KR20190109349A - A Composition comprising extracts or isolated compounds of Cephalotaxus koreana for prevention or treatment of autoimmune diseases - Google Patents

Abstract

A Cephalotaxus koreana extract, a fraction thereof or a compound isolated from the same of the present invention interferes with a signal transduction pathway of a pathway of type 1 interferon, thereby being able to be usefully used for preventing or treating autoimmune diseases related to the pathway. A composition containing the Cephalotaxus koreana extract, homoharringtonine (HHT), which is an ester alkaloid compound isolated therefrom or harringtonine (HT) as an active component interferes with the pathway of type 1 interferon and can interfere with the interaction of STING protein with TBK1 protein.

Description

{A Composition comprising extracts or isolated compounds of Cephalotaxus koreana for prevention or treatment of autoimmune diseases}

The present invention relates to a composition for the prevention or treatment of autoimmune diseases containing the extract or a compound isolated therefrom as an active ingredient.

The immune system recognizes foreign pathogens such as viruses, bacteria and parasites and activates various signaling pathways, triggering an inflammatory response. Among them, the recognition of cytoplasmic DNA activates host defense mechanisms, particularly triggering the production of type I interferon (IFN). In the network of signaling molecules, the stimulator of interferon genes (STING) protein, a protein present in the endoplasmic reticulum (ER), is essential to activate the type I IFN signaling pathway in response to cytoplasmic DNA. It is an adapter protein. STING is mainly expressed in macrophages, dendritic cells, endothelial cells, T cells and fibroblasts. After recognizing cytoplasmic DNA, STING is relocalized into the nucleus with TBK1, which promotes phosphorylation of IRF3, leading to type I IFN production. The carboxyl terminus of STING is important for activating TBK1 and recruiting IRF3.

Cyclic di-GMP, a secondary messenger produced by bacteria, is known to bind directly to STING. In the process of recognizing intracellular DNA, cGAMP (cyclic guanosine monophosphate-adenosine monophosphate) synthase (cGAS) functions as a cytoplasmic DNA sensor and activates the reaction between GTP and ATP, which binds to STING and stimulates the synthesis of type 1 IFN. Induces the formation of an endogenous secondary messenger, cGAMP.

Errors in recognition of self-DNA cause the production of autoantibodies and overproduction of cytokines including CXCL10, IFN-β and TNF-α. Incompletely degraded DNA from cells undergoing apoptosis and necrosis due to lack of lysosome function is impaired in the regulation of innate immune response through TLR-independent pathway and systemic lupus erythematosus (systemic lupus erythematosus). lupus erythematosus (SLE) and autoimmune diseases such as chronic polyarthritis and interferonopathy. In early studies, DNase II knockout mice with markedly elevated levels of IFN-ß and other cytokines either died or showed signs of arthritis. Since cytokine levels and polyarthritic lesions are significantly reduced in Dnase II and STING double knockout mice, STING is believed to be involved in the overproduction of inflammatory cytokines by their own DNA. In addition, mutations in TREX1 (3' repair exonuclease 1), previously known as Dnase III, appear to cause autoimmune diseases through interaction with STING. TREX1 breaks down double-stranded DNA in cells and negatively regulates STING-dependent innate immune responses. Functional deficiency of TREX1 causes DNA accumulation and activation of immune responses, and an example of an IFN-related autoimmune disease caused by mutations in the TREX1 gene is Aicardi-Goutieres Syndrome (AGS). Autoimmune diseases caused by these TREX1 mutations can be overcome by functional deficiency of IRF3 or type I interferon receptor (IFNR). Accordingly, a method of suppressing the type I interferon response to self-DNA by targeting STING can be an effective strategy in treating autoimmune diseases.

Cephalotaxus koreana ) is a plant distributed in China, East India, Thailand, Japan, and Korea, and is also referred to as soil ratio (土香榧). In oriental medicine, it has been used for the treatment of diseases such as alluvial redness caused by parasites accumulated by parasites, and ailments such as pulmonary seawater (肺燥咳嗽), which is arising from drying out of the lungs. Trees are used to treat infections and tumors. Cephalotaxus plants are known to contain alkaloid components such as Homoharringtonine (HHT), Harringtonine (HT) and Cephalotaxine (CET). Cephalotaxin esters homoharingtonin and haringtonin are used to treat leukemias such as chronic myeloid leukemia (CML), acute myeloid leukemia (AML), and myelodysplastic syndrome (MDS). Has been found to be effective.

European Patent Registration No. 0203386

An object of the present invention is the cephalotaxus tree (Cephalotaxus koreana ) It is to provide a composition for preventing or treating autoimmune diseases, containing an extract or a fraction thereof as an active ingredient.

In order to achieve the above object, the present invention is a barberry (Cephalotaxus koreana ) It provides a pharmaceutical composition for preventing or treating autoimmune diseases, containing an extract or a fraction thereof as an active ingredient.

In addition, the present invention provides a health functional food for improving autoimmune diseases, containing the extract or a fraction thereof as an active ingredient.

In addition, the present invention comprises a homoharingtonin (Homoharringtonine; HHT) compound, a Harringtonine (HT) compound or a pharmaceutically acceptable salt of the compound as an active ingredient, a pharmaceutical for the prevention or treatment of autoimmune diseases The composition is provided.

In addition, the present invention provides a health functional food for improving autoimmune diseases, comprising a homoharingtonin compound, a haringtonin compound, or a pharmaceutically acceptable salt of the compound as an active ingredient.

Cephalotaxus of the present invention koreana ) A composition comprising an extract or an ester alkaloid compound isolated therefrom, Homoharringtonine (HHT) or Harringtonine (HT) as an active ingredient, interferes with the type 1 interferon pathway, and STING protein It was confirmed that it can interfere with the interaction of the TBK1 protein. Accordingly, the extract or a compound isolated therefrom may be usefully used for the prevention or treatment of autoimmune diseases related to the type 1 interferon pathway.

1 is a diagram showing the activation of the IFN-β promoter induced by STING by the extract of Gavidia chinensis:
A: luciferase reporter assay; And
B: Western blot.
Figure 2 is a diagram showing the activation of the IFN-β promoter induced by STING by Homoharringtonine (HHT), Harringtonine (HT) and Cephalotaxine (CET).
3 is a diagram showing changes in protein levels of STING, TBK1, and IRF3 according to the concentration of homoharingtonin, haringtonin, and cephalotaxin treatment.
Figure 4 is a diagram showing the cytotoxicity of homoharingtonin, haringtonin and cephalotaxin.
5 is a diagram showing the transcriptional changes of IFNB1 and CXCL10 genes, which are IFN-stimulated genes (ISG), induced by cGAMP by homoharingtonin, haringtonin, and cephalotaxin.
Figure 6 is a diagram showing the interaction of the STING protein and TBK1 protein by homoharingtonin, haringtonin and cephalotaxin:
A: Western blot result of cell lysate (lysate);
B: Western blot results of immunoprecipitation and cell lysates.

Hereinafter, the present invention will be described in detail.

The present invention is the cephalotaxus tree koreana ) It provides a pharmaceutical composition for preventing or treating autoimmune diseases, containing an extract or a fraction thereof as an active ingredient.

The extract may be obtained by using a filtration method, hot water extraction, immersion extraction, reflux cooling extraction, and ultrasonic extraction method known in the art, but is not limited thereto. The extract may be extracted using water, C ₁ to C ₄ lower alcohol or a mixed solvent thereof, but is not limited thereto. When using a lower alcohol as the extraction solvent, it is more preferable to be selected from methanol or ethanol.

In addition, the extract of the present invention includes not only the extract by the above-described extraction solvent, but also an extract obtained through another conventional extraction method, or an extract obtained through purification and fermentation. Decompression by carbon dioxide, extraction by supercritical extraction by high temperature, extraction by extraction by ultrasonic wave, separation by using an ultrafiltration membrane with a certain molecular weight cut-off value, separation by various chromatography, natural state or various microorganisms Active fractions obtained through various purification and extraction methods, such as an extract from the fermentation product used, are also included in the extract of the present invention.

The barnacles may be wild or commercially available, and may be any one or more selected from the group consisting of roots, stems, leaves, and flowers of barnacles, and specifically, may be a root, but is not limited thereto. .

The fraction is water, n-hexane extract from the barberry. It may be prepared by additional extraction with dichloromethane, butanol or ethyl acetate, but is not limited thereto. The fraction of the present invention includes not only the fraction by the solvent described above, but also the active fraction obtained through various fractionation methods, such as separation using an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography, and the like.

The composition may interfere with the type I interferon (IFN) pathway and may have a characteristic of interfering with the interaction between the STING protein and the TBK1 protein.

The autoimmune disease may be one selected from the group consisting of SAVI (STING-associated vasculopathy with onset in infancy), Familial Chilblain Lupus (FCL), polyarthritis and VAPS (vascular and pulmonary syndrome). However, it is not limited thereto.

"STING-associated vasculopathy with onset in infancy (SAVI)" is a mutation in the TMEM173 gene that makes the STING protein, specifically, caused by a gain of function by a N154S or V155E/L170Q heterozygous mutation. (F Kara Eroglu, et al., 2015, Pediatr Rheumatol Online J. 13 (Suppl 1): O85). In the SAVI patient, due to excessive activation of the STING protein, vasculopathy and tissue damage occur within several months of life, resulting in a rash, leading to ulcer and necrosis. SAVI patients have similar symptoms to Chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature (CANDLE) syndrome, an autoimmune disease caused by mutations in the protease PSMB8 (Liu Y, et al., 2014, N Engl J. Med., 371(6):507-518.).

"Familial Chilblain Lupus" is a disease characterized by cold-induced erythematous lesions at the distal ends. It is caused by IFN-I activation signals caused by mutations such as G166E among exons of the TMEM173 gene. (Nadja Konig, et al., 2017, Ann Rheum Dis., 76(2): 468-472).

"Polyarthritis" is a disease representing multiple damage in which symptoms such as pain, swelling, and redness appear in 5 or more joints due to overproduced antibodies, and suppression of signal transmission by STING is multiple. It has been reported to be a therapeutic target for arthritis (Jeonghyun Ahn, 2012, PNAS, 109(47): 19386-19391).

"vascular and pulmonary syndrome (VAPS)" is caused by mutations in N154S, V155M and V147L among the exons of the TMEM173 gene, resulting in overactivation of the STING protein, resulting in systemic inflammation and violaceous lesions of fingers, toes, nose, cheeks and ears. It is a disease causing acral necrosis (Liu Y, et al., 2014, N Engl J Med., 371(6): 507-518). The V155M mutation in TMEM173 continuously expresses type I IFN, causing chronic inflammation, and is accompanied by vascular disease, pulmonary fibrosis, or autoantibodies similar to SLE (Jeremiah N, et al., 2014, J Clin Invest., 124(12). ): 5516?5520.).

"Systemic lupus erythematosus (SLE)" is an autoimmune disease in which antinuclear antibodies accumulate and damage complex tissues and organs. It is known to be caused by mutations in toll-like receptors, sensors that recognize nucleic acids such as RIG-I and DAI, or interferon regulatory factors. Unlike other autoimmune diseases, the STING protein has the ability to inhibit factors that cause inflammation in SLE (Sharma S, et al, 2015, PNAS, 112(7):E710-7). Therefore, when using a substance that inhibits STING activity as a therapeutic agent, side effects in some of these autoimmune diseases should be considered.

From the above, autoimmune diseases such as SAVI, familial alumni lupus, multiple arthritis, VAPS and SLE are diseases caused by excessive activity of the STING protein, and the composition of the present invention can be effectively used for the treatment of the autoimmune diseases. I can.

The composition of the present invention may further contain one or more active ingredients exhibiting the same or similar functions in the extract or fraction of the barberry. For administration, it may be prepared by including one or more pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers can be used by mixing saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components, and if necessary, antioxidants, buffers, Other conventional additives such as bacteriostatic agents may be added. In addition, a diluent, a dispersant, a surfactant, a binder, and a lubricant may be additionally added to form an injectable formulation such as an aqueous solution, a suspension, an emulsion, a powder, a tablet, a capsule, a pill, a granule, or an injection solution. Further, it may be preferably formulated according to each disease or ingredient by an appropriate method in the art or by using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 19th, 1990).

The composition of the present invention may be formulated into tablets, capsules, powders, granules, suspensions, emulsions, syrups, and other liquids by conventional methods. Specifically, the pharmaceutical composition of the present invention can be administered orally or parenterally, and the dosage form for oral administration is tablet, troche, lozenge, water-soluble or dominant suspension, powder or granule, emulsion, It can be formulated in hard or soft capsules, syrup or elixir. For formulations such as tablets and capsules, binders such as lactose, saccharose, sorbitol, mannitol, erythritol, starch, amylopectin, cellulose or gelatin, excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch, stearic acid Lubricating oils such as marnesium, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax may be contained. In the case of a capsule formulation, in addition to the substances mentioned above, it may contain a liquid carrier such as fatty oil. In addition to formulations, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, Talc, magnesium stearate, and mineral oil may be added, but are not limited thereto.

In addition, the composition of the present invention may be administered orally or parenterally, and it is preferable to select a subcutaneous injection, intravenous injection, intramuscular injection, or intraperitoneal injection injection method for parenteral administration. In order to formulate a formulation for parenteral administration, the mixture is prepared as a suspension by mixing in water with the extract of the present invention, and prepared in an ampoule or vial unit dosage form.

The composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "a pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type of patient disease, severity, drug activity, Sensitivity to drugs, time of administration, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all the above factors, and this can be easily determined by a person skilled in the art.

The dosage of the active ingredient according to the present invention considers safety and efficiency when used in the human body, and it is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These considerations when determining the effective amount are described, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co. In the case of oral administration, adults generally use 0.0001~ It can be administered once to several times in an amount of 500 mg, and is preferably administered in an amount of 0.001 to 100 mg. However, since it may increase or decrease depending on the route of administration, the severity of the disease, sex, weight, age, etc., the dosage amount is not limited by any method.

The composition of the present invention may be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response modifiers.

The compositions of the present invention may also contain carriers, diluents, excipients, or a combination of two or more commonly used in biological preparations. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for delivery of the composition in vivo, and, for example, Merck Index, 13th ed., Merck & Co. Inc. compounds, saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components can be mixed and used, and if necessary, antioxidants, buffers, bacteriostatic agents And other conventional additives may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets. Further, it may be preferably formulated according to each disease or component by an appropriate method in the art or by using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

In addition, the present invention provides a health functional food for improving autoimmune diseases, containing the extract or a fraction thereof as an active ingredient.

The health functional food of the present invention may additionally contain one or more active ingredients exhibiting the same or similar function. For administration, it may additionally be prepared by including one or more carriers acceptable as food.

The health functional food of the present invention is preferably in any one formulation selected from beverages, pills, tablets, capsules, and powders, but is not limited thereto, and the health functional food composition of the present invention is added as it is or other It may be prepared with food or food ingredients, and may be suitably prepared according to a conventional method. Examples of foods to which the health functional food composition of the present invention can be added include caramel, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, and various soups. , Beverage, tea, drink, alcoholic beverage and vitamin complex may be in any one form selected from, and includes all of the health food in the usual sense.

The foods include various nutrients, vitamins, minerals (electrolytes), synthetic and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and salts thereof, alkynic acid and salts thereof, organic acids, protective colloidal thickeners, pH It may contain modifiers, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like. In addition, it may contain pulp for the manufacture of natural fruit juices and vegetable beverages.

The above components may be used independently or in combination. Although the proportion of these additives is not very important, it is generally selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention. In addition, the health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional components, and the natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and dextrin, There are polysaccharides such as cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame can be used. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 ml of the composition of the present invention.

In a specific embodiment of the present invention, since it was confirmed that the extract of birch extract inhibits the activity of the IFN-β promoter induced by STING, the pharmaceutical composition and health functional food for the prevention or treatment of autoimmune diseases mediated therethrough It can be usefully used for (see Fig. 1).

In addition, the present invention provides a pharmaceutical composition for preventing or treating autoimmune diseases, comprising a compound represented by the following formula or a pharmaceutically acceptable salt thereof as an active ingredient:

[Formula 1]

[호모해링토닌(Homoharringtonine)]; 또는

[Homoharringtonine]; or

[Formula 2]

[해링토닌(Harringtonine)].

[Harringtonine].

The compounds may have a characteristic of interfering with the type I interferon (IFN) pathway and interfering with the interaction between the STING protein and the TBK1 protein.

The present invention includes not only the compound represented by Formula 1 or 2 or a pharmaceutically acceptable salt thereof, but also possible solvates and hydrates that can be prepared therefrom.

The compound of the present invention can be used in the form of a pharmaceutically acceptable salt, and an acid addition salt formed by a pharmaceutically acceptable free acid is useful. Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid, and aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. It is obtained from non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids. Such pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, ioda Id, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate , Sebacate, fumarate, maleate, butine-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methyl benzoate, dinitro benzoate, hydroxybenzoate, me Toxicbenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfonate, chlorobenzenesulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, -hydroxybutyrate, glycolate , Malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate or mandelate.

The acid addition salt according to the present invention is prepared in a conventional manner, for example, by dissolving the compound of the present invention in an excess acid aqueous solution, and the salt is dissolved in a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It can be prepared by precipitation using.

It can also be prepared by heating the same amount of the compound represented by Formula 1 or 2 and an acid or alcohol in water, and then evaporating and drying the mixture, or by suction filtration of the precipitated salt.

In addition, a pharmaceutically acceptable metal salt can be made using a base. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the non-soluble compound salt, and evaporating and drying the filtrate. At this time, it is suitable pharmaceutical to prepare sodium, potassium or calcium salt as the metal salt. In addition, the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).

In addition, the present invention provides a health functional food for improving autoimmune diseases, including a compound represented by Formula 1 or 2, or a pharmaceutically acceptable salt thereof as an active ingredient.

The health functional food of the present invention may additionally contain one or more active ingredients exhibiting the same or similar function. For administration, it may additionally be prepared by including one or more carriers acceptable as food.

The health functional food of the present invention is preferably in any one formulation selected from beverages, pills, tablets, capsules, and powders, but is not limited thereto, and the health functional food composition of the present invention is added as it is or other It may be prepared with food or food ingredients, and may be suitably prepared according to a conventional method. Examples of foods to which the health functional food composition of the present invention can be added include caramel, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, and various soups. , Beverage, tea, drink, alcoholic beverage and vitamin complex may be in any one form selected from, and includes all of the health food in the usual sense.

The foods include various nutrients, vitamins, minerals (electrolytes), synthetic and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and salts thereof, alkynic acid and salts thereof, organic acids, protective colloidal thickeners, pH It may contain modifiers, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like. In addition, it may contain pulp for the manufacture of natural fruit juices and vegetable beverages.

The above components may be used independently or in combination. Although the proportion of these additives is not very important, it is generally selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention. In addition, the health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional components, and the natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and dextrin, There are polysaccharides such as cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame can be used. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 ml of the composition of the present invention.

In a specific embodiment of the present invention, Homoharringtonine (HHT) and Harringtonine (HT), which are compounds known to be contained in barberry, can inhibit the activity of the stimulator of interferon gene (STING)-induced IFN-β promoter required for the interferon pathway. (Fig. 2), cGAMP-induced ISG (IFN-stimulated gene) was found to inhibit the transcription of IFNB1 and CXCL10 (Fig. 5). HHT and HT did not significantly affect the amount of STING protein and TBK1 protein, but it was found to interfere with the interaction of STING protein and TBK1 protein and inhibit the activation of TBK1 protein (Fig. 6) to prevent autoimmune diseases. And it can be usefully used in therapeutic pharmaceutical compositions and health functional foods for improving autoimmune diseases.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following examples and experimental examples are for illustrative purposes only, and the present invention is not limited by the following examples and experimental examples.

Preparation of extracts and fractions of barberry

Cephalotaxus trees collected from Jeollanam-do koreana ) was used, and it was confirmed that the collected individual was a birch tree by comparing it with a plant specimen of the Department of Life Science at Sungkyunkwan University. Extracts were obtained from the collected barberry trees using the method described in a paper published in 2013 (Kang et al., PLoS One, vol8(11), e82688.).

Specifically, 1.2 kg of dried barberry was pulverized, extracted with 5L of 70% ethanol, and extracted at room temperature for 72 hours, and then the solvent was evaporated at less than 40°C under reduced pressure to obtain an extract. The extract was used in the experiment while being stored at 4°C.

<Experimental Example 1> Confirmation of the effect of inhibiting IFN-β activity of the extract of barberry

Experimental Example 1-1. Confirmation of the effect of inhibiting IFN-β promoter activity by extracts of barberry

A luciferase-reporter assay was performed in order to confirm the effect of the extract of barberry tree on the activation of the IFN-β promoter mediated by STING.

Expression vector by cloning human STING (hSTING) gene, TBK1 gene, and IRF3 gene from pENTR-hSTING (human STING), pENTR-HBK1 and pENTR-IRF3 vectors into pEF-based destination vector using LR Clonase ^{TM enzyme mix (Invitrogen)} Was prepared, and a luciferase reporter (IFN-β promoter-driven luciferase reporter) vector regulated by the IFN-β promoter was prepared using firefly luciferase. The expression vector and reporter were transformed into HEK293T cells, respectively. Transformed HEK293T (Human embryonic kidney 293T) cells were treated with 0, 10, 25, 50, and 100 μg/ml respectively of the extract prepared in Example 1, and then the Dual-Luciferase Reporter Assay System ( Promega) was used to measure luciferase activity according to the manufacturer's protocol.

As a result, the birch extract (CKE) inhibited the activation of the IFN-β promoter by STING, but did not show a significant effect on the inhibition of the activation of the IFN-β promoter by TBK1 and IRF3 (Fig. 1A). _{The 50% inhibitory concentration (IC 50} ) of the activation of IFN-β promoter by STING of the extract of barberry extract was 35.13±3.51 μg/ml.

Experimental Example 1 -2. By the extract of barberry IFN -β activity-regulating protein synthesis

It was found that the effect of inhibiting the activation of the IFN-β promoter by STING of the extract from the above Experimental Example 1-1 is due to the decrease in the expression levels of STING, TBK1 and IRF3 proteins that can inhibit IFN-β promoter activation. Western blot was performed to see.

In a buffer solution containing NP40 1%, NaCl 150mM, Tris (pH 7.4) 50mM, 0.25% Na-deoxycholate, 0.1% SDS, EDTA 1mM, PMSF 1mM, NaF 50mM and protease inhibitor cocktail (Roche) 30 using an ultrasonic homogenizer. The cells were crushed to a strength of% and then centrifuged. After transferring the supernatant to a new tube, protein was quantified. This was mixed in a 1:1 ratio with a buffer containing Tris-Cl (pH6.8) 100mM, 4% SDS, 2% β-mercapto EtOH, and 2% BPB, and heated at 100° C. for 5 minutes. After separating the protein by size using SDS-PAGE, it was transferred to a nitrocellulose membrane. Anti-STING antibody (Cat. #13647., Cell Signaling Technology, 1:1000 dilution), anti-TBK1 antibody (Cat. #05-856., Thermo Fisher Scientific, 1:5000 dilution), anti-IRF3 antibody (Cat. #4302., Cell Signaling Technology, 1:1000 dilution) and control anti-Tubulin antibody (Cat. #T5168., Sigma-Aldrich, 1:5000 dilution) were treated overnight at 4°C. After washing 3 times with TBST, anti-mouse IgG antibody (Cat. #., 115-035-003) and anti-rabbit IgG antibody (Cat. # 111-035-003) as secondary antibodies (each 1:10000 dilution ) Was treated at room temperature for 1 hour.

As a result, it was found that there was no difference in the amount of STING protein by the treatment of blackberry extract, and it was found that blackberry extract inhibited the action of STING without affecting the protein expression of STING, which activates the IFN-β promoter. It was possible (FIG. 1B).

< Experimental example 2> Due to STING of compounds derived from barberry IFN -β promoter activity inhibition effect comparison

It is known that cephalotaxine (CET) and its esters, such as homoharringtonine (HHT) and harringtonine (HT), contain alkaloid components. Thus, it was attempted to confirm the effect of cephalotaxin (CET), homoharingtonin (HHT), or haringtonin (HT) on the activation of IFN-β promoter by STING.

Experimental example 2-1. Of compounds containing barberry IFN Confirmation of the effect of inhibiting -β promoter activity

The effect of cephalotaxin (CET), homoharingtonin (HHT), or haringtonin (HT) on the activation of IFN-β promoter by STING was investigated. The method disclosed in Experimental Example 1-1 was used, and each compound was treated with 0, 5, 50 and 500 ng/ml, respectively.

As a result, it was confirmed that HHT and HT exhibited a dose-dependent inhibitory effect on IFN-β promoter activation by STING. IC ₅₀ showed that HHT was 0.267±0.06 μg/ml, and HT was 0.663±0.11 μg/ml. In addition, the IFN-β promoter activation induced by TBK1 and IRF3 did not show a dose-dependent inhibitory effect, but in the HHT 500 ng/ml treated group, IFN-β promoter activity by TBK1 was 27%, and IFN-β promoter activity by IRF3 It was found to be reduced by 38% (Fig. 2).

Experimental example 2-2. Of compounds containing barberry IFN -β activity-regulating protein synthesis

Example 1-2 to determine whether the inhibitory effect on IFN-β activity of the compound identified in Experimental Example 2-1 is due to decreased expression levels of STING, TBK1 and IRF3 proteins that can inhibit IFN-β promoter activation. Western blot was performed as described above.

As a result, when HHT 500 ng/ml treatment, a small amount of TBK1 protein decreased, but overall, there was no significant decrease in the amount of protein during HHT, HT and CET treatment (FIG. 3 ).

Experimental Example 2-3. Comparison of Cytotoxicity of Compounds Containing Barberry

The cytotoxicity of HHT, HT and CET was compared to confirm whether the activity inhibitory effect shown in Experimental Example 2-1 is due to cytotoxicity.

HEK293T cells and THP-1 cells were treated with HHT, HT, and CET at 0, 1, 5, 50, 500 ng/mL and 5 μg/ml, respectively, and then cells were obtained at 12, 24, 36 and 48 hours. , Cell viability was investigated by CellTiter-Glo analysis (Promega. Madison, WI) according to the manufacturer's protocol.

As a result, the survival of HEK293T cells was not affected by HTT and HT treatment. It was confirmed that the inhibitory effect of HTT and HT on IFN-β activation was not due to cytotoxicity (FIG. 4).

<Experimental Example 3> Confirmation of the effect of HHT and HT on IFN-stimulated gene expression

QRT-PCR was performed to investigate the effects of HTT and HT on the type I IFN activation pathway by STING.

Specifically, HHT, HT, and CET were pretreated with 0, 5, and 50 ng/mL, respectively, to THP-1 cells, and 2'3'-cGAMP, an agonist of STING, was transformed. After 6 hours of transformation, RNA was isolated using a Total RNA Prep kit (BioFact) according to the manufacturer's protocol, and then reverse transcribed with QuantiTect reverse transcription kit (Qiagen) to produce cDNA. 1 μg of cDNA and 1X HOT FIREPol® EvaGreen® PCR mix Plus (Solis BioDyne) and primers of Table 1 (Forward, Reverse each 250nM) by performing Real-time PCR to IFN-stimulated genes (IFN-stimulated genes; ISG) ) Was measured.

gene direction order IFNβ1 Forward ATGACCAACAAGTGTCTCCTCC (SEQ ID NO: 1) Reverse GCTCATGGAAAGAGCTGTAGTG (SEQ ID NO: 2) CXCL10 Forward TCCACGTGTTGAGATCATTGC (SEQ ID NO: 3) Reverse TCTTGATGGCCTTCGATTCTG (SEQ ID NO: 4) GAPDH Forward CATGAGAAGTATGACAACAGCCT (SEQ ID NO: 5) Reverse AGTCCTTCCACGATACCAAAGT (SEQ ID NO: 6)

As a result, by 2'3'-cGAMP treatment, the transcription level of IFNβ1 increased 6.6 times and the transcription level of CXCL10 increased 249 times. However, when HHT or HT treatment was dose-dependent, HHT and HT decreased. It was found that the expression of ISG genes induced by 2'3'-cGAMP was suppressed (FIG. 5).

< Experimental example 4> HHT And STING during HT treatment TBK1 Action check

Experimental example 4-1. with cGAS About STING HHT And check the effect of HT

HHT and HT have been reported to inhibit the translation of short half-life proteins such as c-Myc, Mcl-1 and cyclin D1, so their effects on cGAS and STING were investigated.

Specifically, THP-1 cells were treated with 50 ng/mL of HHT, HT, and CET, respectively, and after 18 hours, Western blot was performed as in Experimental Example 2-2. As the primary antibody, cGAS (Cyclic GMP-AMP (cGAMP) synthase, Cat. #ABF124, Merck Millipore, 1:1000 dilution) and STING (Cat. #13647, Cell Signaling Technology, 1:1000 dilution) were used, and As a control, Tubulin (Cat. #T5168, Sigma-Aldrich, 1:5000 dilution) was used.

As a result, no significant change was found in the protein expression level (Fig. 6A).

Experimental Example 4-2. Checking the effect of HHT and HT on STING and TBK1 interaction

Since no significant change in the amount of STING protein was observed, the effects of HHT, HT and CET on the STING and TBK1 interaction were investigated.

Specifically, the HEK293T cells transformed with the hSTING-expressing vector were treated with 2'3'-cGAMP to induce a reaction between STING and TBK1, and immunoprecipitation (Immunoprecipitation; IP) as described in Experimental Example 2-2. Was performed. The cells were treated with a buffer containing 1% NP40, NaCl 150mM, Tris (pH7.5) 50mM, EDTA 1mM, PMSF 1mM, NaF 50mM, protease inhibitor cocktail, and then protein was quantified. After that, in order to minimize non-specific binding, normal serum and A/G Sepharose beads were added and then rotated at 4° C. for 30 minutes. After transferring only the supernatant to a new tube through centrifugation, an anti-STING antibody (Cat. #13647., Cell Signaling Technology, 1:100 dilution) was treated at 4° C. overnight. The next day, Sepharose beads were added and washed, and the degree of binding between STING and TBK1 was confirmed through SDS-PAGE. In addition, activation of TBK1 protein in addition to STING and TBK1 for cell lysate was investigated by Western blot method using an anti-p-TBK antibody (Cat. #5483., Cell Signaling Technology, 1:1000 dilution).

As a result, it can be seen that when 2'3'-cGAMP was treated in HEK293T cells in which STING was overexpressed, the interaction of STING and TBK1 and phosphorylation of TBK1 were induced, but the above process was inhibited when HHT or HT was treated. there was. This indicates that HHT or HT can inhibit the interaction of STING and TBK1, thereby inhibiting the signaling pathway by 2'3'-cGAMP (Fig. 6B).

<110> Gachon University of Industry-Academic cooperation Foundation <120> A Composition comprising extracts or isolated compounds of Cephalotaxus koreana for prevention or treatment of autoimmune diseases <130> 2018P-01-031 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IFN-b-F <400> 1 agtccttcca cgataccaaa gt 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IFN-b-R <400> 2 gctcatggaa agagctgtag tg 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CXCL10-F <400> 3 tccacgtgtt gagatcattg c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CXCL10-R <400> 4 tcttgatggc cttcgattct g 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-F <400> 5 catgagaagt atgacaacag cct 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-R <400> 6 agtccttcca cgataccaaa gt 22

Claims (5)

A pharmaceutical composition for preventing or treating autoimmune diseases caused by excessive activity of a stimulator of interferon genes (STING) protein, comprising a compound represented by the following formula or a pharmaceutically acceptable salt thereof as an active ingredient:
[Formula 1]

Homoharringtonine; or
[Formula 2]

[Harringtonine].
The group of claim 1, wherein the autoimmune disease is a group consisting of STING-associated vasculopathy with onset in infancy, Familial Chilblain Lupus, polyarthritis, and vascular and pulmonary syndrome (VAPS). One selected from, pharmaceutical composition for the prevention or treatment of autoimmune diseases.
The method of claim 1, wherein the compound is to interfere with the type I interferon pathway (IFN) pathway, the pharmaceutical composition for preventing or treating autoimmune diseases.
According to claim 1, The compound is a composition for preventing or treating autoimmune diseases, wherein the composition interferes with the interaction of STING protein and TBK1 protein.
A health functional food for improving autoimmune diseases caused by excessive activity of a stimulator of interferon genes (STING) protein comprising a compound represented by the following formula or a pharmaceutically acceptable salt thereof as an active ingredient:
[Formula 1]

Homoharringtonine; or
[Formula 2]

[Harringtonine].

Images