, 2018 (Microorganism Accession Number: KACC 92236P).

Bacillus belensis KD1 strain of the present invention was identified by separating from fermented food miso, and as a result of analyzing the genomic DNA of the strain, it was confirmed that it is a new strain belonging to the genus Bacillus belensis.

The method for culturing the Bacillus belensis KD1 strain of the present invention can use a conventional method known in the art.

According to an embodiment of the present invention, the strain may be grown at 15 to 55 ° C, preferably at 40 to 45 ° C.

According to an embodiment of the present invention, the strain may be grown at pH 4.5 to 9.5, preferably at pH 6.0 to 7.0.

According to one embodiment of the present invention, the strain may be grown at 0 to 16% salinity (w / v), and preferably at 0 to 2% (w / v).

Another aspect of the present invention comprises at least one selected from the group consisting of Bacillus velezensis KD1 strain (Accession No. KACC 92236P), the culture of the strain, the concentrate of the strain or culture medium, and dried products thereof. Provided is a composition for food fermentation.

As used in the present invention, the term "culture" refers to a medium obtained by culturing for a period of time in a medium, a medium containing metabolites or extra nutrients, and the like, and includes a culture medium in which the strain is removed after culturing the strain. .

According to one embodiment, the culture of the Bacillus belensis KD1 strain of the present invention may be selected from a medium used for culturing microorganisms, and can be easily changed and used according to the purpose by those skilled in the art.

The culture of the Bacillus belensis KD1 strain of the present invention can be prepared by inoculating the microorganism culture medium with the strain of the present invention and according to a microorganism culture method known in the art (eg, static culture, stirred culture). have.

The Bacillus belensis KD1 strain or a concentrate of the culture medium and dried products thereof can be easily prepared according to a method of concentrating or drying a microorganism or culture medium known in the art, and a culture of the Bacillus belensis KD1 strain, strain , The concentrate of the strain or the culture medium and their dry matter may be contained in 1 to 15% by weight in the composition for food fermentation, but is not limited thereto.

The type of fermented food produced using the Bacillus belensis KD1 strain of the present invention as a seed germ is a jangjang, meju, Korean miso, miso, seasoned miso, red pepper paste, seasoned red pepper paste, chunjang, cheonggukjang, mixed soy sauce, brewed soy sauce, brewed It can be soy sauce or mixed soy sauce, and the types and types of main ingredients used in kimchi vary depending on the type, dipping method, time, fat, etc., and the whole cabbage, kimchi, kkakdugi, dongchimi, bachelor kimchi, radish salty, bosam kimchi, seokbakji, cucumber It can be exhaust, cucumber, etc., and salted fish can be anchovy, canary, early, yellowfish, shredded, bandit, mackerel, saury, stingray, flounder, flounder, sea bass, cod, dome, pollock, defence, bottlefish, trout, samchi, and salmon fish , Mullet, mullet, mullet, clam, clam, mussel, turban, abalone, oyster, clam, sea urchin or sea urchin may be used as raw materials, but may preferably be miso or soy sauce.

The composition for adding food may be prepared in a solid or liquid form of a formulation, and may be prepared by adding a bulking agent to use in the form of a powdery powder, or by granulating it by formulating it.

The food is preferably a fermented food, and within a range that does not reduce protein resolution and antibacterial activity, may further include one or more food additives commonly used in fermented foods in the art.

Another aspect of the present invention is valid for one or more selected from the group consisting of Bacillus velezensis KD1 strain (Accession number KACC 92236P), the culture of the strain, the concentrate of the strain or culture medium, and dried products thereof. It provides a composition for inhibiting microorganisms for food containing ingredients.

The term used in the present invention, "food hazard microorganism" refers to a microorganism that reproduces in food raw materials or food itself and causes food poisoning or decay of food.

Bacillus belensis KD1 strain of the present invention exhibits excellent antimicrobial activity against microorganisms such as food, so when used in the manufacturing process of fermented foods such as soy sauce and miso, it is possible to suppress the reproduction of microorganisms for food, so it is safely consumed. It is possible to manufacture fermented foods that can.

According to one embodiment of the invention, the food hazard microorganisms are Escherichia coli , Bacillus cereus , Staphylococcus aureus , Listeria monocytogenes and Asus It may be one or more selected from the group consisting of Aspergillus flavus .

According to the new Bacillus belensis KD1 strain, which has excellent protein decomposition and antibacterial activity isolated from miso, it has excellent protein decomposition and antibacterial activity. As it can, it can be usefully used for the production of safe fermented foods.

Figure 1 is a photograph showing the protein resolution and antibacterial activity of the first selected 9 strains ((A) protein resolution; (B) Escherichia coli O157: H7; (C) Bacillus cereus ATCC 27348: (D) Staphylococcus aureus KCTC 3881;. (E) Aspergillus flavus subsp flavus KACC 41809).
2 is a photograph showing the starch resolution of the first selected nine strains.
Figure 3 is a photograph showing the thrombolytic ability of the first selected nine strains.
Figure 4 is a photograph showing the hemolysis phenomenon of the first selected nine strains.
5 is a genome map of Bacillus belensis KD1 strain (Accession number KACC 92236P).
6 is a phylogenetic diagram analyzed using genomic DNA of Bacillus belensis KD1 strain.
7 is a graph showing glucose and D-galacturonic acid metabolism of Bacillus belensis KD1 strain.
8 is a diagram showing the fermentation metabolism pathway of the Bacillus belensis KD1 strain.
9 is a photograph showing excellent antibacterial activity of Bacillus belensis KD1 strain.

Hereinafter, the present invention will be described in more detail through one or more embodiments. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1. Selection of primary strain through comparison of protein resolution and antibacterial activity

1-1. Protein resolution analysis

After dissolving 3 g of miso sample in PBS, it was spread on a TSA (trypticase soy agar) medium containing 7.5% NaCl and 1% skim milk, cultured in a 37 ° C incubator for 48 hours, and then formed around the colony. Strains were selected by measuring protein resolution according to the size of the transparent ring.

1-2. Antibacterial activity analysis

Pathogen: the TSA media said a top view of (Escherichia coli O157 H7 (Fig. 1B), Bacillus cereus ATCC 27348 (Fig. 1C), Staphylococcus aureus KCTC 3881 (Fig. 1D), and Aspergillus flavus subsp flavus KACC 41809 (Fig. 1E).), After dropping 1 µl of the pre-culture solution of the strain selected in Example 1-1, incubating for 24 hours in an incubator at 37 ° C., and then selecting the strain by measuring the antibacterial activity according to the size of the transparent ring formed around the colony.

1-3. Primary strain selection

In order to select the primary strain, Examples 1-1 and 1-2 were performed to compare the protein resolution and antibacterial activity of the strains contained in miso.

As a result, as shown in Table 1, nine strains having excellent protein resolution (FIG. 1A, diameter of transparent ring> 1 mm) and antibacterial activity (FIGS. 1B to 1E, diameter of transparent ring> 2 mm) were selected (FIG. 1). ).

Strain system Bacillus velezensis KD1 Bacillus amyloliquefaciens DSM7 ^T Bacillus siamensis KCTC13613 ^T Bacillus velezensis LMG22478 ^T Bacillus subtilis NCIB3610 ^T Bacillus sp. D2-3 Bacillus sp. D9-1 Bacillus sp. D12-2 Bacillus sp. D32-2

Example 2. Final strain selection through functional test and stability test

2-1. Analysis of starch resolution (amylase activity)

1 µl of each culture medium (OD = 1) of the nine strains selected in Examples 1-3 was 1% starch solid medium (1% soluble starch, 0.2% yeast extract, 0.1% K) ₂ HPO ₄ , 0.15% MgSO _{4 ·} 7H ₂ O, 1.5% agar, 7.5% NaCl), and incubated at 37 ° C. for 24 hours. After cultivation, starch resolution was analyzed by observing the presence or absence of a transparent ring formed around the colony by treating Gram's Iodine solution on a solid medium.

2-2. Analysis of fibronolytic activity

After culturing the strains in a trypticase soy broth (TSB) medium containing 7% (w / v) NaCl for 24 hours, 10 μl of cell-free culture supernatant was added to a fibrin plate (0.5%). (w / v) low melting agarose, 0.4% (w / v) fibrinogen (0.01M PBS, pH7.4), 10 NIH U thrombin paper disk ) After dripping and reacting at 37 ° C. for 24 hours, thrombolytic ability was analyzed with or without the formation of a transparent ring around the disc.

2-3. Hemolysis analysis

After progenitor inoculation of the bacteria in TSA medium to which 5% amount of blood (sheep blood, Thermo scientific, USA) was added, incubation for 12 hours at 37 ° C., analysis of hemolysis was performed with or without the presence of a clear ring formed around the colony. B. cereus ATCC 27348 was used as a positive control.

2-4. Endotoxin analysis

The presence or absence of the endotoxin generating gene was analyzed by performing PCR using primers targeting the endotoxin producing genes ( nheA, nheB, nheC, hblA, hblB, hblC, hblD, bceT, entFM, cytK, and ces ). B. cereus ATCC 27348 was used as a positive control. PCR conditions and sequences of the primers used are shown in Tables 2 and 3 below.

gene denaturalization
(denaturation) Annealing and extension Last height
(final extension) hblB 94 ℃ -1 minute (94 ℃ -10sec, 58 ℃ -30sec and 68 ℃ -2min) x 10 times (94 ℃ -10sec, 58 ℃ -30sec and 68 ℃ -2min (increase by 20sec each time)) x 20 times 68 ℃ -7 minutes cytK 95 ℃ -1 minute (95 ℃ -60sec, 48 ℃ -60sec and 72 ℃ -60sec) x 30 times 72 ℃ -7 minutes ces 95 ℃ -15 minutes (95 ℃ -60sec, 58 ℃ -75sec and 72 ℃ -50sec) x 25 times 72 ℃ -7 minutes hblC / hblD 94 ℃ -2 minutes (94 ℃ -1min, 58 ℃ -1min and 72 ℃ -2min) x 35 times 72 ℃ -5 minutes hblA / nheA (94 ℃ -1min, 56 ℃ -1min and 72 ℃ -2min) x 35 times 72 ℃ -5 minutes nheB / nheC (94 ℃ -1min, 54 ℃ -1min and 72 ℃ -2min) x 35 times 72 ℃ -5 minutes bceT (94 ℃ -1min, 55 ℃ -1min and 72 ℃ -2min) x 35 times 72 ℃ -5 minutes entFM 95 ℃ 3 minutes (95 ℃ sec, 60 ℃ sec and 72 ℃ sec) x 35 times 72 ℃ -5 minutes

primer Primer sequence (5 '→ 3') Sequence number nheA forward GTTAGGATCACAATCACCGC SEQ ID NO: 1 reverse ACGAATGTAATTTGAGTCGC SEQ ID NO: 2 nheB forward TTTAGTAGTGGATCTGTACGC SEQ ID NO: 3 reverse TTAATGTTCGTTAATCCTGC SEQ ID NO: 4 nheC forward TGGATTCCAAGATGTAACG SEQ ID NO: 5 reverse ATTACGACTTCTGCTTGTGC SEQ ID NO: 6 hblA forward AAGCAATGGAATACAATGGG SEQ ID NO: 7 reverse AGAATCTAAATCATGCCACTGC SEQ ID NO: 8 hblB forward AAGCAATGGAATACAATGGG SEQ ID NO: 9 reverse AATATGTCCCAGTACACCCG SEQ ID NO: 10 hblC forward GATACTAATGTGGCAACTGC SEQ ID NO: 11 reverse TTGAGACTGCTCGTTAGTTG SEQ ID NO: 12 hblD forward ACCGGTAACACTATTCATGC SEQ ID NO: 13 reverse GAGTCCATATGCTTAGATGC SEQ ID NO: 14 bceT forward CGTATCGGTCGTTCACTCGG SEQ ID NO: 15 reverse GTTGATTTTCCGTAGCCTGGG SEQ ID NO: 16 entFM forward AGAATCTAAATCATGCCACTGC SEQ ID NO: 17 reverse GTATGTAGCTGGGCCTGTACGT SEQ ID NO: 18 cytK forward GTAACTTTCATTGATGATCC SEQ ID NO: 19 reverse GAATACTAAATAATTGGTTTCC SEQ ID NO: 20 ces forward GGTGACACATTATCATATAAGGTG SEQ ID NO: 21 reverse GTAAGCGAACCTGTCTGTAACAACA SEQ ID NO: 22

2-5. Antibiotic susceptibility analysis

Strains cultured to OD ₆₀₀ = 1 in TSB medium were thinly layered on TSA medium using the Top agar method, and the medium was solidified for 30 minutes. Filter-paper discs containing antibiotics (6 nm, GE Healthcare of Life Science, USA) were placed on the medium and cultured at 37 ° C. for 24 hours to observe the presence or absence of transparent ring formation around the colony. Antibiotics were used at the following concentrations for each filter-paper disc: ampicillin (10 mg), polymyxin B (100 U), streptomycin (50 mg), penicillin G (penicillin) G, 20U), gentamicin (30 mg), chloramphenicol (100 mg), tetracycline (30 mg), kanamycin (30 mg), lincomycin (15 mg), oleandomycin (oleandomycin, 15mg), carbenicillin (100mg), neomycin (30mg) and novobiocin (5mg).

2-6. Final strain selection

In order to select the final strain, the functional tests of Examples 2-1 and 2-2 were performed to compare the starch resolution and thrombus lysis capacity of the primary selected strain. In addition, the stability tests of Examples 2-3 to 2-5 were performed to compare hemolysis, endotoxin production, and antibiotic resistance of the primary selected strains.

As a result of the functional test, as can be seen in Figure 2, it was confirmed that the starch resolution of the KD1, D2-3, D9-1, D12-2 and D32-2 strains is excellent. In addition, as can be seen in Figure 3, it was confirmed that the thrombolytic ability of the KD1, D9-1 and D32-2 strains is excellent.

On the other hand, as a result of the stability test, as shown in FIG. 4, it was confirmed that hemolysis was not induced because transparent rings did not appear in KD1, DSM7 ^T , D9-1, D12-2, and D32-2. In addition, as can be seen in Table 4, it was confirmed that all nine strains do not produce endotoxin because PCR bands are not formed.

Strain hblC hblD hblA nheA bceT nheB nheC cytK ces entFM hblB Control + + + + + + + - - + + KD1 - - - - - - - - - - - NCIB 3610 ^T - - - - - - - - - - - DSM7 ^T - - - - - - - - - - - KCTC 13613 ^T - - - - - - - - - - - LMG 22478 ^T - - - - - - - - - - - D2-3 - - - - - - - - - - - D9-1 - - - - - - - - - - - D12-2 - - - - - - - - - - - D32-2 - - - - - - - - - - -

In addition, as shown in Tables 5 to 7 below, it was confirmed that the KD1 and DSM7 ^T strains are sensitive to all antibiotics.

Strain penicillin streptomycin chloramphenicol oleandomycin KD1 - - - - NCIB 3610 ^T + - - - DSM7 ^T - - - - KCTC 13613 ^T + - - - LMG 22478 ^T + - - - D2-3 + - - - D9-1 - + + + D12-2 - - - - D32-2 - + + -

Strain novobiocin neomycin gentamicin tetracycline KD1 - - - - NCIB 3610 ^T + - - - DSM7 ^T - - - - KCTC 13613 ^T - - - + LMG 22478 ^T - - - - D2-3 + - - - D9-1 - - - + D12-2 + - - + D32-2 - - - -

Strain ampicillin lincomycin carbenicillin kanamycin KD1 - - - - NCIB 3610 ^T - - - - DSM7 ^T - - - - KCTC 13613 ^T - - - - LMG 22478 ^T - - - - D2-3 + - - - D9-1 - - - - D12-2 - - + - D32-2 - - - -

By synthesizing these results, the Bacillus belensis KD1 strain was selected as the final strain.

Example 4. Analysis of genomic and biological characteristics of the final selected strain

4-1. Analysis of genetic characteristics of the final selected strain

In order to confirm the genetic characteristics of the Bacillus belensis KD1 strain selected in Example 3, the phylogenetic characteristics of the Bacillus belensis KD1 strain were analyzed after performing the genomic analysis.

Specifically, genomic DNA was extracted from a strain of Bacillus belensis KD1 (Accession No. KACC 92236P) and commissioned for genomic analysis. Analysis of the phylogenetic properties of Bacillus belensis KD1 strain and the analysis of the average nucleotide identity (ANI) and in-silico DDH between Bacillus belensis KD1 genome and strains that are systematically very close to Bacillus belensis KD1 strain Did.

As a result, it was confirmed that the genome map of the finally selected Bacillus belensis KD1 strain is the same as in FIG. 5. In addition, it was confirmed that the results of phylogenetic tree analysis using the genome of the KD1 strain are the same as in FIG. 6.

4-2. Analysis of biological characteristics of the final selected strain

In order to analyze the biological characteristics of the finally selected Bacillus belensis KD1 strain, the KD1 strain was plated on TSA medium, and then growth characteristics at various salt, temperature, pH, and anaerobic conditions were analyzed.

Specifically, D-galacturonic acid (D-galacturonate) was inoculated into the M9 minimal medium using the same carbon source as Bacillus belensis KD1 strain, and then a growth curve during incubation at 37 ° C. for 24 hours was prepared to generate D-gal The metabolism of lacturonic acid was analyzed. The growth curve in the M9 minimal medium using glucose as the carbon source of the day was used as a positive control.

In addition, glucose metabolism of the KD1 strain was analyzed by API 50CHB analysis using the KD1 strain cultured for 24 hours in TSB medium. Additionally, the fermentation metabolism pathway of the KD1 strain was analyzed based on the genomic information analyzed in Example 4-1.

As a result, it was confirmed that the growth characteristics of the Bacillus belensis KD1 strain are shown in Table 8.

Item Characteristic NaCl range for growth (%, w / v) 0-16 Optimal NaCl concentration (%, w / v) 0-2 Temperature range ℃ 15-55 Optimum temperature ℃ 40-45 pH range 4.5-9.5 Optimal pH 6.0-7.0 Anaerobic growth Weak growth

In addition, as can be seen in Figure 7, it was confirmed that the KD1 strain shows glucose and D-galacturonic acid metabolism. On the other hand, it was confirmed that the fermentation metabolism pathway of the KD1 strain is the same as in FIG. 8.

Example 5. Confirmation of excellent antibacterial activity of KD1 strain

It was confirmed whether the Bacillus belensis KD1 strain has better antibacterial effect than other Bacillus begensis strains.

Specifically, as a comparative strain, Bacillus belensis YJ11-1-4 strain was used, and as a control, Bacillus siamensis D2-2 was used, and Bacillus cereus ATCC 27348 (Fig. 9A) as a pathogenic bacterium . , Escherichia coli O157 (FIG. 9B), Staphylococcus aureus KCTC 3881 (FIG. 9C), Listeria Monocytogenes KCTC 13064 (FIG. 9D) and Aspergillus flavus subsp. Antibacterial activity was analyzed in the same manner as in Example 1-2, except that flavus KACC 41809 (FIG. 9E) was used.

As a result, as can be seen in FIG. 9, the transparent ring of the KD1 strain is formed larger than the transparent ring of the YJ11-1-4 strain, and the antibacterial activity of the KD1 strain is higher than the strain of the same Bacillus begenesis strain, the YJ11-1-4 strain. It was confirmed that the activity was excellent.

Example 6. Preparation of soy and miso using KD1 strain

The selected soybeans were immersed in water for 14 hours, dehydrated for 2 hours, and then increased at 100 ° C for 4 hours. Bacillus velezensis KD1 strain was inoculated at 1 × 10 ⁶ / g concentration in beans (total weight of 5.69 kg) increased for 4 hours at 100 ° C., and then molded into 6 loaves of meju. The molded meju was fermented at 15 ° C. for 90 days, immersed in 20 l of 11% salt concentration, aged at 20-25 ° C. for 3 months, and then the meju (soy sauce) was separated from the brine (soy sauce). The separated soy sauce was further aged by 3 months, and the miso was completed by further 9 months.

So far, the present invention has been focused on the embodiments. Those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered in terms of explanation, not limitation. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent range should be interpreted as being included in the present invention.

Claims (7)

Bacillus velezensis KD1 strain having excellent protein resolution and antibacterial activity (Accession number KACC 92236P).
The strain of claim 1, wherein the strain is grown at 15 to 55 ° C.
The strain of claim 1, wherein the strain is grown at pH 4.5 to 9.5.
The strain of claim 1, wherein the strain is grown at 0 to 16% salinity (w / v).
Bacillus velezensis of claim 1 ( Bacillus velezensis ) KD1 strain (Accession No. KACC 92236P), for the fermentation of food products comprising at least one selected from the group consisting of a culture of the strain, the concentrate or a concentrate of the culture medium and dried products thereof Composition.
A Bacillus velezensis KD1 strain of claim 1 (Accession No. KACC 92236P), comprising at least one selected from the group consisting of cultures of the strains, concentrates of the strains or cultures, and dried products thereof as an active ingredient. Composition for the inhibition of food hazard microorganisms.
The method of claim 6, wherein the food microorganisms are Escherichia coli , Bacillus cereus , Staphylococcus aureus , Listeria monocytogenes and Aspergillus plasma Bus (Aspergillus flavus ) is a food composition for inhibiting microorganisms that is at least one member selected from the group consisting of.

Images