KR20190111582A - Lactobacillus paracasei having anti-inflammatory effects on intestinal epithelial cells, and compositions for treating and preventing inflammatory bowel disease comprising thereof - Google Patents

Abstract

The present invention relates to novel lactic acid bacteria having an intestinal anti-inflammatory effect. More specifically, the present invention relates to a Lactobacillus paracasei BioE LP08 strain which is excellent in acid resistance, bile tolerance, intestinal adhesion and antibiotic sensitivity, and inhibits expression and secretion of inflammatory cytokines of intestinal epithelial cells; and a composition for treating and preventing inflammatory bowel disease, containing the strain as an active ingredient.

Description

Lactobacillus paracasei having anti-inflammatory effects on intestinal epithelial cells, and compositions for treating and preventing inflammatory bowel disease comprising

The present invention relates to a novel lactic acid bacterium having an intestinal anti-inflammatory effect, more specifically, Lactobacillus paracay strains that have excellent intestinal adhesion and inhibit the expression and secretion of inflammatory cytokines of intestinal epithelial cells, and contain the same as an active ingredient. It relates to a composition for treating and preventing inflammatory bowel disease.

Inflammatory Bowel Disease (IBD) is a chronic intestinal inflammatory disease including Ulcerative Colitis (UC) and Crohn's Disease (Shanahan F: Inflammatory bowel disease: immunodiagnostics, immunoothera peutics and ecotherapeutics. Gastroenterol. 120: 622-635.2001), which is associated with repeated recurrences in the digestive system without specific etiology, impaired cell walls caused by intestinal antibodies, or abnormal immune responses of pathogens of colonic epithelial cells and intestinal flora. It is promoted by the back means that the inflammation of the digestive system.

Inflammatory bowel disease is a global disease. Recently, the number of patients suffering from ulcerative colitis has increased continuously in Asian countries and developing countries including Korea. Crohn's disease, a representative inflammatory bowel disease, is a chronic refractory inflammatory bowel disease that can invade the entire gastrointestinal tract from the oral cavity to the anus and involves weight loss. It can be caused by a combination of genetic and environmental factors and lasts for a lifetime, but the cause is not clear. As with ulcerative colitis, Crohn's disease has been continuously increasing in recent years in Korea and other Asian countries. Chronic inflammatory bowel disease is unknown cause of the disease, and the continuous increase of the onset is causing social and economic burden.

The cause and pathophysiology of inflammatory bowel disease are not known yet, but genetic factors, environmental factors such as intestinal bacteria and foods, and immunological factors are thought to be involved in the complex mechanism of development. Probiotics (live probiotics) is a living lactic acid bacteria that have a beneficial effect on health when taken by humans, and a lot of research has recently been done on the effects of probiotics in the treatment of inflammatory bowel disease. According to Matsumoto S. et al., Lactobacillus casei inhibits the release of IL-6 in the mononuclear cell model of the colonic lamina propria mononuclear cell induced inflammatory response with lipopolysaccharide (LPS) and NF in SAMP1 / Yit mice. It has been reported to reduce the metastasis of -κB to the nucleus (Matsumoto, S., et al. 2005. Clin Exp Immunol. 140: 417-426).

Intestinal epithelial cells secrete many regulatory substances in the immune response. Antimicrobial peptides include defensin and mucin, chemokines and cytokines such as IL-8, IL-6 and IL-1β. The secretion of (cytokine) causes an inflammatory reaction.

Thus, the inventors of the present invention while studying the strains of lactic acid bacteria that can be applied to the treatment of inflammatory bowel disease, and discovered the lactic acid bacteria strains that have the effect of mitigating inflammation through inhibition of inflammation-related cytokines, these strains are superior to other lactic acid strains It was found that there is an intestinal adhesion and anti-inflammatory effect, the present invention was completed.

Therefore, the main object of the present invention is to provide Lactobacillus paracasei BioE LP08 (( Lactobacillus paracasei BioE LP08) having intestinal adhesion and intestinal anti-inflammatory activity.

Another object of the present invention to provide a pharmaceutical composition for treating and preventing inflammatory bowel disease using the lactic acid bacteria.

Another object of the present invention to provide a food composition for improving and preventing inflammatory bowel disease using the lactic acid bacteria.

The present invention is characterized by having intestinal anti-inflammatory activity Lactobacillus paracasei BioE LP08 (Accession No .: KCTC 18629P) strain is provided.

The strain is excellent in intestinal adhesion, acid resistance and bile resistance, and can inhibit IL-6 and TNF-α secretion of intestinal epithelial cells.

The present inventors isolated lactic acid bacteria from feces of infants to isolate strains having intestinal anti-inflammatory activity, and tested the acid resistance and bile resistance ability of these lactic acid bacteria. As a result, the Lactobacillus paracasei BioE LP08 of the present invention is conventionally acid resistant. And Lactobacillus rhamnosus GG ( Lactobacillus rhamnosus GG) is known to be excellent in bile resistance ability is significantly superior intestinal adhesion capacity.

The present invention provides a mechanical composition for treating and preventing inflammatory bowel disease, which contains Lactobacillus paracasei BioE LP08 (Accession Number: KCTC 18629P) as an active ingredient.

The composition may have an effect of treating and preventing inflammatory bowel disease by inhibiting IL-6 and TNF-α secretion of intestinal epithelial cells.

The Lactobacillus paracasei BioE LP08 strain is harmless to humans because it does not show hemolytic toxicity and does not have antibiotic resistance. And it can be used as a probiotic that can settle and colonize the intestine and perform its functions. Furthermore, since it has excellent intestinal adhesion and has an effect of inhibiting secretion of IL-6 as an indicator of intestinal inflammatory cytokines such as the degree of inflammation, it can be used for the treatment and prevention of inflammatory bowel disease.

Inflammatory bowel disease may also be selected from the group consisting of Crohn's disease, ulcerative colitis and intestinal behcet's disease.

The pharmaceutical composition for treating and preventing inflammatory bowel disease of the present invention may be administered orally or parenterally during clinical administration, and in humans, a typical daily dosage may range from 1 to 30 mg / kg body weight. It may be administered once, or in divided doses. However, the actual dosage should be determined in light of several relevant factors such as the route of administration, the age, sex and weight of the patient, health condition and severity of the disease. In addition, one or two or more pharmaceutically acceptable conventional carriers or one or two or more additives may be selected in an effective amount of the strain or a culture supernatant or probiotic thereof as a main component to prepare a composition of a conventional pharmaceutical formulation. Can be.

The carrier may be used by selecting one or two or more from a diluent, a lubricant, a binder, a disintegrant, a sweetener, a stabilizer, and a preservative, and as an additive, one or two or more of flavors, vitamins, and antioxidants. You can choose to use it.

In the present invention, the carrier and the additive may be used in any pharmaceutically acceptable, specifically, as a diluent lactose (lactose monohydrate), corn starch (cornstarch), soybean oil (soybean oil), microcrystalline cellulose (microcrystalline cellulose) ) Or mannitol (D-mannitorl) is preferable, magnesium stearate or talc is preferred as a lubricant, polyvinyipyrolidone (PVP: polyvinyipyrolidone) or hydroxypropyl cellulose (HPC :) hydroxypropylcellulose). In addition, the disintegrant may be selected from among carboxymethylcellulose calcium (Ca-CMC), sodium starch glycolate, polyacrylin potassium or cross-linked polyvinylpyrrolidone. Preferably, the sweetening agent is selected from sucrose, fructose, sorbitol or aspartame, and as a stabilizer, carboxymethylcellulose sodium (Ma-CMC), beta-cyclodextrin, It is selected from white bee's wax or xanthan gum, and preservatives include methyl p-hydroxy benzoate (methhlparaben), propyl p-hydroxy benzoate (propylparaben), or sorbic acid. It is preferable to select from potassium sorbate.

The pharmaceutical composition of the present invention is used for the purpose of efficiently treating or preventing inflammatory bowel disease, and is not particularly limited in its formulation, and may be used as a beverage, powder, capsule, soft capsule, tablet, gum, or adhesive type liquid composition. It may be used in a transdermal dosage form such as lotion, ointment, gel, cream, patch or spray, and may be used in the preparation of powders, pills, tablets, powders, granules and the like.

In the pharmaceutical composition of the present invention, in addition to the above-mentioned main components, mineral-containing compounds such as vitamins B, C, E, beta-carotene, Ca, Mg, and Zn, phospholipids such as lecithin, or compounds such as maltol, oligosaccharides, and amino acids may be used. Can be.

The present invention provides a dietary supplement for improving and preventing inflammatory bowel disease containing Lactobacillus paracasei BioE LP08 (Accession Number: KCTC 18628P) as an active ingredient.

The inflammatory bowel disease may be selected from the group consisting of Crohn's disease, ulcerative colitis and intestinal behcet's disease.

Examples of the food composition containing lactic acid bacteria include foods for the purpose of improving and preventing inflammatory bowel disease, such as tea, jelly, juice, extract, and beverage, which contain the lactic acid bacteria as an active ingredient. The food composition for preventing inflammatory bowel disease of the present invention processed in various forms as described above is easy to take and can be stored for a long time without any side effects on the human body.

When the strain of the present invention or the culture supernatant thereof is used as a food additive, each of the extracts may be used as it is or may be used together with other food or food ingredients, and may be appropriately used according to a conventional method. The mixed amount of the active ingredient may be appropriately determined depending on the purpose of use (prevention, health or therapeutic treatment). In general, in the preparation of food or beverage, the strain of the present invention or the culture supernatant thereof is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less based on 100 parts by weight of the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

There is no particular limitation on the kind of food. Examples of the food to which the strain of the present invention or the culture supernatant thereof may be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionary, pizza, ramen, other noodles, gums and ice cream, Various soups, beverages, teas, drinks, alcoholic beverages and vitamin complexes, etc., and includes all foods in the usual sense.

The food composition of the present invention may contain various flavors, natural carbohydrates, and the like as additional ingredients, as in general beverages. Natural carbohydrates described above are glucose, monosaccharides such as fructose, maltose, disaccharides such as sucrose, and polysaccharides such as dextrin, cyclodextrin, sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetening agent, natural sweetening agents such as tautin and stevia extract, synthetic sweetening agents such as saccharin, aspartame, and the like can be used.

According to the present invention, Lactobacillus paracasei BioE LP08 (Accession Number: KCTC 18629P) can effectively inhibit inflammatory cytokines of inflammation-induced epithelial cells and has excellent intestinal adhesion. Therefore, the lactic acid bacteria strain of the present invention suggests a possibility as an intestinal anti-inflammatory material, and can be effectively used for the treatment and prevention of inflammatory bowel disease.

Figure 1a shows the 16S rRNA sequence of the Lactobacillus paracasei BioE LP08 (KCTC 18629P) strain of the present invention, Figure 1b shows the homology and homology of the 16S rRNA sequence of the Lactobacillus paracasei BioE LP08 of the present invention and related species Phylogenetic relationship is a comparative schematic.
2 is a gel electrophoresis analysis of the genome DNA of the Lactobacillus paracasei BioE LP08 strain of the present invention.
Figure 3 is the result of measuring the enteric adhesion of the Lactobacillus paracasei BioE LP08 strain of the present invention.
Figure 4a is a result of the analysis of hemolytic activity (hemolytic activity) of the Lactobacillus paracasei BioE LP08 strain of the present invention, Figure 4b is a result of measuring the antibiotic resistance of the Lactobacillus paracasei BioE LP08 strain of the present invention.
5 and 6 are the results confirming the secretion effect of TNF-α (Fig. 5) in intestinal epithelial cell culture by lactic acid bacteria treatment using ELISA of Lactobacillus paracasei BioE LP08 strain of the present invention.
Figure 6 is a result of confirming the effect of IL-6 secretion in intestinal epithelial cell culture by lactic acid bacteria treatment using ELISA of Lactobacillus paracasei BioE LP08 strain of the invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. Since these examples are only for illustrating the present invention, the scope of the present invention is not to be construed as being limited by these examples.

Isolation and Identification of Strains

Example 1-1. Selection of Strains

After serial dilution of 1 g of Korean feces in sterile anaerobic water, 1 ml of dilution was poured into MRS (BD, USA) solid medium and incubated under anaerobic conditions for 3 days. The resulting colonies were transferred to lactic acid bacteria medium to which MRS (Difco, 55g / 1L) and M17 (Difco, 19g / 1L) were added, followed by incubation at 37 ° C. for 18 hours. After selecting a single colony, biochemical and molecular biological identification was performed, and one strain having excellent functional and safety characteristics was finally selected.

Example 1-2. Isolation and Identification of Lactic Acid Bacteria

One) Morphological Analysis and Biochemical Properties

Selected lactic acid bacteria of the present invention were cultured in MRS plate medium and the morphology of the colonies were observed under a microscope by gram-staining. Colony forms of the selected lactic acid bacteria are shown in Table 1 below, and biochemical characteristics are shown in Table 2 below.

L.paracseiBioE LP08 shape circle size 1.5-2mm color White Opacity opacity surface lubricity

L.paracsei BioE LP08 Gram dyeing

Cell morphology Bacillus Anaerobic growth positivity motility voice Aerobic growth positivity

2) 16s rRNA sequencing analysis

Genome DNA was extracted from the selected strains and 16s rRNA sequences were analyzed. Genomic DNA was extracted from 1 ml of pure culture medium of fecal strain by using Intron G-spin genomic DNA extraction kit (Intron, Seoul, Korea). Using the extracted DNA as a template, each strain was identified by DNA sequencing (Macrogen) by PCR using a primer F (AGAGTTTGATCMTGGCTCAG) and primer R (TACGGYTACCTTGTTACGACTT). DNA sequencing showed 99% homology with L. paracasei (JCM 8130) using multiple sequence alignment of the Clustal Omega program.

3) PCR profile

Genome DNA was extracted from strains isolated from baby feces, and PCR was performed using L.paracasei BioE LP08 F (ACATCAGTGTATTGCTTGTCAGTGAATAC) and R (CCTGCGGGTACTGAGATGTTTC) primers as templates. When the PCR product, the final product, and L. paracasei (KCTC3510), which is a control group of the corresponding strain, were analyzed by electrophoresis, as shown in FIG. Showed a pattern.

4) sugar usability analysis

The sugar availability was confirmed using the API 50 CHL Carbohydrate Test Kit (BioMerieux Co., France) for strains isolated from baby feces. After incubating for 18 hours at 37 ° C. in 10 ml of Man-Rogosa-Sharpe (MRS) liquid medium, 1 ml of the culture was recovered and washed twice with CHL solution. The cells were then collected by centrifugation and resuspended in 9 ml of CHL solution. 150 μl of strain suspension was placed in each well of the API 50 CHL kit, and then autoclaved paraffin oil was dispensed onto strain suspensions in the wells. After culturing at 37 ° C. for 3 days, the sugar availability was compared. The change of color by microbial growth was observed for 49 carbon sources, and the use of each carbon source was observed. The final identification result was confirmed by inputting to the identification program API web ( https://apiweb.biomerieux.com ). , As a result of the identification, it was shown that the same as 99.3% with Lactobacillus paracasei as shown in Table 3.

Lactobacillus paracasei BioE LP08

Based on the above results, the strain was named as ““ Lactobacillus paracasei BioE LP08 ”” strain, and it was deposited on October 31, 2017 to the microbial resource center (KCTC), a depositing institution for Korean patent strains. Accession number KCTC 18629P was assigned.

Example 1-3. Determination of Acid and Bile Resistance of Probiotics

In order to test the acid resistance and bile resistance of the L. paracasei BioE LP08 strain isolated and selected in Example 1-5, it was inoculated in MRS liquid medium. After incubation for 24 hours at 37 ℃ centrifuged for 25 minutes at 13000rpm to recover the strain. Then, the isolated strain recovered in MRS liquid medium adjusted to pH 3.0 with HCL was inoculated at a concentration of 1.0 X 10 CFU / ml and incubated for 2 hours at 30 ℃. After 2 hours, each strain was recovered, diluted in sterile saline, plated on MRS plate medium, incubated for 48 hours at 37 ° C, and the number of viable cells was measured by counting the number of colonies on the plate medium. (Table 4).

Example 1-4. Intestinal adhesion measurement of probiotics

Intestinal epithelial cells, Caco-2 cells, were used in cell line banks. Caco-2 cells were treated at 37 ° C. in the presence of 5% CO ₂ using MEM (Corning, USA) medium supplemented with 20% fetal bovine serum (FBS), penicillin (100 IU / mL) and streptomycin (100 mg / mL). Incubated at. For intestinal adhesion experiments, Caco-2 cells were dispensed into 6well plates at a number of 1.5 X 10 ⁵ cells / mL per well, and were used for experiments when a monolayer was formed every other day. Caco-2 cells were changed to non-serum and antibiotic-free medium 1 hour before the experiment, and used after washing three times with PBS at 25 ° C. After washing, 0.5 ml of non-serum and antibiotic-free MEM medium was added, and 5 kinds of lactic acid bacteria were suspended in the medium to a concentration of 1 × ^{10 8} CFU / ml, and 0.5 ml was inoculated again on Caco-2 cells. Incubated at 37 ° C. for 2 hours in the presence of% CO ₂ . After the incubation was completed, the washing was performed three times using PBS buffer to confirm the adhesion ability of the non-attached lactic acid bacteria and washing. After washing, 1% triton X-100 was dispensed to remove the adhered cells, plated onto MRS-agar by continuous dilution using peptone water, and cultured at 37 ° C. for 48 hours to measure the number of bacteria. Lactobacillus rhamnosus GG ( Lactobacillus rhamnosus GG) was used as a positive control to compare the adhesion ability after 2 hours, and the bacteria having the same or higher adhesion ability than the GG strain by converting the number of bacteria into log values were obtained. Evaluated. The results are shown in FIG. Figure 3 is the result of measuring the enteric adhesion of the isolated lactic acid bacteria.

In FIG. 3, L. paracasei BioE LP08 showed intestinal adhesion similar to Lactobacillus rhamnosus GG, a positive control.

Example 1-5. Hemolytic test

 The hemolysis test (hemolysis test) is to confirm that the lactic acid bacteria are not hemolytic toxicity in the human body, was tested for hemolytic, which is the phenomenon of destruction or degradation of red blood cells. By the method of Baumgartner et al., The test strains were grown in MRS medium supplemented with 5% horse blood and incubated for 48 hours at 37 ° C. under anaerobic conditions. Hemolysis was determined by the generation of transparent rings around the cells. As a result of examining the hemolyticity of the strain of the present invention, as confirmed through Figure 4a, it was confirmed that the Lactobacillus paracasei BioE LP08 strain is harmless to the human body because hemolytic activity against horse blood.

Example 1-6. Antibiotic Resistance Assessment

Isolated from baby feces In order to confirm the antibiotic resistance pattern for Lactobacillus paracasei BioE LP08 ( L.paracasei BioE LP08 ), a disk dispenser was used, a system capable of automatically dispensing discs onto plates. Experiments showed that our strains were divided into MRS agar, E. coli (ATCC 25922, control strain) in 20 ml petridish with 100 μl of 1 × ^{10 8} CFU / ml of bacteria in Mueller-Hinton agar, and then containing antibiotics. After inoculation of the disc, the inhibition ring was measured to confirm susceptibility. Antibiotic susceptibility identified was ampicillin (AMP), ciprofloxacin (CIP), vancomycin (VAN), gentamacin (GEN), kanamycin (KAN), streptomycin (SMN), erythromycin (ERY), clindamycin (CLM), tetracycline (CLM) TET), chloramphenicol (CHL), imipenem (IPM), trimethoprim (TMP), and rifampin (RIF), and 13 types of resistant and moderately susceptible (according to the Clinical and Laboratory Standards Institute). Intermediate) and Sensitive. As a result of examining the antibiotic resistance pattern of the strains, in Figure 4b, the control of E. coli among the five lactic acid bacteria evaluated showed sensitivity to seven (AMP, CIP, CHL, GMN, IPM, TET, TMP), L. paracasei BioE LP08 was not resistant to 7 species (AMP, CHL, CMN, ERY, IPM, RIF, TET), confirming its applicability to probiotics.

Example 1-7. Inhibition of IL-6 Cytokine and TNF-α Secretion in Probiotics by ELISA

In order to quantify the amount of IL-6 and TNF-α contained in the cell culture, the IL-6 and TNF-α immunoassay kits were used to measure the ELISA reader.

The results are shown in FIGS. 5 and 6. 5 and 6 show the results of confirming the secretion effect of IL-6 and TNF-α in the immune macrophages (Raw264.7 cells) culture medium by treatment with lactic acid bacteria using ELISA. Immune Macrophages Raw 264.7 Cells It was used as a cell line bank (ATCC). Raw 264.7 cells were cultured at 37 ° C. in the presence of 5% CO ₂ using MEM (Corning, USA) medium supplemented with 10% fetal bovine serum (FBS), penicillin (100 IU / mL) and streptomycin (100 mg / mL). Incubated. To confirm anti-inflammatory activity, Raw264.7 cells were aliquoted into a 24 well plate at a number of 2.5 X 10 ⁵ cells / mL per well, and after 4 hours, the cells were changed to non-serum and antibiotic-free medium. Add 0.25 ml of MEM medium without serum and antibiotics, suspend LPS (5 lactic acid bacteria in a medium to a concentration of 1 × ^{10 8} CFU / ml) and inoculate 0.3 ml again on Raw264.7 cells Incubated for 24 hours at 37 ° C. in the presence of CO ₂ , After the incubation was completed, the supernatant was harvested and centrifuged to remove the supernatant and used for immunoassay L. paracasei BioE-LP08 was proinflammatory in cell culture compared to LPS self-stimulation. The inhibitory effect of the markers IL-6 (Fig. 6) and TNF-α (Fig. 5) was found to be significantly superior (P <0.001) TLR (Toll Like) plays the most important role in the innate immunity Receptor) is a pathogenic microorganism Recognizes pathogen-associated molecular patterns, and TLR4 activates IKK by recognizing gram-negative lipopolysaccharide (LPS), which activates NF-kB, and is a pro-inflammatory cytokine (pro-inflammatory cytokine). It is known to stimulate the secretion of IL-6, TNF-α, etc. to cause an inflammatory response (Jan Buer et al., 2003. Nature review., 4: 195-205). Cytokines are representative hormones for human immunity and immune-related cells. It directly affects the differentiation and function of interleukin-10 (IL-10), which has anti-inflammatory effects, and interleukin-6, TNF-α, etc., promotes inflammation.

Korea Research Institute of Bioscience and Biotechnology KCTC18629P 20171031

Claims (7)

Characterized by having intestinal anti-inflammatory activity Lactobacillus paracasei BioE LP08 (Accession Number: KCTC 18629P) strain. According to claim 1, The strain Lactobacillus paracaze BioE LP08 (trusted) is characterized by excellent intestinal adhesion, acid resistance and bile resistance, and inhibits IL-6, TNF-α secretion of intestinal epithelial cells Number: KCTC 18629P) strain.  Epidemiological composition for the treatment and prevention of inflammatory bowel disease containing Lactobacillus paracasei BioE LP08 (Accession No .: KCTC 18629P) strain as an active ingredient. According to claim 3, wherein the composition is an epidemiological composition for treating and preventing inflammatory bowel disease, characterized in that by inhibiting IL-6, TNF-α secretion of intestinal epithelial cells. The pharmaceutical composition of claim 4, wherein the inflammatory bowel disease is selected from the group consisting of Crohn's disease, ulcerative colitis, and intestinal behcet's disease. Lactobacillus paracasei BioE LP08 (Accession No .: KCTC 18629P) A health functional food for improving and preventing inflammatory bowel disease containing the strain as an active ingredient. The health functional food according to claim 6, wherein the inflammatory bowel disease is selected from the group consisting of Crohn's disease, ulcerative colitis and intestinal behcet's disease.

Images