KR20200042561A - Cell reprogramming composition and method for producing an induced pluripotent stem cell using the same - Google Patents

Abstract

The present invention relates to a cell reprogramming composition and a method for producing induced pluripotent stem cells comprising the same. A compound having the structure of chemical formula 1 of the present invention can produce induced pluripotent stem cells directly from differentiated cells. In addition, compared to a conventional biguanide derivative, it is possible to increase the reprogramming efficiency of cells, and to maintain the undifferentiated state of pluripotent stem cells. Furthermore, it is expected that the composition according to the present invention can be utilized in the development stage of new drugs and cell therapy.

Description

Cell reprogramming composition and method for producing induced pluripotent stem cells using the same {CELL REPROGRAMMING COMPOSITION AND METHOD FOR PRODUCING AN INDUCED PLURIPOTENT STEM CELL USING THE SAME}

The present invention relates to a cell reprogramming composition and a method for producing induced pluripotent stem cells comprising the same, more specifically, a cell reprogramming composition comprising a biguanide derivative as an active ingredient and a medium differentiated from the medium containing the composition It relates to a method for producing induced pluripotent stem cells for culturing cells.

Induced Pluripotent Stem Cell (iPSC) refers to stem cells in an undifferentiated state in which differentiated cells have pluripotency through cell reprogramming, an artificial dedifferentiation process. In 2006, a technology was developed to produce induced pluripotent stem cells from somatic cells through complex overexpression of reprogramming-inducing genes such as Oct4, Sox2, Klf4, and cMyc (Cell, 126.4 (2006): 663-676). Various dedifferentiation technologies have been developed based on the above technology, and this can overcome bioethics controversy and immunocompatibility problems that may occur when using human embryonic stem cells, and can be utilized in the pharmaceutical industry as a variety of medical uses. It is expected to be.

In addition, in addition to the genes involved in reprogramming, it is known that subtoxic doses of mitochondrial inhibitors can promote reprogramming efficiently by promoting glycolysis during the production of induced pluripotent stem cells (The international journal of biochemistry & cell biology 45.11 (2013): 2512-2518). However, both mitochondrial inhibitors such as rotenone and TTFA (thenoyltrifluoroacetone) appear to have toxicity, and thus, new mitochondrial inhibitors capable of dramatically improving reprogramming efficiency even without toxicity can be practically utilized in the process of reverse differentiation. It is essential to develop a follow-up technology.

(1) Kazutoshi Takahashi and Shinya Yamanaka. "Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors." Cell 126.4 (2006): 663-676. (2) Son, Myung Jin, et al. "Interference with the mitochondrial bioenergetics fuels reprogramming to pluripotency via facilitation of the glycolytic transition." The international journal of biochemistry & cell biology 45.11 (2013): 2512-2518.

Accordingly, the present inventors have completed the present invention by establishing a technique capable of enhancing reprogramming efficiency by using a non-toxic biguanide derivative as a mitochondrial inhibitor for cell reprogramming.

Accordingly, an object of the present invention is to provide a composition capable of effectively enhancing cell reprogramming including a biguanide derivative as an active ingredient.

In order to achieve the above object, the present invention provides a composition for promoting reprogramming comprising a compound of Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[Formula 1]

In addition, the present invention is a reprogramming factor is introduced into the differentiated cells comprising the step of culturing in a culture medium containing a compound of Formula 1 or a pharmaceutically acceptable salt thereof into induced pluripotent stem cells Provides a method.

In addition, the present invention provides a composition for maintaining the undifferentiated state of pluripotent stem cells comprising the composition.

The present invention can increase the reprogramming efficiency of cells compared to conventional biguanide derivatives. In addition, it was confirmed that the composition of the present invention can be used to increase the efficiency of producing induced pluripotent stem cells directly from differentiated cells, and can maintain the undifferentiated state of pluripotent stem cells. Furthermore, the composition according to the present invention can be utilized in the stage of cell therapy and new drug development.

Figure 1 confirms the effect of obtaining and maintaining stem cell starch differentiation ability according to treatment with biguanide derivatives (hereinafter referred to as 'IM').
Figure 1a shows the structure of the IM compound.
Figure 1b shows the change in oxygen consumption (OCR) according to the IM compound treatment.
Figure 1c is a comparison of the degree to which a mouse iPSC is generated when the IM compound and rotenone treatment.
Figure 1d is a comparison of the degree to which a human iPSC is produced upon treatment with an IM compound and rotenone.
Figure 1e confirms the effect of maintaining the stem cell function by the IM compound under non-self-renewal conditions (LIF untreated) or self-renewal conditions (LIF treatment).
Figure 1f confirms the effect of maintaining stem cell function by IM compounds under unconditional medium (UM) conditions.
Figure 2 confirms the mechanism of action of the IM compound.
Figure 2a shows the iPSC generation process and the timing of IM compound treatment.
Figure 2b shows the change in the oxygen consumption rate (OCR) over time when the IM compound and rotenone treatment.
Figure 2c shows the intracellular lactate concentration change by the IM compound.
Figure 2d shows the intracellular ATP change by the IM compound.
Figure 2e confirms the expression pattern of OXPHOS-related genes ( NDU5 and ATP5B ), glycolysis-related genes ( HK2 and LDHA ) and stem cell-related genes ( Nanog and Rex1 ) by IM compounds.
Figure 2f shows the change in the active histone marker and inhibitory histone marker of the stem cell function related genes ( Nanog and Oct4 ) by the IM compound.
Figure 3 confirms the cytotoxicity of the IM compound.
Figure 3a confirms the cytotoxicity of the IM compound against cancer cells (SK-MEL-28) under 11.1 mM glucose conditions.
Figure 3b confirms the cytotoxicity of the IM compound against cancer cells under 0.75 mM glucose conditions.
Figure 3c confirms the cytotoxicity of the IM compound against mouse embryonic fibroblasts (MEF) under 25 mM glucose conditions.
Figure 3d confirms the cytotoxicity of the IM compound against MEF introduced with OSKM under 25 mM glucose conditions.
Figure 4 confirms the reprogramming efficacy according to the concentration change of the IM compound, and the presence or absence of OSKM factor.
Figure 4a is a comparison of the reprogramming effect of the MEF OSKM is introduced according to the concentration of the IM compound.
Figure 4b is a comparison of the reprogramming effect of human foreskin fibroblasts (HFF) introduced OSKM according to the concentration of the IM compound.
Figure 4c confirms the reprogramming effect of the IM compound with or without the OSKM factor.
Figure 5 confirms the effect of maintaining the stem cell function according to the concentration change of the IM compound.
Figure 5a confirms that it shows an excellent effect on the maintenance of mESC stem cell capacity at the nanomolar concentration of the IM compound.
5b confirms that the nanomolar concentration of the IM compound shows an excellent effect on the maintenance of stem cell function of hESC.
Figure 6 confirms the effect of a biguanide derivative on stem cell differentiation capacity.
Figure 6a confirms the reprogramming effect by metformin.
Figure 6b confirms the reprogramming effect by phenformin.
Figure 6c confirms the effect of maintaining the stem cell function of the mouse by metformin.
Figure 6d confirms the effect of maintaining human stem cell function by metformin.
7 confirms the effect of promoting reprogramming by the IM compound.
Figure 7a is a comparison of the size of the colonies formed by the IM compound during the reprogramming process.
Figure 7b shows the time course of colony selection by the IM compound during the reprogramming process.
7c is a comparison comparing the number and size of Nanog + or SSEA1 + clusters formed by IM compounds during the reprogramming process.
Figure 7d shows the degree of glycolysis activity by the IM compound.
Figure 7e shows the change in the inhibitory histone marker of the stem cell function related genes ( Nanog and Oct4 ) by the IM compound.

One aspect of the present invention provides a composition for promoting reprogramming comprising a compound of Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[Formula 1]

In one embodiment of the present invention, the reprogramming may be to promote differentiation from differentiated cells to induced pluripotent stem cells.

In one embodiment of the present invention, Formula 1 is a hydrophobic cationic small molecule having a biguanide core, and more specifically N-1- (2-methyl) phenethylbiguanide hydrochloride. Chemical Formula 1 is used by being named 'IM176OUT05' or 'IM'.

In one embodiment of the invention, the differentiated cells may be one or more selected from the group consisting of somatic cells, germ cells, progenitor cells and fibroblasts. More specifically, human-derived fibroblasts are preferred, but are not limited thereto, and all animal-derived somatic cells such as monkeys, pigs, horses, cows, sheep, dogs, cats, mice, and rabbits can be used.

In one embodiment of the invention, the differentiated cells may include any one of Oct4, Sox2, Klf4 and c-Myc (OSKM), and may include all of the OSKM factors. More specifically, the differentiated cells may be one or more selected from the group consisting of Oct4, Sox2 and Klf4, and one or more selected from the group consisting of c-Myc, Lin28 and Nanog additionally introduced. You can. Here, OSKM means Yamanaka factor, and includes Oct4, Sox2, Klf4 and c-Myc. In addition, the introduction means that a gene or protein is introduced, and preferably, a gene is introduced.

In one embodiment of the invention, the composition may be to enhance the reprogramming efficiency due to mitochondrial cell respiration inhibition, promoting glycolysis or promoting the expression of starch potential gene.

As used herein, the term “derived pluripotent stem cells” refers to cells made in a manner of establishing undifferentiated stem cells with similar starch differentiation ability to embryonic stem cells using reprogramming technology on differentiated cells. Induced pluripotent stem cells have almost the same characteristics as embryonic stem cells. More specifically, induced pluripotent stem cells have a cell shape similar to that of embryonic stem cells, have similar gene and protein expression patterns, and have starch potential both in vitro and in vivo. In addition, when forming a teratoma and inserting it into the blastocyst of a mouse, it forms a chimeric mouse, and the germline transfer of the gene is possible.

In one embodiment of the present invention, the composition is a concentration of a compound of Formula 1 or a pharmaceutically acceptable salt thereof 0.1 to 1 μM, 0.1 to 500 nM, 0.5 to 300 nM, 1 to 200 nM or 1 to 100 nM It can be included as In particular, the compound of Formula 1 was found not to exhibit cytotoxicity in the concentration range of 1 to 100 nM (Fig. 3).

In one embodiment of the present invention, the composition may be a culture medium or a culture medium additive.

The "culture medium" or "culture medium additive" is part of the components constituting the culture required when culturing cells, and the formula 1 and its pharmaceutically acceptable salts according to an embodiment of the present invention are effective. Contains as an ingredient. Cells cultured under the medium conditions containing the medium composition may be reprogrammed to induced pluripotent stem cells.

In addition, one aspect of the present invention is induced pluripotent stem cells in differentiated cells comprising the step of culturing in a medium containing a compound of Formula 1 or a pharmaceutically acceptable salt thereof in differentiated cells introduced with reprogramming factors. Provides a method for manufacturing a furnace.

Here, as a method of introducing a reprogramming gene into differentiated cells, a method of providing a substance to cells commonly used in the art may be used without limitation. Depending on the type of reprogramming gene, a method of administering a reprogramming gene to a culture medium of differentiated cells or a method of directly injecting a reprogramming inducer into differentiated cells may be used. The reprogramming gene used at this time is a virus obtained from packaging cells transfected with the viral vector into which the gene is inserted, a plasmid vector containing the inducer gene, a messenger RNA produced by in vitro transcription, or It can be used in the form of proteins produced in various cell lines.

More specifically, a method of directly injecting the reprogramming gene into differentiated cells may use microinjection, electroporation, particle bombardment, and insulator.

In one embodiment of the invention, the compound of Formula 1 or a pharmaceutically acceptable salt thereof may be included in a concentration of 0.1 to 1 μM, 0.1 to 500 nM, 0.5 to 300 nM or 1 to 200 nM, 1 to It is preferably included at a concentration of 100 nM.

In one embodiment of the present invention, the reprogramming factor may include one or more selected from the group consisting of Oct4, Sox2 and Klf4, and additionally one or more selected from the group consisting of c-Myc, Lin28 and Nanog. It can contain.

In addition, an aspect of the present invention provides a composition for maintaining the undifferentiated state of pluripotent stem cells comprising the composition.

Hereinafter, the present invention will be described in more detail by examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited to them.

Preparation Example 1. Preparation of induced pluripotent stem cells (iPSC)

Production Example 1.1. Reagent preparation

As a derivative of biguanide, (N-1- (2-methyl) phenethyl biguanide hydrochloride (hereinafter referred to as 'IM176OUT05' or 'IM'), a hydrophobic cationic small molecule having a biguanide core, was synthesized (FIG. 1a) .In the same manner as in Example 22 of Korean Patent Publication No. 10-2016-0146852 (December 21, 2016), 2-methylphenethylamine and trimethylsilyl trifluor were substituted for 3,4-dichlorophenethylamine. Romethane sulfonate was reacted in. In addition, Rotenone was purchased from Santa Cruz Biotechnology (Dallas, Texas, USA), phenformin, oligomycin A, carbonyl cyanide 4- (tri Fluoromethoxy) phenylhydrazone (FCCP) and 4 ', 6-diamidino-2-phenylindole (DAPI) were purchased from Sigma (St. Louis, MO, USA) Minoxidil was also purchased. It was purchased from Hyundai Pharm (Seoul, Republic of Korea) and metformin was Cayman chemical (Ann Arbor, MI). , USA).

Production Example 1.2. Cell culture

A549 (human lung carcinoma), SK-MEL-28 (human melanoma), SK-OV-3 (human ovarian cancer), 786-O (kidney carcinoma), MDA-MB-435, MDA-MB-231 and MCF -7 (human breast cancer) cells were purchased from ATCC (Manassas, VA, USA) and RPMI (Invitrogen, Grand Island) added with 5% fetal bovine serum (FBS, Invitrogen) and 1% penicillin / streptomycin (PS, Invitrogen) , NY, USA). Mouse embryo fibroblasts (MEF) were isolated from embryos on day 12.5 of embryonic day of CF1 mice (Laboratory Animal Resource Center, Chungcheongbuk-do, Republic of Korea), 10% FBS, 0.1 mM β-mercaptoethanol (β-ME , Sigma), 1% non-essential amino acid (NEAA, Invitrogen) and 1% PS were added in DMEM (Invitrogen). Human foreskin fibroblasts (HFF; ATCC) were cultured in DMEM with 10% FBS, 0.1 mM β-ME, 1% NEAA, 1% L-glutamine (Invitrogen) and 1% PS. The mouse embryonic stem cell line (mESC) J1 (ATCC) was 15% FBS, 0.1 mM β-ME, 1% NEAA, 1% L-glutamine, 20 mM HEPES (Invitrogen), 1% PS and 1,000 U / ml LIF (Millipore) , Billerica, MA, USA), and cultured on a plate coated with γ-irradiated MEF or Matrigel (BD Biosciences, Franklin Lakes, NJ, USA). Human embryonic stem cell line (hESC) H9 (WiCell Research Institute, Madison, WI, USA) was cultured on γ-irradiated MEF using hESC culture medium (UM), or mart with MEF-CM (conditioned medium) Cultured in a conventional manner on a rigel coated plate. All animal experiments were approved by the KRIBB Bioethics Committee.

Preparation Example 1.3. Virus production and generation of induced pluripotent stem cells

PMX vector and VSV-G envelope loaded with human cDNA of Oct4 (POU5F1), Sox2, Klf4 and c-Myc (Addgene, Cambridge, MA, USA) in GP2-293 packaging cells (Clontech, Mountain View, CA, USA) The vector was transfected. At this time, Lipofectamine 2000 transfection reagent (Invitrogen) was used. The virus-containing supernatant was concentrated by ultracentrifugation (Beckman Coulter, Brea, CA, USA) for 90 minutes at 25,000 rpm (rotor: SW32Ti). To generate iPSC, MEF or HFF were seeded in 6-well plates at 1 x 10 ⁵ cells per well. Virus was transduced on day 1 with an infection multiplicity of 1 in the presence of 8 mg / ml polybrene (Sigma). MEF or HFF were trypsinized on the 4th or 5th day of inoculation, respectively, and re-inoculated with a 3 Х 10 ⁴ cell density in a 12-well plate coated with Matrigel. The next day, the medium was replaced with mESC or hESC with or without the IM compound, and then the medium was changed every other day.

Example 1. Reprogramming efficacy analysis test

Example 1.1 Alkaline phosphatase (AP) staining

AP staining was performed according to the manufacturer's instructions (Sigma) using a commercially available kit. Cells were fixed with fixation solution for 30 seconds, and then stained with AP staining solution for 15 minutes in the dark. AP ⁺ colony images were obtained with HP Scanjet G4010 (Hewlett-Packard, Palo Alto, CA, USA). Colony number and density were analyzed with Image J software.

Example 1.2. Oxygen consumption rate (OCR) / extracellular acidification rate (ECAR) measurement

A549 cells were treated with continuously-diluted IM176OUT05 for 24 hours, and oxygen consumption was measured in 3 replicates. On day 4 of reprogramming, OSKM-transduced MEF was repeated ³ times with ³ x 10 ³ cell densities on a poly-L-lysine (Sigma) -coated 96-well XF plate (Agilent, Santa Clara, California, USA). It was re-vaccinated to be measurable. The next day (day 5), the medium was replaced with mESC medium with or without IM compounds. On the 7th day, OCR / ECAR was measured using the Seahorse XFe96 Flux analyzer according to the manufacturer's instructions. After calibrating the probe cartridge for 1 hour without CO ₂ , the baseline level measurement of OCR / ECAR was started. Electron transport system (ETC) target compounds were added sequentially at each indicated time point: 1.5 μM oligomycin (ATP synthase, Complex V inhibitor), 5 μM FCCP (decoupling agent) and 0.5 μM rotenone (Complex I inhibitor) + Antimycin A (Complex III inhibitor). The measured value was normalized by dividing by the number of cells.

Example 1.3. Lactate and ATP analysis

For lactate analysis, 10 μg of total protein in each group was performed according to the manufacturer's instructions for the Lactate Assay Kit (BioVision, Milpitas, CA, USA). After reacting at room temperature for 30 minutes, absorbance was measured using a SpectraMax microplate reader (Molecular Devices, Sunnyvale, CA, USA). For ATP analysis, 0.1 μg of total protein in each group was used, and ATP concentration was quantified using the ADP / ATP Ratio Assay Kit (Abcam, Cambridge, MA, USA). In addition, luminescence was measured using a SpectraMax microplate reader (Molecular Devices).

Example 1.4. RNA extraction and real-time polymerase chain reaction (PCR)

Total RNA was obtained from each group using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). cDNA was synthesized using SuperScript First-strand Synthesis System Kit (Invitrogen) and mixed with Fast SYBR® Green Master Mix (Applied Biosystems, Waltham, MA, USA). Real-time quantitative PCR was performed with a 7500 Fast Real-Time PCR System (Applied Biosystems). Table 1 lists the primer sequences used.

gene Primer (forward) Primer (reverse direction) mNDUS3 SEQ ID NO: 1 (CAAGCAGCTCTCAGCATTTG) SEQ ID NO: 2 (CGCAGAGACAGCAGGTTGTA) mATP5B SEQ ID NO: 3 (GAGGGATTACCACCCATCCT) SEQ ID NO: 4 (CATGATTCTGCCCAAGGTCT) mHK2 SEQ ID NO: 5 (GGGACGACGGTACACTCAAT) SEQ ID NO: 6 (GCCAGTGGTAAGGAGCTCTG) mLDHA SEQ ID NO: 7 (TGGCAGCCTCTTCCTTAAAA) SEQ ID NO: 8 (CAGCTTGCAGTGTGGACTGT) mNanog SEQ ID NO: 9 (GGTCTTCCTGGTCCCCACAGTTTG) SEQ ID NO: 10 (TGGGACTGGTAGAAGAATCAGGGC) mRex1 SEQ ID NO: 11 (ACGAGTGGCAGTTTCTTCTTGGGA) SEQ ID NO: 12 (TATGACTCACTTCCAGGGGGCACT) mWnt1a SEQ ID NO: 13 (GGTTTCTACTACGTTGCTACTGG) SEQ ID NO: 14 (GGAATCCGTCAACAGGTTCGT) mLef-1 SEQ ID NO: 15 (GCCACCGATGAGATGATCCC) SEQ ID NO: 16 (TTGATGTCGGCTAAGTCGCC) mGli-1 SEQ ID NO: 17 (CCAAGCCAACTTTATGTCAGGG) SEQ ID NO: 18 (AGCCCGCTTCTTTGTTAATTTGA) Versican SEQ ID NO: 19 (TTTTACCCGAGTTACCAGACTCA) SEQ ID NO: 20 (GGAGTAGTTGTTACATCCGTTGC) mβ-actin SEQ ID NO: 21 (AGCCATGTACGTAGCCATCC) SEQ ID NO: 22 (CTCTCAGCTGTGGTGGTGAA) Oct4 (ChIP) SEQ ID NO: 23 (ATCCGAGCAACTGGTTTGTG) SEQ ID NO: 24 (CAATCCCACCCTCTAGCCTT) Nanog (ChIP) SEQ ID NO: 25 (TCTTTAGATCAGAGGATGCCCCCTAAGC) SEQ ID NO: 26 (AAGCCTCCTACCCTACCCACCCCCTAT)

Example 1.5. Chromatin immunoprecipitation reaction (ChIP) analysis

On the 7th day of reprogramming, the transduced MEF cells are fixed with formaldehyde to connect histones and DNA, and then using SimpleChIP® Enzymatic Chromatin IP Kit (Cell signaling technology, Danvers, MA, USA) according to the manufacturer's instructions. ChIP analysis was performed. DNA was purified from the precipitated immunocomplex and analyzed by real-time PCR using primers specific for the Oct4 and Nanog promoters. Total chromatin (injected sample) without immunoprecipitation was used as a control. The primers and antibodies used are shown in Tables 1 and 2, respectively.

Antibody Catalog number Company Name Dilution magnification anti-Cytokeratin 15 ab52816 abcam 1: 100 anti-β-catenine c ab32572 abcam 1: 200 anti-β-catenine (FACS) ab22656 abcam 1: 500 anti-Ki67 ab15580 abcam 1: 200 anti-shh (IHC) sc-9024 Santacruz 1:80 anti-shh (FACS) ab135240 abcam 1: 300 anti-PDK sc-7140 Santacruz 1:50 anti-PDH (rabbit IgG) sc-292543 Santacruz 1:50 anti-PDH (mouse IgG) sc-377092 Santacruz 1:50 Normal Rabbit IgG # 2729 Cell signaling technology 1: 500 anti-Histon H3 # 4620 Cell signaling technology 1:50 anti-trimethyl-Histone H3 (Lys4) 04-745 Millipore 1: 200 anti- trimethyl-Histone H3 (Lys27) 07-449 Millipore 1: 200 anti-dimethyl-Histone H3 (Lys9) 07-441 Millipore 1: 200 anti-NANOG A300-397A Bethyl Lab 1: 250 anti-SSEA1 MAB2155 R & D Systems 1: 200

Example 1.6. Immunocytochemistry

The transduced MEF cells were fixed with 4% paraformaldehyde for 10 minutes at room temperature, reacted with 0.1% Triton X-100 (Sigma) for 30 minutes at room temperature, and 4% small blue albumin at room temperature for 2 hours. Blocked. Subsequently, the samples were stained overnight at 4 ° C with each primary antibody and washed with 0.05% Tween-20 (Sigma) in PBS. After the Alexa Fluor® conjugated secondary antibody (Thermo Fisher Scientific) was reacted with the sample for 40 minutes at room temperature, fluorescence images were obtained using an Olympus microscope (Olympus, Tokyo, Japan). Table 2 shows the antibodies used.

Statistical analysis

All figures are representative of three or more independent biological data replicated. The graph shows samples that were tested 5 times for OCR / ECAR; Samples repeated three times for AP staining and PCR analysis; And the mean ± SE of samples repeated twice for ATP analysis. Student's t-test is used for comparison between groups, and p <0.05 indicates statistical significance.

Example 2. Confirmation of the reprogramming effect of IM176OUT05

Example 2.1. Evaluation of cytotoxicity and mitochondrial activity by IM176OUT05

IM showed no cytotoxicity up to 100 μM in media with average glucose concentration (FIG. 3A). In addition, IM showed no cytotoxicity up to 100 μM in MEF and OSKM-introduced MEF (FIGS. 3C and 3D).

However, it has been shown to be susceptible to toxicity under glucose-insufficient conditions, which rely on mitochondrial ETC for energy production (FIG. 3B). Through this, it can be inferred that IM has the possibility of inhibiting mitochondrial function, and actually, it was confirmed that IC50 showed 3.2 μM in the IM treatment group and reduced the oxygen consumption rate, thereby reducing the mitochondrial ETC activity. (FIG. 1B).

Example 2.2. Comparison of reprogramming effect of IM176OUT05 and Rotenone

Sub-toxic doses of rotenone (ETC Complex I inhibitors) have been found to promote efficient somatic reprogramming. Accordingly, the effects of rotenone and IM on iPSC production were compared as follows (FIG. 1C).

First, OSKM reprogramming factors were introduced into mouse embryonic fibroblasts (MEF) and human foreskin fibroblasts (HFF) to be reprogrammed with iPSC (FIGS. 4A and 4B). IM was applied in the concentration range of 1 nM to 100 μM during iPSC generation (FIG. 4). This is because, as confirmed in Example 2.1. Above, IM did not show cytotoxicity up to 100 μM in MEF and OSKM-introduced MEF. Thereafter, as a result of performing alkaline phosphatase (AP) staining, it was shown that the reprogramming efficiency was slightly increased when the IM was treated in the micromolar concentration range, but there was no significant change. On the other hand, AP ⁺ clony number was found to increase significantly in the nanomolar concentration range (Fig. 4a and Fig. 4b). Therefore, it was confirmed that the reprogramming effect was remarkably excellent in the nanomolar concentration range of the IM compound.

IM (10 nM) and rotenone (10 nM) increased reprogramming efficiency by 9.8 and 8.5 times (FIG. 1C) in MEF, respectively, and 3.0 and 2.4 times (FIG. 1D) in HFF, respectively, compared to control. This reprogramming promoting effect was observed even under conditions using three reprogramming factors (Oct4, Sox2 and Klf4) except c-Myc (OSK), but no reprogramming factors were present, or only one factor was present, or Oct4 and Sox2 (OS) alone was not observed under transduced conditions (Fig. 4c).

Example 2.3. Confirmation of the effect of IM176OUT05 on stem cell maintenance

When the IM was treated within the nanomolar concentration range, it was shown to be advantageous for the maintenance of stem cells in both mouse and human embryonic stem cells (ESC) (FIGS. 5A and B). In addition, IM (10nM) is to help maintain the undifferentiated state of ESC under non-self-renewing conditions for mESC (without LIF) and unconditional medium (UM) conditions for hESC. Appeared (FIGS. 1E and 1F). Therefore, low-dose IM having an appropriate level can improve the acquisition and maintenance of stem cell differentiation capacity in both mouse iPSC and human iPSC production processes.

Example 2.4 Stem cell function maintenance and reprogramming effect comparison of IM176OUT05 and other biguanide derivatives (methformin and phenformin)

The effect of IM and other known biguanide derivatives on stem cell differentiation ability was compared (Fig. 6). As a result of confirming AP staining and Oct4-GFP expression in OG2 (Oct4-GFP transgenic mouse) -MEF, it was found that metformin slightly increased the reprogramming efficiency at 10 nM concentration. In addition, metformin in the nanomolar concentration range was found to be somewhat advantageous in maintaining stem cell capacity of mESC and hESC. However, the effect of maintaining reprogramming and stem cell function of metformin was found to be insignificant compared to IM at a concentration of 10 nM (FIG. 6A). In addition, fenformin, another biguanide, was found not to affect the reprogramming efficiency of MEF (FIG. 6B).

Example 3. Effect of IM176OUT05 glycolysis and starch-related gene expression induction effect

Example 3.1. Cell change according to IM treatment

In the initial stage of iPSC generation, cell changes according to IM treatment were confirmed (FIG. 2A). It was shown that IM treatment not only increases the reprogramming efficiency compared to the control group, but also promotes the kinetics of reprogramming compared to the untreated control group (FIG. 7). Specifically, in the group treated with IM, colonies began to be formed at the beginning of the 7th day, and the size of the colonies was confirmed to be larger than that of the control group on the 9th and 11th days (FIG. 7A). The time course required for colony selection was shortened by about 10 days after transduction in the IM treatment group, while delayed by 5 days or more in the control group (FIG. 7B). In addition, the number and size of Nanog ⁺ or SSEA1 ⁺ fluorescent clusters were found to increase in the IM-treated group compared to the control group at the initial time of reprogramming (after 7 to 9 days after transduction) (FIG. 7C).

Example 3.2. Bioenergetic changes according to IM treatment

In the early stages of reprogramming, bioenergetic changes due to IM treatment were confirmed. Basal OCR (before inhibitor treatment) was slightly inhibited due to IM treatment at a concentration of 10 nM or 100 nM compared to DMSO control on the 7th day of reprogramming, and the maximum OCR was significantly suppressed due to IM treatment (FIG. 2B). Rotenone showed a high decrease in both basal and maximal OCR dose-dependently (FIG. 2B). Basal extracellular acidification rate (ECAR) has an inverse correlation with OCR, and increased acidification due to IM and rotenone treatment. These results suggest that glycolytic activity was increased (Fig. 7D). It was found that the intracellular production of lactate, the final product of glycolysis, increased on the 7th day in cells treated with IM or rotenone at 10 nM and 100 nM compared to the control group (FIG. 2C).

Experimental Example 3.3. Changes in intracellular ATP content according to IM treatment

On the 7th day of IM treatment, the intracellular ATP content was reduced due to a decrease in the energy generation function of mitochondria accompanied by a decrease in OCR (FIG. 2D). However, on the 10th day of IM treatment, it was confirmed that intracellular ATP content was restored as glycolysis increased as an alternative energy-generating pathway to overcome energy deficits (FIG. 2D). Therefore, through these results, it was possible to prove that the IM of 10 nM was sufficient to accelerate the glycolysis, despite weakly suppressing the oxygen consumption rate.

Example 3.4. Gene expression change according to IM treatment

Changes in gene expression were observed as follows. Expression of NDU5 (ETC complex I enzyme) and ATP5B (ETC complex V enzyme) in IM-treated cells was reduced on day 7, but recovered on day 10. On the other hand, the expression of HK2 and LDHA (the major glycolytic enzyme) in IM-treated cells increased on day 7 and further improved on day 10 of reprogramming progression. In particular, the expression of Nanog and Rex1 (a gene related to starch potential) in IM-treated cells was significantly upregulated during the early stages of reprogramming, and was saturated in all groups on day 10 (FIG. 2E). That is, in the IM compound treatment group, the expression of OXPHOS-related genes ( NDU5, ATP5B ) was decreased, and the expression of glycolysis-related genes ( HK2, LDHA) and stem cell function-related genes ( Nanog, Rex1 ) was increased. Moreover, active histone markers (H3K4me3) and inhibitory histone markers (H3K27me3 and H3K9me2) were increased or decreased at the Nanog and Oct4 positions on day 7, respectively, by IM treatment (FIGS. 2F and 7E). This suggests that IM can promote metabolic reprogramming and induction of starch potency to glycolysis in the early stages of cell reprogramming.

<110> Korea Research Institute of Bioscience and Biotechnology          IMMUNOMET THERAPEUTICS INC. <120> CELL REPROGRAMMING COMPOSITION AND METHOD FOR PRODUCING AN          INDUCED PLURIPOTENT STEM CELL USING THE SAME <130> FPD / 201808-0072 <160> 26 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of mNDUS3 <400> 1 caagcagctc tcagcatttg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of mNDUS3 <400> 2 cgcagagaca gcaggttgta 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of mATP5B <400> 3 gagggattac cacccatcct 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of mATP5B <400> 4 catgattctg cccaaggtct 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of mHK2 <400> 5 gggacgacgg tacactcaat 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of mHK2 <400> 6 gccagtggta aggagctctg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of mLDHA <400> 7 tggcagcctc ttccttaaaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of mLDHA <400> 8 cagcttgcag tgtggactgt 20 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> forward primer of mNanog <400> 9 ggtcttcctg gtccccacag tttg 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of mNanog <400> 10 tgggactggt agaagaatca gggc 24 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> forward primer of mRex1 <400> 11 acgagtggca gtttcttctt ggga 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of mRex1 <400> 12 tatgactcac ttccaggggg cact 24 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> forward primer of mWnt1a <400> 13 ggtttctact acgttgctac tgg 23 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of mWnt1a <400> 14 ggaatccgtc aacaggttcg t 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of mLef-1 <400> 15 gccaccgatg agatgatccc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of mLef-1 <400> 16 ttgatgtcgg ctaagtcgcc 20 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer of mGli-1 <400> 17 ccaagccaac tttatgtcag gg 22 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of mGli-1 <400> 18 agcccgcttc tttgttaatt tga 23 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> forward primer of Versican <400> 19 ttttacccga gttaccagac tca 23 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of Versican <400> 20 ggagtagttg ttacatccgt tgc 23 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of Nanog (ChIP) <400> 21 agccatgtac gtagccatcc 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of Nanog (ChIP) <400> 22 ctctcagctg tggtggtgaa 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of Oct4 (ChIP) <400> 23 atccgagcaa ctggtttgtg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of Oct4 (ChIP) <400> 24 caatcccacc ctctagcctt 20 <210> 25 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> forward primer of Nanog (ChIP) <400> 25 tctttagatc agaggatgcc ccctaagc 28 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of Nanog (ChIP) <400> 26 tggcagcctc ttccttaaaa 20

Claims (13)

A composition for promoting reprogramming comprising the compound of Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
[Formula 1]

According to claim 1,
The reprogramming is to promote differentiation from differentiated cells to induced pluripotent stem cells, the composition. According to claim 1,
The composition comprises a compound of Formula 1 or a pharmaceutically acceptable salt thereof in a concentration of 1 to 100 nM, composition. According to claim 1,
The composition is a culture medium or a culture medium additive. According to claim 2,
The differentiated cells are at least one selected from the group consisting of somatic cells, germ cells, progenitor cells, and fibroblasts. The method of claim 5,
The differentiated cells, one or more selected from the group consisting of Oct4, Sox2 and Klf4 is introduced, the composition. The method of claim 6,
The differentiated cells are c-Myc, Lin28 and Nanog, one or more selected from the group consisting of, is further introduced, the composition. According to claim 1,
The composition is to enhance the reprogramming efficiency due to mitochondrial cell respiration inhibition, promoting glycolysis or promoting the expression of starch potential gene. A method of producing differentiated cells from a differentiated cell into induced pluripotent stem cells comprising culturing in a medium containing a compound of Formula 1 or a pharmaceutically acceptable salt thereof in differentiated cells into which reprogramming factors are introduced.
[Formula 1]

The method of claim 9,
A method of preparing a compound of Formula 1 or a pharmaceutically acceptable salt thereof at a concentration of 1 to 100 nM into induced pluripotent stem cells in differentiated cells. The method of claim 9,
The reprogramming factor comprises at least one selected from the group consisting of Oct4, Sox2 and Klf4, a method of producing differentiated cells into induced pluripotent stem cells. The method of claim 11,
The reprogramming factor further comprises at least one selected from the group consisting of c-Myc, Lin28 and Nanog, a method of producing differentiated cells into induced pluripotent stem cells. A composition for maintaining the undifferentiated state of pluripotent stem cells comprising the composition according to claim 1.

Images