KR20190074608A - Markers for cocaine addiction - Google Patents

Abstract

The present invention relates to biomarkers of which expressions undergo significant changes upon acute or chronic administration of cocaine. According to the present invention, the expression amount of mRNAs and proteins of the following biomarkers, ARHGEF7, PTOV1, GTF2I, ADAM23, CDH2, GRIA1 (GRIA1X3, GRIA1X4), GRIA2 (GRIA2X6, GRIA2X7), HDAC5, HDAC10, NCAM1, NPY, SNCA, CCNG2, CDC7, CDH8, DLG3, DOCK3, NEUROD6, NEUROG2, SPEN, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, MCM3AP, DRD1, DRD2, DRD3, GNAL, GNG7, LOC101865389, LOC101926461, PPP2R2B, ACHE, ADCY5, AKT3, KCNJ2, LOC101865389, LOC101926461, PLCB1, SLC18A3, SLC5A7, CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246, BAD, BCL2L1, CASP9, LOC101925175, and TNFRSF1A, is significantly upregulated or downregulated upon acute or chronic administration of cocaine, and accordingly, expression patterns of these biomarkers may be beneficially used for the purposes of identifying cocaine addiction and dependency due to acute or chronic exposure to cocaine.

Description

{MARKERS FOR COCAINE ADDICTION}

The present invention relates to a biomarker specific for cocaine poisoning, and specifically relates to a biomarker in which expression of cocaine is significantly changed upon acute or chronic administration.

Drug abuse is the intentional use of drugs for other purposes (non-medical purposes), and substance abuse is distinct from drug abuse according to the user's intent. Many drugs such as opiates, hemp, cocaine, and methamphetamine have been abused for pleasure, anxiety, and mood swings. Recently, however, various substances such as sedatives, stimulants, inhalants and hormones have been abused. Repeated use of these substances not only causes serious illnesses that lead to long-term changes in the brain, but also harms both individuals and society. Such substance abuse is not limited to specific social and economic groups, , The use of these drugs is regulated nationally. Abuse drugs induce drug-seeking behaviors, which are primarily related to drug dependence, (psychological dependence) is formed, and subsequent abuse causes tolerance and chronic dependence. Discontinuation of drug use leads to physical dependence, which is caused by the physiological function of keeping the body normal, resulting in withdrawal (abstinence syndrome), which is physiologically unacceptable. It depends on the drug.

Psychostimulants, such as cocaine or amphetamines, increase agility and increase physical capacity in humans. These substances initially increase dopamine transmission, but long-term drug use leads to dysregulation and mental anxiety in the brain-compensating system, resulting in decreased dopaminergic activity. Chronic cocaine abuse causes major health problems. Cocaine users can experience acute cardiovascular or cerebrovascular emergencies that can lead to sudden death, such as vasoconstriction, dilated pupils, and increased body temperature, heart rate and blood pressure, such as heart attacks or strokes, tachycardia, hypertension, mydriasis, muscle twitching, sleeplessness, extreme nervousness, hallucinations, paranoia, aggressive behavior, and depression Of the symptoms occur. Other complications associated with cocaine use include cardiac rhythm disturbances, chest pain and respiratory failure, seizures, headache, and gastrointestinal complications such as abdominal pain and nausea. Also, since cocaine tends to reduce appetite, many long-term users can become malnourished. Furthermore, it is well known that it is common to abuse nicotine, cocaine and alcohol simultaneously. The combination of cocaine and alcohol has been shown to exert more cardiovascular toxicity in humans than either drug alone.

Historically, chemical-dependent therapies have involved attempts to persuade patients (behavioral therapy) to voluntarily stop using the substance. However, cocaine, morphine, amphetamines, nicotine and alcohol, and other types of dopamine-producing agents are highly toxic substances, and dependence on these drugs may be more difficult to break off and depend on most other toxic substances The damage is considerably greater. In particular, alcohol, cocaine and heroin dependence are usually chronic recurring disorders. Mental dependence almost always precedes physical dependence but does not necessarily lead to physical dependence. Tolerance refers to a reduction in response to a drug effect that requires more dosing to achieve the same effect. (Eg, metabolic tolerance, which increases the metabolism of a drug after chronic use of the drug, behavioral tolerance to compensate for the drug's effects, compensatory change of action on the drug receptor, Functional tolerance.

Desipramine, amantadine, and bromocriptine have been shown to reduce cocaine withdrawal symptoms and have been shown to be effective in the treatment of drug addiction and dependence, Can be used in the treatment of cocaine dependence (see, for example, Bonet et al., Journal of Substance Abuse Treatment, 26 (2004), 225-232). In recent years, studies have been conducted to find molecular marker markers or biomarkers of the central nervous system by drug abuse by applying microarray technology.

In the present invention, it is intended to diagnose acute or chronic cocaine poisoning (or exposure) by locating genes and protein markers which are major evidence for judging drug poisoning by showing changes in expression when cocaine is used.

To achieve the above object, the present invention provides a biomarker for cocaine poisoning and dependence confirmation.

The present invention also provides biomarkers for acute and chronic cocaine poisoning and dependency discrimination.

The present invention also provides biomarker proteins for cocaine poisoning and dependence identification.

The present invention also provides a composition for identifying cocaine poisoning and dependence.

The present invention also provides a kit for identifying cocaine poisoning and dependence.

In addition, the present invention provides a method for providing information necessary for cocaine exposure diagnosis.

According to the present invention, ARHGEF7, PTOV1, GTF2I, ADAM23, CDH2, GRIA1 (GRIA1X3, GRIA1X4), GRIA2 (GRIA2X6, GRIA2X7), HDAC5, HDAC10, NCAM1, NPY, SNCA, CCNG2, CDC7, CDH8, DLG3, DOCK3, NEUROD6 , NEUROG2, SPEN, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, MCM3AP, DRD1, DRD2, DRD3, GNAL, GNG7, LOC101865389, LOC101926461, PPP2R2B, ACHE, ADCY5, AKT3, KCNJ2, LOC101865389, Since the expression levels of mRNA and protein are significantly upregulated or downregulated at the time of acute or chronic administration of cocaine, the expression levels of mRNA and protein are significantly elevated in the case of cocaine, Can be usefully used to identify cocaine poisoning and dependence due to acute or chronic exposure to cocaine.

Figure 1 is a schematic diagram of the overall experimental protocol of the present invention.
FIG. 2 is a diagram showing a process of extracting genes expressing expression due to acute / chronic cocaine poisoning in the hippocampus through analysis of a Venn diagram.
FIG. 3 is a graph showing changes in expression in the hippocampus according to acute / chronic cocaine poisoning. FIG. 3 is a graph showing changes in expression in the hippocampus according to acute / chronic cocaine poisoning. , CCNG2, CDC7, CDH8, DLG3, DOCK3, NEUROD6, NEUROG2, SPEN, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, MCM3AP and WNT10B.
Con: Cocaine-free treated group;
CA: acute cocaine treated group;
CC: chronic cocaine treated group;
Acute Cocaine: Acute cocaine treated group; And
Chronic Cocaine.
FIG. 4 is a diagram showing a process of identifying genes for expression changes due to acute / chronic cocaine poisoning in a striatum through analysis of a Venn diagram.
FIG. 5 is a graph showing the change in expression in the striatum according to acute / chronic cocaine poisoning. FIG. 5 is a graph showing the change in expression in the striatum according to acute / chronic cocaine poisoning. , CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246, BAD, BCL2L1, CASP9, LOC101925175 and TNFRSF1A:
Con: Cocaine-free treated group;
CA: acute cocaine treated group; And
CC: Chronic cocaine administered group.
FIG. 6 is a graph showing the change in expression in the striatum according to acute / chronic cocaine poisoning. FIG. 6 is a graph showing the change in expression in the striatum according to acute / chronic cocaine poisoning. , CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246, BAD, BCL2L1, CASP9, LOC101925175 and TNFRSF1A.
FIG. 7 shows changes in mRNA expression and protein expression levels of genes CAMK2A and CASP9, which are expressed in striatum according to acute / chronic cocaine poisoning.
a: mRNA expression level of CAMK2A and CASP9;
b: protein expression of phosphorylated CAMK2A, CAMK2A and truncated CASP9;
c: Quantification of pCAMK2A / CAMK2A;
d: Quantification of truncated CASP9;
Con: Cocaine-free treated group;
CA: acute cocaine treated group; And
CC: Chronic cocaine administered group.
Fig. 8 is a graph verifying the regulatory pattern of CAMK2A expression in human brain tissue.
FIG. 9 shows a functional protein network for CAMK2A. FIG.

Hereinafter, the present invention will be described in detail with reference to embodiments of the present invention. It should be understood, however, that the invention is not limited thereto and that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined by the appended claims and their equivalents. .

Unless otherwise indicated, nucleic acids are recorded in a 5 'to 3' orientation from left to right. The numerical ranges recited in the specification include numerals defining the ranges and include each integer or any non-integral fraction within a defined range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice of testing the present invention, the preferred materials and methods are described herein.

The term "subject" or "patient" in the present invention refers to any single individual requiring treatment, including humans, apes, monkeys, cows, dogs, guinea pigs, rabbits, chickens, insects and the like. In addition, any subject who participates in a clinical study test that does not show any disease clinical findings, or who participates in epidemiological studies or used as a control group is included. In one embodiment of the present invention, monkeys and humans were included.

The term "tissue" or "sample (sample) " in the present invention means a tissue or a cell obtained from a subject or a patient. The source of the tissue or cell sample may be a solid tissue from fresh, frozen and / or preserved organ or tissue sample or biopsy or aspirate; Blood or any blood components; It may be a cell at any point in the pregnancy or development of the subject. Tissue samples can also be primary or cultured cells or cell lines.

In the present invention, the term "cocaine addiction" refers to the abuse of cocaine, which is an addictive drug, to cause drug dependence, and to increase the amount of each use, tolerance is produced. It is a phenomenon that results in withdrawal symptoms that cause an unbearable abnormality in the whole body. It includes long-term "chronic poisoning" and short-term "acute poisoning" in cocaine.

All technical terms used in the present invention are used in the sense that they are generally understood by those of ordinary skill in the relevant field of the present invention unless otherwise defined. Also, preferred methods or samples are described in this specification, but similar or equivalent ones are also included in the scope of the present invention. The contents of all publications referred to herein are incorporated herein by reference.

In one aspect, the present invention provides a method of inhibiting cocaine exposure, comprising administering an effective amount of a compound selected from the group consisting of ARHGEF7, PTOV1, GTF2I, ADAM23, CDH2, GRIA1 (GRIA1X3, GRIA1X4), GRIA2 (GRIA2X6, GRIA2X7), HDAC5, HDAC10, NCAM1, NPY, SNCA, CDH7, CDH8, DLG3, DOCK3, NEUROD6, NEUROG2, SPEN, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, MCM3AP, DRD1, DRD2, DRD3, GNAL, GNG7, LOC101865389, LOC101926461, PPP2R2B, ACHE , Or one or more genes selected from the group consisting of ADCY5, AKT3, KCNJ2, LOC101865389, LOC101926461, PLCB1, SLC18A3, SLC5A7, CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246, BAD, BCL2L1, CASP9, LOC101925175 and TNFRSF1A Wherein the genes are defined by the Accession no. As described in Tables 1 and 2. The biomarkers for cocaine poisoning and dependence identification, In one embodiment, in order to identify genes whose expression levels vary according to the administration of acute / chronic cocaine, analysis was performed as shown in FIG. 1, and as a result, it was confirmed that the expression levels of the gene groups were significantly increased or decreased .

In one embodiment, at the time of acute cocaine exposure, PTOV1, HDAC5, HDAC10, NPY, SNCA, KDM2BX10, KDM2BX13, KIFAP3, WNT10B, DRD1, DRD2, DRD3, GNAL, PPP2R2B, GNG7, ACHE, SLC5A7, ADCY5, KCNJ2, LOC101925175 and CASP9 And upregulated expression of one or more genes selected from the group consisting of MCM3AP, GTF2I, ADAM23, CDH2, GRIA1X3, GRIA1X4, GRIA2X6, GRIA2X7, CCNG2, CDC7, CDH8, DLG3, NEUROD6, NEUROG2, SPEN, CAMK2A, EGLN2, TNFRSF1A And BCL2L1 can be down-regulated.

In one embodiment, the expression of one or more genes selected from the group consisting of ARHGEF7, DRD1, DRD2, DRD3, GNAL, PPP2R2B, SLC18A3, ACHE, SLC5A7, ADCY5, KCNJ2, TNFRSF1A, BCL2L1 and BAD is upregulated upon chronic cocaine exposure , MCM3AP, PTOV1, GTF2I, AKT3, CAMK2A and LOC101866246 can be down-regulated.

In one aspect, the present invention relates to a biomarker for acute and chronic cocaine poisoning and dependence discrimination, comprising ARHGEF7, PTOV1 and GTF2I genes or a protein encoded by the gene, wherein the expression pattern of the ARHGEF7, PTOV1 and GTF2I genes Can distinguish between acute and chronic cocaine poisoning and dependence. In one embodiment, the expression of ARHGEF7 was increased in the chronic cocaine addiction group, PTOV1 was increased in the acute cocaine addiction group and decreased in the chronic cocaine addiction group, and GTF2I was decreased in the acute and chronic cocaine addiction group , But the decrease in the expression in the acute cocaine addiction group was more significant than that in the chronic cocaine addiction group (see the upper graph of Fig. 3a).

In one aspect, the invention relates to a biomarker protein for cocaine poisoning and dependence identification, comprising a CAMK2A protein, a GRIN1 protein, and a CASP9 protein, wherein the amount of protein expressed upon cocaine exposure changes. In one embodiment, it may further comprise a DLGl marker protein. In one embodiment, CAMK2A gene expression decreased and CASP9 expression increased at cocaine exposure, but at the protein level, CAMK2A protein phosphorylation decreased upon acute and chronic cocaine exposure, and the expression level of CAMK2A protein upon exposure to chronic cocaine was appreciated , CASP9 cleaved at acute cocaine exposure was increased, whereas CASP9 cleaved at chronic cocaine exposure was not observed (see FIG. 7).

In one aspect, the present invention provides a method of inhibiting cocaine exposure, comprising administering an effective amount of a compound selected from the group consisting of ARHGEF7, PTOV1, GTF2I, ADAM23, CDH2, GRIA1 (GRIA1X3, GRIA1X4), GRIA2 (GRIA2X6, GRIA2X7), HDAC5, HDAC10, NCAM1, NPY, SNCA, CDH7, CDH8, DLG3, DOCK3, NEUROD6, NEUROG2, SPEN, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, MCM3AP, DRD1, DRD2, DRD3, GNAL, GNG7, LOC101865389, LOC101926461, PPP2R2B, ACHE A detection reagent for one or more biomarkers selected from the group consisting of: ATCC1, AKT5, AKT3, KCNJ2, LOC101865389, LOC101926461, PLCB1, SLC18A3, SLC5A7, CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246, BAD, BCL2L1, CASP9, LOC101925175 and TNFRSF1A To a composition for identifying cocaine poisoning and dependence.

In one embodiment, the detection reagent may be a reagent capable of detecting the marker at the protein or nucleic acid level.

In one embodiment, the nucleic acid level detection reagent of the marker is selected from the group consisting of a nucleic acid sequence of the marker, a nucleic acid sequence complementary to the nucleic acid sequence, a primer pair specifically recognizing the nucleic acid sequence and a fragment of the complementary sequence, (RT-PCR), competitive RT-PCR (Competitive RT-PCR), and Nuclease protection assay (RT-PCR) But are not limited to, RNase, S1 nuclease assay, in situ hybridization, nucleic acid microarray, Northern blot, and DNA chip.

In one embodiment, the primer pair for the genetic markers of the present invention comprises a primer pair of SEQ ID NOS: 1 and 2, a pair of primers of SEQ ID NOS: 3 and 4, a pair of primers of SEQ ID NOS: 5 and 6, a primer pair of SEQ ID NOS: 7 and 8 A pair of primers of SEQ ID NOs: 9 and 10, a pair of primers of SEQ ID NOs: 11 and 12, a pair of primers of SEQ ID NOs: 13 and 14, a pair of primers of SEQ ID NOs: 15 and 16, a pair of primers of SEQ ID NOs: And primer pairs of 20, primer pairs of SEQ ID Nos. 21 and 22, primer pairs of SEQ ID Nos. 23 and 24, primer pairs of SEQ ID Nos. 25 and 26, primer pairs of SEQ ID Nos. 27 and 28, primer pairs of SEQ ID Nos. 29 and 30 The primer pair of SEQ ID NOs: 31 and 32, the primer pair of SEQ ID NOs: 33 and 34, the primer pair of SEQ ID NOs: 35 and 36, the primer pair of SEQ ID NOs: 37 and 38, the primer pair of SEQ ID NOs: 39 and 40, 42 primer pairs, The primer pair of SEQ ID NOs: 43 and 44, the primer pair of SEQ ID NOs: 45 and 46, the primer pair of SEQ ID NOs: 47 and 48, the primer pair of SEQ ID NOs: 49 and 50, the primer pair of SEQ ID NOs: 51 and 52, The primer pair of SEQ ID NOs: 55 and 56, the primer pair of SEQ ID NOs: 57 and 58, the primer pair of SEQ ID NOs: 61 and 62, the primer pair of SEQ ID NOs: 63 and 64, the primer pair of SEQ ID NOs: 65 and 66, The primer pair of SEQ ID NOS: 67 and 68, the primer pair of SEQ ID NOS: 69 and 70, the primer pair of SEQ ID NOS: 71 and 72, the primer pair of SEQ ID NOS: 73 and 74, the primer pair of SEQ ID NOS: 75 and 76, A pair of primers of SEQ ID Nos. 79 and 80, a pair of primers of SEQ ID Nos. 81 and 82, a pair of primers of SEQ ID Nos. 83 and 84, a pair of primers of SEQ ID Nos. 85 and 86, a pair of primers of SEQ ID Nos. 87 and 88, 89 and 90 prades Primer pairs of SEQ ID Nos. 93 and 94, primer pairs of SEQ ID Nos. 95 and 96, primer pairs of SEQ ID Nos. 97 and 98, primer pairs of SEQ ID Nos. 99 and 100, primer pairs of SEQ ID Nos. 103 and 104, primer pairs of SEQ ID NOs: 105 and 106, primer pairs of SEQ ID NOs: 107 and 108, primer pairs of SEQ ID NOs: 109 and 110, primers of SEQ ID NOs: 111 and 112, primer pairs of SEQ ID NOs: And a pair of primers of SEQ ID NOS: 113 and 114,

In one embodiment, the protein level detection reagent of the marker is an antibody, antibody fragment, aptamer, avidity multimer or peptidomimetics that specifically recognize the protein full length or fragment thereof. ), And these can be detected by Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, immunoelectrophoresis, tissue immuno staining, immunoprecipitation assay, , Complement Fixation Assay (FACS), mass spectrometry, or a method for analyzing the amount of proteins including protein microarrays.

The term "detection" or "measurement" as used herein means to quantify the concentration of a detected or measured subject.

As used herein, the term "primer" refers to a nucleic acid sequence having a short free 3 hydroxyl group that can form base pairs with a complementary template and is a starting point for template strand copy Short nucleic acid sequence " Primers can initiate DNA synthesis in the presence of reagents for the polymerization reaction (i. E., DNA polymerate or reverse transcriptase) and four different nucleoside triphosphates at the appropriate buffer solution and temperature. In the present invention, PCR amplification is carried out using a sense and antisense primer specific to a gene whose expression is changed by acute or chronic intoxication (exposure) of cocaine, and the degree of mRMA expression can be determined by measuring the level of a desired product. The PCR conditions, the lengths of the sense and antisense primers can be modified based on those known in the art. In the present invention, the expression level of each gene was confirmed using the primer pairs of SEQ ID NOS: 1-114.

In the present invention, the term "probe" means a nucleic acid fragment such as RNA or DNA corresponding to a short period of a few nucleotides or several hundreds of nucleotides capable of specifically binding with mRNA, . The probe may be prepared in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. In the present invention, hybridization is performed using a probe complementary to a gene whose expression is changed by acute or chronic intoxication (exposure) of cocaine, and the degree of expression of each gene can be diagnosed through hybridization. The selection and hybridization conditions of a suitable probe can be modified on the basis of those known in the art, so that the present invention is not particularly limited thereto.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

The term "antibody" as used herein in the present invention means a specific protein molecule indicated for an antigenic site as a term known in the art. For purposes of the present invention, an antibody refers to an antibody that specifically binds to a protein expressed in genes that are markers whose expression is changed by acute or chronic intoxication (exposure) of the cocaine of the present invention. The method can be prepared using well known methods. Also included are partial peptides that can be made from the protein. The form of the antibody of the present invention is not particularly limited, and any polyclonal antibody, monoclonal antibody or antigen-binding antibody thereof may be included in the antibody of the present invention and include all immunoglobulin antibodies. Furthermore, the antibodies of the present invention include special antibodies such as humanized antibodies.

The composition for identifying cocaine poisoning and dependence of the present invention is not only for confirming cocaine poisoning and dependence of a subject, but also for identifying a biomarker when the cocaine is administered or treated to a subject in order to develop a drug for preventing or treating cocaine poisoning and dependence &Quot; Addiction and Dependency "to confirm the change in the degree of change.

In one aspect, the present invention provides a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein the compound is selected from the group consisting of ARHGEF7, PTOV1, GTF2I, ADAM23, CDH2, GRIA1 (GRIA1X3, GRIA1X4), GRIA2 (GRIA2X6, GRIA2X7), HDAC5, HDAC10, NCAM1, NPY, SNCA, CCNG2, CDC7, , NEUROD6, NEUROG2, SPEN, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, MCM3AP, DRD1, DRD2, DRD3, GNAL, GNG7, LOC101865389, LOC101926461, PPP2R2B, ACHE, ADCY5, AKT3, KCNJ2, Identification of cocaine poisoning and dependence including detection reagents of one or more biomarkers selected from the group consisting of LOC101865389, LOC101926461, PLCB1, SLC18A3, SLC5A7, CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246, BAD, BCL2L1, CASP9, LOC101925175 and TNFRSF1A For example.

In one embodiment, the kit may further comprise tools and / or reagents for collecting a biological sample from a subject or patient, as well as tools and / or reagents for preparing genomic DNA, cDNA, RNA or protein from the sample have. For example, it may comprise a PCR primer to amplify the relevant region of genomic DNA. The kit may comprise a probe of a genetic element useful for pharmacogenetic profiling. Also, in the use of such kits, the labeled oligonucleotides can be used to facilitate identification during analysis.

In one embodiment, the kit may further comprise a DNA polymerase and a labeling substance such as dNTPs (dGTP, dCTP, dATP and dTTP), a fluorescent substance and the like.

In one aspect, the present invention relates to a method of screening for a biological sample derived from a test sample, comprising the steps of: (a) CDH7, CDH8, DLG3, DOCK3, NEUROD6, NEUROG2, SPEN, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, MCM3AP, DRD1, DRD2, DRD3, GNAL, GNG7, LOC101865389, LOC101926461, PPP2R2B, ACHE , Nucleic acid or protein of at least one biomarker selected from the group consisting of: Lactobacillus, Lactobacillus, Lactobacillus, Lactobacillus, Lactobacillus, Lactobacillus, Lactobacillus, Lactobacillus, Lactobacillus, Detecting a concentration of the compound; Comparing the detection result for the concentration of the nucleic acid or protein to a corresponding result of a corresponding marker of a normal control sample; And comparing the sample from the normal control sample with the normal control sample in comparison with the normal control sample in comparison with the normal control sample. One or more genes or proteins selected from the group consisting of PPP2R2B, GNG7, ACHE, SLC5A7, ADCY5, KCNJ2, LOC101925175, CASP9, ARHGEF7, SLC18A3, TNFRSF1A, BCL2L1 and BAD are upregulated and MCM3AP, GTF2I, ADAM23, CDH2, When one or more genes or proteins selected from the group consisting of GRIA1X3, GRIA1X4, GRIA2X6, GRIA2X7, CCNG2, CDC7, CDH8, DLG3, NEUROD6, NEUROG2, SPEN, CAMK2A, EGLN2, TNFRSF1A, BCL2L1, PTOV1, AKT3 and LOC101866246 are down- And determining a cocaine exposure. The present invention also relates to a method for providing information necessary for cocaine exposure diagnosis.

In one embodiment, the method comprises comparing to a normal control sample, wherein the method comprises the steps of: comparing a sample with a control sample; , KCNJ2, LOC101925175, and CASP9 are upregulated; And one or more genes or proteins selected from the group consisting of MCM3AP, GTF2I, ADAM23, CDH2, GRIA1X3, GRIA1X4, GRIA2X6, GRIA2X7, CCNG2, CDC7, CDH8, DLG3, NEUROD6, NEUROG2, SPEN, CAMK2A, EGLN2, TNFRSF1A and BCL2L1 And if it is down-regulated it can be determined to be an acute cocaine exposure.

In one embodiment, the method further comprises administering one or more compounds selected from the group consisting of ARHGEF7, DRD1, DRD2, DRD3, GNAL, PPP2R2B, SLC18A3, ACHE, SLC5A7, ADCY5, KCNJ2, TNFRSF1A, BCL2L1 and BAD The gene or protein is upregulated; And determining that at least one gene or protein selected from the group consisting of MCM3AP, PTOVl, GTF2I, AKT3, CAMK2A, and LOC101866246 is downregulated to be chronic cocaine exposure.

The "biological sample derived from the test object" includes, but is not limited to, tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine. In addition, a specific method for measuring the expression level of the mRNA or the protein of the gene can detect the expression of the gene at the mRNA level or protein level, and the mRNA or protein is isolated from the biological sample using a known process can do. In one embodiment of the invention, the level of expression of the gene or protein was performed using tissue isolated from the hippocampus or striatum of the monkey.

The present invention will be described in more detail with reference to the following examples. However, the following examples are only for the purpose of illustrating the present invention, and thus the present invention is not limited thereto.

Example 1. Acute / chronic cocaine poisoning-specific biomarkers in the hippocampus

1-1. Detection of gene expression changes due to acute / chronic cocaine poisoning

(N = 2), acute cocaine-treated group (CA, n = 2 to 4), a mean of 3.1 ± 0.1 kg of body weight and about 5 to 6 years of age were fed with crab-eating macaque (Macaca fascicularis) ) And chronic cocaine administered group (CC, n = 2 ~ 3). Cocaine hydrochloride (Johnson Matthey Macfarlan Smith, Edinburgh, Scotland) was completely dissolved in 0.9% saline immediately prior to administration and monkeys were given 1 to 3 mg / kg body weight / day for 5 to 8 weeks, day at 4:00 pm. After cocaine administration, monkeys were sacrificed and hippocampus was obtained. All courses were conducted under the supervision of the KRIBB Institutional Animal Care and Use Committee (Approval No. KRIBB-AEC-16070 and KRIBB-AEC-17079). Total RNA was isolated from the hippocampus using TRIzol (Invitrogen, Carlsbad, Calif., USA), and the RNA integrity number (RIN) value was found to be 7 or more using a 2100 Bioanalyzer (Agilent Technologies, Palo Alto, Calif. Respectively. For RNA sequencing, an RNA library was prepared using a TruSeq RNA library preparation kit (Illumina, San Diego, Calif., USA) and mRNA was purified using oligo-dT magnetic beads. The purified mRNA was cleaved, reverse transcribed with cDNA using random primers and reverse transcriptase, and complementary sequences were synthesized after removing the RNA template. After performing end repair, 3 'adenylation and adapter linkage, the purified cDNA library was concentrated by PCR. The library was sequenced with the Illumina HiSeq 2000 sequencer (Macrogen, Seoul, Korea). Sequences from RNA-Seq were identified by FastQC (version 0.10.0, http: //www.bioinformatics.babraham.ac.uk/projects/fastqc/), followed by low-quality DNA sequences, including adapter sequences, contaminated DNA and PCR copies &Lt; / RTI &gt; and Trimmomatic ver. 0.32 (Bolger, Lohse & Usadel, 2014). The reading results were mapped to the reference genome using TopHat (version 2.0.13) software. The transcripts of each sample were assembled into Cufflinks (version 2.2.1) (Trapnell et al., 2010) based on the FPKM (fragments per kilobase of transcript per million mapped reads) method. Based on the FPKM values of transcripts, genes showing differences in expression between samples were selected and similarities between samples were represented by MDS (multidimensional scaling) plots. RNA-seq data was deposited with GEO (Gene Expression Omnibus) (accession number GSE104332). As a result, in the control group, acute cocaine poisoning and chronic cocaine poisoning, | fold change | 954 genes (transcripts) satisfying ≥ 2 and P <0.05 were identified and hierarchical clustering analysis was performed between the groups (Fig. 2a), and two groups -wise groups) were counted (Fig. 2B). 408 genes were upregulated and 381 genes were downregulated among acute cocaine poisoning (exposure) and chronic cocaine poisoning (exposure) groups, which were significantly higher than control vs CA or control vs CC. Three overlapping genes ARHGEF7 (Rho guanine nucleotide exchange factor 7), PTOV1 (prostate tumor overexpressed 1), and GTF2I (general transcription factor Iii) were selected in a Venn diagram analysis (Fig. 2c) .

In addition to the above three genes, ADAM23, CDH2, GRIA1 (including GRIA1X3 and GRIA1X4), GRIA2 (including GRIA2X6 GRIA2X7), HDAC10, HDAC5 (which includes genes related to neurogenesis or poisoning) in the National Center for Biotechnology Information Database (Including KDM2BX10 and KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, and MCM3AP were selected for the genes NCAM1, NPY and SNCA that are not known to be related to the genes CCNG2, CDC7, CDH8, DLG3, DOCK3, NEUROD6, NEUROG2, SPEN, .

1-2. Comparison of mRNA expression pattern of genes due to acute / chronic cocaine poisoning

1 μg of total RNA was reverse transcribed with cDNA using a kit (Thermo Fisher Scientific, Carlsbad, USA). Real time quantitative PCR was performed using the prepared cDNA, a primer set for the genes selected in Example 1-1 (Table 1) and SYBR Green Core Reagents (SYBR Premix Ex Taq II, Takara, Japan) Respectively. For reference, the primer sets of the present invention were confirmed by BLAST against the NCBI cynomolgus monkey genome sequence database, and their specificity was confirmed. Specifically, the sample was denatured at 95 DEG C for 3 minutes (1 cycle), annealed at 90 DEG C for 10 seconds and 65 DEG C for 30 seconds for amplification, denatured for 10 seconds at 95 DEG C with a final melting curve, Lt; 0 &gt; C for 30 seconds. Data were analyzed by the 2-ΔΔCT method of Applied Biosystems (Carlsbad, CA, USA), a ViiA7 real-time PCR system. Analysis The final product was electrophoresed on 2% agarose gel and UV band confirmed.

Gene Accession No primer The sequence (5'-3 ') SEQ ID NO: ARHGEF7 XM_005586258.2 Forward GACATTAAAACTCTGGGCAACG One Reverse CCAACGACAGGAATGACAATC 2 PTOV1 XM_005589964.1 Forward CATCCCCTACGACCAGAGC 3 Reverse GAGCCCAACAGTCGGTCCA 4 GTF2I XM_005549400.1 Forward GTATGGAATCCCGAGGCT 5 Reverse CGGAAGCAAGTGGAAGAG 6 ADAM23 XM_005574061.1 Forward CATCAACCAAGACTCGGAAAG 7 Reverse CTCCACATAATCCGAAGACAAC 8 CDH2 XM_005586980.1 Forward GACATTATCACAGTGGCAGC 9 Reverse GCAGTAAACTCTGGAGGATTG 10 GRIA1X3 XM_005558333.1 Forward GGTGGTGGTGGACTGTGAATC 11 Reverse GCTGGGATGGTGTCTGTGTAG 12 GRIA1X4 XM_005558334.1 Forward CAGAACGCCTCAATGCTATC 13 Reverse CACTATTCTTCCACTGCTGC 14 GRIA2X6 XM_005556165.1 Forward CTGGGTTTCAGATAGTGGAC 15 Reverse CTCTGCTTCCTTAGGTTGC 16 GRIA2X7 XM_005556166.1 Forward GGAGACTGTCTGGCAAACC 17 Reverse CTCTGCTTCCTTAGGTTGCG 18 HDAC10 XM_005566924.1 Forward GATGGGAAACGCTGACTAC 19 Reverse CAGCAGATGTGTGAGGTGG 20 HDAC5 XM_005584399.1 Forward CAGTGACACCGTCTGGAATG 21 Reverse CATGGCTGTGGATTCCTCG 22 NCAM1 XM_005579649.1 Forward CACTCCCTCTTCACCATCCATC 23 Reverse CTGGCTTCCTTGGCATCATAC 24 NPY XM_005549975.1 Forward GACTGACCCTCGCCCTGT 25 Reverse CTTGCCATACCTCTGCCTG 26 SNCA XM_005555423.1 Forward GAGTTGTGGCTGCTGCTG 27 Reverse CACCACCGCTCCTCCAAC 28 CCNG2 XM_005554984.1 Forward GGGCTGAGTTTGATTGAGGC 29 Reverse GAACAGACTCCAATGCAAGAC 30 CDC7 XM_005542756.1 Forward CTGACCTGTGACTGCTATG 31 Reverse GTATCGTCCACTAAGCAAAG 32 CDH8 XM_005592128.1 Forward GCTATAAAAAAGACTTGACCGG 33 Reverse GCGTTGTCATTGATGTCTTG 34 DLG3 XM_005593877.1 Forward CAGGACGGGGATGATTGAGT 35 Reverse GAACTGCTTTCGCTGTCACTG 36 DOCK3 XM_005547258.1 Forward CTTTGGCTTTGCATTCTCAC 37 Reverse TATTAGGGCAGCCATTGTAG 38 NEUROD6 XM_005549850.1 Forward CCTCAACGACGCTCTGGAC 39 Reverse CTGGTCTCTTGCCGATTCTC 40 NEUROG2 XM_005555708.1 Forward CAAGAAGACCCGTAGACTGAAGG 41 Reverse AGATGTAGTTGTGGGCGAAGC 42 SPEN XM_005544696.1 Forward CAATCAGCAGCAGCAGTAGT 43 Reverse ATCTGTAGAGCGTACTGGAAG 44 KDM2BX10 XM_005572454.1 Forward GTCCCTGTGGTGACTTGGC 45 Reverse AGGCAGGCCTCGCACTTG 46 KDM2BX13 XM_005572457.1 Forward GAGGAGGAGGAGAAGGACGAG 47 Reverse CTTCACGCTCTCCTCTGACTCG 48 KIFAP3 XM_005539960.1 Forward GCTTATCTGTGAAGGAAATGG 49 Reverse AACTCCTCTTCCTCATCATTAG 50 RBM10 XM_005593402.1 Forward GGACGCTACACGATGGATGG 51 Reverse CTGCTCTGCCTCTGACTTGG 52 RBM14 XM_005577130.1 Forward CTACGCCGCACAAGCCAC 53 Reverse GAGTGCGGTAAGGAGCTGC 54 TP53I11 XM_005578119.1 Forward CAGTTCGTCTCTGCTGTGCTC 55 Reverse CCAAGAACTGGACCCCGAAG 56 WNT10B XM_005570737.1 Forward GCTGGCTGCTGGGGTCAT 57 Reverse CAGGGCTGGGCAGAGAGTG 58 MCM3AP XM_005548481.2 Forward CTGAAGTCACAGCCATCC 59 Reverse GGCTATCTTTTGGCACAG 60 GAPDH XM_015430282.1 Forward ACAACAGCCTCAAGATCGTCAG 115 Reverse ACTGTGGTCATGAGTCCTTCC 116

As shown in FIG. 3, expression of PTOV1, HDAC5, HDAC10, NPY, SNCA, KDM2BX10, KDM2BX13, KIFAP3 and WNT10B was significantly upregulated in the CA group and GTF2I, ADAM23, CDH2, GRIA1X3, GRIA1X4, Expression of GRIA2X6, GRIA2X7, CCNG2, CDC7, CDH8, DLG3, NEUROD6, NEUROG2, SPEN and MCM3AP was significantly downregulated. In addition, the expression of ARHGEF7 was significantly up-regulated in the CC group and the expression of PTOV1, MCM3AP, and GTF2I was significantly down regulated (Figs. 3a-f). Specifically, expression of ARHGEF7 was significantly increased only in CC group and expression of PTOV1 was significantly increased in CA group and significantly decreased in CC group. In addition, GTF2I was decreased in CA and CC group, and the decrease in CA group was significantly decreased compared to CC group. In addition, KDM2BX13 and KIFAP3 were found to increase only in the CA group.

(CA: increase in PTOV1 expression, decrease in GTF2I / increase in CC: ARHGEF7, decrease in PTOV1, decrease in expression of GRF2I, and decrease in expression of PTOV1) by controlling the expression pattern of the markers and the expression of ARHGEF7, PTOV1 and GTF2I Significantly less than CA)

Example 2 Acute / Chronic Cocaine Poisoning in Striatum Specific biomarkers

2-1. Selection of genes by Vendor Gram analysis

In order to identify genes whose expression is significantly changed in the striatum when cocaine was administered acutely / chronically, crab-eating macaques (about 5 to 6 years of age) weighing 3.1 ± 0.1 kg on average, Macaca fascicularis (Suzhou, China) was divided into control (n = 2), acute cocaine (CA, n = 2) and chronic cocaine (CC, n = 3) All courses were conducted under the supervision of the KRIBB IACUC (Approval No. KRIBB-AEC-16070). Cocaine hydrochloride (Johnson Matthey Macfarlan Smith, Edinburgh, Scotland) was completely dissolved in 0.9% saline immediately prior to administration and monkeys were given 1 to 3 mg / kg body weight / day for 5 to 8 weeks, day at 4:00 pm. After cocaine administration, monkeys were sacrificed and striations were obtained. Total RNA was isolated from the striatum of each group using TRIzol (Invitrogen, Carlsbad, California, USA) and RNA integrity number (RIN) value of 7 was measured using a 2100 Bioanalyzer (Agilent Technologies, Palo Alto, . For RNA sequencing, an RNA library was prepared using a TruSeq RNA library preparation kit (Illumina, San Diego, Calif., USA) and mRNA was purified using oligo-dT magnetic beads. The purified mRNA was cleaved, reverse transcribed with cDNA using random primers and reverse transcriptase, and complementary sequences were synthesized after removing the RNA template. After performing end repair, 3 'adenylation and adapter linkage, the purified cDNA library was concentrated by PCR. The library was sequenced with the Illumina HiSeq 2000 sequencer (Macrogen, Seoul, Korea). Sequences from RNA-Seq were identified by FastQC (version 0.10.0, http: //www.bioinformatics.babraham.ac.uk/projects/fastqc/), followed by low-quality DNA sequences, including adapter sequences, contaminated DNA and PCR copies &Lt; / RTI &gt; and Trimmomatic ver. 0.32 (Bolger, Lohse & Usadel, 2014). The reading results were mapped to the reference genome Macaca_fascicularis_5.0 (BioSample: SAMN00811240) using TopHat (version 2.0.13) software. The transcripts of each sample were assembled into Cufflinks (version 2.2.1) (Trapnell et al., 2010) based on the FPKM (fragments per kilobase of transcript per million mapped reads) method. Based on the FPKM values of transcripts, genes showing differences in expression between samples were selected and similarities between samples were represented by MDS (multidimensional scaling) plots. The RNA-seq data was deposited with GEO (Gene Expression Omnibus) (accession number GSE103419). The control group, acute cocaine poisoning and chronic cocaine poisoning group showed no significant difference in MRI analysis and hematoxylin and eosin staining (data not shown), but hierarchical clustering analysis between the groups As a result, 1613 genes having an expression level of 2 times or more and satisfying P &lt; 0.05 were identified (FIGS. 4A and 4B). A total of 263 genes were differentially expressed in the striatum exposed to acute cocaine among 1613 genes with a multiple change of 2.0 or more and a P value of less than 0.05. A total of 178 genes were differentially expressed in the striatum exposed to chronic cocaine, and a total of 1413 The expression levels of the genes were different between acute and chronic cocaine poisoning (exposure) striations (Fig. 4C). In addition, using the BioVenn (http://www.biovenn.nl/) (Hulsen, de Vlieg & Alkema, 2008), the inter-group vane diagram (Control vs. CA, Control vs. CC, CA vs. CC) As a result, 13 genes SNAP25, CAMK2A, LOC101867149, KCNAB2, LOC102137553, RBM14, ADD3, PTPRZ1, LOC101865389, ARFGEF2, KCNJ10, LOC101925503 and GOPC were selected (Fig.

2-2. Selection of genes by functional annotation and pathway analysis

The sequences of the above 13 genes were confirmed using the human BLAST database. As a result, the Macaca fascicularis genome showed 92.8% identity with homo sapiens (Ebeling et al., 2011). In addition, the KEGG pathway (http://www.genome.jp/kegg/pathway.html) analysis was used to analyze the biological responses and various standard pathways associated with the genes, and cocaine was used for neuronal development and signaling (Dopamine: DRD1, DRD2, DRD3, GNAL, and GNG7), which are related to neurological pathways such as dopaminergic, cholinergic, HIF and apoptotic pathways among the KEGG pathways BCC, BCL2L1, CASP9, and LPS101865389, LOC101926461, PPP2R2B, cholinergic: ACHE, ADCY5, AKT3, KCNJ2, LOC101865389, LOC101926461, PLCB1, SLC18A3, SLC5A7; HIF1 alpha pathway: CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246; , LOC101925175, TNFRSF1A) qRT-PCR was performed using the primer pairs shown in Table 2 below. To determine the gene expression relationship between acute and chronic cocaine poisoning, Pearson correlation analysis was performed on the expression levels of these transcription factors in qRT-PCR analysis results.

Gene Accession No primer The sequence (5'-3 ') Amplicon size (bp) SEQ ID NO: Dopaminergic synapse DRD1 XM_005579675.1 Forward CCCTCTGATGGGAATGCC 216 61 Reverse CTGGCAATTCTTGGCATGG 62 DRD2 XM_005548104.1 Forward GAGCATTCTGAACTTGTGTG 199 63 Reverse GTTGGCAATGATGCACTC 64 DRD3 XM_005587198.1 Forward CAGCCAGCATCCTGAACCTC 169 65 Reverse CCAAACAGAAGAGGGCAGGAC 66 GNAL XM_005587472.1 Forward CCAAGTGGACAAAGTGAAC 171 67 Reverse GACTCTCTCAGCCTGTTGG 68 GNG7 XM_005547666.1 Forward CGTATCAAGGTCTCCAAAGCGG 106 69 Reverse TAAAGGGGTTCTCGGAGGCAGG 70 LOC101865389 XM_005542907.1 Forward CGAAGTAGGTTGCGGAATGC 161 71 Reverse CATAGGTGTCTGAGCCGAAC 72 LOC101926461 XM_005558151.1 Forward CAGCAAGGGCTACAATAAGG 185 73 Reverse GCAGGTTCCGTAGAAGGTCC 74 PPP2R2B XM_005558151.1 Forward GACCACAGAAGGCTCGGAC 159 75 Reverse GGGTATCAATGTCCTCCTCC 76 Cholinergic synapse ACHE XM_005549276.1 Forward CCTGTGGTAGATGGAGACTTC 150 77 Reverse GTTGTCTTTGCTGAAGCCTGG 78 ADCY5 XM_005547964.1 Forward GACAGGCTTTCCAGGAGA 152 79 Reverse CATATCCTCCTGCTTGGCG 80 AKT3 XM_005539657.1 Forward CAGAACGACCAAAGCCAAACAC 150 81 Reverse CTTCTTGCCTCTGCAGTCTGTC 82 KCNJ2 XM_005584811.1 Forward GAAAGATGGTCACTGTAACG 172 83 Reverse TATCAACCAAAACACACAGC 84 LOC101865389 XM_005547668.1 Forward GAACAAATCGATTCCAGT 204 85 Reverse CGAATCTCTTTGTTGCTGTCC 86 LOC101926461 XM_005542906.1 Forward CTGAAGCAAATAGAGCATAC 219 87 Reverse GAATGTTAGCACTATCTGAGC 88 PLCB1 XM_005568372.1 Forward CTTACCGTTGACCAGATGATG 229 89 Reverse CATTCAAATCCAGTTTCTCAGG 90 SLC18A3 XM_005565137.1 Forward CCTACGGAGAGCGAAGACG 193 91 Reverse CGAACAGCGTGGCGTAGTC 92 SLC5A7 XM_005575201.1 Forward CCTTGCTGACGAAGACTGTG 214 93 Reverse GGGTAATAGCCAGGGTAGAAG 94 HIF-1 signaling pathway CAMK2A XM_005558248.1 Forward GCTGCTGAAGCCCTTAAG 232 95 Reverse CGATGGTGGTGTTGGTGC 96 EGLN2 XM_005589313.1 Forward GCTACAGCCACCTCTACCAC 234 97 Reverse CTCCTGGTTCTCTTGCCTGG 98 ENO2 XM_005569984.1 Forward AAGGTCTTTTCAGGGCTGCAG 138 99 Reverse CGATGGTGGAGTTGATGTGGT 100 LOC101866179 XM_005551953.1 Forward GGAGGAGAAGCAAATCATC 211 101 Reverse CACTGGAATCACTAACTGG 102 LOC101866246 XM_005557063.1 Forward CGTGAGGGCAATGAGAAAG 194 103 Reverse CATCAAGTATTGGTCTCTCG 104 Apoptosis-related genes BAD XM_005577428.1 Forward GGGACAGGCCCTCAGACTC 185 105 Reverse CGAAGGGATGGAGGAGGAG 106 BCL2L1 XM_005568631.1 Forward GGAGACCCCCAGTGCCAT 200 107 Reverse GCTGGGATGTCAGGTCAC 108 CASP9 XM_005544724.1 Forward CCTTCGTTCATCTCCTGCTTAG 204 109 Reverse ATCACCGAATCCTCCAGAACC 110 LOC101925175 XM_005580378.1 Forward GAGAACCTGGAGAAGAAGACGG 204 111 Reverse CTGCTCCAGGTCAGCCATCG 112 TNFRSF1A XM_005569893.1 Forward CACCTGAAAAAGAGGGGGAG 188 113 Reverse CATCTCTCTGCGGGAAGCC 114 GAPDH XM_015430282.1 Forward ACAACAGCCTCAAGATCGTCAG 112 115 Reverse ACTGTGGTCATGAGTCCTTCC 116

As shown in FIG. 5, expression of DRD1, DRD2, DRD3, GNAL, PPG2R2B, GNG7, ACHE, SLC5A7, ADCY5, KCNJ2, LOC101925175 and CASP9 was upregulated in the CA group and CAMK2A, EGLN2, TNFRSF1A and BCL2L1 Was downwardly adjusted. Of these, GNG7, LOC101925175 and CASP9 were specifically up-regulated only in CA and EGLN2 and BCL2L1 were specifically downregulated in CA only. In the CC group, DRD1, DRD2, DRD3, GNAL, PPP2R2B, SLC18A3, ACHE, SLC5A7, ADCY5, KCNJ2, TNFRSF1A, BCL2L1 and BAD were upregulated and AKT3, CAMK2A and LOC101866246 were downregulated. Among these, BAD was specifically upregulated in the CC group. DRD1, DRD3, PPG2R2B, GNG7, ACHE, CAMK2A, and BCL2L1 were significantly different in the expression level of the control group, CA and CC. In addition, Pearson correlation analysis showed that the genes correlated with acute and chronic cocaine administration (R = 0.587, P = 0.0013) (FIG. 6).

2-3. Control of CAMK2A expression by cocaine administration

2-3-1. Changes in mRNA expression of CAMK2A and CASP9

CAMK2A, which is included both in the independent Venn diagram analysis (FIG. 4E) and in the HIF alpha pathway analysis (FIG. 5C), and CASP9, which is involved in cell homeostasis-critical apoptosis pathway, among the KEGG pathways were selected and their acute / chronic cocaine administration And the expression pattern of the protein was confirmed. Specifically, RT-PCR analysis of the RNA isolated from the monkey brain stroma after acute / chronic cocaine administration as in Example 2-1 was performed on the agarose gel to determine the mRNA level of the final product Respectively. As a result, the expression of CAMK2A was decreased by the administration of cocaine, while the expression of CASP9 was increased similarly to the RNA-seq and qRT-PCR data (Fig. 7A).

2-3-2. Confirmation of changes in protein levels of CAMK2A and CASP9

To confirm the expression of CAMK2A and CASP9 at the protein level, total RNA was prepared from the monkey brain striatum after acute / chronic cocaine administration as in Example 2-1, and the remaining tissues were dissolved with 1% SDS buffer . The same amount of protein was electrophoresed in gel with 10% SDS-PAGE (sodium dodecyl sulphate polyacrylamide gel electrophoresis) and transferred to a nitrocellulose membrane (Whatman, dassel, Germany). Anti-CAMK2A, anti-cleaved CASP9 (Abcam, Cambridge, UK), and anti-GAPDH (anti-pCAMK2A) were blocked for 1 hour with 1% skim milk (TBST, 20 mM Tris, 137 mM NaCl and 0.1% Tween 20) (Cell signal, Danvers, Massachusetts, USA). The bands were then incubated with horseradish peroxidase conjugated anti-rabbit IgG (Thermo scientific) diluted 1: 10,000 with secondary antibody and visualized with PXi4 Chemiluminscent and Fluorescent Imaging System (Syngene, Boston, MA, USA) . Quantification of the intensity of each band, averaging for GAPDH, and relative ratios to control were calculated using Image J software (National Institutes of Health, Bethesda, MD, USA). As a result, the level of CAMK2A protein and its phosphorylation decreased by the administration of cocaine, in particular, it was found to decrease sharply upon administration of chronic cocaine (Fig. 7b and c), and CASP9 cleaved in acute cocaine- (Figs. 7B and 7D).

2-3-3. Verification of CAMK2A expression regulation in human brain tissue

CAMK2A < / RTI &gt; mRNA &lt; RTI ID = 0.0 &gt; (SEQ ID NO: &lt; / RTI &gt; Levels were also altered by administration of cocaine in human brain tissue. Specifically, changes in the mRNA expression of CAMK2A in the human brain (GSE44486, GDS5047, probe ID: ILMN_1666445) and changes in CAMK2A mRNA expression in the human brain (GSE44456, GDS4879, control n = Alcoholic n = 20) and mRNA expression of CAMK2A in mouse striatum during chronic morphine administration (GSE7762, GDS2815, n = 36). As a result, the relative mRNA expression of CAMK2A in the midbrain of chronic cocaine abuser (n = 10, triplicate) was significantly reduced (** P <0.01) (Fig. 8). Thus, it was confirmed that the expression of CAMK2A was down-regulated by administration of chronic cocaine in the human midbrain.

2-4. Identification of functional protein network for CAMK2A

The functional protein network for CAMK2A was identified using the STRING database (Szklarczyk et al., 2017) to confirm that functionally related genes with CAMK2A were altered by cocaine administration. As a result, it was confirmed that GRIN1 and DLG1 were functionally linked to CAMK2A (Fig. 9A). Expression levels of CAMK2A, GRIN1 and DLG1 were confirmed by the methods described in the above examples. As a result, GRIN1 was down-regulated when acute / chronic cocaine administration was similar to CAMK2A. However, DLG1 was down- And was rather upregulated in cocaine administration (Fig. 9B). In addition, the level of expression of GRIN1 and DLG1 was examined in GEO data as in Example 2-3-3 above. As a result, GRIN1 was also found in chronic cocaine poisoned human brain tissue Lt; RTI ID = 0.0 &gt; CAMK2A &lt; / RTI &gt; (Figures 9c-f). This indicates that CAMK2A and GRIN1 are associated with cocaine poisoning.

Example 3. Statistical analysis

Gene expression levels were expressed as mean ± standard deviation, and Student's t-test was used to compare differences in gene expression levels between the two groups. Differences between groups were analyzed by one-way ANOVA using SPSS 21 software (SPSS Inc., Chicago, IL, USA). The expression of each of the CA and CC groups, which differed significantly by qRT-PCR, was analyzed using Pearson's correlation coefficients using SPSS 21 software and GraphPad PRISM 5 (CA, USA) Were less than 0.05 (q-values <0.2).

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> MARKERS FOR COCAINE ADDICTION <130> PN1712-461 <160> 116 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ARHGEF7 forward primer <400> 1 gacattaaaa ctctgggcaa cg 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ARHGEF7 reverse primer <400> 2 ccaacgacag gaatgacaat c 21 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PTOV1 forward primer <400> 3 catcccctac gaccagagc 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PTOV1 reverse primer <400> 4 gagcccaaca gtcggtcca 19 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GTF2I forward primer <400> 5 gtatggaatc ccgaggct 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GTF2I reverse primer <400> 6 cggaagcaag tggaagag 18 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ADAM23 forward primer <400> 7 catcaaccaa gactcggaaa g 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ADAM23 reverse primer <400> 8 ctccacataa tccgaagaca ac 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CDH2 forward primer <400> 9 gacattatca cagtggcagc 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CDH2 reverse primer <400> 10 gcagtaaact ctggaggatt g 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GRIA1X3 forward primer <400> 11 ggtggtggtg gactgtgaat c 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GRIA1X3 reverse primer <400> 12 gctgggatgg tgtctgtgta g 21 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GRIA1X4 forward primer <400> 13 cagaacgcct caatgctatc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GRIA1X4 reverse primer <400> 14 cactattctt ccactgctgc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GRIA2X6 forward primer <400> 15 ctgggtttca gatagtggac 20 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GRIA2X6 reverse primer <400> 16 ctctgcttcc ttaggttgc 19 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GRIA2X7 forward primer <400> 17 ggagactgtc tggcaaacc 19 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GRIA2X7 reverse primer <400> 18 ctctgcttcc ttaggttgcg 20 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HDAC10 forward primer <400> 19 gatgggaaac gctgactac 19 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HDAC10 reverse primer <400> 20 cagcagatgt gtgaggtgg 19 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HDAC5 forward primer <400> 21 cagtgacacc gtctggaatg 20 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HDAC5 reverse primer <400> 22 catggctgtg gattcctcg 19 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NCAM1 forward primer <400> 23 cactccctct tcaccatcca tc 22 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NCAM1 reverse primer <400> 24 ctggcttcct tggcatcata c 21 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NPY forward primer <400> 25 gactgaccct cgccctgt 18 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NPY reverse primer <400> 26 cttgccatac ctctgcctg 19 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SNCA forward primer <400> 27 gagttgtggc tgctgctg 18 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SNCA reverse primer <400> 28 caccaccgct cctccaac 18 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CCNG2 forward primer <400> 29 gggctgagtt tgattgaggc 20 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CCNG2 reverse primer <400> 30 gaacagactc caatgcaaga c 21 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CDC7 forward primer <400> 31 ctgacctgtg actgctatg 19 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CDC7 reverse primer <400> 32 gtatcgtcca ctaagcaaag 20 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CDH8 forward primer <400> 33 gctataaaaa gacttgaccg g 21 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CDH8 reverse primer <400> 34 gcgttgtcat tgatgtcttg 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DLG3 forward primer <400> 35 caggacgggg atgattgagt 20 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DLG3 reverse primer <400> 36 gaactgcttt cgctgtcact g 21 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DOCK3 forward primer <400> 37 ctttggcttt gcattctcac 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DOCK3 reverse primer <400> 38 tattagggca gccattgtag 20 <210> 39 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NEUROD6 forward primer <400> 39 cctcaacgac gctctggac 19 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NEUROD6 reverse primer <400> 40 ctggtctctt gccgattctc 20 <210> 41 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NEUROG2 forward primer <400> 41 caagaagacc cgtagactga agg 23 <210> 42 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NEUROG2 reverse primer <400> 42 agatgtagtt gtgggggaag c 21 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPEN forward primer <400> 43 caatcagcag cagcagtagt 20 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SPEN reverse primer <400> 44 atctgtagag cgtactggaa g 21 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> KDM2BX10 forward primer <400> 45 gtccctgtgg tgacttggc 19 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> KDM2BX10 reverse primer <400> 46 aggcaggcct cgcacttg 18 <210> 47 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KDM2BX13 forward primer <400> 47 gaggaggagg agaaggacga g 21 <210> 48 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> KDM2BX13 reverse primer <400> 48 cttcacgctc tcctctgact cg 22 <210> 49 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KIFAP3 forward primer <400> 49 gcttatctgt gaaggaaatg g 21 <210> 50 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> KIFAP3 reverse primer <400> 50 aactcctctt cctcatcatt ag 22 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RBM10 forward primer <400> 51 ggacgctaca cgatggatgg 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RBM10 reverse primer <400> 52 ctgctctgcc tctgacttgg 20 <210> 53 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> RBM14 forward primer <400> 53 ctacgccgca caagccac 18 <210> 54 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> RBM14 reverse primer <400> 54 gagtgcggta aggagctgc 19 <210> 55 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TP53I11 forward primer <400> 55 cagttcgtct ctgctgtgct c 21 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TP53I11 reverse primer <400> 56 ccaagaactg gaccccgaag 20 <210> 57 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> WNT10B forward primer <400> 57 gctggctgct ggggtcat 18 <210> 58 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> WNT10B reverse primer <400> 58 cagggctggg cagagagtg 19 <210> 59 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> MCM3AP forward primer <400> 59 ctgaagtcac agccatcc 18 <210> 60 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> MCM3AP reverse primer <400> 60 ggctatcttt tggcacag 18 <210> 61 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> DRD1 forward primer <400> 61 ccctctgatg ggaatgcc 18 <210> 62 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DRD1 reverse primer <400> 62 ctggcaattc ttggcatgg 19 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DRD2 forward primer <400> 63 gagcattctg aacttgtgtg 20 <210> 64 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> DRD2 reverse primer <400> 64 gttggcaatg atgcactc 18 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DRD3 forward primer <400> 65 cagccagcat cctgaacctc 20 <210> 66 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DRD3 reverse primer <400> 66 ccaaacagaa gagggcagga c 21 <210> 67 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GNAL forward primer <400> 67 ccaagtggac aaagtgaac 19 <210> 68 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GNAL reverse primer <400> 68 gactctctca gcctgttgg 19 <210> 69 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GNG7 forward primer <400> 69 cgtatcaagg tctccaaagc gg 22 <210> 70 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GNG7 reverse primer <400> 70 taaaggggtt ctcggaggca gg 22 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LOC101865389 forward primer <400> 71 cgaagtaggt tgcggaatgc 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LOC101865389 reverse primer <400> 72 cataggtgtc tgagccgaac 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LOC101926461 forward primer <400> 73 cagcaagggc tacaataagg 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LOC101926461 reverse primer <400> 74 gcaggttccg tagaaggtcc 20 <210> 75 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PPP2R2B forward primer <400> 75 gaccacagaa ggctcggac 19 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPP2R2B reverse primer <400> 76 gggtatcaat gtcctcctcc 20 <210> 77 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ACHE forward primer <400> 77 cctgtggtag atggagactt c 21 <210> 78 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ACHE reverse primer <400> 78 gttgtctttg ctgaagcctg g 21 <210> 79 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ADCY5 forward primer <400> 79 gacaggcttt ccaggaga 18 <210> 80 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ADCY5 reverse primer <400> 80 catatcctcc tgcttggcg 19 <210> 81 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AKT3 forward primer <400> 81 cagaacgacc aaagccaaac ac 22 <210> 82 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AKT3 reverse primer <400> 82 cttcttgcct ctgcagtctg tc 22 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KCNJ2 forward primer <400> 83 gaaagatggt cactgtaacg 20 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KCNJ2 reverse primer <400> 84 tatcaaccaa aacacacagc 20 <210> 85 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> LOC101865389 forward primer <400> 85 gaacaaatcg attccagt 18 <210> 86 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LOC101865389 reverse primer <400> 86 cgaatctctt tgttgctgtc c 21 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LOC101926461 forward primer <400> 87 ctgaagcaaa tagagcatac 20 <210> 88 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LOC101926461 reverse primer <400> 88 gaatgttagc actatctgag c 21 <210> 89 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PLCB1 forward primer <400> 89 cttaccgttg accagatgat g 21 <210> 90 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PLCB1 reverse primer <400> 90 cattcaaatc cagtttctca gg 22 <210> 91 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SLC18A3 forward primer <400> 91 cctacggaga gcgaagacg 19 <210> 92 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SLC18A3 reverse primer <400> 92 cgaacagcgt ggcgtagtc 19 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC5A7 forward primer <400> 93 ccttgctgac gaagactgtg 20 <210> 94 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SLC5A7 reverse primer <400> 94 gggtaatagc cagggtagaa g 21 <210> 95 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CAMK2A forward primer <400> 95 gctgctgaag cccttaag 18 <210> 96 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CAMK2A reverse primer <400> 96 cgatggtggt gttggtgc 18 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EGLN2 forward primer <400> 97 gctacagcca cctctaccac 20 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EGLN2 reverse primer <400> 98 ctcctggttc tcttgcctgg 20 <210> 99 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ENO2 forward primer <400> 99 aaggtctttt cagggctgca g 21 <210> 100 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ENO2 reverse primer <400> 100 cgatggtgga gttgatgtgg t 21 <210> 101 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> LOC101866179 forward primer <400> 101 ggaggagaag caaatcatc 19 <210> 102 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> LOC101866179 reverse primer <400> 102 cactggaatc actaactgg 19 <210> 103 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> LOC101866246 forward primer <400> 103 cgtgagggca atgagaaag 19 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LOC101866246 reverse primer <400> 104 catcaagtat tggtctctcg 20 <210> 105 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> BAD forward primer <400> 105 gggacaggcc ctcagactc 19 <210> 106 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> BAD reverse primer <400> 106 cgaagggatg gaggaggag 19 <210> 107 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BCL2L1 forward primer <400> 107 ggagaccccc agtgccat 18 <210> 108 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BCL2L1 reverse primer <400> 108 gctgggatgt caggtcac 18 <210> 109 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CASP9 forward primer <400> 109 ccttcgttca tctcctgctt ag 22 <210> 110 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CASP9 reverse primer <400> 110 atcaccgaat cctccagaac c 21 <210> 111 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LOC101925175 forward primer <400> 111 gagaacctgg agaagaagac gg 22 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LOC101925175 reverse primer <400> 112 ctgctccagg tcagccatcg 20 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFRSF1A forward primer <400> 113 cacctgaaaa agagggggag 20 <210> 114 <211> 19 <212> DNA <213> Artificial Sequence <220> TNFRSF1A reverse primer <400> 114 catctctctg cgggaagcc 19 <210> 115 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 115 acaacagcct caagatcgtc ag 22 <210> 116 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 116 actgtggtca tgagtccttc c 21

Claims (18)

(GRIA2X6, GRIA2X7), HDAC5, HDAC10, NCAM1, NPY, SNCA, CCNG2, CDC7, CDH8, DLG3, DOCK3 , NEUROD6, NEUROG2, SPEN, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, MCM3AP, DRD1, DRD2, DRD3, GNAL, GNG7, LOC101865389, LOC101926461, PPP2R2B, ACHE, ADCY5, AKT3, KCNJ2, Or a protein encoded by said gene, wherein said gene comprises at least one gene selected from the group consisting of LOC101865389, LOC101926461, PLCB1, SLC18A3, SLC5A7, CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246, BAD, BCL2L1, CASP9, LOC101925175 and TNFRSF1A Biomarkers for identification of addiction and dependence. 2. The method of claim 1, wherein the gene expression is upregulated at the time of acute cocaine exposure. 2. The method according to claim 1, wherein the gene expression is upregulated at the time of acute cocaine exposure. A biomarker for identifying cocaine poisoning and dependence, comprising at least one gene selected from the group consisting of ADCY5, KCNJ2, LOC101925175 and CASP9, or a protein encoded by said gene. 3. The method of claim 1, wherein the expression of MCM3AP, GTF2I, ADAM23, CDH2, GRIA1X3, GRIA1X4, GRIA2X6, GRIA2X7, CCNG2, CDC7, CDH8, DLG3, NEUROD6, NEUROG2, SPEN, CAMK2A, EGLN2, TNFRSF1A and BCL2L1, or a protein encoded by said gene, wherein said biomarker is for identifying cocaine poisoning and dependence. 2. The method of claim 1, wherein the gene expression is upregulated in chronic cocaine exposure. 2. The method of claim 1, wherein the gene expression is up-regulated when exposed to chronic cocaine. A biomarker for identifying cocaine poisoning and dependence, comprising the above gene or a protein encoded by the gene. The method according to claim 1, wherein the gene expression is down-regulated when exposed to chronic cocaine. The method according to claim 1, wherein the gene is selected from the group consisting of MCM3AP, PTOV1, GTF2I, AKT3, CAMK2A and LOC101866246, Biomarkers for dependency checking. A biomarker for acute and chronic cocaine poisoning and dependence discrimination, comprising ARHGEF7, PTOV1 and GTF2I genes or proteins encoded by said genes. A biomarker protein for the detection of cocaine poisoning and dependence, including CAMK2A protein, GRIN1 protein and CASP9 protein, wherein the amount of protein expressed upon cocaine exposure changes. (GRIA2X6, GRIA2X7), HDAC5, HDAC10, NCAM1, NPY, SNCA, CCNG2, CDC7, CDH8, DLG3, DOCK3 , NEUROD6, NEUROG2, SPEN, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, MCM3AP, DRD1, DRD2, DRD3, GNAL, GNG7, LOC101865389, LOC101926461, PPP2R2B, ACHE, ADCY5, AKT3, KCNJ2, Wherein the detection reagent comprises at least one biomarker selected from the group consisting of LOC101865389, LOC101926461, PLCB1, SLC18A3, SLC5A7, CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246, BAD, BCL2L1, CASP9, LOC101925175 and TNFRSF1A. &Lt; / RTI &gt; 9. The composition of claim 8, wherein the detection reagent is a reagent capable of detecting the marker at the protein or nucleic acid level. 10. The method of claim 9, wherein the reagent for detecting the nucleic acid level of the marker comprises a nucleic acid sequence of the marker, a nucleic acid sequence complementary to the nucleic acid sequence, a primer pair or probe specifically recognizing the nucleic acid sequence and a fragment of the complementary sequence, A composition for identifying cocaine poisoning and dependence, comprising a primer pair and a probe. 11. The method according to claim 10, wherein the detection reagent is selected from the group consisting of a polymerase chain reaction, a real-time RT-PCR, a reverse-transcription polymerase chain reaction, a competitive RT-PCR, , S1 nuclease assay), in situ hybridization, nucleic acid microarrays, northern blots or DNA chips for the detection of cocaine poisoning and dependence. 11. The method of claim 10, wherein the primer pair comprises a pair of primers of SEQ ID NOS: 1 and 2, a pair of primers of SEQ ID NOS: 3 and 4, a pair of primers of SEQ ID NOS: 5 and 6, a pair of primers of SEQ ID NOS: 7 and 8, The primer pair of SEQ ID NOs: 11 and 12, the primer pair of SEQ ID NOs: 13 and 14, the primer pair of SEQ ID NOs: 15 and 16, the primer pair of SEQ ID NOs: 17 and 18, the primer pair of SEQ ID NOs: 19 and 20, The primer pair of SEQ ID NOs: 23 and 24, the primer pair of SEQ ID NOs: 25 and 26, the primer pair of SEQ ID NOs: 27 and 28, the primer pair of SEQ ID NOs: 29 and 30, the primer pair of SEQ ID NOs: Primer pairs of SEQ ID Nos. 33 and 34, primer pairs of SEQ ID Nos. 35 and 36, primer pairs of SEQ ID Nos. 37 and 38, primer pairs of SEQ ID Nos. 39 and 40, primer pairs of SEQ ID Nos. 41 and 42, Primers 43 and 44 The primer pair of SEQ ID NOs: 45 and 46, the primer pair of SEQ ID NOs: 47 and 48, the primer pair of SEQ ID NOs: 49 and 50, the primer pair of SEQ ID NOs: 51 and 52, the primer pair of SEQ ID NOs: 53 and 54, A primer pair of SEQ ID Nos. 61 and 62, a pair of primers of SEQ ID Nos. 63 and 64, a pair of primers of SEQ ID Nos. 65 and 66, a pair of primers of SEQ ID Nos. 67 and 68, The primer pair of SEQ ID NOs: 69 and 70, the primer pair of SEQ ID NOs: 71 and 72, the primer pair of SEQ ID NOs: 73 and 74, the primer pair of SEQ ID NOs: 75 and 76, the primer pair of SEQ ID NOs: 77 and 78, The primer pair of SEQ ID Nos: 81 and 82, the primer pair of SEQ ID Nos. 83 and 84, the primer pair of SEQ ID Nos. 85 and 86, the primer pair of SEQ ID Nos. 87 and 88, the primer pair of SEQ ID Nos. 89 and 90, Numbers 91 and 92 Primer pairs of SEQ ID NOs: 95 and 96, primer pairs of SEQ ID NOs: 97 and 98, primer pairs of SEQ ID NOs: 99 and 100, primer pairs of SEQ ID NOs: 101 and 102, primer pairs of SEQ ID NOs: 103 and 104, primer pairs of SEQ ID NOs: 105 and 106, primer pairs of SEQ ID NOs: 107 and 108, primer pairs of SEQ ID NOs: 109 and 110, primer pairs of SEQ ID NOs: 111 and 112, and primer pairs of SEQ ID NOs: Primer pair. &Lt; RTI ID = 0.0 &gt; 18. &lt; / RTI &gt; 10. The method of claim 9, wherein the reagent for detecting the protein level of the marker is selected from the group consisting of an antibody, an antibody fragment, an aptamer, an avidity multimer, or a peptidomimetic peptidomimetics) for the detection of cocaine poisoning and dependence. 14. The method of claim 13, wherein the detection reagent is selected from the group consisting of Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay ), Complement Fixation Assay (FACS), FACS, mass spectrometry or protein microarrays. SNACA, CCNG2, CDC7, CDH8, DLG3, DOCK3, NEUROD6, NEUROG2, SPEN, GRA1 (GRIA1X3, GRIA1X4), GRIA2 (GRIA2X6, GRIA2X7), HDAC5, HDAC10, NCAM1, NPY, SNCA, CTOV1, GTF2I, ADAM23, CDH2, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, MCM3AP, DRD1, DRD2, DRD3, GNAL, GNG7, LOC101865389, LOC101926461, PPP2R2B, ACHE, ADCY5, AKT3, KCNJ2, LOC101865389, LOC101926461, PLCB1, SLC18A3 Wherein the detection reagent comprises at least one biomarker selected from the group consisting of SLC5A7, CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246, BAD, BCL2L1, CASP9, LOC101925175 and TNFRSF1A. 1) From the biological sample derived from the test subject, ARHGEF7, PTOV1, GTF2I, ADAM23, CDH2, GRIA1 (GRIA1X3, GRIA1X4), GRIA2 (GRIA2X6, GRIA2X7), HDAC5, HDAC10, NCAM1, NPY, SNCA, CCNG2, CDC7, ACK3, NEUROD6, NEUROG2, SPEN, KDM2B (KDM2BX10, KDM2BX13), KIFAP3, RBM10, RBM14, TP53I11, WNT10B, MCM3AP, DRD1, DRD2, DRD3, GNAL, GNG7, LOC101865389, LOC101926461, PPP2R2B, ACHE, ADCY5, AKT3, The concentration of the nucleic acid or protein of at least one biomarker selected from the group consisting of KCNJ2, LOC101865389, LOC101926461, PLCB1, SLC18A3, SLC5A7, CAMK2A, EGLN2, ENO2, LOC101866179, LOC101866246, BAD, BCL2L1, CASP9, LOC101925175 and TNFRSF1A step;
2) comparing the detection result for the concentration of the nucleic acid or protein to a corresponding result of a corresponding marker of a normal control sample to which cocaine has not been administered; And
3) Compared with the normal control sample, PTOV1, HDAC5, HDAC10, NPY, SNCA, KDM2BX10, KDM2BX13, KIFAP3, WNT10B, DRD1, DRD2, DRD3, GNAL, PPP2R2B, GNG7, ACHE, SLC5A7, ADCY5, One or more genes or proteins selected from the group consisting of KCNJ2, LOC101925175, CASP9, ARHGEF7, SLC18A3, TNFRSF1A, BCL2L1, and BAD are upregulated and upregulated by one or more of MCM3AP, GTF2I, ADAM23, CDH2, GRIA1X3, GRIA1X4, GRIA2X6, GRIA2X7, CCNG2, CDC7 , And wherein the one or more genes or proteins selected from the group consisting of CDH8, DLG3, NEUROD6, NEUROG2, SPEN, CAMK2A, EGLN2, TNFRSF1A, BCL2L1, PTOV1, AKT3 and LOC101866246 are down- How to provide the information needed to diagnose the exposure. 17. The method of claim 16, further comprising the steps of: comparing PTOV1, HDAC5, HDAC10, NPY, SNCA, KDM2BX10, KDM2BX13, KIFAP3, WNT10B, DRD1, DRD2, DRD3, GNAL, PPP2R2B, GNG7, ACHE, SLC5A7, ADCY5, KCNJ2 , LOC101925175, and CASP9 are upregulated; And one or more genes or proteins selected from the group consisting of MCM3AP, GTF2I, ADAM23, CDH2, GRIA1X3, GRIA1X4, GRIA2X6, GRIA2X7, CCNG2, CDC7, CDH8, DLG3, NEUROD6, NEUROG2, SPEN, CAMK2A, EGLN2, TNFRSF1A and BCL2L1 Further comprising the step of determining that the patient is under acute cocaine exposure if the patient is down-regulated. 17. The method of claim 16, wherein at least one gene selected from the group consisting of ARHGEF7, DRD1, DRD2, DRD3, GNAL, PPP2R2B, SLC18A3, ACHE, SLC5A7, ADCY5, KCNJ2, TNFRSF1A, BCL2L1 and BAD The protein is upregulated; And determining that the one or more genes or proteins selected from the group consisting of MCM3AP, PTOVl, GTF2I, AKT3, CAMK2A, and LOC101866246 are downregulated to be chronic cocaine exposure, providing information necessary for cocaine exposure diagnosis Way.

Images