KR20200022970A - Production method of brazzein from transgenic tobacco for high expression of brazzein - Google Patents

Abstract

The present invention relates to a recombinant expression vector for plant transformation, a tobacco transformed by the vector, and a method for mass-producing brazzein using the same in order to mass-produce brazzein from a plant body. The recombinant vector of the present invention can express a brazzein protein in an active form in plant cells. Accordingly, the brazzein mass-produced from a plant has the same activity as that of wild-type brazzein, thereby contributing to the commercialization of sweeteners in the future.

Description

Production method of brazzein from transgenic tobacco for high expression of brazzein}

The present invention relates to a method for producing brazein from a transgenic tobacco after producing a transformed tobacco using the expression vector for high expression of sweet protein brazein.

Peptides, amino acids and some compounds, as well as sugars and polyols, have a sweet taste. On the other hand, most proteins do not taste or smell. However, some proteins make them sweet in humans, such as Neoculin, Mabinlin, Pentadin, Miraculin, Monellin, Eggsolyme, and Tau. There are Thaumatin and Brazein. Most sweet proteins are derived from tropical plants in Africa and vary in sweetness, but are about 100,000 times sweeter than sugar molecules.

As the quality of life improves in modern society, various adult diseases such as diabetes, hypertension, and obesity are caused by major diseases. People with these diseases are more likely to have major health problems as they gain more weight in demanding high-calorie foods. Therefore, to solve this problem, low-calorie sugar substitutes are used in sugar-containing foods and beverage products worldwide. Sweet protein has a sweeter taste than sugar, but calories are very low, making it suitable for use as a sugar substitute. Most of them are native to the special tropical regions of Africa, so food-friendly biotechnological studies using yeast or plant expression systems are essential for commercialization as sweeteners.

Brazein is the first sweet protein found in the pulp tissue surrounding the seeds of tropical fruit obli ( Pentadiplandra brazzeana Bailon) native to West Africa in 1994 by the University of Wisconsin-Madison. This is the second sweet protein found in obli fruit since the sweet protein found in 1989, Pentadin, which consists of 54 amino acids and has the smallest molecular weight of 6.5 kDa and one α-helix. And three β-sheets. It is about 2,000 times sweeter than 2% sugar solution by weight and 9,500 times sweeter than molecular weight. It has the sweetest taste and sweetest after sugar. In addition, the presence of four disulfide bonds in the molecule is stable over high heat and wide pH range compared to other proteins (2 hours at 98 ° C, pH 2.5-8.0), making it very suitable as a sweetener or food additive.

Brazein is present at 0.05-0.2% of the obli weight and there are two types depending on the N-terminal amino acid residues. One is the main type (pGlu-1-brazzein) brazein, present at 80%, with pyroglutamate (Pyro Glu, Pyro E) at the N-terminus. The other is des-pGlu-1-brazzein brazein, which is present at 20%, with no pyroglutamate at the N-terminus and consists of 53 amino acids.

The production of recombinant proteins using plant expression systems has other advantages over mammalian, yeast, various cell lines, and bacterial expression systems. Intracellular vesicles and Golgi apparatus enable post-translational modification process to produce modified protein which is not available in prokaryotic expression system.In case of protein production using animal cell or experimental animal There is no fear of infection by the acquired common pathogen. It is also economically efficient because only light, land, and water can produce proteins indefinitely, and in the laboratory, if only agar is agar, continuous passage is possible. In addition, it is possible to store and store the protein in seed form for a long time.

However, even in such a plant expression system, there is a difficulty in increasing the expression level.

In 2005, Agrobacterium-mediated brazein was expressed in corn plants (Lamphear et al., 2005). The expression system overexpressed 53.75 μg of brazein per gram of corn (Non-Patent Literature 1). In 2008, Texas-based Prodigene and Nectar Worldwide produced 1-2 kilograms of brazein from 1 tonne of maize. After receiving GRAS (Generally Recognized as Safe) approval from the US Food and Drug Administration (FDA), it attempted to commercialize it as a sweetener. However, due to the problem of cross-contamination between different crops, the entire corn crop was discarded and commercialization did not proceed.

Therefore, it is very stable in high heat and wide pH range of sweet protein and can be mass-produced using plant expression system, which is deemed suitable for commercialization as sweetener as well as food additive with sweetness 2,000 times higher than 2% sugar solution. There is a need for new transgenic plants.

Lamphear, B.J., Barker, D.K., Brooks, C.A., Delaney, D.E., Lane, J.R., Beifuss, K., Love, R., Thompson, K., Mayor, J., and Clough, R. (2005). Expression of the sweet protein brazzein in maize for production of a new commercial sweetener. Plant biotechnology journal, 3, 103-114.

Therefore, the present inventors have researched in order to solve the above problems, and as a result of the cross-contamination does not occur, it is possible to solve the cross-contamination problem stayed in the commercialization stage, and to grow to a large adult of about 2-3 m than other plants It is possible to mass-produce brazein, and to produce a transformed tobacco that can be stored in the form of a seed that is kept active for a long time, and thereby to develop a method for producing brazein, thereby completing the present invention. It became.

Accordingly, an object of the present invention is to provide a recombinant vector for tobacco transformation, a transformed tobacco for high expression of brazein transformed thereto, and a method for producing the same.

It is another object of the present invention to provide a method for producing brazein from the transformed tobacco.

As a means for solving the above problems, the present invention is a tobacco trait comprising a promoter and an operably linked AMV (Alfalfa Mosaic Virus RNA4) enhancer, an endoplasmic reticulum signal peptide and a polynucleotide encoding brazein Provide a recombinant vector for conversion.

In addition, as another means for solving the above problems, the present invention provides Agrobacterium transformed with the recombinant vector.

In addition, as another means for solving the above problems, the present invention provides a transformed tobacco, wherein the recombinant vector is introduced, expressing the brazein protein.

In addition, as another means for solving the above problems, the present invention provides a promoter and a polynucleotide encoding an alfaplasm Mosaic Virus RNA4 (AMV) enhancer, an endoplasmic reticulum signal peptide and brazein operably linked thereto. Preparing a recombinant expression vector for tobacco transformation comprising a; And

Preparing a transformed tobacco transformed with the recombinant expression vector;

It provides a method for producing a transformed tobacco for braze high expression comprising a.

In addition, as another means for solving the above problems, the present invention

The transformed tobacco was produced using the recombinant expression vector for braze high expression, and the purified recombinant zebrain expressed in the transformed tobacco was sequentially purified by salting out, heat treatment, anion chromatography and cation chromatography. Making;

It comprises a, provides a method for producing brazein from transgenic tobacco.

By using the recombinant expression vector for the production of transformed tobacco for braze high expression according to the present invention, high-quality brazein protein having no sweetness activity can be expressed in a plant expression system such as tobacco and can be mass-produced at low cost and high efficiency. . It is expected that brazein, which is produced in large quantities in plants, will have the same activity as wild-type brazein, which will contribute to future sweetener commercialization.

Figure 1 shows a schematic diagram of the production of tobacco expression vectors for the expression of four types of brazein ((A) expression vector cassette, (B) pBI525 vector and (C) pBINPLUS).
Figure 2 shows a map of the T-DNA regions of the binary vectors pBI-BZ1, pBI-BZ2, pBI-BZ3 and pBI-BZ4 [35S-35SP: Replication Enhancer Cauliflower Mosaic Virus (CaMV) 35S promoter; AMV: alfalfa mosaic virus RNA4 enhancer; TEV: untranslated leader sequence of tobacco etch virus; SP, vesicle signal sequence; KDEL, ER ER retention signal; NOS-T, NOS (Nopaline Synthase Gene) Terminator].
Figure 3 confirms the brazein gene in the Agrobacterium LBA4404 transformed by electrophoresis (black arrow indicates the band of the 159bp position of the brazein PCR product. M: 100 bp marker (Civic Bioscience, Beloeil, Canada). pBI-BZ1-4: transgenic tobacco.
Figure 4 is a schematic diagram showing a process for producing a transformed tobacco (square box shows the procedure for producing a transformed tobacco plant, the dotted arrow indicates the composition of the medium).
5 shows the Agrobacterium-mediated tobacco transformation process [A: wild type tobacco plants; B: co-culture; C: callus induction; DF: chute induction; G: route induction; H: mini incubation; B, large culture].
FIG. 6 is a representative four photographs of tobacco transformed with pBI-BZ1-4 (pBI-BZ1: upper left, pBI-BZ2: upper right, pBI-BZ 3: lower left, pBI-BZ 4: lower right).
Figure 7 shows the brazein expression and purification process of K. lactics GG799 [STEP 1 ~ STEP 3: expression process, STEP 4 ~ STEP 10: purification process].
8 Analysis of purification results using SDS-PAGE and HPLC steps 11-12 shows analysis of the amount of protein per fraction. In addition, STEP 13 analyzed purity using 0.206 mg / ml brazzein.
9 is a brazein standard curve for analysis of ELISA results.
10 shows the results of PCR analysis of pBI-BZ1 tobacco genetically modified strains ((A) region of pBI-BZ1 T-DNA. (B) identification of NPTII and Brazzein genes; M, 100 bp plus ladder; Plasmid extracted from P, positive control, Agrobacterium; WT, wild type tobacco plants; 1-5, transgenic tobacco plant line].
Figure 11 shows the results of PCR analysis of pBI-BZ2 tobacco genetically modified strains ((A) region of pBI-BZ2 T-DNA. (B) identification of NPTII and Brazzein genes; M, 100 bp plus ladder; Plasmid extracted from P, positive control, Agrobacterium; WT, wild type tobacco plants; 1-5, transgenic tobacco plant line].
Figure 12 shows the results of PCR analysis of pBI-BZ3 tobacco genetically modified strains ((A) region of pBI-B3 T-DNA. (B) identification of NPTII and Brazzein genes; M, 100 bp plus ladder; Plasmid extracted from P, positive control, Agrobacterium; WT, wild type tobacco plants; 1-5, transgenic tobacco plant line].
Figure 13 shows the results of PCR analysis of pBI-BZ4 tobacco genetically modified strains ((A) region of pBI-BZ4 T-DNA. (B) identification of NPTII and Brazzein genes; M, 100 bp plus ladder; Plasmid extracted from P, positive control, Agrobacterium; WT, wild type tobacco plants; 1-5, transgenic tobacco plant line].
Figure 14 shows the results of semi-quantitative RT-PCR analysis of the transgenic line of pBI-BZ1 tobacco [(A) Region of pBI-BZ1 T-DNA. (B) identification of EF-1α and brazein genes; M, 100 bp plus ladder; Plasmid extracted from P, positive control, Agrobacterium; WT, wild type tobacco plants; 1-5, transgenic tobacco plant line].
Figure 15 shows the results of semi-quantitative RT-PCR analysis of the transgenic line of pBI-BZ2 tobacco [(A) Region of pBI-BZ2 T-DNA. (B) identification of EF-1α and brazein genes; M, 100 bp plus ladder; Plasmid extracted from P, positive control, Agrobacterium; WT, wild type tobacco plants; 1-5, transgenic tobacco plant line].
Figure 16 shows the results of semi-quantitative RT-PCR analysis of the transgenic line of pBI-BZ3 tobacco [(A) region of pBI-BZ3 T-DNA. (B) identification of EF-1α and brazein genes; M, 100 bp plus ladder; Plasmid extracted from P, positive control, Agrobacterium; WT, wild type tobacco plants; 1-5, transgenic tobacco plant line].
Figure 17 shows the results of semi-quantitative RT-PCR analysis of the transgenic line of pBI-BZ4 tobacco [(A) Region of pBI-BZ4 T-DNA. (B) identification of EF-1α and brazein genes; M, 100 bp plus ladder; Plasmid extracted from P, positive control, Agrobacterium; WT, wild type tobacco plants; 1-5, transgenic tobacco plant line].
18 is a schematic diagram showing a process for purifying brazein from a transgenic tobacco according to the present invention.
19 shows the results of SDS-PAGE analysis of brazein purified by CM-Sepharose chromatography on tobacco leaves [lane M; Triple color protein markers; Lanes 1-5: fraction eluted by CM-Sepharose chromatography].
20 is a sweetness check check list.
FIG. 21 shows the results of SDS-PAGE analysis for comparing brazein expression levels between wild type tobacco leaves and tobacco leaves transformed with the pBI-BZ3 gene [lane M, FroggaBio BLUelf Prestained Protein Ladder; FIG. Lane 1: 20 μg of crude extract of wild-type tobacco leaves; Lane 2: 30 μg of crude extract of transgenic tobacco; Lane 3: 20 μg crude extract of transgenic tobacco].
FIG. 22 shows the results of SDS-PAGE analysis for comparison of brazein levels precipitated by ammonium sulfate precipitation [lane M: Caffematein prestained protein ladder; Lane 1: the protein precipitated by 20-30% of ammonium sulfate; Lane 2: the protein precipitated by 30-40% of ammonium sulfate; Lane 3, protein precipitated by ammonium sulfate 40-50%; Lane 4: protein precipitated by 50-60% of ammonium sulfate; Lane 5, protein precipitated by 60-70% ammonium sulfate; Lane 6: protein precipitated by 70-80% ammonium sulfate; Lane 7: protein precipitated with 80-90% of ammonium sulfate].
FIG. 23 shows the results of SDS-PAGE analysis for comparison of brazein levels purified by heat treatment [lane M: FroggaBio BLUelf Prestained protein ladder; Lane 1, protein remained after heat treatment for 1 hour; Lane 2: the protein remained after heat treatment for 2 hours; Lane 3: the protein remains after heat treatment for 3 hours; Lane 4: the protein remains after heat treatment for 4 h].
FIG. 24 shows the results of SDS-PAGE analysis of brazein purified by heat treatment and DEAE-Sepharose chromatography [lane M: Caffematein prestained protein ladder; Lane 1: the protein remained after heat treatment for 2 hours; Lane 2: elution fraction by DEAE-Sepharose chromatography; Lane 3: flow-through fraction by DEAE-Sepharose chromatography].
Figure 25 shows the results of SDS-PAGE analysis of brazein purified by CM-Sepharose chromatography [lane M: Caffematein prestained protein ladder; Lane 1: flow-through fraction by DEAE-Sepharose chromatography. Lane 2: brazein purified by CM-Sepharose chromatography].
Figure 26 shows the HPLC pattern of recombinant brazein expressed and purified in transgenic tobacco (Nicotiana tabacum) and Kluyveromyces lactis of the present invention ((A): Kluyveromyces lactis, (B): Nicotiana tabacum).
Fig. 27 shows the N-terminal amino acid sequence analysis by Edman digestion.
28 shows the primary structure and N-terminal amino acid sequence analysis of recombinant brazein expressed in transgenic tobacco (Nicotiana tabacum) of the present invention [(A) amino acid sequence of des-pE1M-brazzein, (B) tobacco leaf N-terminal amino acid sequence of purified des-pE1M-brazzein and brazzein].
29 shows circular dichroism spectroscopy of recombinant brazein expressed in Kluyveromyces lactis Spectra are shown [Far-UV CD spectra were obtained at protein concentrations of 2.5, 5.0, 10 and 20 μM].
30 shows circular dichroism spectroscopy of recombinant brazein expressed in transgenic tobacco (Nicotiana tabacum) of the present invention. Spectra are shown [Far-UV CD spectra were obtained at protein concentrations of 2.5, 5.0, 10 and 20 μM].
31 shows a comparison of mean residue ellipticity (MRE) between recombinant brazein and Kluyveromyces lactis of transgenic tobacco (Nicotiana tabacum) of the present invention [solid line: Nicotiana tabacum; Dotted line: Kluyveromyces lactis. Far-UV CD spectra were obtained at a protein concentration of 10 μM].
Fig. 32 shows the molecular weight and amino acid sequence analysis of recombinant brazein obtained from the transformed tobacco (Nicotiana tabacum) of the present invention by LC-MS / MS.
Figure 33 shows the sweetener activity test results of purified recombinant brazein of the transformed tobacco (Nicotiana tabacum) of the present invention.

The present invention relates to a recombinant expression vector for producing a transgenic tobacco comprising a promoter and a polynucleotide encoding alfalfa mosaic virus RNA4 (AMV) enhancer and operably linked thereto.

In one embodiment of the present invention, a recombinant vector for tobacco transformation comprising a promoter and an operably linked AMV (Alfalfa Mosaic Virus RNA4) enhancer, an endoplasmic reticulum signal peptide, and a polynucleotide encoding brazein It includes.

In the present invention, a "recombinant expression vector" is a vector capable of expressing a protein or nucleic acid (RNA) of interest in a suitable host cell, and is an essential regulator operably linked to allow the expression of a polynucleotide (gene) insert. Refers to a genetic construct containing the element.

The Alphalfa Mosaic Virus RNA4 (AMV) enhancer is known to be located under the 35S promoter to promote transcription. Although the Alfalfa Mosaic Virus RNA4 (AMV) enhancer in the present invention can use a known sequence without limitation, preferably GenBank Accession No. As disclosed in M10851 may be a nucleotide sequence represented by SEQ ID NO: 1.

In one embodiment of the present invention, the recombinant vector may further include an endoplasmic reticulum signal peptide. The endoplasmic reticulum signal peptide is preferably located on top of the brazein gene in order to accumulate in the endoplasmic reticulum for mass production of brazein and to have a correct folding structure.

The brazein may be a wild type brazein or a brazein variant.

In the present invention, brazein may include all of the brazein major type, subtypes, variants. The brazein variant refers to the first to fourth variants of the brazein subtype (SEQ ID NO: 1), specifically, registered Korean Patent No. 981087, domestic registered Patent No. 108340, domestic registered Patent No. 1416892, It may be disclosed in domestic registered patent No. 1416892, or domestic registered patent No. 1416892, but is not limited thereto.

In one embodiment of the present invention, the brazein gene may further include reverse TEV (untranslated leader sequence of tobacco etch virus) and His-tag. The reverse TEV (untranslated leader sequence of tobacco etch virus) is inserted to maintain the sweetness activity of brazein by removing His-tag, which is a rear sequence during purification, and is represented by SEQ ID NO: 7.

Recombinant vector for plant transformation comprising the brazein gene of the present invention can be prepared using a known plant transformation vector as a base vector, a general binary vector (cointegration vector) can be used Can be. A wide variety of binary vectors are widely used in plant transformation, and almost all binary vectors are international centers and university research institutes such as the Center for the Application of Molecular Biology to International Agriculture, GPO Box 3200, Canberra ACT2601, Australia (CAMBIA). The basic binary vector skeleton can be used by variously modifying a transformant selection marker gene, a promoter, a transcription termination gene, and the like at the left and right boundary sites where the gene is delivered using the Ti plasmid as a parent.

Since the vector according to the present invention is a plant transformation vector, various plant-functional promoters known in the art may be used, and preferably, AMV (Alfalfa Mosaic Virus RNA4) enhancer, endoplasmic signal sequence for the brazein expression. reticulum signal peptide) and brazein are operably linked to the promoter.

The term 'promoter' refers to a DNA sequence that controls the expression of a nucleic acid sequence operably linked in a particular host cell. 'Operably linked' means that one nucleic acid fragment is combined with another nucleic acid fragment. Its function or expression is influenced by other nucleic acid fragments. In addition, it may further comprise any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site and a sequence regulating termination of transcription and translation.

The promoters include the Cauliflower Mosaic Virus (CaMV) 35S promoter, the Pigwarm Mosaic Virus 35S promoter, the Sugarcane Vasiliform Virus promoter, the Comerina Yellow Mottle Virus promoter, the ribulose-1,5-bis-phosphate carboxylase. Light-induced promoter from subunit (ssRUBISCO), rice cytozolic triocellate isomerase (TPI) promoter, adenine phosphoribosyltransferase (APRT) promoter from Arabidopsis, rice actin 1 gene promoter and Mannopin synthase and octopin synthase promoters, preferably the Cauliflower Mosaic Virus (CaMV) 35S promoter (SEQ ID NO: 5).

In addition, the selection marker gene includes an antibiotic resistance gene, a herbicide resistance gene, a metabolic gene, a luminescent gene, a green fluorescence protein (GFP) gene, a β-glucuronidase (GUS) gene, a β-galactosidase (GAL) gene, and the like. It is not limited. Specifically, neomycin phosphotransferase II (NPT II) gene, hygromycin phosphotransferase gene, phosphinothricin acetyltransferase gene or dihydrofolate reductase gene, etc. may be used, but phosphinothricin Acetyltransferase is preferred.

Preferably, the vector for plant transformation of the present invention may be pBI-BZ2, pBI-BZ3 or pBI-BZ4 having the cleavage map described in FIG. More preferably, the plant transformation vector of the present invention may be pBI-BZ3.

In the plant transformation vector pBI-BZ2 of the present invention, NOS (nopaline synthase gene) promoter, neomycin phosphotransferase II (NPT II) gene, NOS (nopaline synthase gene) terminator, and califlower mosaic are selected marker genes. Gene constructs in which the virus 35S promoter, AMF (Alfalfa Mosaic Virus RNA4) enhancer, vesicle signal sequence, brazein gene, reverse untranslated leader sequence of tobacco etch virus (TEV), His-tag, and nopaline synthase gene (NOS) terminator It includes.

In the plant transformation vector pBI-BZ3 of the present invention, NOS (nopaline synthase gene) promoter, neomycin phosphotransferase II (NPT II) gene, NOS (nopaline synthase gene) terminator, and califlower mosaic are selected marker genes. Viral gene 35S promoter, Alfalfa Mosaic Virus RNA4 (AMV) enhancer, endoplasmic reticulum signal sequence, brazein gene and nopaline synthase gene (NOS) terminator.

In the plant transformation vector pBI-BZ4 of the present invention, NOS (nopaline synthase gene) promoter, neomycin phosphotransferase II (NPT II) gene, NOS (nopaline synthase gene) terminator, and califlower mosaic are selected marker genes. Viral gene 35S promoter, Alfalfa Mosaic Virus RNA4 (AMV) enhancer, brazein gene and nopaline synthase gene (NOS) terminator.

Meanwhile, in one embodiment of the present invention, the recombinant vector of the present invention was transformed into an agrobacterium spp. And then the brazein gene was introduced into the plant by the transformed agrobacterium.

Therefore, the present invention provides a cell transformed with the plant transformation vector of the present invention. The transformed cells may be agrobacterium spp., Preferably Agrobacterium tumefacience or Agrobacterium rhizogenes.

The present invention also provides a tobacco transformed with the recombinant expression vector. The transformed tobacco overexpresses brazein and may be a cell, tissue or culture thereof of tobacco and includes some or all of the tobacco.

Tobacco in the present invention preferably belongs to seed plants which produce and spread seeds (seeds). The seed plant is composed of roots, stems, leaves, and flowers of the reproductive organs, which are largely nutritious organs, and have seeds that are embryos of an undeveloped state. The tobacco in the present invention may be a whole tobacco plant having a complete structure or a part of tobacco, which is composed of organs, tissues or a plurality of cells such as roots, stems, leaves, flowers and seeds. Some of the tobacco may be connected to the entire plant or may be separated.

In addition, the cells or tissues of the transformed tobacco according to the present invention is not limited as long as it is derived from tobacco.

In addition, tobacco in the present invention comprises a culture of tobacco cells or tissue. The 'culture' refers to a part of the plant, such as cells, tissues, organs, pears, seeds, etc. of the plant by using the pluripotency, which is the ability of the plant cells or tissues to form or regenerate the entire plant. It means the product cultured in the added medium. Cell / tissue culture products of the plant may be, for example, but not limited to, cultures such as embryo culture, section culture, callus culture, suspension culture, drug culture (potted culture), protoplast culture, and the like. Protoplasts refer to the cell contents from which the plant cell wall has been removed and isolated.

Tobacco in the present invention is not particularly limited as long as it is a plant of the genus Tobacco (Nicotiana genus) that can overexpress the protein, it is possible to carry out the present invention by selecting a variety suitable for the purpose of transformation and mass production of proteins. Can be. For example, Nicotiana benthamiana L. or Nicotiana tabacum cv. Varieties such as xanthi can be used.

Tobacco transformed with the recombinant expression vector according to the present invention can be prepared using a method of transforming a plant known in the art without limitation. As a transformation method of a plant, for example, a method of fusing a liposome comprising a recombinant expression vector and a plant protoplast, a method of injecting a recombinant expression vector into a plant protoplast using PEG, Direct injection into plant cells, microparticle bombardment, gene gun, electroporation, transformation with virus, vaccum infiltration method, floral meristem dipping method And the like, and preferably, a transformation method using Agrobacterium may be used.

The present invention also provides

Preparing a recombinant vector for tobacco transformation comprising a promoter and an operably linked AMV (Alfalfa Mosaic Virus RNA4) enhancer, an endoplasmic reticulum signal peptide and a polynucleotide encoding brazein;

Transforming the vector to tobacco to produce a transformed tobacco;

It includes a method for producing a transformed tobacco for braze high expression comprising a.

Step (1) is a step of preparing a recombinant vector for tobacco transformation, as described above in the method for producing a recombinant expression vector according to the present invention.

Step (2) is to transform the vector into tobacco, specifically, the vector may be transformed into tobacco by a transformation method using Agrobacterium.

The transformation method using Agrobacterium is a method of delivering external genes to plant cells using Agrobacterium, a Gram-negative bacterium of soil causing tumors in the roots and stems of plants. T-DNA (transfer DNA) of tumor-inducing plasmid (Ti plasmid) found in Agrobacterium, such as Agrobacterium tumefaciens and Agrobacterium rhizogenes It is a method using a phenomenon inserted into the genome of a plant. In transformation with Agrobacterium, binary plasmids (or binary vectors) and T-DNA containing exogenous DNA and T-DNA (LB and RB sequences located on both edges of the external gene) to be introduced into the plant It is common to use a binary system consisting of two plasmids of helper plasmids that allow the plasmid to be inserted into the plant genome. Transformation method using Agrobacterium can be used for tissues of various plants such as leaves, stems, and roots, and young tissues tend to be transformed well.

Using the Agrobacterium transformation method of the present invention, the brazein gene may be transiently expressed or stablely expressed. For transient expression, a part of the plant, for example, a leaf of the plant, is infected with Agrobacterium containing a recombinant expression vector and transformed, and the infected portion of the plant is obtained after a time sufficient for the desired protein to be sufficiently expressed. can do. For stable expression, the cells or tissues of the plant may be cultured, infected with Agrobacterium, transformed, and further cultured to select suitable transformants, followed by redifferentiation, and then cultured into transformed plants having a complete structure. . By obtaining and germinating seeds from the transformed plants, the transgenic plants can be obtained stably in the next generation.

In addition, the present invention

Transforming tobacco with the recombinant expression vector;

Cultivating the transformed tobacco;

Obtaining the cultivated tobacco; And

Recovering brazein from the tobacco obtained

It includes a mass production method of brazein comprising a.

Specifically, in the mass production method of brazein according to the present invention, step (1) is a step of transforming tobacco with the recombinant expression vector.

The recombinant expression vector, plant transformation method, and the range and type of the plant to be transformed are as described above.

Step (2) is cultivation of the transformed tobacco.

The step of cultivating the tobacco, after transforming the tobacco, the environmental conditions such as light, temperature, humidity, and water, inorganic salts, nutrients, hormones necessary for the growth of tobacco during the time to express the desired amount of protein This means providing the necessary elements for plant growth. When cells, tissues or their cultures isolated from plants are transformed, elements necessary for the culture of tobacco tissues such as water, nutrients, inorganic salts, growth regulators, etc. may be delivered through culture media. In addition, when the brazein according to the present invention is expressed in a plant using an inducible promoter, it may be grown while applying a corresponding stimulus required for activating the inducible promoter, for example, light, heat or hormones.

Step (3) is a step of obtaining tobacco grown.

Obtaining the plant means obtaining all or part of the tobacco that is transformed to overexpress the desired protein. It may be to obtain the transformed part of the root, stem, leaf and the like or the seed of the transformed plant overexpressing the brazein of the present invention, transformed with a culture of plant cells or tissues, for example the brazein gene It may be to obtain a callus, a protoplast or the like.

Step (4) is a step of recovering brazein from the obtained tobacco.

The step is to separate the brazein from the transgenic tobacco, the transgenic tobacco is ground and filtered to extract the protein. Brazein can be separated in high purity by performing salting, heat treatment, anion chromatography, and cationic chromatography sequentially.

The salting is preferably carried out by precipitation with an ammonium sulfate solution of 30 to 80% concentration.

The heat treatment is preferably performed for 1 to 3 hours at 70 ~ 90 ℃.

The anion chromatography is performed using DEAE-Sepharose, an anion exchange resin, and the cation chromatography is preferably performed using CM-Sepharose, a cationic ion resin. .

In order to extract proteins, pretreatment such as freezing and drying the tobacco can be performed. It is possible to rapidly produce a large amount of the transformed tobacco overexpressing the brazein according to the present invention in large quantities.

Since the production of braze with the transgenic tobacco plants thus produced does not cause cross-contamination, the problem of cross-contamination that remained in the commercialization stage can be solved. In addition, when a useful protein is produced using a transgenic tobacco plant, it is able to grow into a large adult of about 2-3 m compared to other plants, thereby enabling mass production of brazein, and maintaining its activity for a long time in the form of a seed. It can be stored as an advantage.

In particular, although the yield is slightly lower in the transgenic tobacco, the tobacco expression system is more industrially available in terms of production cost or management when it is cultivated in large quantities compared to the yeast expression system which is expensive to produce.

Hereinafter, the present invention will be described in more detail through examples according to the present invention, but the scope of the present invention is not limited to the examples given below.

EXAMPLE

<Materials and Test Methods>

1. Constructing Plant Expression Vectors

1.1 Four Kinds of Gene Expression Cassettes

Four different expression gene cassettes were constructed to compare the amount of brazein expression in transgenic tobacco plants. Both ends of the cassette were synthesized including Nco I and Bam H I restriction sites.

Design 1 and Design 2 of the expression gene cassettes were designed to compare the difference in expression according to the presence or absence of the KDEL (Lys-Asp-Glu-Leu) amino acid sequence, which accumulates proteins in the endoplasmic reticulum at the polypeptide C terminus. (FIG. 1A). And since the N-terminus of brazein is very important for sweetness, the TEV (Tobacco etch virus) protease sequence was added to both ends of the brazein gene sequence, so that only the brazein was cut after purification.

Design 3 and Design 4 were designed to compare the difference in expression according to the presence or absence of signal peptide (SP) [SEQ ID NO: 4], which allows the first type of polypeptide made from ribosomes to enter the endoplasmic reticulum. (FIG. 1A).

Alfalfa Mosaic Virus RNA4 (AMV) enhancer: SEQ ID NO: 3 TTTTATTTTTAATTTTCTTTCAAATACTTCCA

Endoplasmic reticulum signal peptide: SEQ ID NO: 4

GCTACCCAAAGGAGAGCAAACCCTAGTTCTCTACATCTTATCACTGTGTTCTCACTGCTTGCTGCAGTAGTTTCCGCCGAAGTTGAT

Cauliflower Mosaic Virus (CaMV) 35S Promoter: SEQ ID NO: 5

GCATGCCTGCAGGTCCGATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATGGTCCGATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTAGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG

NOS terminator: SEQ ID NO: 6

CCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAATAATACATACCATTAGCAT

reverse untranslated leader sequence of tobacco etch virus (TEV): SEQ ID NO: 7

ggccagttttacctcaatgag

NOS (nopaline synthase gene) promoter: SEQ ID NO: 8

gggtttctggagtttaatgagctaagcacatacgtcagaaaccattattgcgcgttcaaaagtcgcctaaggtcactatcagctagcaaatatttcttgtcaaaaatgctccactgacgttccataaattcccctcggtatccaattagagtctcatattcactctcaatccaaataatctgca

Neomycin phosphotransferase II (NPT II) gene: SEQ ID NO: 9

atgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctga

1.2 pBI-BZ Vector Construction

Plant transformation vectors were constructed based on the Agrobacterium plasmid. PBINPLUS [Central University Biomedical Engineering Engineering Laboratory] with NPTII selection marker gene and powerful duplicated-enhancer CaMV (Cauliflower Mosaic Virus) 35S promoter [SEQ ID NO: 5], AMV reader (Alfalfa Mosaic Virus RNA4) [SEQ ID NO: 3] And pBI525 vectors with NOS terminator (SEQ ID NO: 6) (Datla, RS, Bekkaoui, F., Hammerlindl, JK, Pilate, G., Dunstan, DI, and Crosby, WL (1993) .Improved high-level constitutive foreign Gene expression in plants using an AMV RNA4 untranslated leader sequence.Plant Science, 94, 139-149.) [Bioprotein Engineering Laboratory, Chung-Ang University College of Medicine] was constructed to construct a pBI-BZ vector (FIG. 1 (B)). .

The pBI525 vector and four brazein gene cassettes were treated with Nco I and Bam H I restriction enzymes (TAKARA, Shiga, Japan), respectively, and electrophoresed on 0.7% agarose gel. After gel extraction using FavorPrep GEL / PCR Purification Mini Kit (FAVORGEN, Ping-Tung, Taiwan), 5 μl of pBI525 at 20 ng / μl concentration, 21 μl of gene cassette was added to 1 μl of T4 ligase, 10 × ligase buffer. After mixing with 3 μl (Promega, CA, USA) and ligation for 16 hours at 4 ℃. After ligation of 30 µl of Ligation sample was transformed into E. coli TOP10, the cloned colonies (Colony) were cloned and cloned into pBINPLLUS (Fig. 1 (c)) and Hind III, Eco R I restriction enzymes (TAKARA, Shiga, Japan) and then subcloned in the same manner as above to construct four types of brazein expression vectors pBI-BZ1-4 (pBI-BZ1, pBI-BZ2, pBI-BZ3, pBI-BZ4) (Fig. 2). ).

2 Plant materials and transformation

2.1 plant material

Tobacco Nicotiana tabacum cv. 'Xanti' is a MS (Murashige, T., and Skoog, F. (1962) .A revised medium for rapid growth and bio assays with tobacco tissue cultures.Physiologia plantarum, 15, 473-497) subcultured in the medium and propagated, cotyledons were collected from subcultured 1-2 weeks old tobacco plants, and the fragments (10 × 2 mm) were used as a transgenic material.

2.2 Medium composition

The medium used for transformation was classified into Agrobacterium infection medium, co-culture medium, plant regeneration medium and rooting medium. The detailed composition is as follows. Agrobacterium infected medium was supplemented with 0.48% MS mineral salt with B5 vitamin, 100 μM acetosyringone (Gamborg, OL, Miller, RA, and Ojima, K. (1968) .Nutrient requirements of suspension cultures of soybean root cells. cell research, 50, 151-158), co-culture medium was 0.48% MS mineral salt, B5 vitamin, NAA (A-naphthalene Acetic Acid) 0.1 mg / L, BA (BenzylAdenine, 6-Benzyl-Amino-purine) 1 mg / L and 400 μM acetosyringone were added. Kanamycin 100 mg / L and cefotaxime 250 mg / L were added to coculture medium without acetosyringone for callus induction and regeneration from leaf explants, and B5 vitamin and kanamycin 100 mg / L for 0.48% MS mineral salt in rooting medium. L was used. 3% sucrose, 0.8% phyto agar (Duchefa Biochemie, Haarlem, The Netherlands) was added to all solid media except Agrobacterium infected medium, and the mixture was adjusted to pH 5.6-5.8 and autoclaved at 121 ° C and 1.2 atm for 15 minutes. It was used by dispensing into a x20 mm plastic Petri dish or plant box.

2.3 Agrobacterium Transformation

MicroPulser electroporation system (Bio-Rad) to transform pBI-BZ1-4 binary vector (pBI-BZ1, pBI-BZ2, pBI-BZ3, pBI-BZ4) into Agrobacterium tumefaciens LBA4404 [Bioprotein Engineering Lab. , Hercules, CA, USA). A. tumefaciens LBA4404 electro-cells were mixed with 20 μl of each pBI-BZ1-4 1 μg, and injected into a 1 mm cuvette and subjected to an electric shock of 1.25 KV, followed by SOC medium [2% tryptone, 0.5% yeast extract. , 10M NaCl, 2.5Mm KCl, 10Mm MgCl ₂ , 10Mm MgSO ₄ , 20m glucose is included and used for recovery during transformation] was added and cultured for 1 hour shaking at 28 ℃, 200 rpm. Then, smeared on a LB plate containing Kanamycin (Kanamycin) at 100 ㎍ / ㎖ concentration and incubated at 37 ℃ colony PCR was performed to transform transformed colonies were used for tobacco transformation.

The oligonucleotide primer for PCR used to identify the brazein gene is a brazein specific primer, which is Forward 1: 5'-GAT AAG TGC AAG AAG GTT TAC GAG-3 ', Forward 2: 5'-GAC AAG TGT AAG AAG GTG TAC-3 ', Reverse: 5'-ATA CTC GCA GTA GTC GCA GAT-3' was used. pBI-BZ1, pBI-BZ2, and pBI-BZ3 were performed using forward 1 and reverse primers, and pBI-BZ4 was performed using forward 2 and reverse primers (Tables 1 and 4). PCR conditions were denatured at 94 ° C. for 2 minutes, followed by 30 times of 20 seconds at 94 ° C., 10 seconds at 55 ° C., and 20 seconds at 72 ° C., and finally extension was performed at 72 ° C. for 5 minutes to obtain sufficient PCR products. (Table 2). When performing colony PCR, Maxime PCR PreMix Kit ( i- StarTaq) (Intron biotechnology, Gyeonggi-do, KOREA) was used. After completion of PCR, the brazein band was confirmed by 2% agarose gel electrophoresis (FIG. 3).

2.4 Tobacco Transformation

A. tumefaciens LBA4404 transformed with pBI-BZ1-4 was streaked into two LB plates containing 100 µg / ml kanamycin and incubated at 28 ° C. for 48 hours in dark. After scraping the whole cell with a scraper and suspended in Agrobacterium infection medium to OD ₆₀₀ (Optical density 600 ㎚) = 25 and activated for 3-4 hours at 28 ℃, dark conditions used for tobacco leaf slice inoculation . Aseptically cultured tobacco leaf sections were inoculated with shaking for 1 minute in an activated Agrobacterium infected medium, and then the upper surface of the leaf sections were wound up in the co-culture medium and cultured at 25 ° C. for 3 days. After co-cultivation, the back of the leaf section with pores was placed on the back and placed on the callus induction and plant regeneration medium, which was selected as a selection, and subcultured every week at 25 ° C. and 16 hours of light conditions. Callus formed was separated to continue passage in the same medium. When the chute began to develop from callus about 3-4 weeks after incubation, only the chute part was cut and subcultured in the same medium to grow into news bodies, and after 1-2 weeks, it was transferred to rooting medium to induce roots. When rooting was induced for 4 weeks, the roots were washed with water and then planted in a cultivated culture soil, and grown in a greenhouse for 1 week after being purified (FIG. 4).

In the transformation line where the T-DNA portion of the pBI-BZ1 vector was introduced, 74 callus were used using 100 leaf fragments, and in the transformation line where the T-DNA portion of the BI-BZ2 vector was introduced, 100 leaf fragments were used. In the transformation line where the T-DNA portion of the BI-BZ3 vector was introduced, 96 callus were obtained using 100 leaf fragments, and finally, the T-DNA portion of the BI-BZ4 vector was introduced. In the conversion line, 100 leaf sections were used to obtain 77 callus. From these callus, independence was induced to produce 11 independent transformants, pBI-BZ1, 9 pBI-BZ2, 15 pBI-BZ3, and 10 pBI-BZ4, which were grown in a greenhouse after purification.

3 Transformed Tobacco Plant Analysis

3.1 Anti-brazzein Antibody Construction

The primary antibody used for Western blotting was ProSci, a 5 mg purified high-purity sample containing the 53-amino acid subtype brazein gene from Kluyveromyces lactis Strain GG799, a species of yeast Saccharomycetaceae . (12170 Flint Place Poway, CA 92064, USA) was used for the production. New Zealand white rabbits were used to provide 7.5 ml of pre-immune, 25 ml of bleed # 1, 25 ml of bleed # 2, and 25 ml of bleed # 3 in polyclonal serum.

For the ELISA performed result, bleed # 3 a 1: 1000 dilution the OD ₄₅₀ value of 1.384, 1: dilution factor of 5000 is OD ₄₅₀ value of 0.678, 1: 250,000 values, the OD ₄₅₀ value to obtain a result of 0.221. In case of ELISA and western blot, serum of Bleed # 3 was centrifuged at 13,000 rpm for 10 minutes, and the supernatant was filtered using a 0.22 μm filter and diluted 1: 2,000.

3.2 Total Soluble Protein Extraction

Add 100 mg of wild type tobacco leaf to be used as a control tobacco leaf or control and 300 μl of PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na ₂ HPO ₄ , 2 mM KH ₂ PO ₄ ) in a 1.5 ml tube. The leaves were crushed using a homogenizer. The supernatant was taken after centrifugation for 1 min at 4 ° C. and 13,000 rpm.

3.3 Determination of TSP using BCA (Bicinchoninic acid)

After diluting the TSP extracted from tobacco leaves in a volume ratio of 1: 5, and reacting at 37 ° C. for 30 minutes using Pierce ™ BCA Protein Assay Kit (Thermo Scientific, Erembodegem, Belgium), ELISA reader EPOCH (Biotek, The absorbance was measured at 562 nm using Winooski, VT, USA).

The experiment was repeated three times in total.

3.4 Transgenic Plant Selection by ELISA

Carbonate-bicarbonate buffer (pH 9.2) was used to adjust the TSP concentrations of all transformants and wild type at a concentration of 1.35 mg / mL and indirect ELISA. 100 μl of TSP was coated per well on a 96-well culture plate (Nunc, Roskilde, Denmark) and incubated at 4 ° C. for 16 hours. After washing for 4 minutes with 200 μl of PBS-T buffer, 150 μl of 3% BSA (Bioworld, Dubiln, Ohio, USA) was blocked at RT (Room temperature) for 2 hours. After washing in the same manner, the primary antibody was treated with 100 μl and incubated at 37 ° C. for 1 hour 30 minutes. The primary antibody used was centrifuged at 13,000 rpm for 10 min in serum of bleed # 3, and the supernatant was filtered using a 0.22 μm filter and diluted 1: 2,000. After the primary antibody treatment, the wash was performed, and the secondary antibody was diluted at a volume ratio of 1: 10,000, and 100 μl of the secondary antibody was incubated at RT for 2 hours. Secondary antibodies were purchased using goat poly anti-rabbit igG (H & L) and HRP (Komabiotech, Yeongdeungpo, Seoul, Korea). After incubation, wash the substrate 3.3 ', 5.5'-tetramethylbenzidine (TMB) (KPL, Gaithersburg, MA) for 5 minutes at 100 ㎖ each, add 100 μl of TMB stop solution (KPL, Gaithersburg, MA), and then add ELISA reader. Absorbance was measured at 450 nm using EPOCH (Biotek, Winooski, VT, USA).

3.5 Confirmation of T-DNA Insertion in Genomic DNA by PCR

Use the DNeasy Plant Mini Kit (Qiagen, Hilden , Germany) the selection process tough on the purified transgenic tobacco leaves 100 ㎎ isolation of genomic DNA according to the protocol by the expression vector within the T-DNA region is inserted correctly, that the NPTⅡ and bra Jane Genes were identified by performing PCR analysis.

Primers used for PCR for NPTII gene identification are NPTII specific primers (Forward: 5'-ATG ATT GAA CAA GAT GGA TTG CAC-3 ', Reverse: 5'-TCA GAA GAA CTC GTC AAG AAG G-3'). (Table 4). PCR conditions were denatured at 94 ° C. for 2 minutes, followed by 30 times of 20 seconds at 94 ° C., 10 seconds at 62 ° C., and 40 seconds at 72 ° C., and finally extension was performed at 72 ° C. for 5 minutes to obtain sufficient PCR products. (Table 3).

The primer used to identify the brazein gene is a brazein specific primer (Forward 1: 5'-GAT AAG TGC AAG AAG GTT TAC GAG-3 '), (Forward 2: 5'-GAC AAG TGT AAG AAG GTG TAC-3 '), (Reverse: 5'-ATA CTC GCA GTA GTC GCA GAT-3') was used. pBI-BZ1, pBI-BZ2, and pBI-BZ3 were performed using forward 1 and reverse primers, and pBI-BZ4 was performed using forward 2 and reverse primers (Tables 1 and 4). PCR conditions were denatured at 94 ° C. for 2 minutes, followed by 30 times of 20 seconds at 94 ° C., 10 seconds at 55 ° C., and 20 seconds at 72 ° C., followed by extension at 72 ° C. for 5 minutes to obtain sufficient PCR products. (Table 3). Maxime PCR PreMix Kit ( i- StarTaq) (Intron biotechnology, Gyeonggi-do, KOREA) was used for all PCR reactions.

3.6 Total RNA Extraction and cDNA Synthesis

To carry out RT-qPCR and semi-quantitative RT-PCR, 50-100 mg of transformed and wild-type tobacco leaves were taken, and then liquid nitrogen was added and disrupted using a homogenizer. 1 ml of TRIzol (Invitrogen Inc. Carlsbad, Calif.) Was added thereto and allowed to stand at room temperature for 5 minutes. Then, 200 μl of chloroform (Usb, GE Healthcare) was treated, shaken for 15 seconds, left at room temperature for 15 minutes, and centrifuged at 13,000 rpm at 4 ° C. for 10 minutes to separate DNA, RNA, and protein layers. 500 μl of iso-propanol was added to 500 μl of the isolated RNA and allowed to stand on ice for 10 minutes, followed by centrifugation for 10 minutes under the same conditions, and the supernatant was removed. After washing once more with 1 ml of 75% ethanol and 1 ml of 100% ethanol containing DEPC distilled water (DEPC DW), RNA was dissolved using 40 µl of DEPC DW after ethanol removal. Absorbance was measured at 230 nm, 260 nm and 280 nm using a spectrophotometer (Biotek, Winooski, VT, USA) and then the concentration and purity of the total RNA were confirmed. The high-purity RNA 1 ㎍ value between the value of the 260/280 ㎚ 1.8-2.0 using ^{QuantiTect ⓡ Reverse Transcription Kit (QIAGEN GmbH} , Hilden, Germany) was synthesized cDNA (Complements DNA) 20 ㎕.

3.7 Semi-quantitative RT-PCR

To confirm the mRNA expression level of EF-1 α (Nicotiana tabacum elongation factor 1-alpha) used as a brazein and housekeeping gene, the synthesized cDNA was diluted to a volume ratio of 1:20 and used as a template for PCR. All primers used for RT-PCR were synthesized in Macrogen (Seoul, Korea) using PrimerQuest Tool of Integrated DNA Technologies (IDT). The expression level of the brazein primer was synthesized based on the brazein specific sequence (pBI-BZ1: Forward 5'-GAA CTA CCC AGT GAG CAA GTG-3 ', Reverse 5'-GGA GAT TGC GTT TCT CGT CAT A- 3 '; pBI-BZ2: Forward 5'-TCA GTT GGC GAA CCA ATG TA-3', Reverse 5'-CGC AAA TGC ACT GGA GAT TG-3 '; pBI-BZ3: Forward 5'-ACG ACT GCA AGC TCG ATA AA-3 ', Reverse 5'-TAC TCG CAG TAG TCG CAA ATG-3'; pBI-BZ4: Forward 5'-TGT CAG CTT GCT AAC CAA TGT A-3 ', Reverse 5'-ACT CGC AGT AAT CGC AGA TG-3 ') (Table 4).

EF-1 α expression of the housekeeping gene primer was synthesized by (Forward: 5'-GTC AAG AAT GTT GCG GTT AAG G-3 ', Reverse: 5'-TGA TGA TAG CTT GGG AGG TAA AG-3') Used (Table 4). Each sample was denatured at 94 ° C for 2 minutes using Maxime PCR PreMix Kit ( i -StarTaq) (Intron biotechnology, Gyeonggi-do, KOREA), followed by 26 cycles of 94 ° C 20 seconds, 55 ° C 10 seconds, and 72 ° C 20 seconds. The extension was performed at 72 ° C. for 5 minutes in order to obtain sufficient PCR product (Table 5). After PCR, 5 μl each was loaded onto 2% agarose gel to confirm the expression of brazein compared to the expression of EF-1 α .

4.1. Brazein Purification from Transgenic Tobacco

4.1.1 Protein Extraction

In order to extract proteins from tobacco transformed with BI-BZ3 having the highest expression of brazein, leaves were collected from tobacco plants over 1 m in length and the leaves were frozen in a freezer (-70 ° C.). To extract proteins from tobacco leaves, a buffer is required. The plant extraction buffer (tris 40 mM, NaCl 50 mM, EDTA 20 mM, sodium citrate 55 mM, sodium thiosulfate 12 mM, pH 6.7) is used at 121 ℃ and After autoclaving for 15 minutes at 1.2 atm, it was stored at 4 ℃. At this time, it was calculated by calculating the ratio of 4 mL of plant extraction buffer per 1 g of leaves. Next, 400 g of frozen leaves were thoroughly crushed with a blender (National, NC250d, Japan) with 1600 mL of cold plant extraction buffer. In order to separate the homogenized extract with a blender, the supernatant was removed by using miracloth rapid after centrifugation at 7,500 rpm for 30 minutes in a centrifuge. In order to remove chlorophyll from the separated supernatant, it was adjusted to pH 4.0 with acetic acid and then centrifuged at 7,500 rpm for 30 minutes, and chlorophyll was removed using miracloth rapid.

4.1.2 Ammonium Sulfate Precipitation

Chlorophyll was removed using acetic acid in the extract of 4.1.1 and the protein was precipitated using the salting out method (ammonium sulfate precipitation). Therefore, the concentration condition of ammonium sulfate was precipitated at 10% intervals from 0% to 90%, and all these protein precipitation processes were conducted in a 4 ° C. cold chamber to prevent denaturation. Proteins were precipitated at each 10% ammonium sulfate concentration condition, which was centrifuged at 7,500 rpm for 30 minutes to dissolve the pellets in 10 mL distilled water. Because brazein is water soluble, it was dissolved in distilled water to solubilize brazein. The proteins dissolved in 10 mL distilled water were further centrifuged at 7,500 rpm and 30 minutes, and then the supernatant was removed by using miracloth rapid. After removing the suspended solids by using Miracloth rapid, the suspended solids were removed by a secondary filter using a filter paper (Advantec) having a pore size of 0.45 μm. The concentration of ammonium sulfate was filtered at 10% intervals from 0% to 90% for each sample, followed by dialysis in distilled water to remove salts.

4.1.3 Heat Treatment

As mentioned above, after confirming the concentration of brazein through the concentration condition experiment of ammonium sulfate, samples of the concentration were collected and dialyzed in distilled water. The heat treatment attempted to remove other proteins using the properties of brazein, which were stable at high temperatures. The dialysis sample was placed in four microtubes of 2 mL each and heat treated for 1 hour, 2 hours, 3 hours, and 4 hours at an interval of 1 hour in a heat block maintained at 80 ° C. After heat treatment, the samples were further centrifuged at 7,500 rpm for 30 minutes, and the supernatant was removed using floating cloth using miracloth rapid. After removing the suspended solids, the supernatant in which the braze was dissolved was filtered using the filter paper (Advantec) having a pore size of 0.45 μm to filter the suspended solids.

4.1.4 Ion Chromatography

For purification of braze, an anion exchange resin and a cation exchange resin are used. Before using the ion exchange resin, the samples to be purified were dialyzed in the equilibrium buffer solution suitable for the resin so that the resin could be loaded. First, the resin to be used was subjected to dialysis in tris-HCl (20 mM, pH 8.0), an equilibrium buffer solution of the resin, as an anion exchange resin, DEAE (diethylamnioethyl) fast flow. After the DEAE fast flow resin was filled in a column, an equilibration buffer was flowed by about 15 times the volume of the resin to prepare an equilibrium state, and then the sample was loaded. The anion exchange resin received a column eluate because other proteins bound to brazein and brazein were eluted. After receiving all the eluate, the eluate was dialyzed in 50 mM sodium acetate (pH 4.0), an equilibrium buffer solution of cation exchange resin. CM (carboxymethyl) -Sepharose fast flow, which is a cation exchange resin, was also equilibrated by filling the column with a resin and then flowing an equilibration buffer of 15 times the volume of the resin. Samples were loaded into the resin at equilibrium at a flow rate of 2 mL / min. After loading, rinse buffer solution (50 mM sodium acetate, 50 mM sodium chloride, pH 4.0) until the OD ₂₈₀ value does not change, and then dissolve buffer solution (50 mM sodium acetate, 400 mM sodium chloride, pH 7.0) was used to receive the elution solution in 9 mL increments. After measuring the elution solution at OD ₂₈₀ , a certain section was collected and dialyzed in distilled water, and after dialysis, the OD ₂₈₀ value was measured and lyophilized. The lyophilized sample was the same as the total protein based on the OD ₂₈₀ value measured after dialysis to determine the purity of the brazein in a portion of 16.5% tris-tricine gel (Fig. 18).

4.2. Characterization of Brazein Purified from Transgenic Tobacco

4.2.1 High-performance liquid chromatography

After purifying brazein, high-performance liquid chromatography (HPLC) was used to confirm changes in protein purity and structure. Two reverse-phase assays were performed, and the purity of Kluyveromyces lactis ( K. lactis ) and purified brazein from tobacco leaves was confirmed using a reverse-phase HPLC column. The column was purified by applying a C18 UG-120 column (5 μm, 4.6 mm × 250 mm) of Shiseido (Tokyo, Japan) to Gilder HPLC. Here, the eluent for checking the purity of brazein was used as a mixture of 0.1% trifluoroacetic acid aqueous solution (TFA; solvent-1), a mixture of 70% acetonitrile and 0.1% TFA (solvent-2), and gradient from 20% to 80%. Was carried out. The flow rate was 0.3 mL / min and the elution profile was confirmed at 210 nm in the UV region (Jo, HJ, Noh. JS, and kong, KH (2013) .Efficient secretory expression of the sweet-tasting protein brazzein in the yeast Kluyveromyces lactis . Protein Expr. Purif., 90, 84-89).

4.2.2 N-terminal amino acid sequencing

N-terminal amino acid sequence analysis confirmed that the purified brazein from tobacco leaves matched the amino acid sequence of des-pE1M-brazzein. 10 μg / mL of brazein purified from tobacco leaves was dissolved in H ₂ O and submitted to analysis by Life Science Laboratories (Seoul, Korea). N-terminal amino acid sequencing was performed by Edman sequencing method and the equipment was automated Edman sequencer. The analysis was performed by electrophoresis of brazein protein to fix a protein band blot on PVDF or purified protein sample through RP-HPLC C18 column to a micro-glass fiber filer. Initiating the initial reaction of N-terminated polypeptide chains through PITC (phenylisothiocyanate) coupling reaction to a sample immobilized on a micro-glass fiber filer, PTC (phenylthiocarbamyl) -polypeptide, ATIN (anilinothiazolamine) -amino acid and final PTH (phenylthiohydantoin) Derivatives The amino acid derivatives were sequentially sequenced by injection into HPLC based on the PTH-C18 column through the formation of stabilized structures in the form of amino acids.

4.2.3 Circular Dichroism Analysis

The measurement of circular dichroism (CD) confirmed the changes in the higher order structure of the purified brazein in tobacco and the components of the protein secondary structure. Purified brazein from the K. lactis expression system was confirmed by previous studies (Jo, HJ, Noh. JS, and kong, KH (2013) .Efficient secretory expression of the sweet-tasting protein brazzein in the yeast Kluyveromyces lactis.Protein Expr.Purif., 90, 84-89). Therefore, brazein purified from K. lactis and brazein purified from tobacco leaves were analyzed.

After culturing K. lactis Strain GG799 strain with brazein wild-type gene in YPD (yeast extract 1%, peptone 2%, dextrose 2%), cells were grown, and YPGal (yeast extract 1%) containing galactose as an inducer , peptone 2%, galactose 2%) and incubated. After the incubation was completed, the supernatant was purified using centrifugation (7,000 rpm, 30 min) using CM-Sepharose, a cation exchange resin. The eluted brazein solution was dialyzed in distilled water to remove the salts contained in the elution solution, followed by lyophilization to determine the purity of the 16.5% tris-tricine gel.

Circular dichroism spectra of K. lactis and brazein purified from tobacco leaves were measured using J-815 spectrometer (Jasco co., Ltd.) located at Inha University Standard Analysis Institute. A 150 W xenon lamp was used as the light source and measured using a high performance UV-Vis-NIR avalanche photo-diode fluorescence monochromator. Real-time measured data was recorded and analyzed with spectra managerTM software. The scan range before measurement was 180 nm to 260 nm, the scan rate was set to 100 nm / min, and the absorbance of the baseline was measured without the sample. Then, the brazein samples purified from tobacco leaves and K. lactis were measured at concentrations of 2.5, 5.0, 10 and 20 μM in H ₂ O, respectively.

4.2.4 Molecular Weight Verification

There are several ways to determine the molecular weight of the purified brazein from tobacco leaves. The mass is usually measured using a mass spectrometer. The mass is measured by ionization of the sample, and the mass is matched in a library system (e.g., NIST Standard Reference System), which is a database that stores chemicals corresponding to it. The material was predicted through a molecular weight that fits. The mass spectrometer used in this study is LC-ESI-MS / MS, a system that analyzes with two mass spectrometers. It is divided into mass spectrometer and tandem mass spectrometer according to the number of mass spectrometers, and the sensitivity is clearly different and has the advantage of more detailed analysis. Specifically, the mass spectrometer analyzes the ions, but the tandem mass spectrometer fragments and sends the peptide sequence to another MS detector by means of collision-induced dissociation (CID) or electron-transfer dissociation (ETD) methods. By analyzing the sequences, the results of higher sensitivity experiments can be obtained. LC-ESI-MS / MS was measured to confirm the brazein, and the results obtained will be compared with brazein using NCBI blast.

In this study, the samples purified from tobacco leaves were identified by LC-ESI-MS / MS and Thermo LTQ orbitrap XL with ETD System. The sample was dropped on a 16% tris-tricine gel, cut out a band of 6.5 kDa, and placed in a micro tube containing distilled water.

4.2.5 Determination of sweet activity of brazein

Because brazein is a protein and not a sugar, it cannot be measured using a sugar meter. Although the sugar level of brazein cannot be accurately measured using a sugar meter, an ascending method (Jo, HJ, Noh. JS, and kong, KH (2013) .Efficient secretory expression of the sweet- tasting protein brazzein in the yeast Kluyveromyces lactis.Protein Expr.Purif., 90, 84-89). Since the threshold value of sweetness is different for each person, activity was measured by comparing the sweetness concentration of the sugar solution and the brazein sample. The experiment uses samples diluted in distilled water, where the exact concentration of the thickest sample to be diluted is used to ensure proper dilution so that the absolute threshold value can be accurately determined. The highest concentration of brazein sample was made to 100 μg / mL in distilled water, based on this solution 90 μg / mL, 80 μg / mL, 70 μg / mL, 60 μg / mL, 50 μg / mL 40 μg / mL, 30 μg / mL, 25 μg / mL, 12.5 μg / mL, 10 μg / mL of the sample. This experiment was carried out with blindness evaluation, and the participants were composed of non-smokers. On the day before the experiment, 2 to 3 hours of fasting before the start of the experiment to optimize the experimental conditions. In the experiment method, the participants of the experiment rinse the mouth with the prepared bottled water, and then start the sample at a low concentration of 200 μL and gradually taste the high concentration so that the sweetness can be checked in the evaluation table (FIG. 20). The resulting data were averaged to minimize the standard deviation, excluding the minimum and maximum values. The mean value of sucrose was determined as the average value, and the activity of sweet taste of brazein purified from tobacco leaves was confirmed.

<Experiment Result>

3.1 Transgenic Tobacco Plant Formation

Agrobacterium-mediated tobacco transformation secured 11 transgenic plants including pBI-BZ1, 9 pBI-BZ2, 15 pBI-BZ3, and 10 pBI-BZ4. One representative of the best representative of the double expression was selected (Fig. 6).

3.2 yeast Kluyveromyces lactics  Antibody Production Using Brazein Purified from GG799

In order to produce a brazein specific primary antibody (Rabbit-anti-brazzein), 5 mg of brazein powder was purified from yeast K. lactics GG799, and then purified after SDS-PAGE and HPLC (FIGS. 6 and 7). ) It was used by ProSci of USA.

3.3 Transgenic Plant Selection by ELISA

BCA protein was quantified to fix the TSP concentration of transformed and wild-type plants to 1.35 mg / ml, followed by ELISA to select plants with the highest expression levels of braze for each transformation line.

As a result, it showed the highest expression of brazein in pBI-BZ3 plants which consist only of signal peptide and brazein sequence. The pBI-BZ2 plant without the endoplasmic reticulum KDEL amino acid sequence expressed about 64.31 times higher than the plant containing the pBI-BZ1 gene, and the pBI-BZ3 with signal peptide was about 6.39 times higher than that of pBI-BZ4. Showed high expression (Table 6).

Comparing this with the brazein standard curve, 0.0073 ng / ml of brazein was inserted in tobacco plants with pBI-BZ1 gene and 0.4714 ng / ml and pBI-BZ3 gene was inserted in tobacco plants with pBI-BZ2 gene. It was confirmed that 0.1412 ng / ml of brazein was expressed in tobacco plants in which 0.9020 ng / ml and pBI-BZ4 gene were inserted in the tobacco plants (Table 6).

Analysis of Brazein Expression Levels of Four Transformed Lines by ELISA Transgenic line ELISA (OD ₄₅₀ ) Concentration (ng / ml) Fold change pBI-BZ1 0.01 0.0073 One pBI-BZ2 0.1625 0.4714 64.31 pBI-BZ3 0.304 0.9020 123.05 pBI-BZ4 0.054 0.1412 19.27

3.4 Confirmation of T-DNA Insertion in Genomic DNA by PCR

PCR was performed using a brazein- specific primer and an NPTII gene-specific primer to confirm that all of the pBI-BZ1, pBI-BZ2, pBI-BZ3, and pBI-BZ4 tobacco transformants were amplified T-DNA (Fig. 10 ~ 14).

3.5 Analysis of mRNA Expression by Semi-quantitative RT-PCR

The semi-quantitative RT-PCR was performed using the top five transgenic plants that were determined to have the highest expression levels of brazein for each gene. Comparison of the expression levels of brazein using EF-1 α as a housekeeping gene showed that all of the tobacco plants containing pBI-BZ1, pBI-BZ2, pBI-BZ3, and pBI-BZ4 genes overexpressed brazein compared to wild-type tobacco plants. In the tobacco plants to which the pBI-BZ2 gene was introduced, it was confirmed that brazein expression was significantly high (FIGS. 14 to 17. Table 7).

Analysis of brazein mRNA expression levels of four transgenic lines by semi-quantitative RT-PCR Transgenic line 2 ^{△△ CT} Average (2 ^{△△ CT} ) Fold change pBI-BZ1 45.43 47.36 46.31 46.37 1.16 pBI-BZ2 2409.12 2403.73 2280.65 2364.50 59.05 pBI-BZ3 40.20 39.89 40.05 40.04 1.00 pBI-BZ4 2748.09 3618.40 2886.36 3084.28 77.02

4.1 Purification of Brazein from Transgenic Tobacco Leaves

In order to extract the brazein from the transformed tobacco leaves, it was first extracted all the protein with a plant extraction buffer (plant extraction buffer) to confirm that the brazein was properly extracted (Fig. 21). In order to remove other proteins and chlorophyll from crude extracts identified with brazein, a salting method using ammonium sulfate precipitation and a heat treatment method using heat denaturation were performed.

First, brazein was precipitated at 10% intervals from 0% to 90% using ammonium sulfate on the supernatant, and the concentration of brazein was determined. It was confirmed that precipitated at 30%-80% mainly without precipitation in more than% (Fig. 22). The concentration of brazein was collected and the precipitate was dissolved in distilled water to remove salts through dialysis and subjected to heat treatment. Many proteins are unstable in heat, but because brazein is stable at 80 ° C. for 4.5 hours, heat treatment is performed every hour from 1 hour to 4 hours to confirm that the optimal time for protein removal is 2 hours (FIG. 23). Heat treatment for 1 hour showed unremoved protein than heat treatment for 2 to 4 hours. When comparing the heat treatment from 2 hours to 4 hours, the difference is not so much that it is judged that the 2 hour heat treatment is the best time. Therefore, after 2 hours of heat treatment, purification was performed using an anion exchange resin, but not purified in a single band (FIG. 24). Samples that were not purified in a single band were collected and subjected to brazein purification in the next step, cation exchange resin. Brazein purified using a cation exchange resin was confirmed by SDS-PAGE was found to be a single band (single band) (Fig. 25). After confirming that it is a single band, the eluate was dialyzed in distilled water, and then lyophilized to obtain a brazein in powder form, and HPLC (High Performance Liquid Chromatography) analysis was performed to confirm the purity and activity of the purified brazein. HPLC measurement was compared with brazein purified from K. lactis . As a result, brazein purified from K. lactis was found at 13.234 minutes, and tobacco expressed in 13.294 minutes. The difference between the two was 0.06 minutes, which was expected to be about the same material (FIG. 26).

4.2.1 Brazein Tablet Yield

Thus far, it has been confirmed that the expression of brazein is expressed by transforming the brazein gene in tobacco leaves. Brazein tried to express in various expression systems, as shown in Table 8, the yield was different depending on the expression system. Although the history of the production of brazein through transformation in plants is not long, there have been many studies on the production of brazein using other expression systems (Table 8).

The production of brazein using tobacco leaves is the simplest and most easily accessible of the plants, and there are several purification steps to make this work successful. In each step, the total protein amount, brazein The amounts, purity, fold and yield were summarized in the table (Table 9). According to the purification step, the amount of total protein was reduced and the amount of brazein was greatly reduced.

The yield of 1.9 mg / Kg is never small when expressed and purified in tobacco. It is meaningful because the tobacco expression system may be better in terms of production cost or management when grown in large quantities compared to the yeast expression system, which has a high production cost.

Expression host used for recombinant brazein production and characterization Host E.coli K. lactis Zea mays * N. tabacum Brazzein
yield 1.8 mg / L 55 mg / L 53.8 mg / kg 1.9 mg / kg

* Not purified

4.2.2 N-terminal amino acid sequencing

N-terminal amino acid sequence was analyzed to determine whether the protein purified from the transformed tobacco leaves is the target protein. A purified sample was provided with 10 μg / mL and five amino acid sequences were identified by Edman sequencing method and compared with the brazein sequence.

The brazein gene transformed on tobacco leaves was a minor type brazein consisting of 53 amino acids without pyroglutamate at the N-terminus. The sequence proceeds with D-K-C-K-K. As a result of analysis, it was confirmed that the sequences except for the third amino acid were identical with D-K-X-K-K (FIG. 27). The third amino acid, which is not read in the data, is considered to be cysteine because it is most likely to be cysteine in the case of common amino acid because of Edman sequencing analysis method. Therefore, as a result, it was confirmed that the protein purified from the tobacco leaf is consistent with the sequence of the brazein of minor type (FIG. 18).

4.2.3 Higher order structure analysis of brazein by circular dichroism spectroscopy

The higher order structures of brazein expressed and purified using plant and yeast expression systems were compared and analyzed by circular dichroism spectroscopy. Mean ellipticity (MRE) of brazein purified from plants and expressed in yeast was measured at concentrations of 2.5, 5.0, 10 and 20 μM in the range from 190 nm to 250 nm (FIGS. 29 and 30). . As a result of the measurement, both samples showed the lowest absorption at 215 nm and the overall spectrum was similar, indicating that the higher order structures of the purified brazein in yeast and the purified brazein in tobacco leaves were very similar (FIG. 31). . In addition, the values of α-helix and β-stranded structures were determined for each value measured at 10 μM using the K2D3 program.

As a result, the purified brazein from K. lactis contained 7.41% α-helix structure and 17.16% β-stranded structure, and the purified brazein from tobacco leaves had a 9.9% α-helix structure and 19.7% β-stranded. It appears to contain the structure, but there is a slight difference, but there is no significant structural change (Table 10: Evaluation of the secondary structure composition of Kluyveromyces lactis and Nicotiana tabacum by K2D3).

4.2.4 LC-MS / MS

There are several ways to determine the molecular weight of the purified brazein from tobacco leaves. Basically, mass spectrometer can be used to confirm the exact molecular weight, and LC-ESI-MS / MS used in this study, as can be seen from the name, can be separated and analyzed using two mass spectrometers. Mass spectrometers and tandem mass spectrometers have distinct advantages in sensitivity, and have the advantage of being able to analyze more reliably. If the mass spectrometer analyzes the ions and checks the molecular weight, the tandem mass spectrometer has the advantage that the peptide can be cut and sequenced to obtain more accurate results.

A request was made to a company to analyze LC-ESI-MS / MS, and the analysis results are shown in FIG. 32. It can be seen in the underlined portion of the red letters that 10 amino acids out of the 54 sequences of brazein match the amino acid sequences of brazein. This can be confirmed in the spectrum below, and selects peaks with high current and accuracy among several peaks, and then obtains the result from the analysis agency by matching the sequences. Thus, these sequences had the code of P56552.1 in the NCBI blast (ncbi.nlm.nih.gov), which was confirmed by the result of Brazein's search.

4.2.5 Determination of sweet activity of brazein

The degree of sweetness of purified brazein expressed in tobacco leaves was measured against sucrose. First, in order to accurately determine the concentration of purified brazein with high purity, BCA was quantified three times to obtain an average value. In the braze sweetness test, 10 participants participated in the step-by-step concentration test and checked the sweetness of the brazein sample to determine the relative activity of sucrose and sweetness.

As a result, brazein expressed in tobacco leaves showed about 1,330 times sweeter than sucrose (FIG. 33).

Review

Since the 1990s, studies on expressing sweet proteins such as Monelin, Miraculin, Taumatin, and Brazein as recombinant proteins using plants have been actively conducted. In the case of taumartin, overexpression of proteins in strawberries, pears, cucumbers, and tomatoes, starting from the potato expression, was expressed (Witty, 1990; Szwacka et al., 2002; Bartoszewski et al., 2003; Lebedev et al., 2000; Schestibratov and Dolgov, 2005). In the case of brazein, it was expressed in corn in the United States in 2005, which resulted in 53.75 mg of unpurified brazein per kg of corn (Lamphear, BJ, Barker, DK, Brooks, CA, Delaney, DE). , Lane, JR, Beifuss, K., Love, R., Thompson, K., Mayor, J., and Clough, R. (2005) .Expression of the sweet protein brazzein in maize for production of a new commercial sweetener. J. Plant Biotech., 3, 103-114). However, later problems with cross-contamination between different crops caused the entire transgenic maize crop to be discarded, making it difficult to proceed with subsequent studies. Based on these findings, this study has the advantage of being able to grow to a large adult size of 2-3 m compared with other plants, allowing mass production, and keeping proteins in seed form for long-term activity. The study was conducted using tobacco. Four kinds of pBI-BZ1-4 expression vectors were constructed using different gene cassettes to express sweet protein brazein as a recombinant protein in tobacco plants, thereby constructing a transformed tobacco plant expressing brazein. The transgenic tobacco plants were identified by PCR, semi-quantitative RT-PCR, RT-qPCR and T-DNA insertion and mRNA expression in plant chromosomal DNA. As a result, pBI-BZ-3 showed the most expression, and 15.3 mg per kg of tobacco leaf was expressed. The recombinant brazein thus expressed was purified from tobacco leaves and subjected to structure and characterization. As a result of the purification process, brazein was extracted and purified through ammonium sulfate precipitation, heat treatment, cation chromatography, and anion chromatography to obtain 1.9 mg of brazein per kg of tobacco leaves. In order to confirm whether the extracted brazein had sweetness activity and whether the expressed and purified proteins were brazein, the primary structure, higher order structure and sweetness characteristics were analyzed. First, the approximate molecular weight was confirmed by SDS-PAGE, and purity and protein folding were confirmed using HPLC. As a result of confirming the secondary structure of the protein using the circular dichroism spectroscopy on the identified samples, it was found that the purified braze from yeast was compared with the content of the α-helix structure and the β-strand structure. There is a slight difference from Jane, but there is no significant structural change. The N-terminal amino acid sequence analysis confirmed that it was consistent with the sequence of brazein, and LC-MS / MS also confirmed that the molecular weight and internal sequence were consistent with the brazein. As a result of the comparison between sucrose and sweetness, the result was about 1,330 times sweeter. As a result of comparative analysis of sweetness of purified and purified brazein in different expression systems, brazein purified from K. lactis compared to sucrose showed 1,820 times sweetness and 1,280 times sweetness purified from E. coli . Because brazein expressed in prokaryotic E. coli is purified through refolding, folding may be different, and thus, sweetness activity is somewhat lower than that of brazein purified from eukaryotes. But eukaryotic k. The sweetened activity of the purified brazein in lactis and tobacco leaves should be similar but varies by about 27%. In untransformed tobacco leaves, proteins similar in size to the molecular weight of brazein are present. Therefore, unlike protein purified from K. lactis , the sample purified from tobacco leaves contains other proteins besides brazein because the final protein concentration is the same but the sweetness activity is lowered because the concentration of brazein is different. do. Another possibility is that the molecular weight of the purified brazein from transgenic tobacco measured by LC-MS / MS is 6,958, which is about 500 molecular weights with that of the minor type brazein. Therefore, there is a possibility that the formula may have occurred in Brazein by the post-translational modification process, and this suggests that the formula may affect the sweetness. The results of the analysis of purified brazein from tobacco leaves showed that the purified braze was purified with high purity and accurate folding and had a higher sweetness than sucrose. In addition, the amount of recombinant brazein expressed in tobacco leaves is 15.3 mg, and the purified brazein, which is purified through a multi-step process, is 1.9 mg per kg, but the yield seems somewhat low, but this is never a small amount. It is meaningful because the tobacco expression system may be better in terms of production cost or management when it is cultivated in large quantities compared to the yeast expression system which is expensive to produce. Therefore, it is believed that this will contribute to the commercialization of sweeteners after mass production of brazein. Furthermore, transforming not only tobacco plants but also plants with fleshy fruit without cross-contamination will be a great help for the agricultural product market, including the sweetener business.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Production method of brazzein from transgenic tobacco for high          expression of brazzein <130> P18U21C0844 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 53 <212> PRT <213> Artificial Sequence <220> <223> brazzein minor type <400> 1 Asp Lys Cys Lys Lys Val Tyr Glu Asn Tyr Pro Val Ser Lys Cys Gln   1 5 10 15 Leu Ala Asn Gln Cys Asn Tyr Asp Cys Lys Leu Asp Lys His Ala Arg              20 25 30 Ser Gly Glu Cys Phe Tyr Asp Glu Lys Arg Asn Leu Gln Cys Ile Cys          35 40 45 Asp Tyr Cys Glu Tyr      50 <210> 2 <211> 159 <212> DNA <213> Artificial Sequence <220> <223> brazzein minor type <400> 2 gacaaatgca aaaaagttta cgaaaattac ccagtttcta agtgccaact ggccaatcaa 60 tgcaattacg attgcaagct tgataagcat gctcgatctg gagaatgctt ttacgatgaa 120 aagagaaatc ttcaatgcat ttgcgattac tgcgaatac 159 <210> 3 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> AMV enhancer <400> 3 ttttattttt aattttcttt caaatacttc ca 32 <210> 4 <211> 87 <212> DNA <213> Artificial Sequence <220> <223> endoplasmic reticulum signal peptide <400> 4 gctacccaaa ggagagcaaa ccctagttct ctacatctta tcactgtgtt ctcactgctt 60 gctgcagtag tttccgccga agttgat 87 <210> 5 <211> 623 <212> DNA <213> Artificial Sequence <220> <223> CaMV 35S promoter <400> 5 gcatgcctgc aggtccgatt gagacttttc aacaaagggt aatatccgga aacctcctcg 60 gattccattg cccagctatc tgtcacttta ttgtgaagat agtggaaaag gaaggtggct 120 cctacaaatg ccatcattgc gataaaggaa aggccatcgt tgaagatgcc tctgccgaca 180 gtggtcccaa agatggaccc ccacccacga ggagcatcgt ggaaaaagaa gacgttccaa 240 ccacgtcttc aaagcaagtg gattgatgtg atggtccgat tgagactttt caacaaaggg 300 taatatccgg aaacctcctc ggattccatt gcccagctat ctgtcacttt attgtgaaga 360 tagtggaaaa ggaaggtggc tcctacaaat gccatcattg cgataaagga aaggccatcg 420 ttgaagatgc ctctgccgac agtagtccca aagatggacc cccacccacg aggagcatcg 480 tggaaaaaga agacgttcca accacgtctt caaagcaagt ggattgatgt gatatctcca 540 ctgacgtaag ggatgacgca caatcccact atccttcgca agacccttcc tctatataag 600 gaagttcatt tcatttggag agg 623 <210> 6 <211> 257 <212> DNA <213> Artificial Sequence <220> <223> NOS terminator <400> 6 ccgatcgttc aaacatttgg caataaagtt tcttaagatt gaatcctgtt gccggtcttg 60 cgatgattat catataattt ctgttgaatt acgttaagca tgtaataatt aacatgtaat 120 gcatgacgtt atttatgaga tgggttttta tgattagagt cccgcaatta tacatttaat 180 acgcgataga aaacaaaata tagcgcgcaa actaggataa attatcgcgc gcggtgtcat 240 ctatgttact agatcgg 257 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse TEV <400> 7 ggccagtttt acctcaatga g 21 <210> 8 <211> 184 <212> DNA <213> Artificial Sequence <220> <223> NOS promoter <400> 8 gggtttctgg agtttaatga gctaagcaca tacgtcagaa accattattg cgcgttcaaa 60 agtcgcctaa ggtcactatc agctagcaaa tatttcttgt caaaaatgct ccactgacgt 120 tccataaatt cccctcggta tccaattaga gtctcatatt cactctcaat ccaaataatc 180 tgca 184 <210> 9 <211> 795 <212> DNA <213> Artificial Sequence <220> <223> NPT II gene <400> 9 atgattgaac aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc 60 ggctatgact gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca 120 gcgcaggggc gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg 180 caggacgagg cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg 240 ctcgacgttg tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag 300 gatctcctgt catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg 360 cggcggctgc atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc 420 atcgagcgag cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa 480 gagcatcagg ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg catgcccgac 540 ggcgaggatc tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat ggtggaaaat 600 ggccgctttt ctggattcat cgactgtggc cggctgggtg tggcggaccg ctatcaggac 660 atagcgttgg ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc 720 ctcgtgcttt acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt 780 gacgagttct tctga 795

Claims (5)

To prepare a transformed tobacco using a recombinant expression vector for high expression of braze, and to purify the recombinant brazein expressed in the transformed tobacco by sequentially performing salting, heat treatment, anion chromatography and cation chromatography step;
Comprising, a method for producing brazein from a transgenic tobacco.
The method of claim 1,
The recombinant expression vector for high expression brazein will include a promoter and an operably linked AMV (Alfalfa Mosaic Virus RNA4) enhancer, an endoplasmic reticulum signal peptide, and a polynucleotide encoding brazein. .
The method of claim 1,
The salting out is carried out by precipitation with an ammonium sulfate solution of 30-80% concentration.
The method of claim 1,
The heat treatment is carried out for 1 to 3 hours at 70 ~ 90 ℃.
The method of claim 1,
The anion chromatography is performed using DEAE-Sepharose, an anion exchange resin,
Wherein the cation chromatography is performed using a cation ion resin CM-Sepharose (carboxymethyl-Sepharose).

Images