KR20190113677A - A Noble Fusion Protein-based Nanoparticles and Uses Thereof - Google Patents

Abstract

The present invention relates to novel mussel adhesive protein-based nanoparticles and uses thereof, and more specifically, to a fusion protein for gene or drug delivery, in which a functional peptide is fused with a mussel adhesive protein; a method of preparing fusion protein-based nanoparticles for gene or drug delivery, based on the fusion protein; fusion protein-based nanoparticles for gene or drug delivery, prepared by the method; and a CRISPR/CAS9 gene editing system using the nanoparticles. Since the functional peptide for gene delivery is fused with the mussel adhesive protein, the nanoparticles for gene or drug delivery, based on the fusion protein according to the present invention, have excellent biocompatibility, and can effectively penetrate into target cells, and thus can be used not only in the CRISPR/CAS9 gene editing system, but also in the treatment and research for various diseases as a biomaterial-based carrier for gene editing and a drug carrier that carries and delivers a target drug.

Description

A Noble Fusion Protein-based Nanoparticles and Uses Thereof

The present invention relates to novel fusion protein-based nanoparticles and their use.

CRISPR (Clustered regularly interspaced short palindromic repeats) / Cas9 system, which is composed of CRISPR protein, cas9 protein and gRNA, is a system that can precisely cut the DNA sequence of interest. It is a gene editing technology with a very wide range.

Although studies have been actively conducted on vectors for efficiently delivering CRISPR / CAS9 proteins and gRNAs into cells, most of them are limited to adeno-associated viruses and limited to clinical applications due to safety issues. There is.

In order to increase the efficiency of gene transfer, a number of studies have been conducted to connect functional peptides such as DNA binding peptides, cell penetrating peptides, or nuclear localization signals to vectors. have. Gene-binding peptides are mainly composed of cationic amino acids, which can bind to anionic genes, thereby improving the gene carrying capacity of the vector. Cell-penetrating peptides are mainly derived from membrane-translocating sequences or protein transduction domains to transfer macromolecules such as proteins, DNA, and RNA into cells without damaging the cell membrane. It is possible to increase the influx, and the nuclear position signal is an amino acid sequence that selectively transports into the nucleus, and thus has been spotlighted as a functional peptide for gene transfer because it can efficiently transfer vectors and genes into the nucleus.

Polyion complex is a method of self-assembly of molecules through electrostatic attraction between the molecules using polymers with multiple positive charges and polymers with multiple negative charges. This method is used as a technology for making materials used in living organisms because it does not require chemical catalysts, enzymes, light, heat, etc. to make new materials with polymers.

In addition, researches for delivering drugs by forming ionic complexes with therapeutic proteins, genes, and bioactive materials that charge in vivo along with such charged polymer materials are carried out. K. Kataoka et al. Used a block copolymer of polyethylene oxide and poly-L-lysine and a block copolymer of polyethylene oxide and poly-L-aspartate together. The concept of 'polyion complex (PIC) micelle', which produces nanoparticles using ionic bonds between polymers with different charges, has been proposed (see A. Harada and K. Kataoka, Macromolecules, 28, 5294). (1995)).

Mussel adhesive protein is a protein derived from mussel's foot and has excellent adhesion and biocompatibility. Because of this property does not cause an immune response in the human body is processed into a formulation of hydrogel, nanofibers, nanoparticles and the like is used in the treatment of various conditions.

In the previous studies, the present inventors have confirmed that bioadhesive materials using mussel proteins can be mass-produced using E. coli to secure sufficient materials and have excellent adhesion, biocompatibility, and biodegradability in a humid environment of the body. (International Patent Publication WO2006 / 107183 or WO2005 / 092920).

However, it has been confirmed that nanoparticles using mussel adhesive proteins and iron ions can be used for in vivo mass transfer. However, there has been no report on the production of nanoparticles using dione bonds, and their use as vectors for gene editing has been reported. Never

The present inventors have made intensive research efforts to develop a carrier capable of effectively delivering a gene of interest and / or drug into a cell. As a result, the inventors produced a fusion protein in which a functional peptide was fused to a mussel adhesive protein and then tyrosine residues were converted to DOPA (dihydroxyphenylalanine). In addition, by treating a polyelectrolyte with a negative charge to the fusion protein, induces a dion bond between the positively charged lysine residue and the negatively charged polyelectrolyte in the fusion protein and electrospinning without a separate material for crosslinking Nanoparticles were prepared through the present invention, and thus the nanoparticles produced were completed by confirming that the target substance can be effectively delivered into the target cell as a carrier of the target substance.

Accordingly, one object of the present invention is to provide a fusion protein for gene or drug delivery, in which a functional peptide is fused to an mussel adhesive protein.

Another object of the present invention is to provide a method for preparing fusion protein-based nanoparticles for gene or drug delivery.

In addition, another object of the present invention to provide a fusion protein-based nanoparticles for gene or drug delivery, prepared according to the above method.

It is still another object of the present invention to provide a CRISPR / Cas9 gene editing system comprising fusion protein-based nanoparticles.

Hereinafter, the present invention will be described in detail.

According to one aspect of the invention, the invention is a fusion that is a recombinant mussel adhesive protein linked to a mussel adhesive protein produced by fusing a functional peptide for gene delivery to a mussel adhesive protein (MAP) Provide protein.

The present invention is based on a fusion protein linked to a functional peptide for gene delivery to the mussel adhesive protein.

According to a preferred embodiment of the present invention, the mussel adhesive protein is a modified 10% to 100% of the total tyrosine residues to dopa (DOPA).

Tyrosine accounts for about 20-30% of the total amino acid sequence of most mussel adhesive proteins. Tyrosine in the natural mussel adhesive protein is converted to the form of waveguide by the addition of -OH groups through hydration. However, mussel adhesive proteins produced in E. coli are not converted to tyrosine residues, and therefore, it is preferable to perform a modification reaction to convert tyrosine residues to waveguides by a separate enzyme and chemical treatment method. The method of modifying the tyrosine residue contained in the mussel adhesive protein may be a method known in the art, and is not particularly limited. Preferably, tyrosinase can be used to modify tyrosine residues into dopatic residues.

In one embodiment of the present invention, mussel adhesive protein was produced by satisfying the waveguide conversion rate through in vitro enzyme reaction using mushroom tyrosinase.

In the present invention, "mussel adhesive protein" is an adhesive protein derived from mussels, preferably Mytilus edulis , Mytilus galloprovincialis or Mytileus nose Mussel adhesion proteins derived from Mytilus coruscus or variants thereof, including but not limited to.

For example, the mussel adhesive proteins of the present invention are Mefp (Mytilus edulis foot protein) -1, Mgfp (Mytilus galloprovincialis foot protein) -1, Mcfp (Mytilus coruscus foot protein) -1, Mefp-2, each derived from the mussel species. Mefp-3, Mgfp-3 and Mgfp-5 or variants thereof, preferably fp (foot protein) -1 (SEQ ID NO: 1), fp (foot protein) -1 variant (SEQ ID NO: 3), selected from the group consisting of fp-2 (SEQ ID NO: 4), fp-3 (SEQ ID NO: 5), fp-4 (SEQ ID NO: 6), fp-5 (SEQ ID NO: 7), and fp-6 (SEQ ID NO: 8) Proteins, or fusion proteins to which one or more proteins selected from the group are linked, or variants thereof, include, but are not limited to.

In addition, the mussel adhesive proteins of the present invention include all mussel adhesive proteins described in International Publication No. WO2006 / 107183 or WO2005 / 092920.

The mussel adhesive proteins include fp-151 (SEQ ID NO: 9), fp-131 (SEQ ID NO: 10), fp-353 (SEQ ID NO: 11), fp-153 (SEQ ID NO: 12), fp-351 (SEQ ID NO: 13), and the like. It may include, but is not limited to, fusion proteins.

In addition, the mussel adhesive protein of the present invention may include a polypeptide in which the decapeptide (SEQ ID NO: 2), which is repeated about 80 times in fp-1 (SEQ ID NO: 1), is continuously connected 1 to 12 or more times. Preferably, the decapeptide of SEQ ID NO: 2 may be a fp-1 variant polypeptide (SEQ ID NO: 3) linked 12 consecutive times, but is not limited thereto.

In addition, the mussel adhesive protein may include an additional sequence at the carboxyl terminus or the amino terminus of the mussel adhesive protein or some amino acids may be substituted with other amino acids under the premise of maintaining adhesion. Preferably, a polypeptide consisting of 3 to 25 amino acids including RGD (Arg Gly Asp) may be linked to the carboxyl terminus or amino terminus of the mussel adhesive protein, but is not limited thereto.

3 to 25 amino acids including the RGD include, but are not limited to, Arg Gly Asp (RGD), Arg Gly Asp Ser (RGDS), Arg Gly Asp Cys (RGDC), and Arg Gly Asp Val (RGDV). , RGDSPASSKP (Arg Gly Asp Ser Pro Ala Ser Ser Lys Pro), GRGDS (Gly Arg Gly Asp Ser), GRGDTP (Gly Arg Gly Asp Thr Pro), GRGDSP (Gly Arg Gly Asp Ser Pro), GRGDSPC (Gly Arg Gly Asp Ser Pro Cys) and YRGDS (Tyr Arg Gly Asp Ser) may be at least one selected from the group consisting of.

In the present invention, the functional peptide is a peptide having a gene transfer function, gene binding peptide (DNA binding peptide, DBP), cell permeable peptide (Cell penetrating peptide (CPP), penetratin (penetratin), nuclear position signal (Nuclear) localization signal, NLS) and T-ag peptide, but may be selected from the group.

In the present invention, the 'gene binding peptide' may be a DBP peptide capable of binding to a gene (Nicole M. Moore, Clayton L. Sheppard, Shelly E. Sakiyama-Elbert, 2009. Acta Biomaterialia 5: 854-864) However, the present invention is not limited thereto, and any gene-binding peptide can be used as long as it exhibits gene-binding activity.

In the present invention, the 'cell permeable peptide' is a 9mer arginine (polyR) peptide (Wender PA, Mitchell DJ, Pattabiraman K., Pelkey ET, Steinman L. and Rothbard JB 2000. PNAS 97: 13003-13008) or penetratin peptide (Kaplan , IM et al. 2005. J. Control, Release 102: 247-253), but is not limited thereto, and any cell-permeable peptide may be used so long as it exhibits cell permeation activity that can efficiently penetrate the cell membrane. have.

In the present invention, the 'nuclear position signal peptide' is SV40 (Gorlich D, Kutay U. Annu Rev Cell Dev Biol 1999. 15: 607-60), T-ag (Hui-Yuan Wang, Jing-Xiao Chen, Yun-Xia Sun, Ji-Zhe Deng, Cao Li, Xian-Zheng Zhang, Ren-Xi Zhuo. 2011. Journal of Controlled Release 155: 26-33), but is not limited to this, as long as it is capable of delivering material within the nucleus. Any nuclear position signal peptide can be used.

According to another aspect of the present invention, the present invention provides a method for producing a fusion protein-based nanoparticle for gene or drug delivery, and a fusion protein-based nanoparticle for gene or drug delivery produced thereby, comprising the following steps: :

(a) mixing the fusion protein and a polyelectrolyte capable of a polyion complex with the fusion protein; And

(b) mixing and electrospinning the target gene or drug loaded in the nanoparticles into the mixture of step (a).

The nanoparticles may be crosslinked through dione bonds of polyelectrolytes having positive and negative charges of the lysine residues of the fusion protein.

Preferably, the polyelectrolyte is polyphosphate, but a gene, protein, polymer, or polysaccharide having a negative charge may also be used as a composition capable of inducing dione bonds. Specifically, tripolyphosphate (TPP), hyaluronic acid (Hyaluronic acid, HA), bovine serum albumin (BSA), and the like.

According to a preferred embodiment of the invention, the polyphosphate is selected from the group consisting of sodium tripolyphosphate (TPP), sodium pyrophosphate (PP), sodium trimethaphosphate (STP), and sodium hexametaphosphate (SHMP) The polyphosphate may be used as long as the species is not limited thereto and as long as it can form a polyion complex with the fusion protein of the present invention.

The fusion protein-based nanoparticles of the present invention can deliver any material to achieve the desired effect as long as it can carry or load the desired material to be delivered in or outside the body.

Preferably, the gene or drug of interest is not limited thereto.

The gene may be a plasmid, mRNA, RNA, DNA or a combination thereof.

The drug may be a low molecular weight drug, a genetic drug, a protein drug, an antibody drug, a synthetic compound drug, or a combination thereof, but is not limited thereto. Specifically, the low molecular weight drugs include doxorubicin, Docditomycin, mitomycin, bleomycin, cytarabine, azasergin, mechloretamine, cyclophosphamide, triethylenemelamine, threosulfane, retinoic acid, bin Blastine, vincristine, aspirin, salicylate, ibuprofen, flurbiprofen, pyroxhamm, naprosen, phenopropene, indomethacin, phenylbutazone, mesotrexate, mecloethamine, dexamethasone , Prednisolone, celecoxib, valdecoxib, nimesulide, cortisone, corticosteroids, and the like.

The gene drug may be small interfering RNA (siRNA), small hairpin RNA (shRNA), microribonucleic acid (microRNA, miRNA), plasmid deoxyribonucleic acid (plasmid DNA), or the like. The protein drug may be a monoclonal antibody-based trastuzumab, rituximab, bevacizumab, cetuximab, or bortezomib. ), Erlotinib, gefitinib, imatinib mesylate, sunitinib; Enzyme-based L-asparaginase; Hormone-based tritorelin acetate, megestrol acetate, flutamide, bicalutamide, goserelin; Cytochrome c, p53 protein and the like. In particular, the drug may be an anticancer agent such as doxorubicin, paclitaxel, docetaxel, cisplatin, carboplatin, 5-FU, etoposide, and camptothecin, which have anticancer effects.

In addition, the nanoparticles of the present invention can be easily loaded or attached to various bioactive substances involved in the action of promoting the growth and differentiation of cells through the interaction with cells or tissues of the human body and help the regeneration and recovery of tissues. have.

In the present invention, the "physiologically active substance" refers to various biomolecules and includes cells, proteins, nucleic acids, sugars, enzymes, and the like. The bioactive substance may be a cell, a protein, a polypeptide, a polysaccharide, a monosaccharide, an oligosaccharide, a fatty acid, a nucleic acid, and preferably a cell.

The "cell" may be any cell including prokaryotic and eukaryotic cells. For example, mesenchymal stem cells, adipose stem cells, osteoblasts, periodontal ligament cells (periodontal) Immunity including ligament cells, vascular endothelial cells, fibroblasts, hepatocytes, neurons, cancer cells, B cells, white blood cells, etc. Cells, embryonic cells, and the like.

In addition, the physiologically active substance includes, but is not limited to, plasmid nucleic acid as a nucleic acid material, hyaluronic acid as a sugar substance, heparin sulfate, chondroitin sulfate, alginate, and hormonal protein as a protein substance.

The size of the nanoparticles may range from an average diameter of 80 to 130 nm, preferably 110 nm. This size is suitable for the nanocomposite to move to the target cell, and when injected into the human body can be delivered through a variety of methods, such as injection, oral, skin. The loaded drug can be delivered by injection or other method suitably for humans or other mammals with a therapeutically effective disease state or condition, but is preferably delivered parenterally. Parenteral means intramuscular, intraperitoneal, intraperitoneal, subcutaneous, intravenous and intraarterial. Therefore, the nanoparticles of the present invention can typically be formulated in injection formulations. Injectable nanoparticles of the invention can be injected or inserted into the body of a human or other mammal by any suitable method, preferably by injection through a hypodermic needle. For example, it can be administered by injection or in any other way, intraarterial, intravenous, genitourinary, subcutaneous, intramuscular, subcutaneous, intracranial, intracardiac, intrapleural, or other body cavity or possible space. Or through a catheter or syringe, for example, during arthroscopy, intraarticularly, into the genitourinary tract, into the vasculature, into the palate or into the pleura, or into any body cavity or possible space in the body, surgery, surgery, diagnosis or Can be introduced during interventional procedures.

The mussel adhesive protein and the target gene or drug of the present invention may be mixed in various ratios to prepare the composite nanoparticles through electrospinning.

For example, in the case of the fusion protein ( m MAP-DBP) and pgLuc, the mixture is mixed at a ratio of 1: 0.1 to 1:10, preferably 1: 1 to 8: 1 (w / w), and then complexed through electrospinning. Nanoparticles can be produced

Step (b) is a step of preparing a composite nanoparticle by mixing the mixture of step (a) and the gene or drug, and then electrospinning it. The electrospinning process is a technique for forming nanoparticles using electrical attraction and repulsive force generated when charging a polymer solution or a molten polymer to a predetermined voltage. The electrospinning process can produce nanoparticles with various diameters ranging from several nm to thousands of nm, simple equipment structure, and applicable to a wide range of materials.

According to an embodiment of the present invention, in order to perform the electrospinning process, the fusion protein, polyelectrolyte and gene may be dissolved in a water-based solvent. The use of water based solvents instead of organic solvents can rule out the toxic effects of the solvents remaining during electrospinning. The water-based solvent may be further mixed with an organic solvent in order to improve evaporation, preferably 60 to 80% (v / v) of ethanol may be further mixed with distilled water.

In addition, the present invention can provide a pharmaceutical composition comprising the nanoparticles of the present invention, the pharmaceutical composition, powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. Oral dosage forms, external preparations, suppositories and sterile injectable solutions can be used in the form of a formulation. Carriers, excipients and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. Solid form preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid form preparations include at least one excipient such as starch, calcium carbonate, sucrose or lactose, It is prepared by mixing gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

The dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, weight of the subject to be treated, the specific disease or pathology to be treated, the severity of the disease or pathology, the route of administration and the judgment of the prescriber. Dosage determination based on these factors is within the level of skill in the art and generally dosages range from 0.01 mg / kg / day to approximately 2000 mg / kg / day. More preferred dosage is 1 mg / kg / day to 500 mg / kg / day. Administration may be administered once a day or may be divided several times. The dosage does not limit the scope of the invention in any aspect.

The nanoparticles according to the present invention not only have excellent biocompatibility, but also prove their applicability as in vivo and external delivery agents through effective intracellular injection and gene editing effects.

According to another aspect of the invention, the invention is a fusion protein linked to a functional peptide to the mussel adhesive protein (Mussel Adhesive Protein, MAP); A polyelectrolyte capable of forming a fusion complex with the fusion protein; And it provides a CRISPR / Cas9 gene editing system comprising a fusion protein-based nanoparticles for gene delivery, including; the target gene to be loaded.

In one embodiment, the present invention provides nanoparticles for CRISPR / Cas9 gene edit delivery through dione binding using a lysine residue of the fp-1 polypeptide.

The target gene preferably corresponds to a constituent of the CRISPR / Cas9 regime. The CRISPR / Cas9 constituents are Cas9 consisting of protein, mRNA, plasmid and the like; plasmids or gRNAs containing the genetic information of the gRNA; donor DNA and mixtures thereof, but is not limited thereto.

Therefore, the nanoparticles of the present invention can be applied as a gene therapeutic agent by supporting the components of the CRISPR / Cas9 system.

The size of the nanoparticles may be in the range of 100 ~ 200 nm in average diameter, this size is suitable for the nanoparticles to penetrate the target cell membrane, when delivered to the human body is delivered through a variety of methods such as injection, oral, skin It may be used, and may be used for genetic diseases, but is not limited thereto.

Accordingly, the present invention can provide a nanoparticle carrying a gene having genetic information of gRNA and Cas9 protein using the fusion protein of the present invention and a CRISPR / Cas9 gene editing system using the nanoparticle of the present invention.

In conclusion, the fusion protein of the present invention and the nanoparticles based on the present invention prepared by the preparation method of the present invention can be effectively delivered to the target gene or drug, such as CRISPR / Cas9 gene editing system, drug delivery system, etc. Application is possible.

Nanoparticles for gene or drug delivery based on the fusion protein according to the present invention has excellent biocompatibility and effectively penetrates into the target cell because the functional peptide for gene delivery is fused to the mussel adhesive protein, CRISPR / CAS9 gene editing As a system, as well as a biomaterial-based gene-editing carrier and a drug carrier that carries and delivers a target drug, it can be used for the treatment and research of various diseases.

1 is a CRISPR / Cas9 gene editing through the production of nanoparticles by mussel adhesive protein-based polyion complex for the delivery of the CRISPR / Cas9 gene edit of the present invention and the expression of the two plasmids in the nanoparticles It is a schematic diagram showing the mechanism by which the sieve works to edit the desired gene.
Figure 2 shows the results of SDS-PAGE confirming the expression of the fusion protein for mussel adhesive protein-based gene delivery.
3 shows peak intensities of DOPA and tyrosine residues of mussel adhesive proteins.
Figure 4 is a photo of the mussel adhesive protein and Luciferase gRNA (guide RNA) expressing the complex of plasmid (plasmid) gene electrophoresis according to the relative ratio (N / P ratio) of nitrogen and phosphorus.
5 is an SEM observation result of mussel adhesive protein-based nanoparticles containing plasmids containing Cas9 protein and EGFP-gRNA (Enhanced Green Fluorescent Protein-Guide RNA) gene.
Figure 6 is when the plasmid (plasmid Cas9-mCherry, pCas9-mCherry) incorporating the Cas9 protein gene with mCherry peptide in HEK 293 cells when delivered through the mussel adhesive protein-based nanoparticles ( m MAP @ pCas9-mCherry NPs) Confocal microscope results show that mCherry-Cas9 is expressed.
FIG. 7 shows plasmids containing plasmid gGFP and pgGFP containing plasmid Cas9 (pCas9) and EGFP-gRNA gene (gGFP) containing Cas9 protein genetic information in MDA-MB-231-Luc-GFP cells injected with EGFP. Fluorescence microscope results show that the expression of EGFP protein is reduced in MDA-MB-231-Luc-GFP cells when delivered via mussel adhesive protein based nanoparticles containing m MAP @ pCas9 / pgGFP NPs.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to present the invention, the present invention is not limited by the following examples.

The inventors performed the following experiment sequentially to prepare nanoparticles based on functional peptide-mussel adhesive protein.

An overview of the overall experiment for preparing the nanoparticles of the present invention is shown in FIG. 1.

Example 1 Preparation of Mussel Adhesion Protein-Functional Peptide Fusion Proteins

The inventors prepared a fusion protein linked to a functional peptide for gene transfer to the mussel adhesive protein as follows.

First, the mussel adhesion protein fp-1 (Mytilus mussel foot) consisting of decapeptides consisting of 10 amino acids (AKPSYPPTYK) repeated 12 times among the mussel adhesion protein fp-1 present in nature is connected 12 times. protein type 1) Variants (SEQ ID NO: 3) were prepared according to known procedures (Proc. Natl. Acad. Sci. USA 2010, 107, 12850-3).

In addition, primers for a nucleotide sequence encoding a functional peptide for gene transfer (Table 1) were prepared and linked to the mussel adhesion protein fp-1 variant prepared as described above using a polymerase chain reaction. Functional peptides for gene delivery used in the present invention are as follows:

(i) DNA binding peptides (DBP) (Nicole M. Moore, Clayton L. Sheppard, Shelly E. Sakiyama-Elbert, 2009. Acta Biomaterialia 5: 854-864);

(ii) 9mer arginine (polyR), a cell penetrating peptide (CPP) (Wender PA, Mitchell DJ, Pattabiraman K., Pelkey ET, Steinman L. and Rothbard JB 2000. PNAS 97: 13003-13008 ); And

(iii) penetratin (Kaplan, I.M. et al. 2005. J. Control, Release 102: 247-253).

SEQ ID NO: Peptide Amino acid sequence 14 DBP KWKWKKA 15 polyR RRRRRRRRR 16 penetratin RQIKIWFQNRRMK

In addition, the primer sequences used in the present invention are shown in Table 2 below.

SEQ ID NO: primer Sequence (5 '→ 3') 17 fp-1 variant forward CATATGGCGAAACCGAGC 18 DBP reverse CTCGAGTTACGCTTTTTTCCATTTCCATTTCTTGTACGTTGGAGGATAAGAAG 19 polyR reverse CTCGAGTTAGCGGCGGCGGCGGCGGCGGCGGCGGCGCTTGTACGTTGGAGGATAAGAAG 20 Penetratin reverse CTCGAGTTATTTTTTCCATTTCATGCGGCGGTTCTGAAACCAAATTTTAATCTGGCGCTTGTACGTTGGAGGATAAGAAG

Each plasmid (MAP-DBP, MAP-PolyR, MAP-penetratin) was transformed into E. coli TOP10 strain using the pET-22b (+) vector containing the T7 promoter as a plasmid carrier. In addition, for expression of the fusion protein, the cloned recombinant vector was transformed back into E. coli BL21 (DE3) strain (hereinafter referred to as recombinant fusion protein MAP-DBP and recombinant fusion protein MAP-PolyR).

E. coli strains transformed with the MAP-DBP and MAP-PolyR genes were cultured in an LB liquid medium containing 50 μg / ml of ampicillin at 37 ° C. and 300 rpm, and an optical density of 600 nm was obtained. When OD ₆₀₀ reached the level of 0.4 to 0.6, 1 mM of IPTG (isopropyl-β-D-thiogalactopyranoside) was added and incubated for 8 hours under the same conditions. The cells thus cultured were centrifuged at 4 ° C. and 18,000 × g for 10 minutes, and resuspended in the elution buffer (10 mM Tris-HCl, and 100 mM sodium phosphate, pH 8) to disrupt the cells at 200 Kpsi. Proceeded. In order to obtain cell debris from the cell lysate thus obtained, the cells were centrifuged at 4 ° C. and 18,000 × g for 20 minutes, and the target was prepared using 25% (v / v) acetic acid. The fusion protein was extracted and the finally purified fusion protein was lyophilized and stored at -80 ° C. Production and purification of the protein was analyzed by 12% (w / v) SDS-PAGE, the concentration of the protein was measured by Bradford assay (Bio-Rad).

As a result, as shown in Figure 2, it was confirmed that the mussel adhesive protein-functional peptide fusion protein of the present invention was successfully expressed.

In particular, the dual recombinant fusion protein MAP-DBP and recombinant fusion protein MAP-PolyR were significantly expressed, MAP-penetratin was expressed but not soluble in water as a solvent in the following examples, MAP-DBP and / or MAP-PolyR Used.

Example 2. Preparation of Mussel Adhesion Protein Nanoparticles Incorporating a Target Gene

2.1. DOPA-Converted Mussel Adhesive Protein m MAP-DBP, m MAP-PolyR and pCas9, pgRNA Plasmid Gene Preparation

In order to prepare functional peptide-mussel adhesive protein-based nanoparticles incorporating the gene of interest, the present inventors have modified the DOPA-conversion of tyrosine residues into DOPA residues since DOPA residues can enhance adhesion in vivo compared to tyrosine residues. Mussel adhesive proteins mMAP-DBP, mMAP-PolyR were prepared as follows:

An in vitro enzymatic reaction using a tyrosinase enzyme was performed on the recombinant fusion proteins MAP-DBP and MAP-PolyR of the present invention prepared in Example 1 to be present in the MAP-DBP and MAP-PolyR. Tyrosine residues were converted to DOPA (dihydroxyphenylalanine).

Specifically, 1.50 mg / ml MAP solution and 100 μg / mL tyrosinase were reacted in a buffer solution (100 mM sodium phosphate, 20 mM boric acid, 25 mM ascorbic acid, pH 6.8) for 1 hour, followed by 1% acetic acid solution. Dialysis was performed using.

At this time, it was confirmed that about 17% of the total tyrosine residues were converted to DOPA through peak intensities of DOPA and tyrosine residues as shown in FIG. 3.

As a result, m MAP-DBP and m MAP-PolyR in which tyrosine residues of each MAP-DBP and MAP-PolyR were converted to DOPA (dihydroxyphenylalanine) were produced.

The present inventors selected pCas9-mCherry and pgRNA-EGFP in the form of plasmids as delivery materials in order to confirm the effect of gene transfer through the gene carrier. All of them can be expressed in eukaryotes using the U6 promoter, and in the case of pCas9-mCherry, it is easy to confirm the expression of Cas9 by red fluorescence when expressed due to the mCherry peptide. The above plasmids are as follows: addgene (pU6- (BbsI) _CBh-Cas9-T2A-mCherry was a gift from Ralf Kuehn (Addgene plasmid # 64324; http://n2t.net/addgene:64324; RRID: Addgene_64324, EGFP gRNA (BRDN0000563266) was a gift from John Doench & David Root (Addgene plasmid # 80036; http://n2t.net/addgene:80036; RRID: Addgene_80036)), and each transformed into E. coli Top10 strain and then used the midi-prep method. The plasmid was obtained through.

2.2. gRNA Plasmid Gene Loading Protein Complex Preparation

To prepare functional peptide-mussel adhesion protein-based nanoparticles incorporating the gene of interest, we prepared a gRNA plasmid gene loading protein complex as follows:

The complex with the gRNA plasmid gene was prepared using m MAP-PolyR and m MAP-DBP prepared in Example 2.1.

Specifically, pgLuc gene was added to m MAP-PolyR and m MAP-DBP solutions at various N / P (protein (nitrogen) / nucleic acid (phosphorus)) ratios, followed by reaction for 30 minutes. The composite thus prepared was subjected to electrophoresis for 20 minutes on a 1% (w / v) agarose gel. At this time, m MAP was used as a control.

As a result, as shown in FIG. 4, the complex was successfully formed at an N / P ratio of 4: 1 for m MAP-DBP-pgLuc and 8: 1 for M MAP-PolyR-pgLuc, respectively. It was confirmed.

2.3. gRNA Plasmid Gene Loading Protein Nanoparticle Preparation

To prepare the gene-containing functional peptide-mussel adhesion protein-based nanoparticles, we prepared gRNA plasmid gene loading protein nanoparticles as follows:

To prepare nanoparticle complexes loaded with pCas9 and pgRNA plasmid gene loading ( m MAP-PolyR @ pCas9-mCherry + pgRNA-EGFP NPs) using m MAP-PolyR prepared in Example 2.1, Spinning technology was used.

 Specifically, 4 wt% of MAP was dissolved in distilled water, pCas9-mCherry and pgRNA-EGFP were mixed in a 1: 1 ratio, and the MAP solution was mixed with an N / P ratio of 8: 1. To this was added 0.1% sodium tripolyphosphate (TPP) solution to form enough intermolecular diion bonds (Polyion complx) to make nanoparticles. The mixed solution was electrospun.

Electrospinning was carried out in such a way that the solution was discharged at a rate of 0.5 ml / h using a syringe pump, producing nanoparticles with a high voltage of 9 kV when the tip with a diameter of 0.45 mm passed through a flat needle. The resulting nanoparticles were collected on a stirred tank containing phosphate buffered saline (PBS; pH 7.4) or aluminum foil and analyzed by SEM.

As a result, as shown in Figure 5, it was confirmed the formation of the gene loading nanoparticles (Mussel Adhesive Protein Nanoparticles, MAP NPs) of the present invention.

Example 3 Mussel Adhesion Protein Nanoparticles Incorporating a Target Gene in vitro  relay

The inventors of the present invention applied the MAP NPs, which are functional peptide-mussel adhesion protein-based nanoparticles containing the target gene of the present invention, prepared in Example 2 to the CRISPR / Cas9 system, whether the gene edits were actually delivered or not. And its properties were confirmed on in vitro.

First, HEK 293 cells were incubated at a rate of 2.0 × 10 ⁵ per 500ul of medium for 24 hours. 48 hours after administration of the mussel adhesion protein-based nanoparticle ( m MAP-PolyR @ pCas9-mCherry) fused with the functional peptide of the present invention, paloidin-FITC that specifically stains actin (actin) (Phalloidin-Fluorescein isothiocynate) was used to make the cells fluoresce green. Cell samples were observed under a confocal microscope.

As a result, as shown in Figure 6, confirmed the fluorescence expression of Cas9-mCherry, which means that the mussel adhesion protein-based nanoparticles ( m MAP-PolyR @ pCas9-mCherry) linked to the functional peptide of the present invention successfully into the cell Present that it was delivered.

In addition, the present inventors attempted to confirm whether the gene was edited by Cas9-mCherry.

To this end, MDA MB231 cells with EGFP inserted into the gene were incubated at a rate of 2.0 × 10 ⁵ per 500ul of medium for 24 hours. Mussel adhesion protein-based nanoparticles linked to the functional peptide of the present invention ( m MAP-PolyR @ pCas9-mCherry + pgRNA-EGFP, m MAP-PolyR @ pCas9 / pgGFP NPs) 48 hours after administration, the cell sample Was observed through a fluorescence microscope.

As a result, as shown in Figure 7, it was confirmed that the fluorescence expression level of EGFP was reduced, which means that the mussel adhesive protein-based nanoparticles ( m MAP-PolyR @ pCas9 / pgGFP NPs) incorporating the gene of the present invention into cells Effective delivery suggests that the CRISPR / Cas9 gene edit worked to edit the target gene.

Overall, in the present invention, a polyion complex of a lysine residue and tripolyphosphate (TPP) of a recombinant fusion protein made by electrospinning to a recombinant mussel adhesive protein fusion to which a functional peptide is linked, without a separate crosslinking treatment. ), A novel protein-based nanoparticle showing both adhesion and biocompatibility. When the prepared nanoparticles were applied to a clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 system, excellent CRISPR / Cas9 gene edit delivery and editing effects were achieved. The present invention can be utilized as a vector system for gene editing. have.

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> A Noble Fusion Protein-based Nanoparticles and Uses Thereof <130> POSTECH1-58P-1 <150> KR 10-2018-0035610 <151> 2018-03-28 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 800 <212> PRT <213> Artificial Sequence <220> <223> fp-1 <400> 1 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro   1 5 10 15 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys              20 25 30 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr          35 40 45 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser      50 55 60 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys  65 70 75 80 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro                  85 90 95 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys             100 105 110 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr         115 120 125 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser     130 135 140 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys 145 150 155 160 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro                 165 170 175 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys             180 185 190 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr         195 200 205 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser     210 215 220 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys 225 230 235 240 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro                 245 250 255 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys             260 265 270 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr         275 280 285 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser     290 295 300 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys 305 310 315 320 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro                 325 330 335 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys             340 345 350 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr         355 360 365 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser     370 375 380 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys 385 390 395 400 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro                 405 410 415 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys             420 425 430 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr         435 440 445 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser     450 455 460 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys 465 470 475 480 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro                 485 490 495 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys             500 505 510 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr         515 520 525 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser     530 535 540 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys 545 550 555 560 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro                 565 570 575 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys             580 585 590 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr         595 600 605 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser     610 615 620 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys 625 630 635 640 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro                 645 650 655 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys             660 665 670 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr         675 680 685 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser     690 695 700 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys 705 710 715 720 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro                 725 730 735 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys             740 745 750 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr         755 760 765 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser     770 775 780 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys 785 790 795 800 <210> 2 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> fragment sequence derived from fp-1 <400> 2 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys   1 5 10 <210> 3 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> fp-1 variant <400> 3 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro   1 5 10 15 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys              20 25 30 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr          35 40 45 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser      50 55 60 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys  65 70 75 80 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro                  85 90 95 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys             100 105 110 Pro Ser Tyr Pro Pro Thr Tyr Lys         115 120 <210> 4 <211> 472 <212> PRT <213> Artificial Sequence <220> <223> fp-2 <400> 4 Leu Phe Ser Phe Phe Leu Leu Leu Thr Cys Thr Gln Leu Cys Leu Gly   1 5 10 15 Thr Asn Arg Pro Asp Tyr Asn Asp Asp Glu Glu Asp Asp Tyr Lys Pro              20 25 30 Pro Val Tyr Lys Pro Ser Pro Ser Lys Tyr Arg Pro Val Asn Pro Cys          35 40 45 Leu Lys Lys Pro Cys Lys Tyr Asn Gly Val Cys Lys Pro Arg Gly Gly      50 55 60 Ser Tyr Lys Cys Phe Cys Lys Gly Gly Tyr Tyr Gly Tyr Asn Cys Asn  65 70 75 80 Leu Lys Asn Ala Cys Lys Pro Asn Gln Cys Lys Asn Lys Ser Arg Cys                  85 90 95 Val Pro Val Gly Lys Thr Phe Lys Cys Val Cys Arg Asn Gly Asn Phe             100 105 110 Gly Arg Leu Cys Glu Lys Asn Val Cys Ser Pro Asn Pro Cys Lys Asn         115 120 125 Asn Gly Lys Cys Ser Pro Leu Gly Lys Thr Gly Tyr Lys Cys Thr Cys     130 135 140 Ser Gly Gly Tyr Thr Gly Pro Arg Cys Glu Val His Ala Cys Lys Pro 145 150 155 160 Asn Pro Cys Lys Asn Lys Gly Arg Cys Phe Pro Asp Gly Lys Thr Gly                 165 170 175 Tyr Lys Cys Arg Cys Val Asp Gly Tyr Ser Gly Pro Thr Cys Gln Glu             180 185 190 Asn Ala Cys Lys Pro Asn Pro Cys Ser Asn Gly Gly Thr Cys Ser Ala         195 200 205 Asp Lys Phe Gly Asp Tyr Ser Cys Glu Cys Arg Pro Gly Tyr Phe Gly     210 215 220 Pro Glu Cys Glu Arg Tyr Val Cys Ala Pro Asn Pro Cys Lys Asn Gly 225 230 235 240 Gly Ile Cys Ser Ser Asp Gly Ser Gly Gly Tyr Arg Cys Arg Cys Lys                 245 250 255 Gly Gly Tyr Ser Gly Pro Thr Cys Lys Val Asn Val Cys Lys Pro Thr             260 265 270 Pro Cys Lys Asn Ser Gly Arg Cys Val Asn Lys Gly Ser Ser Tyr Asn         275 280 285 Cys Ile Cys Lys Gly Gly Tyr Ser Gly Pro Thr Cys Gly Glu Asn Val     290 295 300 Cys Lys Pro Asn Pro Cys Gln Asn Arg Gly Arg Cys Tyr Pro Asp Asn 305 310 315 320 Ser Asp Asp Gly Phe Lys Cys Arg Cys Val Gly Gly Tyr Lys Gly Pro                 325 330 335 Thr Cys Glu Asp Lys Pro Asn Pro Cys Asn Thr Lys Pro Cys Lys Asn             340 345 350 Gly Gly Lys Cys Asn Tyr Asn Gly Lys Ile Tyr Thr Cys Lys Cys Ala         355 360 365 Tyr Gly Trp Arg Gly Arg His Cys Thr Asp Lys Ala Tyr Lys Pro Asn     370 375 380 Pro Cys Val Val Ser Lys Pro Cys Lys Asn Arg Gly Lys Cys Ile Trp 385 390 395 400 Asn Gly Lys Ala Tyr Arg Cys Lys Cys Ala Tyr Gly Tyr Gly Gly Arg                 405 410 415 His Cys Thr Lys Lys Ser Tyr Lys Lys Asn Pro Cys Ala Ser Arg Pro             420 425 430 Cys Lys Asn Arg Gly Lys Cys Thr Asp Lys Gly Asn Gly Tyr Val Cys         435 440 445 Lys Cys Ala Arg Gly Tyr Ser Gly Arg Tyr Cys Ser Leu Lys Ser Pro     450 455 460 Pro Ser Tyr Asp Asp Asp Glu Tyr 465 470 <210> 5 <211> 50 <212> PRT <213> Artificial Sequence <220> <223> fp-3 <400> 5 Pro Trp Ala Asp Tyr Tyr Gly Pro Lys Tyr Gly Pro Pro Arg Arg Tyr   1 5 10 15 Gly Gly Gly Asn Tyr Asn Arg Tyr Gly Arg Arg Tyr Gly Gly Tyr Lys              20 25 30 Gly Trp Asn Asn Gly Trp Lys Arg Gly Arg Trp Gly Arg Lys Tyr Tyr          35 40 45 Gly ser      50 <210> 6 <211> 750 <212> PRT <213> Artificial Sequence <220> <223> fp-4 <400> 6 Tyr Gly Arg Arg Tyr Gly Glu Pro Ser Gly Tyr Ala Asn Ile Gly His   1 5 10 15 Arg Arg Tyr Tyr Glu Arg Ala Ile Ser Phe His Arg His Ser His Val              20 25 30 His Gly His His Leu Leu His Arg His Val His Arg His Ser Val Leu          35 40 45 His Gly His Val His Met His Arg Val Ser His Arg Ile Met His Arg      50 55 60 His Arg Val Leu His Gly His Val His Arg His Arg Val Leu His Asn  65 70 75 80 His Val His Arg His Ser Val Leu His Gly His Val His Arg His Arg                  85 90 95 Val Leu His Arg His Val His Arg His Asn Val Leu His Gly His Val             100 105 110 His Arg His Arg Val Leu His Lys His Val His Asn His Arg Val Leu         115 120 125 His Lys His Leu His Lys His Gln Val Leu His Gly His Val His Arg     130 135 140 His Gln Val Leu His Lys His Val His Asn His Arg Val Leu His Lys 145 150 155 160 His Leu His Lys His Gln Val Leu His Gly His Val His Thr His Arg                 165 170 175 Val Leu His Lys His Val His Lys His Arg Val Leu His Lys His Leu             180 185 190 His Lys His Gln Val Leu His Gly His Ile His Thr His Arg Val Leu         195 200 205 His Lys His Leu His Lys His Gln Val Leu His Gly His Val His Thr     210 215 220 His Arg Val Leu His Lys His Val His Lys His Arg Val Leu His Lys 225 230 235 240 His Leu His Lys His Gln Val Leu His Gly His Val His Met His Arg                 245 250 255 Val Leu His Lys His Val His Lys His Arg Val Leu His Lys His Val             260 265 270 His Lys His His Val Val His Lys His Val His Ser His Arg Val Leu         275 280 285 His Lys His Val His Lys His Arg Val Glu His Gln His Val His Lys     290 295 300 His His Val Leu His Arg His Val His Ser His His Val Val His Ser 305 310 315 320 His Val His Lys His Arg Val Val His Ser His Val His Lys His Asn                 325 330 335 Val Val His Ser His Val His Arg His Gln Ile Leu His Arg His Val             340 345 350 His Arg His Gln Val Val His Arg His Val His Arg His Leu Ile Ala         355 360 365 His Arg His Ile His Ser His Gln Ala Ala Val His Arg His Val His     370 375 380 Thr His Phe Glu Gly Asn Phe Asn Asp Asp Gly Thr Asp Val Asn Leu 385 390 395 400 Arg Ile Arg His Gly Ile Ile Tyr Phe Gly Gly Asn Thr Tyr Arg Leu                 405 410 415 Ser Gly Gly Arg Arg Arg Phe Met Thr Leu Trp Gln Glu Cys Leu Glu             420 425 430 Ser Tyr Gly Asp Ser Asp Glu Cys Phe Val Gln Leu Leu Glu Gly Asn         435 440 445 Gln His Leu Phe Thr Val Val Gln Gly His His Ser Thr Ser Phe Arg     450 455 460 Ser Asp Leu Ser Asn Asp Leu His Pro Asp Asn Asn Ile Glu Gln Ile 465 470 475 480 Ala Asn Asp His Val Asn Asp Ile Ala Gln Ser Thr Asp Gly Asp Ile                 485 490 495 Asn Asp Phe Ala Asp Thr His Tyr Asn Asp Val Ala Pro Ile Ala Asp             500 505 510 Val His Val Asp Asn Ile Ala Gln Thr Ala Asp Asn His Val Lys Asn         515 520 525 Ile Ala Gln Thr Ala His His His Val Asn Asp Val Ala Gln Ile Ala     530 535 540 Asp Asp His Val Asn Asp Ile Gly Gln Thr Ala Tyr Asp His Val Asn 545 550 555 560 Asn Ile Gly Gln Thr Ala Asp Asp His Val Asn Asp Ile Ala Gln Thr                 565 570 575 Ala Asp Asp His Val Asn Ala Ile Ala Gln Thr Ala Asp Asp His Val             580 585 590 Asn Ala Ile Ala Gln Thr Ala Asp Asp His Val Asn Asp Ile Gly Asp         595 600 605 Thr Ala Asn Ser His Ile Val Arg Val Gln Gly Val Ala Lys Asn His     610 615 620 Leu Tyr Gly Ile Asn Lys Ala Ile Gly Lys His Ile Gln His Leu Lys 625 630 635 640 Asp Val Ser Asn Arg His Ile Glu Lys Leu Asn Asn His Ala Thr Lys                 645 650 655 Asn Leu Leu Gln Ser Ala Leu Gln His Lys Gln Gln Thr Ile Glu Arg             660 665 670 Glu Ile Gln His Lys Arg His Leu Ser Glu Lys Glu Asp Ile Asn Leu         675 680 685 Gln His Glu Asn Ala Met Lys Ser Lys Val Ser Tyr Asp Gly Pro Val     690 695 700 Phe Asn Glu Lys Val Ser Val Val Ser Asn Gln Gly Ser Tyr Asn Glu 705 710 715 720 Lys Val Pro Val Leu Ser Asn Gly Gly Gly Tyr Asn Gly Lys Val Ser                 725 730 735 Ala Leu Ser Asp Gln Gly Ser Tyr Asn Glu Gly Tyr Ala Tyr             740 745 750 <210> 7 <211> 82 <212> PRT <213> Artificial Sequence <220> <223> fp-5 <400> 7 Lys His His His His His His Ser Ser Glu Glu Tyr Lys Gly Gly Tyr   1 5 10 15 Tyr Pro Gly Asn Thr Tyr His Tyr His Ser Gly Gly Ser Tyr His Gly              20 25 30 Ser Gly Tyr His Gly Gly Tyr Lys Gly Lys Tyr Tyr Gly Lys Ala Lys          35 40 45 Lys Tyr Tyr Tyr Lys Tyr Lys Asn Ser Gly Lys Tyr Lys Tyr Leu Lys      50 55 60 Lys Ala Arg Lys Tyr His Arg Lys Gly Tyr Lys Lys Tyr Tyr Gly Gly  65 70 75 80 Ser Ser         <210> 8 <211> 103 <212> PRT <213> Artificial Sequence <220> <223> fp-6 <400> 8 Ile Ala Ala Leu Cys Gly Ile Val Lys Ser Ile Asp Ser Asp Asp Ser   1 5 10 15 Asp Tyr Asp Tyr Lys Gly Arg Gly Tyr Cys Thr Asn Lys Gly Cys Arg              20 25 30 Ser Gly Tyr Asn Tyr Phe Gly Asn Lys Gly Tyr Cys Lys Tyr Gly Glu          35 40 45 Lys Ser Tyr Thr Tyr Asn Cys Asn Ser Tyr Ala Gly Cys Cys Leu Pro      50 55 60 Arg Asn Pro Tyr Gly Lys Leu Lys Tyr Tyr Cys Thr Asn Lys Tyr Gly  65 70 75 80 Cys Pro Asn Asn Tyr Tyr Phe Tyr Asn Asn Lys Gly Tyr Tyr Tyr Leu                  85 90 95 Glu His His His His His His             100 <210> 9 <211> 200 <212> PRT <213> Artificial Sequence <220> <223> fp-151 <400> 9 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro   1 5 10 15 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys              20 25 30 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr          35 40 45 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Pro Trp Ser Ser      50 55 60 Glu Glu Tyr Lys Gly Gly Tyr Tyr Pro Gly Asn Thr Tyr His Tyr His  65 70 75 80 Ser Gly Gly Ser Tyr His Gly Ser Gly Tyr His Gly Gly Tyr Lys Gly                  85 90 95 Lys Tyr Tyr Gly Lys Ala Lys Lys Tyr Tyr Tyr Lys Tyr Lys Asn Ser             100 105 110 Gly Lys Tyr Lys Tyr Leu Lys Lys Ala Arg Lys Tyr His Arg Lys Gly         115 120 125 Tyr Lys Lys Tyr Tyr Gly Gly Ser Ser Gly Ser Ala Lys Pro Ser Tyr     130 135 140 Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala 145 150 155 160 Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro                 165 170 175 Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro             180 185 190 Ser Tyr Pro Pro Thr Tyr Lys Leu         195 200 <210> 10 <211> 171 <212> PRT <213> Artificial Sequence <220> <223> fp-131 <400> 10 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro   1 5 10 15 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys              20 25 30 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr          35 40 45 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Pro Trp Ala Asp      50 55 60 Tyr Tyr Gly Pro Lys Tyr Gly Pro Pro Arg Arg Tyr Gly Gly Gly Asn  65 70 75 80 Tyr Asn Arg Tyr Gly Arg Arg Tyr Gly Gly Tyr Lys Gly Trp Asn Asn                  85 90 95 Gly Trp Lys Arg Gly Arg Trp Gly Arg Lys Tyr Tyr Gly Ser Ala Lys             100 105 110 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr         115 120 125 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser     130 135 140 Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys 145 150 155 160 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Leu                 165 170 <210> 11 <211> 175 <212> PRT <213> Artificial Sequence <220> <223> fp-353 <400> 11 Pro Trp Ala Asp Tyr Tyr Gly Pro Lys Tyr Gly Pro Pro Arg Arg Tyr   1 5 10 15 Gly Gly Gly Asn Tyr Asn Arg Tyr Gly Arg Arg Tyr Gly Gly Tyr Lys              20 25 30 Gly Trp Asn Asn Gly Trp Lys Arg Gly Arg Trp Gly Arg Lys Tyr Tyr          35 40 45 Pro Trp Ser Ser Glu Glu Tyr Lys Gly Gly Tyr Tyr Pro Gly Asn Thr      50 55 60 Tyr His Tyr His Ser Gly Gly Ser Tyr His Gly Ser Gly Tyr His Gly  65 70 75 80 Gly Tyr Lys Gly Lys Tyr Tyr Gly Lys Ala Lys Lys Tyr Tyr Tyr Lys                  85 90 95 Tyr Lys Asn Ser Gly Lys Tyr Lys Tyr Leu Lys Lys Ala Arg Lys Tyr             100 105 110 His Arg Lys Gly Tyr Lys Lys Tyr Tyr Gly Gly Ser Ser Gly Ser Ala         115 120 125 Asp Tyr Tyr Gly Pro Lys Tyr Gly Pro Pro Arg Arg Tyr Gly Gly Gly     130 135 140 Asn Tyr Asn Arg Tyr Gly Arg Arg Tyr Gly Gly Tyr Lys Gly Trp Asn 145 150 155 160 Asn Gly Trp Lys Arg Gly Arg Trp Gly Arg Lys Tyr Tyr Gly Ser                 165 170 175 <210> 12 <211> 187 <212> PRT <213> Artificial Sequence <220> <223> fp-153 <400> 12 Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro   1 5 10 15 Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys              20 25 30 Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr          35 40 45 Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Pro Trp Ser Ser      50 55 60 Glu Glu Tyr Lys Gly Gly Tyr Tyr Pro Gly Asn Thr Tyr His Tyr His  65 70 75 80 Ser Gly Gly Ser Tyr His Gly Ser Gly Tyr His Gly Gly Tyr Lys Gly                  85 90 95 Lys Tyr Tyr Gly Lys Ala Lys Lys Tyr Tyr Tyr Lys Tyr Lys Asn Ser             100 105 110 Gly Lys Tyr Lys Tyr Leu Lys Lys Ala Arg Lys Tyr His Arg Lys Gly         115 120 125 Tyr Lys Lys Tyr Tyr Gly Gly Ser Ser Gly Ser Ala Asp Tyr Tyr Gly     130 135 140 Pro Lys Tyr Gly Pro Pro Arg Arg Tyr Gly Gly Gly Asn Tyr Asn Arg 145 150 155 160 Tyr Gly Arg Arg Tyr Gly Gly Tyr Lys Gly Trp Asn Asn Gly Trp Lys                 165 170 175 Arg Gly Arg Trp Gly Arg Lys Tyr Tyr Gly Ser             180 185 <210> 13 <211> 187 <212> PRT <213> Artificial Sequence <220> <223> fp-351 <400> 13 Pro Trp Ala Asp Tyr Tyr Gly Pro Lys Tyr Gly Pro Pro Arg Arg Tyr   1 5 10 15 Gly Gly Gly Asn Tyr Asn Arg Tyr Gly Arg Arg Tyr Gly Gly Tyr Lys              20 25 30 Gly Trp Asn Asn Gly Trp Lys Arg Gly Arg Trp Gly Arg Lys Tyr Tyr          35 40 45 Pro Trp Ser Ser Glu Glu Tyr Lys Gly Gly Tyr Tyr Pro Gly Asn Thr      50 55 60 Tyr His Tyr His Ser Gly Gly Ser Tyr His Gly Ser Gly Tyr His Gly  65 70 75 80 Gly Tyr Lys Gly Lys Tyr Tyr Gly Lys Ala Lys Lys Tyr Tyr Tyr Lys                  85 90 95 Tyr Lys Asn Ser Gly Lys Tyr Lys Tyr Leu Lys Lys Ala Arg Lys Tyr             100 105 110 His Arg Lys Gly Tyr Lys Lys Tyr Tyr Gly Gly Ser Ser Gly Ser Ala         115 120 125 Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro     130 135 140 Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro 145 150 155 160 Ser Tyr Pro Pro Thr Tyr Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr                 165 170 175 Lys Ala Lys Pro Ser Tyr Pro Pro Thr Tyr Lys             180 185 <210> 14 <211> 7 <212> PRT <213> Artificial Sequence <220> DBP <400> 14 Lys Trp Lys Trp Lys Lys Ala   1 5 <210> 15 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> polyR <400> 15 Arg Arg Arg Arg Arg Arg Arg Arg Arg Arg   1 5 <210> 16 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> penetratin <400> 16 Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys   1 5 10 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> fp-1 variant primer F <400> 17 catatggcga aaccgagc 18 <210> 18 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> DBP primer R <400> 18 ctcgagttac gcttttttcc atttccattt cttgtacgtt ggaggataag aag 53 <210> 19 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> polyR primer R <400> 19 ctcgagttag cggcggcggc ggcggcggcg gcggcgcttg tacgttggag gataagaag 59 <210> 20 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Penetratin primer R <400> 20 ctcgagttat tttttccatt tcatgcggcg gttctgaaac caaattttaa tctggcgctt 60 gtacgttgga ggataagaag 80

Claims (11)

A fusion protein for gene or drug delivery, in which a functional peptide is fused to a mussel adhesive protein.
The method of claim 1,
The mussel adhesive protein is a protein consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 or selected from the group A fusion protein, characterized in that one or more amino acid sequences are linked.
The method of claim 1,
The mussel adhesive protein is a fusion protein, characterized in that 10 to 100% of the total tyrosine residues modified with dopa (DOPA).
The method of claim 1,
The functional peptide consists of a DNA binding peptide (DNA binding peptide, DBP), cell penetrating peptide (CPP), penetratin (penetratin), nuclear localization signal (NLS) and T-ag peptide A fusion protein, characterized in that at least one selected from the group.
A method of making a fusion protein-based nanoparticle for gene or drug delivery, comprising the following steps:
(a) mixing the fusion protein of any one of claims 1 to 4 and a polyelectrolyte capable of a polyion complex with the fusion protein; And
(b) mixing and electrospinning the target gene or drug loaded in the nanoparticles into the mixture of step (a).
The method of claim 5,
The polyelectrolyte is a polyphosphate, characterized in that the manufacturing method of the fusion protein-based nanoparticles for gene or drug delivery.
The method of claim 6,
The polyphosphate is one species selected from the group consisting of sodium tripolyphosphate (TPP), sodium pyrophosphate (PP), sodium trimetaphosphate (STP), and sodium hexametaphosphate (SHMP), gene or drug Method of making fusion protein-based nanoparticles for delivery.
The method of claim 5,
The target gene is characterized in that the plasmid, mRNA, RNA, DNA or a combination thereof, a method for producing a fusion protein-based nanoparticles for gene or drug delivery.
The method of claim 5,
The drug is a low molecular weight drug, a gene drug, a protein drug, an antibody drug, a synthetic compound drug or a combination thereof, characterized in that the gene or drug delivery fusion protein-based nanoparticles manufacturing method.
Fusion protein-based nanoparticles for gene or drug delivery, produced according to the method of claim 5.
A fusion protein in which a functional peptide for gene delivery is linked to a mussel adhesive protein (MAP); A polyelectrolyte capable of forming a fusion complex with the fusion protein; And a fusion protein-based nanoparticle for gene delivery, comprising a gene of interest; CRISPR / Cas9 gene editing system.

Images