KR20200012083A - Method and kit for detecting Mycobacterium tuberculosis complex and Nontuberculous mycobacteria using lateral flow assay - Google Patents

Abstract

The present invention can simultaneously detect Mycobacterium tuberculosis and nontuberculous mycobacteria in one kit by collecting only advantages of a molecular biological detection method using PCR and a lateral flow assay. Specifically, the present invention can detect Mycobacterium tuberculosis and nontuberculous mycobacteria efficiently, conveniently and cost-effectively in one kit without expensive molecular diagnostic equipment by making the detection of PCR amplification products for target genes of Mycobacterium tuberculosis and nontuberculous mycobacteria possible in a lateral flow assay device, for example, a membrane strip.

Description

Method and kit for detecting Mycobacterium tuberculosis complex and Nontuberculous mycobacteria using lateral flow assay

The present invention relates to a method and kit for detection of Mycobacterium tuberculosis and non-tuberculosis acid bacterium using lateral flow analysis. More specifically, the present invention relates to a single tuberculosis bacillus and non-tuberculosis acid bacterium by collecting only the advantages of molecular biological detection method and lateral flow analysis using PCR. It relates to a method that can be detected simultaneously in the kit of and a kit for the same.

In addition, the present invention enables the detection of PCR amplification products for the target genes of Mycobacterium tuberculosis and non-tuberculosis acidophilus in the lateral flow analysis device so that tuberculosis bacteria and non-tuberculosis acidophilic bacteria are inexpensively and conveniently in one kit without expensive molecular diagnostic equipment. It relates to a method that can be detected efficiently and a kit therefor.

Tuberculosis is an infection caused by a bacterium called Mycobacterium tuberculosis , which is mostly caused in the lungs, but can cause disease in most tissues or organs in the body, such as the kidneys, nerves, and bones. In addition, Mycobacterium tuberculosis complex (MTBC) is not only Mycobacterium tuberculosis, but also Mycobacterium africanum (M. africanum), Mycobacterium Origi (M. orygis) Cobacterium Bovis, Mycobacterium Microti, Mycobacterium Canetti, Mycobacterium Capre, Mycobacterium A group related to the mycobacterium tuberculosis species, including M. pinnipedii, M. suricattae, and M. mungi. Causes tuberculosis symptoms in animals and animals.

On the other hand, nontuberculous mycobacteria (NTM) refers to mycobacteria (mycobacteria) excluding tuberculosis bacteria and leprosy bacteria, and exists normally in the surrounding natural environment. More than 140 species are now known, and new species are constantly being discovered. Since non-tuberculosis mycobacterium is present in the surrounding environment, the detection of non-tuberculosis mycobacterium in the human body is not always considered to be a causative agent of lung disease and can be contaminated from the environment during the diagnosis process.

Since 1980, diseases caused by non-tuberculosis acidophilic bacteria have been reported worldwide, and more than 90% of them cause lung disease. Mycobacterium avium complex accounts for 60-80% of infections by non-tuberculosis mycobacterium, 15-20% of M. kansasii and the rest of mycobacterium. M. abscessus, M. fortuitum and M. chelonae account for less than about 5%.

Tuberculosis bacillus and non-tuberculosis acidophilic bacteria have most of the common causes of lung disease, and since symptoms are similar, diagnosis of tuberculosis as well as non-tuberculosis acid bacillus is necessary for diagnosis of tuberculosis. Mycobacterium tuberculosis has the characteristic of growing very slowly compared to other bacteria. Since cell division takes 18-24 hours, the diagnosis of Mycobacterium tuberculosis by culturing is time-consuming and inefficient. Chest X-rays are useful for diagnosing and monitoring the disease but are difficult to distinguish from other lung diseases. For this reason, recent molecular biological tests have been widely used, and molecular biological tests have the advantage of being able to detect tuberculosis bacteria as well as to discriminate between non-tuberculosis and antimicrobial resistance.

Tuberculosis is a representative disease in developing countries and occurs in areas with poor medical conditions. Molecular biological diagnostics have many advantages compared to other TB diagnostic methods, but it is urgent to develop and disseminate low-cost diagnostic methods in the developing countries where economic efficiency is difficult to secure expensive molecular diagnostic equipment.

Therefore, it can be said that the technical field to which the present invention belongs is required to provide a new technology capable of simultaneously detecting tuberculosis bacteria and non-tuberculosis antibacterial bacteria at a low cost, simple and high sensitivity, compared to conventional molecular biological diagnostic methods using PCR.

On the other hand, it is to be understood that the matters described as the background art are merely for the purpose of improving the understanding of the background of the present invention and are not cited as an approval that they may be used as the "prior art" of the present invention.

Republic of Korea Patent Publication No. 10-1027036 (2011.04.11)

It is an object of the present invention to provide a method and kit for the detection of Mycobacterium tuberculosis and non-tuberculosis acid bacterium using lateral flow analysis. Specifically, it is an object of the present invention to provide a method and kit for detecting the tuberculosis bacteria and non-tuberculosis antibacterial bacteria at the same time by collecting only the advantages of molecular biological detection method and lateral flow analysis method using PCR.

In addition, an object of the present invention is to enable the detection of PCR amplification products for the target genes of Mycobacterium tuberculosis and non-tuberculosis acidophilus in the lateral flow analysis device, so that tuberculosis bacteria and non-tuberculosis acidophilic bacteria are inexpensive and simple without expensive molecular diagnostic equipment. The present invention provides a method for efficiently detecting a kit and a kit therefor.

However, the problems of the present invention as described above are exemplary, and the scope of the present invention is not limited thereby. Further objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

As a result of resolving the technical problem of the present invention and in accordance with the object of the invention, the present inventors have selected the IS6110 insertion element (target element) as a target gene for the detection of Mycobacterium tuberculosis. For detection, rpoB gene was selected as a target gene, and then the common sequences of each of these target genes were selected to design specific primers for discrimination between Mycobacterium tuberculosis and non-tuberculosis antibacterial bacteria, and PCR amplification products amplified by these primers. In other words, the PCR amplification products for the target genes of tuberculosis bacteria and non-tuberculosis antibacterial bacteria came to devise a test kit and method that can be confirmed by lateral flow analysis, an immunological method.

As used herein, the term "sample" refers to a variety of samples capable of detecting genes of Mycobacterium tuberculosis and / or non-tubercular acidophilus, in addition to sputum, saliva, and blood of a suspicious patient, for example, tuberculosis and / or non-tuberculosis acidophilus. It is used as a concept that includes tissues, tissue exudates, and cells obtained from lungs, kidneys, pleura, and spine of suspected patients.

As used herein, the term "gene sample" is used in a broad sense including DNA, RNA, cDNA generated from RNA by reverse transcriptase, DNA amplified by pre-PCR (preliminary PCR), and the like. .

As used herein, the term "lateral flow assay device", "lateral flow assay strip" or "lateral flow assay membrane strip" refers to at least two antibodies immobilized on a membrane, a porous membrane through which PCR amplification products can flow through capillary action, Upstream side of the may be provided with a loading pad that absorbs the PCR amplification products to be dropped and ensure a uniform flow. The loading pad may be dipped with gold nanoparticles conjugated with streptavidin (or equivalent) that can selectively bind to biotin (or equivalent) contained in the PCR amplification product. The loading pad may be composed of a sample pad onto which PCR amplification products are loaded, and a bonding pad immersed with gold nanoparticles to which streptavidin (or equivalent) is conjugated, and an absorption pad downstream of the membrane to promote capillary action. It may be provided.

The detection method of Mycobacterium tuberculosis and non-tuberculosis acid bacterium using the lateral flow analysis method of an embodiment of the present invention,

The first tag is labeled at the 5 'end of the first forward primer that specifically binds to the IS6110 gene of Mycobacterium tuberculosis, which is a target gene for the detection of Mycobacterium tuberculosis, and the non-tuberculosis of Mycobacterium tuberculosis, which is the target gene for detection of a second tag at the 5 'end of the second forward primer that specifically binds to the rpoB gene, the 5' end of the first reverse primer that specifically binds to the IS6110 gene of Mycobacterium tuberculosis, which is a target gene for detection of Mycobacterium tuberculosis, and Labeling a third tag at the 5 'end of the second reverse primer that specifically binds to the rpoB gene of the non-tuberculosis mycobacterium, which is a target gene for detection of the non-tuberculosis mycobacterium,

Amplifying a gene sample in a sample by PCR using the pair of the first forward primer and the first reverse primer and the pair of the second forward primer and the second reverse primer;

Loading the PCR amplification product on one side of a lateral flow analysis device to form a complex with a conjugated gold nanoparticle that binds specifically to the third tag;

A second test in which the complex is moved to the other side of the lateral flow analysis device and the complex is located at a distance from the anti-first tag antibody in the first test line of the lateral flow analysis device and the first test line Binding with an anti-second tag antibody in a line,

And detecting tuberculosis bacteria and non-tuberculosis antibacterial bacteria in the sample by checking whether bands formed by the collection of gold nanoparticles of the complex in the first test line and the second test line are formed.

When a band is formed in the first test line, tuberculosis bacteria are present in the sample, and when a band is formed in the second test line, it may be determined that non-TB tuberculosis is present in the sample.

In the method for detecting Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the first tag may be digoxigenin (DIG), and the second tag may be fluorescein (FITC).

In the method for detecting Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the anti-first tag antibody may be an anti-DIG antibody, and the anti-second tag antibody may be an anti-FITC antibody.

In the method for detecting Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the third tag may be biotin, and the binder may be streptavidin.

In the method for detecting Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the first forward primer and the first reverse primer may be primers of SEQ ID NO: 1 and primers of SEQ ID NO: 2, respectively.

In the method for detecting Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the second forward primer and the second reverse primer may be primers of SEQ ID NO: 3 and primers of SEQ ID NO: 4, respectively.

Mycobacterium tuberculosis and non-tuberculosis acid bacterium detection kit using the lateral flow analysis method of one embodiment of the present invention,

A first forward primer that specifically binds to the IS6110 gene of Mycobacterium tuberculosis, which is a target gene for detection of Mycobacterium tuberculosis, and is labeled with a first tag at its 5 'end;

A second forward primer that specifically binds to the rpoB gene of non-tuberculosis mycobacteria, which is a target gene for detection of non-tuberculosis mycobacteria, and a second tag is labeled at the 5 'end;

A first reverse primer specifically binding to the IS6110 gene of Mycobacterium tuberculosis, which is a target gene for detection of Mycobacterium tuberculosis, and labeled with a third tag at its 5 'end; And

A composition for PCR amplification comprising a second reverse primer specifically bound to the rpoB gene of non-tuberculosis mycobacteria, which is a target gene for detection of non-tuberculosis mycobacteria, and labeled with a third tag at a 5 'end;

A first test line having gold nanoparticles conjugated with a binder that specifically binds to the third tag, and having an anti-first tag antibody that specifically binds to the first tag, and the second And a lateral flow assay device having an anti-second tag antibody that specifically binds a tag and having a second test line positioned at a distance from the first test line.

In the detection kit of Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the first tag may be digoxigenin (DIG), and the second tag may be fluorescein (FITC).

In the detection kit of Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the anti-first tag antibody may be an anti-DIG antibody, and the anti-second tag antibody may be an anti-FITC antibody.

In the detection kit of Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the third tag may be biotin, and the binder may be streptavidin.

In the detection kit of Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the composition for PCR amplification may further include DNA polymerase, dNTPs and PCR buffer solution.

In the detection kit of Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the first forward primer and the first reverse primer may be primers of SEQ ID NO: 1 and primers of SEQ ID NO: 2, respectively.

In the detection kit of Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium of one embodiment of the present invention, the second forward primer and the second reverse primer may be primers of SEQ ID NO: 3 and primers of SEQ ID NO: 4, respectively.

According to the present invention, by collecting only the advantages of the molecular biological detection method and the lateral flow analysis method using PCR can be detected at the same time in one kit tuberculosis bacteria and non-tuberculosis acid bacterium.

Specifically, the present invention enables the detection of PCR amplification products for target genes of Mycobacterium tuberculosis and Mycobacterium tuberculosis in non-tuberculosis and non-tuberculosis acidophilus in a lateral flow analysis device, for example, to prevent tuberculosis and non-tuberculosis mycobacteria without expensive molecular diagnostic equipment. Inexpensive and simple to detect efficiently in one kit.

Accordingly, the present invention provides a rapid and accurate diagnosis of patients or carriers infected with Mycobacterium tuberculosis and / or non-tuberculosis acidophilus, which is transmitted in a space where a large number of people, including hospitals and schools, are living. Can be blocked in advance.

On the other hand, the scope of the present invention is not limited by the effects as described above.

1 is a diagram showing a homology analysis result for the IS6110 gene which is a target gene for the detection of Mycobacterium tuberculosis.
2 is a diagram showing a result of homology analysis for the rpoB gene which is a target gene for the detection of non-tuberculosis mycobacterium.
3 is a view showing the main structure of the lateral flow analysis device according to an embodiment of the present invention.
FIG. 4 is a diagram showing a result of performing lateral flow analysis on PCR amplification products of target genes of Mycobacterium tuberculosis and non-tuberculosis acid bacterium using the lateral flow analysis device shown in FIG. 3.

Hereinafter, the present invention will be described in more detail in the following examples. However, the following examples are merely to exemplify the contents of the present invention and do not limit or limit the scope of the present invention. From the detailed description and examples of the present invention, those skilled in the art to which the present invention pertains can be easily inferred to be within the scope of the present invention. References cited in the present invention are incorporated herein by reference.

Throughout the specification, when a part is said to "include" a certain component, it means that it can further include other components, without excluding other components unless specifically stated otherwise.

Example 1: Mycobacterium tuberculosis gene homology analysis

The IS6110 gene was selected as a target gene to identify Mycobacterium tuberculosis, and homology analysis was performed using sequence information of Mycobacterium tuberculosis. Gene homology of Mycobacterium tuberculosis was analyzed using MEGA 7.0 ( https://www.megasoftware.net/ ), a public homology analysis program. Sequence information for homology analysis of Mycobacterium tuberculosis is shown in Table 1 below.

Sequence Information for Mycobacterium Tuberculosis Homology Analysis TB IS6110 LC005454.1 LC005455.1 LC005456.1 LC005461.1 LC005465.1 LC005475.1 LC005476.1 LC005477.1

Example 2: Non-tuberculosis acidophilic gene homology analysis

The rpoB gene of non-tuberculosis mycobacterium was selected as a target gene, and sequence information of various non-tuberculosis mycobacteria was confirmed in Genbank, and homology analysis was performed. Gene homology analysis of non-tuberculosis mycobacteria was also performed using MEGA 7.0, a public homology analysis program. Sequence information for homology analysis of non-tuberculosis antibacterial bacteria is shown in Table 2 below.

Sequence Information for Homologous Analysis of Nontuberculous Acid Bacteria Non-tuberculosis Reference sequence Non-tuberculosis Reference sequence M. interjectum HM022207.1 M.bohemicum KJ729110.1 M. novocastrense AY859704.1 M.bolletii AY859692.1 M.abscessus JF346872.1 M.branderi JQ582667.1 M.alvei AY859697.1 M.chelonae EU109289.1 M.arupense JN571215.1 M.chimaera GQ153309.1 M.aubagnense AY859694.1 M.colombiense GQ153308.1 M.avium avium EF521907.1 M.conceptionense AY859695.1 M.avium hominissuis EF521911.1 M.conspicuum HQ141573.1 M.avium paratuberculosis EF521906.1 M.farcinogenes AY262742.1 M.avium silvaticum EF521905.1 M.florentinum HM022205.1 M.gastri JN986748.1 M.fortuitum JF346874.1 M.goodii AY262736.1 M.immunogenum AY262739.1 M.gordonae JF346873.1 M.interjectum HM022207.1 M.haemophilum GQ245966.1 M.intracellulare JQ411539.1 M.heckshornense KJ729109.1 M.iranicum HQ009483.1 M.heidelbergense HM132044.1 M.kansasii HQ880687.1 M.houstonenese AY147173.1 M.kumamotonense JN571251.1 M.lentiflavum JN881350.1 M.porcinum AY262737.1 M.leprae AL450380.1 M.scrofulaceum GQ153305.1 M.mageritense AY147169.1 M.senegalense AY262738.1 M.malmoense GQ153314.1 M.septicum AY147167.1 M.mantenii KJ729111.1 M.setense EU371506.1 M.marinum CP000854.1 M.shimoidei HM807416 M.massiliense EU109294.1 M.simiae GQ153313.1 M.mucogenicum AY147171.1 M.smegmatis AY262735.1 M.neworleansense AY147172.1 M.terrae JN571261 M.novocastrense AY859704.1 M.timonense EF584435.1 M.parascrofulaceum JQ411538.1 M.triviale JF712873.1 M.peregrinum AY147166.1 M.vulneris EU834057.1 M.phlei AY859700.1 M.wolinskyi AY262743.2 M.phocaicum AY859693.1 M.xenopi JN881349.1

Example 3 Preparation of Positive Control for Target Gene Amplification Experiments of Mycobacterium Tuberculosis and Non-tuberculosis Acid Bacteria

Using the sequence information as shown in Table 3 and Table 4 below, the synthesis of genes used as a template for amplifying target genes of Mycobacterium tuberculosis and non-tuberculosis antibacterial bacteria was performed. Each gene synthesis was carried out using a gene synthesis service of Bioneer (Daejeon Metropolitan City, Korea), and the synthetic genes of Mycobacterium tuberculosis and non-TB tuberculosis were quantified and prepared at a concentration of 10 ² to 10 ⁵ copies / μL. .

Synthetic gene sequence information of Mycobacterium tuberculosis (SEQ ID NO: 5) Mycobacterium tuberculosis (nucleotide positions, 37418-37498, CP019613.1) GAGACGATCAACGGCCTATACAAGACCGAGCTGATCAAACCCGGCAAGCCCTGGCGGTCCATCGAGGATGTCGAGTTGGCC

Sequence information of synthetic gene of non-tuberculosis antibacterial bacterium (SEQ ID NO: 6) Mycobacterium avium subsp. avium (nucleotide position, 165-303, KU861849.1) CAGAAGCGCAAGATCTCCGACGGTGACAAGCTCGCCGGCCGGCACGGCAACAAGGGCGTCATCGGCAAGATCCTGCCGCAGGAGGACATGCCGTTCCTGCCGGACGGCACGCCGGTGGACATCATCCTGAACACCCACG

Example 4 Preparation and Gene Amplification of Primer for Target Gene Amplification for Detection of Mycobacterium Tuberculosis and Non-tuberculosis Acid Bacteria

Primers for specifically amplifying tuberculosis bacteria and non-tuberculosis acidophilic bacteria were designed to select homologous portions of the IS6110 gene sequence and the rpoB gene sequence and to have similar Tm values so that experiments could be performed under the same amplification conditions. Analysis of the Tm value for the selected primer sequence was performed using oligoanalyzer 3.1, a web-based program provided by IDT (INTEGRATED DNA TECHNOLOGIES). Detailed primer sequence information is shown in Table 5 below.

Primer sequence information for detection of Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium (R = A / G) SEQ ID NO: designation Sequence (5 '→ 3') Length % GC Tm size One TB forward primer GAGACGATCAACGGCCTATAC 21 52.4 54.8 81 bp 2 TB reverse primer GGCCAACTCGACATCCTC 18 61.1 55.6 3 NTM forward primer CAGAAGCGCAAGATCTCCGA 20 55 57.2 139bp 4 NTM reverse primer CGTGGGTGTTCARGATGATGTC 22 52.3 56.9

  The primers of SEQ ID NO: 1 and the primers of SEQ ID NO: 2 are forward primers and reverse primers for specifically amplifying target genes of Mycobacterium tuberculosis, respectively. The primers of SEQ ID NO: 3 and primers of SEQ ID NO: 4 are forward primers and reverse primers for specifically amplifying target genes of non-TB tuberculosis, and can amplify 139 bp of non-TB tuberculosis rpoB gene. .

In this embodiment, the primers and sequence of SEQ ID NO: 2 so that the target gene amplification products of Mycobacterium tuberculosis and non-tuberculosis mycobacterium, i.e., Mycobacterium tuberculosis IS6110 gene amplification product and non-tuberculosis mycobacterium rpoB gene amplification product, can be identified by immunoassay. Biotin was labeled at the 5 'end of primer No. 4, digoxigenin (DIG) was labeled at the 5' end of the primer of SEQ ID NO. 1, and 6-carboxyl was added at the 5 'end of the primer of SEQ ID NO. Fluorescein (6-Carboxyfluorescein) was bound and labeled. Each labeled primer was synthesized using Oligo Synthesis Service of BIONIA (Daejeon Metropolitan City, Korea), prepared by adding sterile distilled water to a final concentration of 100 μM, and stored in a refrigerator until the amplification experiment. As a master mix for PCR amplification, 2X PCR master mix (PM Mix, Inc., Yongin, Gyeonggi-do, Korea) was used.

Gene amplification was performed using the AllInOneCycler ™ PCR system of Bioneer Inc. according to the composition of Table 6 and the reaction conditions of Table 7.

PCR Amplification Composition of Mycobacterium Tuberculosis and Non-tuberculosis Acid Bacteria density Usage per volume (volume) Primer of SEQ ID NO: 1 100 μM 0.1 μL Primer of SEQ ID NO: 2 100 μM 0.1 μL Primer of SEQ ID NO: 3 100 μM 0.1 μL Primer of SEQ ID NO: 4 100 μM 0.1 μL PCR Master Mix 2 × 10 μL DNA template 10 ² to 10 ⁵ copies / μL 1 μL DW (distilled water) - 8.6 μL Total volume - 20 μL

PCR reaction conditions for Mycobacterium tuberculosis denaturalization 95 ° C, 5 minutes 1 cycle denaturalization 95 ℃, 15 seconds 32 cycles Annealing & Extension 55 ° C, 45 seconds extension 72 ° C., 5 minutes 1 cycle

Example 5 Identification of Mycobacterium Tuberculosis and Non-TB Tuberculosis Gene Amplification Products Using Lateral Flow Assay

In the present embodiment, digoxigenin (DIG) is labeled at the 5 'end of the forward primer (SEQ ID NO: 1) to detect Mycobacterium tuberculosis, and the forward primer (SEQ ID NO: 3) Label fluorescein (FITC) at the 5 'end of the forward primer) and biotin at the 5' end of the reverse primer (SEQ ID NOS: 2 and 4) and amplify by the primers PCR amplification products were injected into a lateral flow assay device to display streptavidin-conjugated gold nanoparticles (streptavidin-) on a membrane labeled with an anti-DIG antibody (mycobacterium tuberculosis detection) and an anti-FITC antibody (non-tuberculosis acid bacterium detection), respectively. An example of a kit for simultaneously detecting Mycobacterium tuberculosis and non-tuberculosis antibacterial bacterium reacted with a conjugated gold) is provided.

The device for the lateral flow analysis according to the design as described above was manufactured by requesting to PMDX (Yongin-si, Gyeonggi-do, Korea). Anti-DIG antibody (mycobacterium tuberculosis detection) and anti- for identification of PCR amplification products amplified by primer pairs of SEQ ID NOs: 1 and 2 for detection of Mycobacterium tuberculosis and primer pairs of SEQ ID NOs: 3 and 4 for detection of non-tuberculosis antibacterial bacteria. FITC antibodies (non-tuberculosis antibacterial detection) were immersed in test lines 1 and 2 of the membrane, respectively. A loading pad loaded with PCR amplification products was immersed in streptavidin-bonded gold nanoparticles to prepare a device for lateral flow analysis (FIG. 3). 5 μL of the amplification product obtained in Example 4 was added dropwise to the loading pad of the device prepared as described above, 100 μL of the development buffer was added, and 5 minutes later, the analysis was performed.

Since the loading pad is immersed with gold nanoparticles conjugated with streptavidin capable of specifically binding to biotin, the PCR amplification product labeled with biotin (ie, amplified by reverse primers of SEQ ID NO: 2 or SEQ ID NO: 4). When Mycobacterium tuberculosis target gene amplification product or non-tuberculosis mycobacterial target gene amplification product) is loaded onto the loading pad, the streptavidin-conjugated gold nanoparticles bind to the PCR amplification product labeled by biotin to form a complex.

And the complex is moved by the capillary phenomenon by the development buffer, the amplification product labeled by digoxigenin in the complex (that is, the Mycobacterium tuberculosis target gene amplification product amplified by the forward primer of SEQ ID NO: 1) of the test line 1 In combination with the anti-DIG antibody, gold nanoparticles gather to show a red band in test line 1. This indicates that the target gene of Mycobacterium tuberculosis is present in the gene sample to be amplified, that is, the detection signal of Mycobacterium tuberculosis.

In addition, the complex is further moved by the capillary phenomenon by the development buffer, and the amplification product labeled with fluorescein (ie, the non-TB tuberculosis target amplification product amplified by the forward primer of SEQ ID NO: 3) in the complex It combines with the anti-FITC antibody of test line 2 to collect gold nanoparticles, resulting in a red band in test line 2. This indicates that a target gene of non-TB tuberculosis bacterium exists in the gene sample to be amplified, that is, a detection signal of non-TB tuberculosis.

On the other hand, in the absence of Mycobacterium tuberculosis or nonmycobacterium tuberculosis in the genetic sample to be tested, streptavidin-conjugated gold nanoparticles do not complex with the PCR amplification product and the test line is caused by the capillary phenomenon caused by the development buffer. 1 and 2 are excessive. Because digosgenin or FITC must be present in the gold nanoparticle-complex to collect streptavidin-conjugated gold nanoparticles in test line 1 and / or test line 2, the presence of Mycobacterium tuberculosis or nonmycobacterium tuberculosis In this case, the forward primer of SEQ ID NO: 1 labeled with digosgenin or the forward primer of SEQ ID NO: 3 labeled with FTIC are not used in PCR amplification. In the present embodiment, although omitted for convenience of description, a control line (negative display) is provided at the end of the membrane strip (the end in the buffer development direction) in which streptavidin-bonded gold nanoparticles which do not form a complex with the PCR amplification product are thus provided. Line).

Therefore, when using the detection kit of Mycobacterium tuberculosis and non-tuberculosis acid bacterium using the lateral flow analysis method of one embodiment of the present invention, simply confirming whether or not a red band appears in test lines 1 and 2, It can be analyzed simply and effectively.

On the other hand, in the present embodiment, as a result of lateral flow analysis of the PCR amplification product of Example 4, the target gene amplification of Mycobacterium tuberculosis and non-tuberculosis mycobacteria up to a concentration of 10 ² to 10 ⁵ copies / μL was confirmed in the detection kit (Fig. 4).

Finally, as can be seen in Figure 4, the present invention enables the detection of PCR amplification products for target genes of Mycobacterium tuberculosis and non-tuberculosis acidophilus in a lateral flow analysis device, such as a membrane strip, without the need for expensive molecular diagnostic equipment. Mycobacterium tuberculosis and non-tuberculosis antibacterial bacteria can be efficiently and efficiently detected in one kit.

Accordingly, the present invention provides a rapid and accurate diagnosis of patients or carriers infected with Mycobacterium tuberculosis and / or non-tuberculosis acidophilus, which is transmitted in a space where a large number of people, including hospitals and schools, are living. Can be blocked in advance.

As mentioned above, although this invention was demonstrated to the said Example, this invention is not limited to this. Those skilled in the art can make modifications and changes without departing from the spirit and scope of the present invention, and it will be appreciated that such modifications and changes also belong to the present invention.

<110> YOON, Hyun Kyu <120> Method and kit for detecting Mycobacterium tuberculosis complex          and Nontuberculous mycobacteria using lateral flow assay <130> P18-0056KR <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TB forward primer <400> 1 gagacgatca acggcctata c 21 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TB reverse primer <400> 2 ggccaactcg acatcctc 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> NTM forward primer <400> 3 cagaagcgca agatctccga 20 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> NTM reverse primer <400> 4 cgtgggtgtt cargatgatg tc 22 <210> 5 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> Mycobacterium tuberculosis (nucleotide position, 37418-37498,          CP019613.1) <400> 5 gagacgatca acggcctata caagaccgag ctgatcaaac ccggcaagcc ctggcggtcc 60 atcgaggatg tcgagttggc c 81 <210> 6 <211> 139 <212> DNA <213> Artificial Sequence <220> <223> Mycobacterium avium subsp. avium (nucleotide position, 165-303,          KU861849.1) <400> 6 cagaagcgca agatctccga cggtgacaag ctcgccggcc ggcacggcaa caagggcgtc 60 atcggcaaga tcctgccgca ggaggacatg ccgttcctgc cggacggcac gccggtggac 120 atcatcctga acacccacg 139

Claims (13)

The first tag is labeled at the 5 'end of the first forward primer that specifically binds to the IS6110 gene of Mycobacterium tuberculosis, which is a target gene for the detection of Mycobacterium tuberculosis, and the non-tuberculosis of Mycobacterium tuberculosis, which is the target gene for detection of a second tag at the 5 'end of the second forward primer that specifically binds to the rpoB gene, the 5' end of the first reverse primer that specifically binds to the IS6110 gene of Mycobacterium tuberculosis, which is a target gene for detection of Mycobacterium tuberculosis, and Labeling a third tag at the 5 'end of the second reverse primer that specifically binds to the rpoB gene of the non-tuberculosis mycobacterium, which is a target gene for detection of the non-tuberculosis mycobacterium,
Amplifying a gene sample in a sample by PCR using the pair of the first forward primer and the first reverse primer and the pair of the second forward primer and the second reverse primer;
Loading the PCR amplification product on one side of a lateral flow analysis device to form a complex with a conjugated gold nanoparticle that binds specifically to the third tag;
A second test in which the complex is moved to the other side of the lateral flow analysis device and the complex is located at a distance from the anti-first tag antibody in the first test line of the lateral flow analysis device and the first test line Binding with an anti-second tag antibody in a line,
Determining whether the band formed by the collection of gold nanoparticles of the complex in the first test line and the second test line to detect tuberculosis bacteria and non-tuberculosis acid bacterium in the sample, lateral flow analysis method Method of detecting tuberculosis bacteria and non-tuberculosis acid bacterium used. The method of claim 1,
Wherein the first tag is digoxigenin (DIG) and the second tag is fluorescein (FITC). The method of claim 2,
Wherein said anti-first tag antibody is an anti-DIG antibody and said anti-second tag antibody is an anti-FITC antibody. The method of claim 3,
Wherein said third tag is biotin and said joiner is streptavidin. The method according to any one of claims 1 to 4,
Wherein said first forward primer and said first reverse primer are primers of SEQ ID NO: 1 and primers of SEQ ID NO: 2, respectively. The method of claim 5,
Wherein said second forward primer and said second reverse primer are primers of SEQ ID NO: 3 and primers of SEQ ID NO: 4, respectively. A first forward primer that specifically binds to the IS6110 gene of Mycobacterium tuberculosis, which is a target gene for detection of Mycobacterium tuberculosis, and is labeled with a first tag at its 5 'end;
A second forward primer that specifically binds to the rpoB gene of non-tuberculosis mycobacteria, which is a target gene for detection of non-tuberculosis mycobacteria, and a second tag is labeled at the 5 'end;
A first reverse primer specifically binding to the IS6110 gene of Mycobacterium tuberculosis, which is a target gene for detection of Mycobacterium tuberculosis, and labeled with a third tag at its 5 'end; And
A composition for PCR amplification comprising a second reverse primer specifically bound to the rpoB gene of non-tuberculosis mycobacteria, which is a target gene for detection of non-tuberculosis mycobacteria, and labeled with a third tag at a 5 'end;
A first test line having gold nanoparticles conjugated with a binder that specifically binds to the third tag, and having an anti-first tag antibody that specifically binds to the first tag, and the second Mycobacterium tuberculosis and non-tuberculosis using lateral flow analysis comprising a lateral flow assay device having an anti-second tag antibody that specifically binds a tag and having a second test line positioned at a distance from the first test line Antibacterial Detection Kit. The method of claim 7, wherein
Wherein the first tag is digoxigenin (DIG) and the second tag is fluorescein (FITC). The method of claim 8,
Wherein the anti-first tag antibody is an anti-DIG antibody and the anti-second tag antibody is an anti-FITC antibody. The method of claim 9,
Wherein said third tag is biotin and said joiner is streptavidin. The method according to any one of claims 7 to 10,
The PCR amplification composition further comprises a DNA polymerase, dNTPs and PCR buffer solution, detection kit. The method according to any one of claims 7 to 10,
Wherein said first forward primer and said first reverse primer are primers of SEQ ID NO: 1 and primers of SEQ ID NO: 2, respectively. The method of claim 12,
Wherein said second forward primer and said second reverse primer are primers of SEQ ID NO: 3 and primers of SEQ ID NO: 4, respectively.

Images