KR20190143037A - Gene expression cassette in which transcription and translation is decoupled for production of high quality recombinant proteins in bacteria - Google Patents

Abstract

The present invention relates to a gene expression cassette in which translation is initiated after transcription to produce a high quality recombinant protein in bacteria. More specifically, according to the present invention, the gene expression cassette comprises: a switch reconfiguring a transcription-translation coupling system embedded in bacteria to prevent translation initiation so as to initiate the translation from only an mRNA cast with a perfect length; and a trigger system activating the translation initiation from the corresponding switch. Accordingly, when 5′UTR of a natural system, in which translation and transcription are coupled, is replaced with the switch and a trigger sequence activating the translation initiation from the switch is inserted into the downstream (3′ terminal) of a target recombinant gene, a transcription step and a translation step of bacteria can be decoupled. Moreover, the gene expression cassette can reduce cost burden of a purification process while increasing productivity of a high quality recombinant protein with a perfect length and the produced recombinant protein can be applied to various industries from drugs and an antibody to a raw material of functional cosmetics, detergent, fertilizer, and livestock feed.

Description

Gene expression cassette in which transcription and translation is decoupled for production of high quality recombinant proteins in bacteria}

The present invention relates to a gene expression cassette for enhancing the productivity of a recombinant protein of full length in the process of producing a recombinant protein by culturing a microorganism, and in particular, by reconstructing the transcription and translation system inherent in an organism, It relates to a gene expression cassette that utilizes switches and triggers to control only translation of mRNA of length into a template.

In bacteria, when the translation initiation sequence is naturally exposed during the transcription step, the translation initiation step proceeds at the same time, which is called transcription-translation coupling or cotranscriptional translation. In bacteria, about 4% of intracellular mRNA is present without a stop codon due to premature termination of transcription and cleavage of mRNA.When co-translational translation occurs, translation is initiated from mRNA that is prematurely terminated without transcription. . The translation of the prematurely terminated mRNA into a template results in the production of polypeptides without function and the waste of cellular resources such as amino acids and ATP.

Because of these problems, bacteria have ribosomal repair systems such as tmRNAs that mediate trans-translation and ArfA-Release factor2, which induces ribosome release factors, but only in cells Difficult to solve the problem In addition, overexpression of recombinant proteins results in the accumulation of prematurely terminated mRNAs, making it difficult to resolve mRNAs that do not have stop codons.

On the other hand, both the productivity and the quality of the final product are important for producing recombinant proteins intended for polymers and mostly high functional products. Existing studies for this purpose include removing proteolytic enzymes from production strains, improving cell lines to supply the amino acids contained in the protein of interest, increasing the number of copies of genes, and reengineering promoter engineering and 5'UTR. We are developing technologies to improve transcription and translation efficiency.

In addition, recently, techniques for reconstructing genes with codons optimized for the host and researches to homogenize codon frequency patterns with the origin of genes have been attempted with ribosomal profiling techniques, and functional structures after purification of large expressed proteins are purified. Signal peptides for the functional expression of recombinant proteins have been developed using techniques for refolding and high screening methods.

However, the technologies developed to date are mainly aimed at increasing the yield of protein, expressing the functional structure, and purifying the expressed protein. The process of removing impurities is necessary, and there is a problem incurred due to the cost of the purification process.

Therefore, there is a need to develop a system capable of producing high productivity and high quality recombinant protein while reducing the burden of the purification process without damage.

Republic of Korea Patent Registration No. 10-2013-0010873 (published date: 2013.01.29.), Relates to a recombinant plasmid for gene expression that operates on light, transformants and methods for controlling gene expression using the same, Light-switch genes whose gene expression is regulated upon exposure of light to a microorganism transformed with a recombinant plasmid comprising two transcriptional repressor binding sites, ribosomal binding sites, and a fusion gene of the gene of interest under the control of a promoter It is described about the expression system.

In the present invention, a gene is composed of a switch that prevents translation initiation so that translation is initiated only from a full-length mRNA template by reconstructing the transcription-translation tuning system inherent in bacteria and a trigger system that can activate translation initiation from the switch It is intended to provide an inventive cassette. In addition, the present invention seeks to provide a technique that increases the productivity of high-quality, full-length recombinant protein, while reducing the cost of purification.

In a first aspect, the present invention provides a transcriptional stem loop structure with mRNA, wherein in the DNA molecule in which the ribosomal binding site is located in the stem loop structure, a partial sequence is used to form the stem loop structure. A DNA sequence encoding an RNA sequence designed to participate (a); The DNA sequence encoding the RNA sequence complementary to the RNA sequence designed to participate in the formation of the stem loop structure, the partial sequence (b) located after the stop codon; Provides a DNA molecule comprising a do.

In the first aspect of the present invention, the DNA molecule preferably includes a multiple cloning site after the ribosomal binding site and before the DNA sequence (b).

The present invention provides, in a second aspect, a vector comprising the DNA molecule of the first form.

According to a third aspect of the present invention, there is provided a mRNA, in which a stem loop structure is formed and ribosomal binding sites are located in the stem loop structure, wherein an RNA sequence (a) in which a partial sequence participates in the stem loop structure; Comprising a complementary sequence capable of binding to the RNA sequence (a), RNA sequence located after the stop codon (b); provides an mRNA comprising a.

In the third aspect of the present invention, preferably, when the RNA sequence (b) binds to the RNA sequence (a), the stem loop structure is released and translation starts. At this time, the translation initiation is preferably initiated by binding the ribosome to the ribosome binding site.

According to the present invention, the transcriptional and translational phases were unsynchronized by introducing so-called switch and trigger sequences into the mRNA. This allowed translation to be initiated only when transcription proceeded to the targeted 3 'end, thereby producing a full length, high quality recombinant protein.

On the other hand, when using the present invention, the produced recombinant protein can be applied to a variety of industries, ranging from pharmaceuticals and antibodies to raw materials of functional cosmetics, detergents, fertilizers, animal feed.

Figure 1 a) is a schematic diagram of the mechanism of operation of the ProQC gene expression cassette in which the trigger sequence for initiating translation from the switch is located in the same mRNA, b) mRNA having a switch and the trigger sequence It is a schematic diagram showing whether or not ribosomal binding to RBS (Ribosome binding site) of mRNA that does not have a switch and a trigger (Trigger) sequence.
Figure 2 is a schematic of the txtl-Cis-sfGFP gene expression cassette in which the trigger sequence initiating translation from the switch is located in the same mRNA as the switch and in a plasmid separate from the switch where the trigger expresses the target gene. It is a schematic diagram of a natural gene expression cassette (txtl-Trans-sfGFP).
3 is a graph comparing the reporter protein sfGFP expressed in the ProQC gene expression cassette and the natural gene expression cassette and normalizing unit fluorescence in each system to the expression value of the natural gene expression cassette. (Unit fluorescence of ProNC-sfGFP = 1)
4 is a genetic circuit diagram for observing the degree of intramolecular and intermolecular interactions of the switch and trigger sequences of mRNA transcribed in the ProQC gene expression cassette.
Figure 5 is a graph showing the ratio of the unit fluorescence of ProIntra cells using the sfGFP protein as an index for initiation of translation by intracellular mRNA interaction.
Figure 6 is a mCherry_lacZ_gfp (MLG) fusion protein production method and ProQC-MLG plasmid, ProNC-MLG gene circuit diagram expressing MLG protein.
Figure 7 a) is a graph showing the amino terminal and carboxy terminal amount of the MLG fusion protein of each of the ProQC-MLG strain and ProNC-MLG strain, mCherry, sfGFP fluorescence divided by the absorbance of 600nm wavelength, to calculate the fluorescence per cell, Fluorescence per cell was converted to the amount of each fluorescent protein and normalized to the amount of mCherry. b) normalized the expression level of ProNC-MLG to 1 for the full-length protein (based on the sfGFP at the carboxy terminus) to confirm the fusion protein productivity of unit cells in ProQC-MLG and ProNC-MLG. This is a graph compared.
8 shows SDS-PAGE results of proteins expressed from ProQC-MLG strains and ProNC-MLG (control) strains. Full-length shows the fusion protein purified using a carboxy-terminated histidine tag as a full-length marker.

The present invention provides gene expression cassettes that release transcription-translational synchronization of bacteria and allow translation to be initiated only on mRNA strands where transcription is complete. In other words, the present invention is a nucleic acid sequence that prevents translation initiation so that translation is not started in the mRNA template transferred to an incomplete length (so-called 'Switch' in the present invention) and the full length is transferred to the switch Provided is a gene expression cassette comprising a nucleic acid sequence capable of binding to activate the translation initiation (so-called 'Trigger' in the present invention). More specifically, when the transcription is completely terminated so that the trigger nucleic acid sequence at the 3 'end of the mRNA is exposed on the mRNA and binds complementarily with the switch sequence at the 5'UTR of the mRNA, the switch sequence is involved. This is to unpack the stem loop structure and start the translation. Such a transcriptional translation desynchronization system of the present invention enables the production of high quality recombinant proteins of full length in bacteria.

A schematic diagram of the gene expression cassette of the present invention is shown in FIG. 1. The mRNA molecule transcribed from the DNA on the bacteria has a sequence capable of binding ribosomes, that is, a ribosomal binding site (RBS). When ribosomes are bound to this ribosomal binding site, translation can be initiated. However, in the present invention, the time point at which the translation is started is intended to be controlled through the so-called 'switch-trigger system' of the present invention.

Referring specifically to the schematic diagram of Figure 1, the so-called switch sequence of the present invention (RNA sequence (a) in the present invention) and the trigger (Trigger) sequence (RNA sequence (b) of the present invention) are present on the same mRNA strand.

A switch sequence (referred to herein as an 'RNA sequence (a)') refers to a sequence in which some of the sequences participate in the formation of a stem loop structure comprising RBS. If part of the sequence is involved in the formation of the stem loop structure comprising the RBS, it is not particularly limited to its length.

The trigger sequence (referred to herein as' RNA sequence (b) ') is located at the 3' end of the same mRNA as the switch sequence is present, preferably after the stop codon. The trigger sequence consists of a sequence capable of complementarily binding to the switch sequence.

Translation is not initiated when the stem loop structure is formed. In the case of mRNA whose transcription has been completely terminated, the trigger sequence is exposed on the mRNA, and the exposed trigger sequence binds to the complementary sequence switch sequence to release the stem loop structure. The translation is started. That is, the trigger sequence for initiating translation from the switch is located at the 3 'end of the same mRNA as the switch sequence is located, as shown in a) of Figure 1, the trigger sequence at the mRNA 3' end is Exposure to mRNA through a complete transcription process pairs with a switch sequence located on the 5'UTR to provide complementary binding and signal to turn on translation.

When the ribosome binds to the ribosomal binding site in a state in which the switch-trigger sequence complementarily binds and the stem loop structure is released, the translation starts normally and is translated by a stop codon located before the trigger sequence. When this is terminated, it is possible to produce a complete protein from a complete mRNA template that has not lost its 3 'end.

When using the gene expression cassette of the present invention, as shown in b) of Figure 1, the ribosome binding site of the mRNA that does not have a switch-trigger system (ribosome cannot bind to the ribosome binding site, whereas translation can not be initiated , It can be confirmed that the ribosome is bound only to the mRNA ribosomal binding site of the present invention having a switch-trigger system to initiate translation.

On the other hand, the switch sequence in the present invention, it is preferred that 'part' of the sequence participates in the formation of the stem loop structure. If all of the switch sequences participate in forming the stem loop structure, even if the trigger sequence binds complementarily to the switch sequence, the binding force participating in the stem loop structure formation and the trigger sequence are mutually different. It is because it becomes the same and it is not easy to eliminate stem loop structure formation.

On the other hand, the present invention can form a transcription system loop (stem loop) structure with mRNA, in the DNA molecule ribosomal binding site is located in the stem loop structure, a partial sequence may participate in the formation of the stem loop structure A DNA sequence encoding an RNA sequence designed to be (a); And a DNA sequence encoding the RNA sequence complementary to the RNA sequence designed to participate in forming the stem loop structure, wherein the partial sequence is located after the stop codon (b). Provided are vectors comprising DNA molecules.

The present invention in the form of the DNA molecule is implemented on the DNA switch-trigger (Trigger) system at the mRNA level, the DNA of the present invention will serve as a gene expression cassette system to ensure high efficiency expression of the target protein, The vector comprising the DNA molecule of the present invention will serve to transport this expression system. Bacteria transformed with the vector of the present invention can produce the target protein in an intact form as described in the present invention, it is possible to produce a recombinant target protein with high efficiency.

On the other hand, in the present invention, it is possible to configure a variety of promoters and terminators required for the start and end of expression, it is possible to adjust the amount of the target protein according to the intensity of the promoter.

On the other hand, in the present invention, after the ribosome binding site, before the DNA sequence (b) (so-called 'Trigger' sequence), it includes a multiple cloning site (mutiple cloning site), the multiple cloning site genes encoding various target proteins Can be inserted.

Hereinafter, the content of the present invention will be described in more detail through the following examples. However, the scope of the present invention is not limited only to the following examples, but includes modifications of equivalent technical ideas.

Example 1: Transcription-translation asynchronous gene expression cassette construction

The T7 promoter, a strong promoter widely used in recombinant protein production, was used to construct synthetic gene expression cassettes (ProQC gene expression cassettes) that only initiate translation in the mRNA strand where transcription was completed in bacteria. In the example, all the Mach-T1 ^R strains were used to perform the cloning.

First, the Chloramphenicol resistance gene (Cam ^R ) using the pACYC_Duet plasmid as a template and the EcoNI-PT7-NheI-TT7-F / SpeI-pACYC-R primer set in Table 2 to remove unnecessary restriction enzyme sites from the vector Amplifying a vector section including the. The pACYC_Duet plasmid was cloned using EcoNI and NheI and the amplified PCR using EcoNI and SpeI restriction enzymes, respectively, to remove the NheI restriction enzyme sequence of the existing plasmid and to clone the gene expression cassette between the T7 promoter and T7 terminator sequences. PACYC * with site inserted was produced.

Existing translation initiation switch and trigger systems transfer trigger sequences from plasmids with high copy numbers or relatively strong promoters to facilitate translation initiation when triggers are present. . However, in the present embodiment, after the presence of one trigger molecule per switch for translation initiation at the same ratio, in order to verify whether translation initiation occurs smoothly even in a condition where there are not many trigger molecules, FIG. As described above, a genetic circuit was prepared using green fluorescent protein (sfGFP) as a reporter.

Next, sfGFP was first amplified using the PBR322-J23100-sfGFP plasmid as a template using the Swit-sfGFP-F1 / SpeI-SacI-sfGFP-R primer set of Table 2, followed by BsaI-Swit-sfGFP-F2 / BsaI- Amplified with Trig-R2 primer set, the toehold switch was attached to the 5 'end of the sfGFP and the Trigger sequence was attached to the 3' end. The pACYC * vector was cut with BsaI and NheI restriction enzymes, and then the amplification product was cloned using the BsaI restriction enzyme sequence to clone the txtl-Cis-sfGFP plasmid and the txtl-Trans-sfGFP plasmid by cloning using the BsaI and SpeI restriction enzyme sequences. Each was produced. In addition, a plasmid was prepared to transcribe a trigger for gene expression of the txtl-Trans-sfGFP plasmid.

The pCDF-Term plasmid was constructed by cloning the sequence from the T7 promoter to the T7 terminator of pACYC * to the pCDF_Duet vector using EcoNI and Bsu36I restriction enzyme sequences, and the BsaI-Trigger # 3-F / BsaI- Trig-R2 in Table 2. The trigger sequence amplified using the primer set was cut with a BsaI restriction enzyme and cloned into a pCDF-Term vector cut with BsaI and NheI restriction enzymes to prepare a pCDF-Trigger plasmid.

The pCDF-Trigger plasmid has a higher copy number than the pACYC_Duet plasmid, which is about 40 copies per cell, about 12-15 copies per cell, and thus is continuously supplied and translated from a natural gene expression cassette independent of transcription termination of sfGFP. Is initiated.

Experimental Example 1: Confirmation of ProQC Gene Expression Cassette Efficiency

In order to compare the translation initiation efficiency from the constructed ProQC gene expression cassette, a txtl-Cis-sfGFP plasmid and pCDF-Term plasmid pair, txtl-, were used in Escherichia coli BL21 (DE3), which is widely used for recombinant protein production. The pairs were transformed with Trans-sfGFP plasmid and pCDF-Trigger plasmid, respectively.

In order to maintain the plasmid, Spectinomycine (Spec, 50 ug / mL) and chloramphenicol (Chloramphenicol, Cam, 34 ug / mL) antibiotics were selected on a plate to which the colonies were formed. After inoculating in Lysogeny broth medium and growing overnight, the absorbance was measured using a UV-1700 Spectrophotometer.

The initial absorbance (OD ₆₀₀ ; opticaldensityat ₆₀₀ nm) was diluted to 0.05 and incubated until reaching OD ₆₀₀ = 0.8, followed by induction with 0.2 mM IPTG. ) And fluorescence was measured with a filter of 486 nm / 535 nm wavelength using Hydex. The experiment of measuring the fluorescence was performed three times and the value measured in the multiplate reader was converted to fluorescence per cell by dividing by the OD ₆₀₀ of each sample.

As a result, as shown in Fig. 3, when the fluorescence of the natural gene expression system is set to 1, the relative initiation efficiency in the ProQC gene expression cassette (ProQC-sfGFP) is almost the same as that of the natural gene expression system (ProNC-sfGFP). Similarly appeared.

Experimental Example 2: Genetic circuit for measuring intramolecular and intermolecular interaction of switch and trigger sequence of mRNA and measurement of intramolecular and intramolecular interaction]

There are various molecules inside the cell, especially when many mRNAs are transcribed from the T7 promoter, which has a strong intensity, triggered by intermolecular interactions by triggers at the 3 'end of other mRNAs. Translation can also be initiated from the switch.

By controlling the translation to be initiated by a 3 'end trigger that is exposed at the end of transcription, a system that allows translation to be initiated from an intact full-length mRNA is more identical than the interaction between mRNA molecules. Intramolecular interactions should prevail.

Therefore, in order to verify this, different reporter proteins were introduced into the same switch, but a trigger was added to the mRNA of one reporter protein.

The existing mCherry sequence was intended to remove the translation initiation sequence in order to be completely controlled by the switch because an unintended translation initiation sequence exists at the amino terminus, and the BsaI-Trc-mcherry shown in Table 2 using the pET28a-mCherry plasmid as a template. Amplify the mCherry gene except for the N-terminal 8 amino acid sequence using the -F / SpeI-mCherry-R primer set and then use pACYC * using BsaI and SpeI (vectors use BsaI and NheI restriction enzymes) restriction enzyme sequences. After insertion into the vector, cloned the sequence from the T7 promoter to the T7 terminator into the pCDF_Duet vector using EcoNI and Bsu36I restriction enzyme sequences to create a gene circuit that allows transcription of the controlled but not triggered mRNA to be transcribed. (FIG. 4).

Next, after transforming BL21 (DE3) with txtl-Cis-sfGFP and pCDF-txtl-Trans-mCherry plasmids, GFP and mCherry fluorescence were measured.

As a result, as shown in FIG. 5, the interaction between mRNA molecules caused the 3 'terminal trigger sequence of txtl-Cis-sfGFP to initiate translation from the switch of pCDF-txtl-Trans-mCherry, at 6.3%. The incidence of translation initiation from the switch by intramolecular interaction was 93.7%. In other words, even if the same switch is on different mRNA strands, the translation initiation efficiency by intramolecular interaction, which has a trigger on the same mRNA strand, was superior.

Experimental Example 3: Comparison of Protein Quality Produced from ProQC Gene Expression Cassette

Since the long mRNA encoding the long protein has a high risk of being damaged during transcription, it was intended to confirm whether the productivity of the long protein is improved when the ProQC gene expression cassette prepared in Example 1 is used.

To prepare 4581 bp long mCherry, lacZ, sfGFP (MLG) fusion proteins as a model system, we first set the BsaI-Trc-mcherry-F / KpnI-Lnk-MR / Lnk-MR primer set using pET28a plasmid as a template. Amplification product BL21 (DE3) with a linker attached and a starter codon and a stop codon using a KpnI-lacZ-F / BsaI-lacZ-R primer set as a template Prepared sfGFP gene amplification product having a linker attached to the amino terminus using BsaI-Lnk-sfGFP-F / SpeI-sfGFP-R primer set as a template with the removed lacZ gene amplification product, pBR322-J23100-sfGFP plasmid It was. Each of the three amplification products was cut by mCherry with BsaI and KpnI restriction enzymes, lacZ with KpnI and BsaI restriction enzymes, sfGFP with BsaI and SpeI restriction enzymes, purified and ligated in one tube, and finally BsaI-Trc- After amplification with mcherry-F / SpeI-sfGFP-R primer set, three genes were sequentially linked to amplified strands, and TA cloning was performed.

After amplifying MLG using the BsaI-his-MF / SpeI-SacI-sfGFP-R primer set as the template with the pMD19-MLG plasmid, the BsaI-Swit # 3-R / SpeI- template was used as the txtl-Cis-sfGFP plasmid. Amplify the vector sequence using the Trig-F primer set and clone it using the BsaI and SpeI restriction enzyme sequences to clone the txtl-Cis-MLG_NH plasmid and clone it using the BsaI and NheI restriction enzyme sequences to txtl-Trans-MLG_NH plasmid Were produced respectively (FIG. 6).

The mCherry, lacZ, and sfGFP (MLG) fusion proteins produced through the above process have mCherry fluorescent protein at the amino terminus (5 'terminus) and sfGFP fluorescent protein at the carboxy terminus (3' terminus). By measuring the ratio of sfGFP fluorescence, one could see if both ends of the long protein produced intracellularly were lost.

Next, the unit fluorescence was calculated to convert the two types of fluorescence emitted from the cell into the number of molecules. For this, in the case of the sfGFP gene, the txtl-Trans-sfGFP plasmid was used as a template. Txtl-Trans-sfGFP_CH plasmid was prepared by attaching 6 repeated histidine tags (6XHis) to the carboxy terminus of sfGFP and cloning it to the pACYC * vector using EcoNI and SacI restriction enzyme sequences. In the case of the mCherry gene, pCDF-txtl-Trans-mCherry plasmid as a template was amplified with Duet-F / His-MR primer set of Table 2, and the histidine tag (6XHis) was attached to the carboxy terminus of mCherry, followed by EcoNI and SacI restriction enzymes. The txtl-Trans-mCherry_CH plasmid was constructed by cloning into the pACYC * vector using the sequence.

In addition, Unit-sfGFP, txtl-Trans-mCherry-CH plasmid and pCDF-Trigger transformed with a txtl-Trans-sfGFP plasmid and a pCDF-Trigger plasmid pair to BL21 (DE3) to calculate the fluorescence per mass of fluorescent protein. Unit-mCherry was constructed in which plasmid pairs were transformed into BL21 (DE3). Unit-sfGFP and Unit-mCherry were expressed in 4 hours after fluorescence protein expression as described in Experiment 1 to harvest the cells. Ni-NTA purification, a protein purification method using histidine tags, was performed from the harvested cells to purify sfGFP and mCherry, respectively, to derive a correlation between protein amount and fluorescence intensity. At this time, the protein amount was measured by the Bradford assay and the fluorescence was measured by the fluorescence of the purified sample diluted with PBS buffer at various ratios to establish the formula for the protein amount and fluorescence intensity of each of sfGFP and mCherry. . (Formulate formula for fluorescence intensity per gram protein when measured by Hydex)

Next, in order to prevent the lacZ possessed by BL21 (DE3) from being purified or bound like MLG fusion protein, we tried to remove the lacZ gene from chromosome. Genetic recombination methods were used.

To this end, FRT-Kan-FRT amplification was performed using pFRT72 plasmid as a template using lacZ-Del-F1 / lacZ-Del-R1 / lacZ-Del-F2 / lacZ-Del-R2 primer set shown in Table 2. The template plasmid was removed. The amplification product was subjected to PCR purification and ethanol concentration to transform the BL21 (DE3) / pKD46 strain expressing the recombinant enzyme. In addition, after confirming that the FRT-Kan-FRT sequence was inserted in place of the lacZ gene, colony PCR was performed using a set of lacZ-check-F / lacZ-check-R primers, and then transformed into a pCP20 plasmid. By expressing the Kanamycin resistance gene (Kan ^R ) was removed to produce a BL21 (DE3) ΔlacZ strain.

ProCh-MLG strain was prepared by transforming the txtl-Cis-MLG / pCDF-Term plasmid pair into BL21 (DE3) ΔlacZ and transforming the ProQC-MLG strain and the txtl-Trans-MLG / pCDF-Trigger plasmid pair. It was.

The ProQC-MLG, ProNC-MLG strain Spec, Cam antibiotics overnight in LB (Lysogeny broth) medium containing cultured after the induction with 0.2 mM IPTG when diluted to OD ₆₀₀ = 0.05 has reached the OD ₆₀₀ = 0.8 recombinant The protein was allowed to be expressed. After 4 hours, the sfGFP and mCherry fluorescence of the cells were measured, divided into unit fluorescence, converted into the amino and carboxy terminal amounts of the MLG fusion protein in the cell, and then normalized to the mCherry amount in each system. As in a), it was confirmed that the ratio of the full-length protein from the ProQC gene expression cassette to the carboxy terminus (sfGFP) was much higher than that of the natural gene expression cassette.

In addition, in order to confirm the fusion protein productivity of unit cells in ProQC-MLG and ProNC-MLG, the expression level of the full-length protein including the carboxy terminus (sfGFP) was confirmed. As shown in b) of FIG. When the expression level of -MLG was normalized to 1, the amount of full-length MLG fusion protein in individual cells was also 1.7 times higher than that of ProNC-MLG when ProQC gene expression cassette was applied.

Next, in order to confirm the distribution of the length of the MLG fusion protein produced in the actual cell, MLG fusion protein expressed from each strain of ProQC-MLG and ProNC-MLG was used for the amino terminal 6X histidine tag through the Ni-NTA method. Purification by The amino terminal tag can be used to recover the peptide synthesized in the expression cassette without distinction. At this time, peptides which are not terminated early or due to degradation of mRNA are not purified until the termination codon is purified. As a control group of the experimental group, the txtl-Cis-MLF_CH plasmid was transformed into BL21 (DE3) ΔlacZ, purified with histidine tag at the carboxy terminus, and the MLG fusion protein was fully purified to the terminus. Indicated as.

Proteins purified from ProQC and ProNC for differentiation on SDS-PAGE gels were measured in concentrations by a Bradford assay and injected with the same amount of protein in one compartment. As a result of SDS-PAGE of the protein, as shown in FIG. 8, the protein purified from ProQC has a relatively full length and a shorter amount of protein compared to the protein purified from ProNC. Compared with, it is clearly distinguished.

On the other hand, the sequences, strains, plasmids and primer sequences used in the above Examples and Experimental Examples are described in Tables 1 to 3 below.

Strains and Plasmids Used Strain name Related Features source Mach-T1 ^R E. coli F- 80 (lacZ) ΔM15 ΔlacX74 hsdR (rK-mK +) ΔrecA1398 endA1 tonA Invitrogen BL21 (DE3) E. coli str. B F-ompT gal dcm lon hsdSB (rB-mB-) λ (DE3
[lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB +] K-12 (λS) Preceding Research BL21 (DE3) △ lacZ BL21 (DE3) △ lacZ Invention BL21 (DE3) -NC BL21 (DE3) / pACYC_Duet / pCDF-Term Invention ProQC-sfGFP BL21 (DE3) / txtl-Cis-sfGFP / pCDF-Term Invention ProNC-sfGFP BL21 (DE3) / txtl-Trans-sfGFP / pCDF-Trigger Invention ProIntra BL21 (DE3) / txtl-Cis-sfGFP / pCDF-txtl-Trans-mCherry Invention Unit-sfGFP BL21 (DE3) / txtl-Trans-sfGFP_NH / pCDF-Trigger Invention Unit-mCherry BL21 (DE3) / txtl-Trans-mCherry_NH / pCDF-Trigger Invention BL21 (DE3) △ lacZ-NC BL21 (DE3) △ lacZ / pACYC_Duet / pCDF-Term Invention ProQC-MLG BL21 (DE3) △ lacZ / txtl-Cis-MLG_NH / pCDF-Term Invention ProNC-MLG BL21 (DE3) △ lacZ / txtl-Trans-MLG_NH / pCDF-Trigger Invention Plasmid Name Related Features source pACYC_Duet Expression vector, Cm ^R , p15A _ori Novagen pACYC * pACYC_Duet △ NheI / P _T7 -BsaI-NheI-T _T7 Invention pCDF_Duet Expression vector, Sm ^R , cloDF13 _ori Novagen pBR322-J23100-sfGFP pBR322 / BBaJ23100-UTR-sfGFP Preceding Research pET28a-mCherry pET28a-BBaJ23100-UTR-mCherry Preceding Research pMD19 TA cloning vector TaKaRa txtl-Cis-sfGFP pACYC * / P _T7 -Switch # 3-sfGFP-Trigger-T _T7 Invention txtl-Trans-sfGFP pACYC * / P _T7 -Switch # 3-sfGFP-T _T7 Invention pCDF-Term pCDF_Duet / P _T7 -BsaI-NheI-T _T7 Invention pCDF-Trigger pCDF_Duet / P _T7 -Trigger-T _T7 Invention pCDF-txtl-Trans-mCherry pCDF_Duet / P _T7 -Switch # 3-mCherry ^Trc -T _T7 Invention txtl-Trans-sfGFP_CH pACYC * / P _T7 -Switch # 3-sfGFP_6XHis-T _T7 Invention txtl-Trans-mCherry_CH pACYC * / P _T7 -Switch # 3-mCherry ^Trc _6XHis-T _T7 Invention pMD19-MLG pMD19 / P _T7 -Switch # 3-mCherry ^Trc _lacZ_sfGFP-Trigger-T _T7 Invention txtl-Cis-MLG_NH pACYC * / P _T7 -Switch # 3-6XHis_mCherry ^Trc _lacZ_sfGFP-Trigger-T _T7 Invention txtl-Trans-MLG_NH pACYC * / P _T7 -Switch # 3-6XHis_MLG-T _T7 Invention txtl-Cis-MLG_CH pACYC * / P _T7 -Switch # 3-MLG_6XHis-Trigger-T _T7 Invention txtl-Trans-MLG_CH pACYC * / P _T7 -Switch # 3-MLG_6XHis-T _T7 Invention pKD46 Red recombinase expression vector, Amp ^R Preceding Research pFRT72 pGEM-FRT-Kan-FRT variant Preceding Research pCP20 FLP recombinase expression vecotor, Amp ^R , Cm ^R Preceding Research

Primer sequence used Primer Name order EcoNI-PT7-NheI-TT7-F ACTCCTGCATTAGGAAATTAATACGACTCACTATAggagaccCGCAGCGcTAGCATAACCC
CTTGGGGC SpeI-pACYC-R ACCACTAGTGCTGATGTCCGGCG BsaI-Swit-sfGFP-F2 cccGGTCTCCTATAGGGATCTATTACTACTTACCATTGTCTTGCTCTATacagaaacagag
gagatATAGAatgAGACAATGGAACCTGGCGGCAGCGCAAAAG Swit-sfGFP-F1 AGGAGATATAGAATGAGACAATGGAACCTGGCGGCAGCGCAAAAGGCTAGCAAGGGCGAGG
AGC SpeI-SacI-sfGFP-R GGGACATCGGAATGTCCCATCAGACTAGTCAATACGATTACTTTCTGTGAGCTCACTTGTA
CAGCTCGTCCATGC BsaI-Trig-R2 TATggtctctCTAgCTTATCTATTACTACTTACCATTGTCTTGCTCTTATTGATGGGACAT
CGGAATGTCCCATC BsaI-Trigger # 3-F cccGGTCTCCTATAGGGTGATGGGACATTCCGATGTCC BsaI-Trc-mcherry-F ACAGGTCTCTCTAGCGCTATCATTAAAGAGTTCATGCG SpeI-mCherry-R CAGACTAGTCAATACGATTACTTTCTGTGAGCTCATTTGTACAGCTCATCCATGC Duet-F CGGGATCTCGACGCTCTCC His-G-R TGTACTAGTGAGCTCATTA GTGATGGTGATGGTGATG CTTGTACAGCTCGTCCATGCCGAG His-M-R TGTACTAGTGAGCTCATTA GTGATGGTGATGGTGATG TTTGTACAGCTCATCCATG lacZ-Del-F1 GCCGTTCGACGATTCTCCATATGGGAGTACTCGCGGTTGACTGAG lacZ-Del-R1 CTAGCAAGAATCATATGGAGAGCGAGTGCTGGAGCGAACTGCGAAG lacZ-Del-F2 GCAGACATGGCCTGCCCGGTTATTATTATTTTTGACACCAGAGCCGTTCGACGATTCTCCA
TATG lacZ-Del-R2 GGCTCGTATGTTGTGTGAAATTGTGAGCGGATAACAATTTCACACACTAGCAAGAATCATA
TGGAGAGCG lacZ-check-F TCACTTTTGCTGATATGGTTGATGTC lacZ-check-R CGACTGGAAAGCGGGCAGTGAG KpnI-Lnk-M-R ACGGTCTCCATGGTACCAGCACTACCAGCAC Lnk-m-r CTTGCTAGCACCAGCACTACCAGCACTACCAGCACTATCTTTGTACAGCTCATCCATG KpnI-lacZ-F AGTGGTCTCACCATGATTACGGATTCACTG BsaI-lacZ-R ACCGGTCTCTGAATCTTTTTGACACCAGACCAAC BsaI-Lnk-sfGFP-F AGCGGTCTCGATTCAGCAGGCTCAGCAGGCTCAGCAGGCGCTAGCAAGGGCGAGG SpeI-sfGFP-R CAGACTAGTCAATACGATTACTTTCTGTGAGCTC BsaI-Swit # 3-R ATTGGTCTCTCTAGCCTTTTGCGCTGCCGCCAGG SpeI-Trig-F TGACTAGTCTGATGGGACATTCCGATGTCCCATCAATAAGAGCAAGACAATGGTAAGTAG BsaI-his-M-F AAGGGTCTCACTAGCCATCACCATCACCATCACGCTATCATTAAAGAGTTCATGCG

Toehold switch and gene sequence used Toehold switch Remarks switch # 3 (DNA sequence) SEQ ID NO: 1 switch # 3 (RNA sequence) SEQ ID NO: 2 Trigger # 3 (DNA sequence) SEQ ID NO: 3 Trigger # 3 (RNA sequence) SEQ ID NO: 4 gene Remarks mCherry ^Trc SEQ ID NO: 5 sfGFP SEQ ID NO: 6 mcherry_lacZ_sfGFP SEQ ID NO: 7

<110> Seoul National University R & DB Foundation <120> Gene expression cassette in which transcription and translation          is decoupled for production of high quality recombinant proteins          in bacteria <130> YP-18-112 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> switch # 3 DNA <400> 1 gggatctatt actacttacc attgtcttgc tctatacaga aacagaggag atatagaatg 60 agacaatgga acctggcggc agcgcaaaag 90 <210> 2 <211> 90 <212> RNA <213> Artificial Sequence <220> <223> switch # 3 RNA <400> 2 gggaucuauu acuacuuacc auugucuugc ucuauacaga aacagaggag auauagaaug 60 agacaaugga accuggcggc agcgcaaaag 90 <210> 3 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> trigger # 3 DNA <400> 3 tgatgggaca ttccgatgtc ccatcaataa gagcaagaca atggtaagta gtaatagata 60 ag 62 <210> 4 <211> 62 <212> RNA <213> Artificial Sequence <220> Trigger # 3 RNA <400> 4 ugaugggaca uuccgauguc ccaucaauaa gagcaagaca augguaagua guaauagaua 60 ag 62 <210> 5 <211> 690 <212> DNA <213> sea anemone <400> 5 atggctagcg ctatcattaa agagttcatg cgcttcaaag ttcacatgga gggttctgtt 60 aacggtcacg agttcgagat cgaaggcgaa ggtgagggcc gtccgtatga aggcacccag 120 accgccaaac tgaaagtgac taaaggcggc ccgctgcctt ttgcgtggga catcctgagc 180 ccgcaattta tgtacggttc taaagcttat gttaaacacc cagcggatat cccggactat 240 ctgaagctgt cttttccgga aggtttcaag tgggaacgcg taatgaattt tgaagatggt 300 ggtgtcgtga ccgtcactca ggactcctcc ctgcaggatg gcgagttcat ctataaagtt 360 aaactgcgtg gtactaattt tccatctgat ggcccggtga tgcagaagaa gacgatgggt 420 tgggaggcgt ctagcgaacg catgtacccg gaagatggtg cgctgaaagg cgaaattaaa 480 cagcgcctga aactgaaaga tggcggccat tatgacgctg aagtgaaaac cacgtacaaa 540 gccaagaaac ctgtgcagct gcctggcgcg tacaatgtga atattaaact ggacatcacc 600 tctcataatg aagattatac gatcgtagag caatatgagc gcgcggaggg tcgtcattct 660 accggtggca tggatgagct gtacaaatga 690 <210> 6 <211> 720 <212> DNA <213> Aequorea victoria <400> 6 atggctagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg cgcggcgagg gcgagggcga tgccaccaac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcagc 300 ttcaaggacg acggcaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaacttcaa cagccacaac gtctatatca ccgccgacaa gcagaagaac 480 ggcatcaagg ccaacttcaa gatccgccac aacgtggagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgt gctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtga 720                                                                          720 <210> 7 <211> 4527 <212> DNA <213> Escherichia coli <400> 7 atggctatca ttaaagagtt catgcgcttc aaagttcaca tggagggttc tgttaacggt 60 cacgagttcg agatcgaagg cgaaggtgag ggccgtccgt atgaaggcac ccagaccgcc 120 aaactgaaag tgactaaagg cggcccgctg ccttttgcgt gggacatcct gagcccgcaa 180 tttatgtacg gttctaaagc ttatgttaaa cacccagcgg atatcccgga ctatctgaag 240 ctgtcttttc cggaaggttt caagtgggaa cgcgtaatga attttgaaga tggtggtgtc 300 gtgaccgtca ctcaggactc ctccctgcag gatggcgagt tcatctataa agttaaactg 360 cgtggtacta attttccatc tgatggcccg gtgatgcaga agaagacgat gggttgggag 420 gcgtctagcg aacgcatgta cccggaagat ggtgcgctga aaggcgaaat taaacagcgc 480 ctgaaactga aagatggcgg ccattatgac gctgaagtga aaaccacgta caaagccaag 540 aaacctgtgc agctgcctgg cgcgtacaat gtgaatatta aactggacat cacctctcat 600 aatgaagatt atacgatcgt agagcaatat gagcgcgcgg agggtcgtca ttctaccggt 660 ggcatggatg agctgtacaa agatagtgct ggtagtgctg gtagtgctgg taccatgatt 720 tcggattcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa 780 cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga agaggcccgc 840 accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatggcgctt tgcctggttt 900 ccggcaccag aagcggtgcc ggaaagctgg ctggagtgcg atcttcctga ggccgatact 960 gtcgtcgtcc cctcaaactg gcagatgcac ggttacgatg cgcccatcta caccaacgtg 1020 acctatccca ttacggtcaa tccgccgttt gttcccacgg agaatccgac gggttgttac 1080 tcgctcacat ttaatgttga tgaaagctgg ctacaggaag gccagacgcg aattattttt 1140 gatggcgtta actcggcgtt tcatctgtgg tgcaacgggc gctgggtcgg ttacggccag 1200 gacagtcgtt tgccgtctga atttgacctg agcgcatttt tacgcgccgg agaaaaccgc 1260 ctcgcggtga tggtgctgcg ctggagtgac ggcagttatc tggaagatca ggatatgtgg 1320 cggatgagcg gcattttccg tgacgtctcg ttgctgcata aaccgactac acaaatcagc 1380 gatttccatg ttgccactcg ctttaatgat gatttcagcc gcgctgtact ggaggctgaa 1440 gttcagatgt gcggcgagtt gcgtgactac ctacgggtaa cagtttcttt atggcagggt 1500 gaaacgcagg tcgccagcgg caccgcgcct ttcggcggtg aaattatcga tgagcgtggt 1560 ggttatgccg atcgcgtcac actacgtctg aacgtcgaaa acccgaaact gtggagcgcc 1620 gaaatcccga atctctatcg tgcggtggtt gaactgcaca ccgccgacgg cacgctgatt 1680 gaagcagaag cctgcgatgt cggtttccgc gaggtgcgga ttgaaaatgg tctgctgctg 1740 ctgaacggca agccgttgct gattcgaggc gttaaccgtc acgagcatca tcctctgcat 1800 ggtcaggtca tggatgagca gacgatggtg caggatatcc tgctgatgaa gcagaacaac 1860 tttaacgccg tgcgctgttc gcattatccg aaccatccgc tgtggtacac gctgtgcgac 1920 cgctacggcc tgtatgtggt ggatgaagcc aatattgaaa cccacggcat ggtgccaatg 1980 aatcgtctga ccgatgatcc gcgctggcta ccggcgatga gcgaacgcgt aacgcgaatg 2040 gtgcagcgcg atcgtaatca cccgagtgtg atcatctggt cgctggggaa tgaatcaggc 2100 cacggcgcta atcacgacgc gctgtatcgc tggatcaaat ctgtcgatcc ttcccgcccg 2160 gtgcagtatg aaggcggcgg agccgacacc acggccaccg atattatttg cccgatgtac 2220 gcgcgcgtgg atgaagacca gcccttcccg gctgtgccga aatggtccat caaaaaatgg 2280 ctttcgctac ctggagagac gcgcccgctg atcctttgcg aatacgccca cgcgatgggt 2340 aacagtcttg gcggtttcgc taaatactgg caggcgtttc gtcagtatcc ccgtttacag 2400 ggcggcttcg tctgggactg ggtggatcag tcgctgatta aatatgatga aaacggcaac 2460 ccgtggtcgg cttacggcgg tgattttggc gatacgccga acgatcgcca gttctgtatg 2520 aacggtctgg tctttgccga ccgcacgccg catccagcgc tgacggaagc aaaacaccag 2580 cagcagtttt tccagttccg tttatccggg caaaccatcg aagtgaccag cgaatacctg 2640 ttccgtcata gcgataacga gctcctgcac tggatggtgg cgctggatgg taagccgctg 2700 gcaagcggtg aagtgcctct ggatgtcgct ccacaaggta aacagttgat tgaactgcct 2760 gaactaccgc agccggagag cgccgggcaa ctctggctca cagtacgcgt agtgcaaccg 2820 aacgcgaccg catggtcaga agccgggcac atcagcgcct ggcagcagtg gcgtctggcg 2880 gaaaacctca gtgtgacgct ccccgccgcg tcccacgcca tcccgcatct gaccaccagc 2940 gaaatggatt tttgcatcga gctgggtaat aagcgttggc aatttaaccg ccagtcaggc 3000 tttctttcac agatgtggat tggcgataaa aaacaactgc tgacgccgct gcgcgatcag 3060 ttcacccgtg caccgctgga taacgacatt ggcgtaagtg aagcgacccg cattgaccct 3120 aacgcctggg tcgaacgctg gaaggcggcg ggccattacc aggccgaagc agcgttgttg 3180 cagtgcacgg cagatacact tgctgatgcg gtgctgatta cgaccgctca cgcgtggcag 3240 catcagggga aaaccttatt tatcagccgg aaaacctacc ggattgatgg tagtggtcaa 3300 atggcgatta ccgttgatgt tgaagtggcg agcgatacac cgcatccggc gcggattggc 3360 ctgaactgcc agctggcgca ggtagcagag cgggtaaact ggctcggatt agggccgcaa 3420 gaaaactatc ccgaccgcct tactgccgcc tgttttgacc gctgggatct gccattgtca 3480 gacatgtata ccccgtacgt cttcccgagc gaaaacggtc tgcgctgcgg gacgcgcgaa 3540 ttgaattatg gcccacacca gtggcgcggc gacttccagt tcaacatcag ccgctacagt 3600 caacagcaac tgatggaaac cagccatcgc catctgctgc acgcggaaga aggcacatgg 3660 ctgaatatcg acggtttcca tatggggatt ggtggcgacg actcctggag cccgtcagta 3720 tcggcggaat tccagctgag cgccggtcgc taccattacc agttggtctg gtgtcaaaaa 3780 gattcagcag gctcagcagg ctcagcaggc gctagcaagg gcgaggagct gttcaccggg 3840 gtggtgccca tcctggtcga gctggacggc gacgtaaacg gccacaagtt cagcgtgcgc 3900 ggcgagggcg agggcgatgc caccaacggc aagctgaccc tgaagttcat ctgcaccacc 3960 ggcaagctgc ccgtgccctg gcccaccctc gtgaccaccc tgacctacgg cgtgcagtgc 4020 ttcagccgct accccgacca catgaagcag cacgacttct tcaagtccgc catgcccgaa 4080 ggctacgtcc aggagcgcac catcagcttc aaggacgacg gcacctacaa gacccgcgcc 4140 gaggtgaagt tcgagggcga caccctggtg aaccgcatcg agctgaaggg catcgacttc 4200 aaggaggacg gcaacatcct ggggcacaag ctggagtaca acttcaacag ccacaacgtc 4260 tatatcaccg ccgacaagca gaagaacggc atcaaggcca acttcaagat ccgccacaac 4320 gtggaggacg gcagcgtgca gctcgccgac cactaccagc agaacacccc catcggcgac 4380 ggccccgtgc tgctgcccga caaccactac ctgagcaccc agtccgtgct gagcaaagac 4440 cccaacgaga agcgcgatca catggtcctg ctggagttcg tgaccgccgc cgggatcact 4500 ctcggcatgg acgagctgta caagtga 4527

Claims (6)

In a DNA molecule capable of forming a transcription system loop (stem loop) structure with mRNA, the ribosomal binding site is located in the stem loop structure,
A DNA sequence encoding an RNA sequence designed such that a partial sequence can participate in forming the stem loop structure;
And a DNA sequence encoding the RNA sequence complementary to the RNA sequence designed to participate in the formation of the stem loop structure, the DNA sequence located after the stop codon (b).
The method of claim 1,
The DNA molecule,
After the ribosomal binding site, before the DNA sequence (b),
A DNA molecule, characterized in that it comprises a multiple cloning site (mutiple cloning site).
A vector comprising the DNA molecule of claim 1.
For mRNA forming a stem loop structure and the ribosomal binding site located within the stem loop structure,
An RNA sequence in which a portion of the sequence participates in the stem loop structure (a);
Comprising a complementary sequence capable of binding to the RNA sequence (a), the RNA sequence located after the stop codon (b); mRNA comprising a.
The method of claim 4,
The mRNA,
When the RNA sequence (b) is bound to the RNA sequence (a), mRNA is characterized in that the translation of the stem loop structure is released.
The method of claim 5,
The translation start,
MRNA characterized in that the ribosome is initiated by binding to the ribosomal binding site.

Images