KR20190091003A - A New Primer for Detecting Microorganism in Tap Water - Google Patents
A New Primer for Detecting Microorganism in Tap Water Download PDFInfo
- Publication number
- KR20190091003A KR20190091003A KR1020180009906A KR20180009906A KR20190091003A KR 20190091003 A KR20190091003 A KR 20190091003A KR 1020180009906 A KR1020180009906 A KR 1020180009906A KR 20180009906 A KR20180009906 A KR 20180009906A KR 20190091003 A KR20190091003 A KR 20190091003A
- Authority
- KR
- South Korea
- Prior art keywords
- tap water
- bacteria
- coli
- primer
- water
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
본 발명은 수돗물 내 유해성 미생물 검지를 위한 신규 프라이머에 관한 것으로, 보다 상세하게는 수돗물 또는 세정수에서 유해성 미생물을 측정 또는 검출할 수 있는 신규 프라이머에 관한 것이다.The present invention relates to a novel primer for detecting harmful microorganisms in tap water, and more particularly to a novel primer capable of measuring or detecting harmful microorganisms in tap water or washing water.
환경부의 먹는물 수질기준 (2015)에 따르면 수돗물, 먹는물공동시설과 음용지하수의 일반세균은 평판집락법으로 측정시 100 CFU/ml 이하이어야 하고, 총대장균군, 분원성대장균군, 그리고 대장균 기준은 시험관법, 막여과법 혹은 효소기질이용법으로 미검출이어야 한다.According to the Ministry of Environment's Drinking Water Quality Standard (2015), general bacteria of tap water, drinking water joint facilities and drinking groundwater should be less than 100 CFU / ml as measured by the flat colony method. Should not be detected by in vitro, membrane filtration or enzyme substrate use.
상기 공정시험 방법은 배양 기반의 방법이므로 기준치 이하 또는 검측이 되지 않더라도 활성이 있는 세균들이 수돗물에 존재함을 알아내는 것이 중요하다.Since the process test method is a culture-based method, it is important to find out that active bacteria are present in tap water even if they are below the reference value or not detected.
배양 기반의 방법은 시료의 환경적 특성에 따라서 검출의 일관성이 낮으므로, 신규 방법의 검증은 분자생물학적인 방법인 정량적 PCR로 진행하는 것이 일반적이다.Since the culture-based method has low detection consistency according to the environmental characteristics of the sample, verification of the new method is generally performed by quantitative PCR, a molecular biological method.
또한, 세척수 내 세균 검출 분석을 통해서 옥내 급수관 세척의 완성도와 잔류 미생물에 의한 위해도 등에 관한 진단이 가능하므로, 이러한 용도들에 적합한 바이오 센서의 개발을 위해서는 검출한계 설정이 필요하다.In addition, it is possible to diagnose the completeness of the indoor water pipe washing and the risk of residual microorganisms through the analysis of the detection of bacteria in the wash water.
본 발명의 수돗물 내 유해성 미생물 검지를 위한 신규 프라이머에 있어서 상기한 문제점을 해결하고자 예의 연구 검토한 결과,As a result of intensive studies to solve the above problems in the novel primer for detecting harmful microorganisms in tap water of the present invention,
수돗물 내 기준치 이하 또는 검측이 되지 않더라도 활성이 있는 세균 또는 미생물을 검지, 검출할 수 있는 신규 프라이머를 발견하고, 본 발명을 완성하게 되었다.The inventors have discovered a novel primer capable of detecting and detecting active bacteria or microorganisms even if they are below the reference level in the tap water or are not detected, thereby completing the present invention.
따라서, 본 발명의 목적은 수돗물 및 세정수에서 유해성 미생물을 측정 또는 검출할 수 있는 신규 프라이머를 제공하는 것이다.Accordingly, it is an object of the present invention to provide novel primers capable of measuring or detecting harmful microorganisms in tap water and washing water.
한편으로, 본 발명은On the other hand, the present invention
수돗물 또는 세정수에서 유해성 미생물을 측정 또는 검출하는 것을 특징으로 하는 서열번호 1 내지 서열번호 4로 구성된 군으로부터 선택된 1종의 염기서열을 갖는 프라이머를 제공한다.Provided is a primer having one base sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4 characterized in that the harmful microorganism is measured or detected in tap water or washing water.
본 발명에 따른 신규 프라이머를 이용하여, 수돗물 내 기준치 이하 또는 검측이 되지 않더라도 활성이 있는 세균 또는 미생물을 검지, 검출할 수 있다.By using the novel primer according to the present invention, it is possible to detect and detect active bacteria or microorganisms even if it is below the reference value in tap water or is not detected.
도 1은 본 발명에 따른 프라이머 oligonucleotide의 설계 및 제작 예시를 나타낸 그래프이다.1 is a graph showing an example of the design and production of primer oligonucleotide according to the present invention.
이하, 본 발명을 보다 상세히 설명한다.Hereinafter, the present invention will be described in more detail.
환경부 먹는물 수질기준에 준하는 세균 16S rRNA copy 수를 본 연구진의 실험결과를 기반으로 도출하였고, 이의 10% 수준까지 검출할 수 있도록 바이오 센서의 검출한계 목표치를 설정하였다(표 1 참조).The number of bacterial 16S rRNA copies corresponding to the drinking water quality standards of the Ministry of Environment was derived based on the results of our experiments, and the detection limit targets of the biosensor were set to detect up to 10% of them (see Table 1).
16S rRNA 유전자 수 1) According to drinking water quality standard
16S rRNA gene number 1)
16S rRNA 유전자 수 2) New sensor detection limit target
16S rRNA gene number 2)
본 연구에서 대상으로 하는 두 번째 시료는 옥내 급수관에서 세척 과정에서 획득된 세척수이다. 세척수 내 세균 검출 분석을 통해서 옥내 급수관 세척의 완성도와 잔류 미생물에 의한 위해도 등에 관한 진단이 가능하므로, 이러한 용도들에 적합한 바이오 센서의 개발을 위해서는 검출한계 목표치 설정이 필요하였다.The second sample in this study is the wash water obtained from the washing process in the indoor water supply pipe. Since the detection of bacteria in the wash water can be used to diagnose the completeness of indoor water pipe cleaning and the risks caused by residual microorganisms, it is necessary to set detection limit targets in order to develop a biosensor suitable for these applications.
이를 위해서 본 연구진이 옥내 급수관의 세척수 시료 30 여개를 분석해서 획득된 데이터를 기반으로 세척수 내 측정치 범위를 분석하였고, 아래 표와 같은 측정치 범위를 보이었다 (표 2). 수돗물에 비해서 현격하게 높은 수의 세균들이 검출되었고 그 측정된 값의 범위도 상당히 넓었다. 세척수에서 측정된 값 중에서 최소치의 10%를신규 센서가 검측할 수 있으면 충분하다고 판단하여, 신규 바이오센서를 세척수 분석에 활용시 검출 한계의 목표치를 아래 표에 설정하였다. To this end, the researchers analyzed the measurement ranges in the wash water based on the data obtained by analyzing 30 wash water samples of indoor water supply pipes and showed the measurement ranges as shown in the following table (Table 2). Significantly higher numbers of bacteria were detected compared to tap water, and the range of the measured values was quite wide. It was determined that the new sensor could detect 10% of the minimum value in the wash water, and the target value of the detection limit when the new biosensor was used in the wash water analysis was set in the table below.
(총 세균)General bacteria
(Total bacteria)
107-1011 16S copies/ml 3) 10 4 -10 6 CFU / ml 2)
10 7 -10 11 16S copies / ml 3)
> 106 16S copies/ml> 1,000 CFU / ml
> 10 6 16S copies / ml
(E. coli)Escherichia coli
( E. coli )
103-105 16S copies/ml 5) 10 2 -10 4 CFU / ml 4)
10 3 -10 5 16S copies / ml 5)
> 100 16S copies/ml> 10 CFU / ml
> 100 16S copies / ml
1) 세척수 내 측정된 값들 중 최소치의 10% 수준으로 목표치 설정 1) Set the target value to 10% of the minimum value among the measured values in the wash water.
2) 먹는물 수질기준의 일반세균 평판집락법으로 측정 2) Measured by general bacterial colony collection method based on drinking water quality standard
3) PMA 전치리한 후 살아있는 총 세균 16S rRNA 유전자 수 측정치 3) Total bacterial counts of live 16S rRNA genes after PMA pretreatment
4) 먹는물 수질기준의 대장균 막여과법으로 측정 4) Measured by E. coli membrane filtration method of drinking water quality standard
5) PMA 전처리한 후 살아있는 E. coli 16S rRNA 유전자수 측정치 5) Measurement of live E. coli 16S rRNA gene count after PMA pretreatment
본 발명에서, 특정 타깃 미생물 항체를 설치하지 않은 (1) 일반세균 검측용 바이오 센서 (Bacteria sensor)와 특정 타킷 미생물 (대장균 [E. coli]) 항체를 설치한 (2) 대장균 검측용 바이오 센서 (E. coli specific sensor)에 대해서 검측한계 평가를 위한 연구를 수행하였다.In the present invention, (1) Bacteria sensor for detecting general bacteria and (2) E. coli detection antibody for detecting specific target microorganisms ( E. coli ) without specific target microbial antibody (2) E. coli specific sensor) was performed to evaluate the detection limit.
시료 내 미생물이 센서의 임피던스 반응으로 검출되는지를 아래 절차에 의해서 진행하였다. 수돗물의 시료를 바로 적용하기 보다는 기지의 배지에서 순수배양된 E. coli K12를 농도를 다르게 준비해서 미생물 검지 센서에 투여하고 센서에서 발생하는 임피던스를 측정하였다. 이때 공 시료로서 PBS 만의 임피던스 프로파일과 비교해서 임피던스 변화가 통계적으로 95% 수준에서 유의한 (p-value < 0.05) 최저의 미생물 농도를 검출한계로 산정하였다.Whether the microorganisms in the sample were detected by the impedance response of the sensor was performed by the following procedure. Rather than directly applying a sample of tap water, E. coli K12 purely cultured in a known medium was prepared at different concentrations and administered to a microbial detection sensor, and the impedance generated from the sensor was measured. At this time, as the blank sample, the lowest microbial concentration was found to be significant (p-value <0.05) at the 95% level of impedance change compared to the PBS-only impedance profile.
실험예 1:Experimental Example 1:
수돗물과 세척수 내 미생물 군집의 구성원들을 모두 분석하는 것이 가장 좋은 방법이나 그 비용과 시간이 너무 소모가 될 것이므로, 미생물 군집내 개체 다양성을 생태적 요인을 측정하는 항목으로 포함하기로 했다. 이를 간단히 측정하는 방법은 16S rRNA 유전자를 PCR로 증폭해서 간단한 효소 digestion를 하는 T-RFLP (terminal-restiction fragment length polymorphism) 방법으로 분석해서 class 수준의 알파 다양성을 Shannon Index로 측정하였다. 그 밖의 생물학적 항목으로는 대장균, 분원성대장균군, 총대장균군, 일반세균을 대표할 수 있는 지표 세균들 4종을 선정해서 이들의 정량적인 수를 quantitative PCR (qPCR)로 측정하였다(표 3 참조). It is best to analyze all members of the microbial community in tap water and wash water, but the cost and time will be too time consuming, so we decided to include the diversity of organisms in the microbial community as a measure of ecological factors. A simple method to measure this was to classify alpha-level diversity in the Shannon Index by T-RFLP (terminal-restiction fragment length polymorphism) method, which amplifies 16S rRNA gene by PCR and performs simple enzyme digestion. As for other biological items, four indicator bacteria representing E. coli, F. coli, total E. coli, and general bacteria were selected and their quantitative numbers were measured by quantitative PCR (qPCR) (see Table 3). ).
qPCR을 이용한 미생물의 정량적인 검측은 다음과 같이 진행되었다: Quantitative detection of microorganisms using qPCR proceeded as follows:
①타깃 미생물의 적정 qPCR primer 및 PCR cycle을 선정 ① Select the appropriate qPCR primer and PCR cycle of the target microorganism
②Primer를 제작 (이에 대한 예시를 <그림 6>에 도시) ② Produce a primer (shown in Figure 6)
③해당 미생물을 이용하여 제작된 primer들을 PCR 증폭으로 DNA product 생성③ DNA product generation by PCR amplification of primers prepared using the microorganism
④동시에 copy 수를 알고 있는 시료를 이용해서 같은 PCR 증폭 ④ Amplify the same PCR using sample that knows copy number at the same time
⑤타깃 미생물의 gene copy 수를 산정⑤ Calculate gene copy number of target microorganism
putida putida
xylE-R: GCCGTGTCTATCTGAAGGxylE-F: AGCATCCTCATCCACAAC
xylE-R: GCCGTGTCTATCTGAAGG
coli coli
tir-R: CCGGCTGATTTTTTCGATGAtir-F: GTGGCGCATTGATTCTTGG
tir-R: CCGGCTGATTTTTTCGATGA
cloacaecloacae
HycE-R: TGACCGGCGACAACCAGAAGHycE-F: TGTTGCCGCGCAGCATGTAG
HycE-R: TGACCGGCGACAACCAGAAG
GFP-R: CAAACTTGACTTCAGCTCTGGTCTTGFP-F: GCCATGCCAGAAGGTTATGTTC
GFP-R: CAAACTTGACTTCAGCTCTGGTCTT
2004K. Verthe et al.,
2004
실험예 2: 센서 기저 반응 특성 곡선 분석Experimental Example 2: Analysis of Sensor Base Response Characteristic Curves
본 연구에서 개발된 기본적인 센서의 세균 농도 (혹은 수)에 대한 임피던스 변화 반응에 대한 특성을 알아보았다. The characteristics of impedance change response to bacterial concentration (or number) of the basic sensor developed in this study were investigated.
첫째, 세균 수가 증가할수록 센서의 반응도 비례적으로 증가하다가 임피던스 변화율이 30% 부근에서 포화되는 경향을 보인다. 즉 40,000 - 60,000 CFU/ml 범위 보다 높은 세균 수에서는 센서의 반응이 포화되는 경향을 보인다. 둘째, 세균의 수가 상대적으로 적은 800 CFU/ml 이하 범위에서는 세균 수와 센서의 임피던스 변화율 간에 선형적인 상관성이 있다. First, as the number of bacteria increases, the response of the sensor increases proportionally, but the impedance change rate tends to saturate around 30%. In other words, the bacterial response higher than the 40,000-60,000 CFU / ml range tends to saturate the sensor's response. Second, in the range of less than 800 CFU / ml, where there is a relatively small number of bacteria, there is a linear correlation between the number of bacteria and the impedance change rate of the sensor.
본 연구에서 대상으로 하는 먹는 물의 세균 수는 낮은 편이므로, 세균 수가 낮은 수준에서 보여 주는 선형적인 상관관계가 본 연구에서 개발된 센서의 정량적 검출 능력에 대한 가능성을 제시하고 있다. 이러한 근거로 아래에서는 1000 CFU/ml 이하의 세균 수에 집중해서 본 연구에서 제작된 센서들의 정량적 검출 능력을 실험적으로 평가하였다. Since the number of bacteria in the drinking water in this study is low, the linear correlation of low bacterial count suggests the potential for quantitative detection of the sensor developed in this study. On the basis of this, below, the quantitative detection capability of the sensors fabricated in this study was experimentally focused on the number of bacteria below 1000 CFU / ml.
실험예 3: 일반세균 검측용 바이오 센서의 정량적 검측 능력Experimental Example 3: Quantitative Detection Capability of Biosensor for General Bacterial Detection
본 연구에서 개발된 일반 세균 검측용 바이오 센서가 시료 내 총 세균 수를 정량적으로 측정할 수 있는지를 실험적으로 평가하였다. PBS 용액에 E. coli K-12 만을 포함한 단일 균주 배양 결과물을 이용해서 총 세균 수가 다양한 시료의 기존 방법인 평판집락법 (LB배지)와 본 연구에서 개발한 non-specificity 바이오 센서의 측정치를 비교 분석하였다.It was experimentally evaluated whether the general bacterial detection biosensor developed in this study can quantitatively measure the total number of bacteria in a sample. Using a single strain culture product containing only E. coli K-12 in PBS solution, comparative analysis of the plate colony method (LB medium) and the non-specificity biosensor developed in this study It was.
그 결과 센서의 전기적 신호 변화인 임피던스 변화량은 총 세균의 수의 값과 양적인 상관관계가 확인되었다 (R2 = 0.9584). 이는 시료 내 일반세균이 증가할수록 바이오센서의 반응도 비래해서 증가하므로 정량적인 분석이 가능함을 보이고 있다.As a result, the amount of impedance change, which is a change in the electrical signal of the sensor, was positively correlated with the value of the total number of bacteria (R 2 = 0.9584). This shows that as the general bacteria in the sample increases, the response of the biosensor also increases, resulting in quantitative analysis.
실험예 4: 미생물 군집 내 타깃 세균의 선별적 검측 성능(specificity) 평가Experimental Example 4: Evaluation of Selective Detection of Target Bacteria in Microbial Community
대장균 antibody가 부착된 바이오 센서가 대장균만 선별적으로 검측하고 비 대장균은 검출하지 않는지에 대해서 평가하기 위해서 대장균의 지표 세균으로 E. coli K12를 비 대장균이면서 세균인 Pseudomonas putida를 지표 세균으로 선정해서 각각의 단일 균주를 다른 비율로 혼합한 mock communities를 아래 표 4와 같이 제작하였다.In order to evaluate whether the E. coli antibody with the E. coli antibody selectively detects E. coli but not E. coli , E. coli K12 is selected as an indicator bacterium of E. coli and Pseudomonas putida as an indicator bacterium. Mock communities of a single strain of different ratios were prepared as shown in Table 4 below.
(CFU/ml)(CFU / ml)
(CFU/ml)(CFU / ml)
E.coli K12는 4,800 CFU/ml로 고정하고, Pseudomonas putida의 농도를 다양하게 변화 했을 때에도, 일관성 있는 측정 결과를 보였다. 이 결과는 개발된 센서가 타깃이 아닌 세균에 의한 영향에 무관하게 타깃 세균인 대장균을 일관성 있게 검출하는 능력이 있음을 입증한 것이다. E. coli K12 was fixed at 4,800 CFU / ml and consistent results were obtained when various concentrations of Pseudomonas putida were varied. These results demonstrate that the developed sensor has the ability to consistently detect target bacteria E. coli, regardless of the effects of non-target bacteria.
Claims (1)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020180009906A KR20190091003A (en) | 2018-01-26 | 2018-01-26 | A New Primer for Detecting Microorganism in Tap Water |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020180009906A KR20190091003A (en) | 2018-01-26 | 2018-01-26 | A New Primer for Detecting Microorganism in Tap Water |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR20190091003A true KR20190091003A (en) | 2019-08-05 |
Family
ID=67615961
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020180009906A KR20190091003A (en) | 2018-01-26 | 2018-01-26 | A New Primer for Detecting Microorganism in Tap Water |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR20190091003A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20040012854A (en) | 2001-05-22 | 2004-02-11 | 더 세크러터리 오브 스테이트 포 디펜스 | Identifying micro-organisms |
-
2018
- 2018-01-26 KR KR1020180009906A patent/KR20190091003A/en unknown
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20040012854A (en) | 2001-05-22 | 2004-02-11 | 더 세크러터리 오브 스테이트 포 디펜스 | Identifying micro-organisms |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fiksdal et al. | Application of rapid enzyme assay techniques for monitoring of microbial water quality | |
| Yu et al. | Bacterial diversity and community structure in an aerated lagoon revealed by ribosomal intergenic spacer analyses and 16S ribosomal DNA sequencing | |
| Zhang et al. | Effects of ultraviolet disinfection on antibiotic‐resistant Escherichia coli from wastewater: inactivation, antibiotic resistance profiles and antibiotic resistance genes | |
| Halatsi et al. | PCR detection of Salmonella spp. using primers targeting the quorum sensing gene sdiA | |
| Branco et al. | Impact of chromium-contaminated wastewaters on the microbial community of a river | |
| Liang et al. | Comparison of bacterial community in matured and degenerated pit mud from Chinese Luzhou‐flavour liquor distillery in different regions | |
| Kuo et al. | A rapid method for the detection of representative coliforms in water samples: polymerase chain reaction-enzyme-linked immunosorbent assay (PCR-ELISA) | |
| CN111154900B (en) | Pseudomonas aeruginosa specific new molecular target and rapid detection method thereof | |
| Wolf-Baca et al. | Detection of pathogenic bacteria in hot tap water using the qPCR method: preliminary research | |
| Wadhawan et al. | Assessing tetrazolium and ATP assays for rapid in situ viability quantification of bacterial cells entrapped in hydrogel beads | |
| Kostić et al. | Microbial diagnostic microarray for food‐and water‐borne pathogens | |
| Lloyd-Jones et al. | Quantification of the Pseudomonas population in New Zealand soils by fluorogenic PCR assay and culturing techniques | |
| Leskelä et al. | Sensitive genus-specific detection of Legionella by a 16S rRNA based sandwich hybridization assay | |
| JP6632228B2 (en) | Primer set for detecting 1,4-dioxane-degrading bacteria and method for detecting and quantifying 1,4-dioxane-degrading bacteria | |
| KR102150025B1 (en) | A Real Time Detection Sensor Device for Microorganism in Tap Water | |
| Meyer et al. | Microscale biosensor for measurement of volatile fatty acids in anoxic environments | |
| Strateva et al. | Analysis of biofilm formation in nosocomial Stenotrophomonas maltophilia isolates collected in Bulgaria: an 11-year study (2011–2022) | |
| Yousef | Detection of bacterial pathogens in different matrices: Current practices and challenges | |
| KR20190091003A (en) | A New Primer for Detecting Microorganism in Tap Water | |
| CN108018364A (en) | A kind of kit and detection method of absolute quantitation detection vibrio parahemolyticus | |
| CA2451053A1 (en) | Method for specific fast detection of relevant bacteria in drinking water | |
| Gomes et al. | Characterization, validation and application of a DNA microarray for the detection of mandatory and other waterborne pathogens | |
| US20090136930A1 (en) | Method for the identification of microorganisms by means of in situ hybridization and flow cytometry | |
| Zhu et al. | Rapid detection and quantification of microbes related to microbiologically influenced corrosion using quantitative polymerase chain reaction | |
| CN104031129A (en) | Peptide nucleic acid probe set and kit used for detecting staphylococcus aureus and/or staphylococcus epidermidis, use method of kit and application of kit |