KR20190070886A - A stem cell culture composition comprising a copolymer capable of controlling stemness - Google Patents

Abstract

The present invention relates to a culture composition for controlling stemness comprising a copolymer. Specifically, it is possible to control stemness of stem cells cultured in the copolymer according to a change in the composition of hydrophobic cell-adhesive polymers and hydrophilic polymers having cell repulsion, constituting the copolymer.

Description

[0001] The present invention relates to a stem cell culture composition comprising a polymeric copolymer capable of controlling stem cell function,

The present invention relates to a culture composition for controlling stem cell function including a polymeric copolymer.

The application of stem cells to tissue engineering and regenerative medicine has received tremendous attention over the past decade. The global interest in the use of hMSCs in the treatment of human diseases has been heightened by encouraging the results of basic scientific research and hundreds of clinical trials are underway. Elderly patients who receive the most benefit from these therapies have fewer stem cells in their body and severely limit their therapeutic efficacy due to their marked decrease in the rate of proliferation and differentiation. Therefore, there is a limitation in increasing the number of stem cells in vivo of such patients, and expansion in vitro is required to secure an adequate number of stem cells for stem cell treatment.

In vitro, however, the minimum number of cells required for cell therapy or regenerative medicine is about 1 × ^{10 9} , which is further increased if the conditions are met and included in the experiment. In order to supply this amount of stem cells of a variety of existing origins, a minimum of at least 10 passages are required in vitro. Then, the cells are aged and deformed, and are no longer suitable for the concept of treatment. This is a big problem to be solved by the culture system of stem cells now. In addition, even if the conditions and criteria for these cells are taken, when the cells are used for treatment, the cells are already floated and other human stem cells must be used. In this case, Therefore, in order to use stem cells as a cell therapy agent, there is an urgent need to develop new methods for solving the above problems by increasing stemness.

Therefore, the inventors of the present invention have found that a change in the surface reaction force of the polymer through the change of the polymer composition causes the stem cell to recognize and adhere to the polymer substance, assuming that the interaction between the cell-substrate and the cell-cell will determine the behavior of the stem cell The stem cell function of the stem cells was changed, thereby completing a polymer polymer-based culture composition capable of controlling stem cell function.

Korean Patent Publication No. 10-2016-0089110

Acta Biomater. 2012; 8 (2): 559-569

An object of the present invention is to provide a stem cell culture composition for controlling stem cell function including a polymer copolymer.

Another object of the present invention is to provide a method for controlling stem cell function of a stem cell, which comprises culturing a cell in a stem cell culture composition comprising a polymer copolymer.

As described in the background art, in order to utilize stem cells as a cell therapy agent, not only a large amount of stem cells are required, but also maintaining and using a cell therapy agent in a timely manner by controlling the stem cell function of stem cells It is an important part.

As used herein, the term "stem cell function" refers to pluripotency, which is capable of producing all cells, such as embryonic stem cells, and self-renewal, which can indefinitely produce self- ) Ability is commonly used in the industry. In other words, stem cell function means the ability to maintain the characteristics of stem cells. Therefore, the improvement of stem cell ability means that it increases telomerase activity, increases expression of stemness acting signals, increases proliferation while maintaining undifferentiated cells, or increases cell migration activity (Pittenger, MF et al., 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284 (5411), 143-147). On the other hand, if the above characteristics are opposite, the stem cell capacity may be decreased. Therefore, in the present invention, controlling stem cell function means maintaining or enhancing stem cell function or lowering stem cell function to advance to differentiation stage.

Therefore, the present inventors have assumed that the cell-substrate interactions and cell-cell interactions of stem cells will play an important role in determining the behavior of stem cells such as whether differentiation and undifferentiation of stem cells, It was confirmed that the change of the surface bonding property and the repulsive force of the polymer caused by the change of the composition of the high molecular weight polymer caused a change in the behavior and function of the stem cells. Specifically, a stem cell is cultured in a culture composition comprising a polymeric polymer having a typical polymeric PCL having a cell adhesive domain and a polymer polymer having various chain lengths and molar fractions polymerized with PEG blocking the adhesion of the PCL, And it was confirmed that the composition of the polymer changed the stem cell function of stem cells.

Accordingly, the present invention provides a stem cell culture composition comprising a polymer copolymer controlling stem cell function of stem cells.

The polymeric copolymer may be a polymeric compound having a hydrophobic and cell adhesive domain and a hydrophilic polymeric compound having the cell repelling capability, and the polymeric compound may be a biocompatible polymer.

In one specific embodiment of the present invention, the copolymer may be a polymer of poly (ε-caprolactone) and PEG (poly (ethylene glycol)), which are biocompatible macromolecular compounds having cell adhesive domains. More specifically, it may have a structure represented by the following Formula 1:

[Chemical Formula 1]

In the above formula, X and y may mean molar fractions (mol%) of PEG and PCL, respectively.

Specifically, the change in molar fraction (mol%) of PEG and PCL constituting the copolymer causes a change in the adhesion of the stem cell to the copolymer, which also influences the interaction between the stem cells, In the examples of the present invention. In a specific example, the stem cell ability of stem cells was measured by measuring changes in the expression level of transcription factors expressed when stem cells were present, and measuring changes in REDOX regulatory factor and ROS. Thus, when stem cells are present as stem cells, the expression level of the transcription factor is increased, and the activation factor (REDOX) is activated to activate oxidative stress (ROS ) May be less.

In a specific embodiment of the present invention, stem cell performance of stem cells is improved as the molar fraction of PEG in the copolymer is increased. However, when the molar fraction of PEG in the copolymer is 25 mol% or more, It is confirmed that the amount of transcription factors expressed in stem cells such as NANOG and SOX2 is reduced. Preferably, the stem cell capability of the stem cells can be improved in a culture composition comprising a copolymer consisting of less than 5 to 25 mol% of PEG and more than 95 to 75 mol% of PCL.

In another embodiment of the present invention, it has been confirmed that the stem cell capacity is improved as the chain length of the PEG is increased. Specifically, when the chain length is 500 Da to 5000 Da, the stem cell ability of the stem cell can be improved.

In a more specific embodiment, the copolymer may be further enhanced in stem cell performance when composed of 5 to 10 mol% of PEG having a chain length of 750 to 2000 Da and 95 to 90 mol% of PCL.

The stem cells, which are cultured in the composition for a culture comprising the above-mentioned polymer, and whose stem cell performance is improved, may be mesenchymal stem cells, and more specifically, bone marrow-derived mesenchymal stem cells.

The present invention also provides a method for preparing a copolymer, comprising: preparing a copolymer by controlling a molar fraction of PEG (poly (ethylene glycol)) and PCL (poly-ε-caprolactone); And

And culturing the stem cells in a stem cell culture composition containing the copolymer as described above, to thereby control the stem cell function of the stem cells.

Since the constitution and characteristics of the prepared copolymer and stem cell are the same as those of the above-described stem cell culture composition, the description thereof is omitted in order to avoid redundant description.

The present invention confirms that the change in the behavior of the stem cells can be controlled by a change in the intrinsic characteristics of the synthetic material (polymer polymer) in contact with the cells. Accordingly, it can be used for the development of a stem cell culture platform and a cell therapy agent using a synthetic material.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic diagram showing (A) a copolymer structure comprising (A) PCL showing hydrophobicity and cell adhesion, PEG showing hydrophilic and cellular repulsive force, and cPCL showing hydrophilicity and cell adhesion. (B) protein adsorption and (C) change in contact angle on the spin-coated surface with changes in the mole fraction of each subunit. (D) Cell growth on various substrates, indicating changes in cell attachment and spread. (E) NANOG and (F) SOX2 genes expressing stem cell function upon culturing hMSCs on the various substrates. (G) ROS according to the cell culture substrate. The expression level of STRO-1, a marker for undifferentiation of hMSCs according to cell culture substrate, was measured.
FIG. 2 shows the results of (A) demonstrating that surface repellency is required for the regulation of stem cell function. In order to prove that surface repellency is required for the regulation of stem cell function, 10% PEG-90% PCL was pre-incubated with various concentrations of fibronectin (FN) (Green, phalloidi n; blue, Hoechst; scale bar = 100 μm). (B) NANOG and (C) SOX2 regulated by surface water repellency. All bars were mean ± SD * p <0.05, ** p <0.01 compared to TCPS.
(B) NANOG and (C) SOX2 (B). FIG. 3 is a graph showing the change in cell adhesion according to the change of the PEG chain length and mole fraction in the copolymer, Was measured and confirmed. (E) to (H) show the expression levels of antioxidation-related genes according to the substrate changes, and (I) the amounts of ROS according to the substrate changes.
Figure 4 shows nano- and angstrom-scale features dependent on PEG chain length using X-ray scattering (XRS) ((A) small angle and (B) wide angle). (C) the crystallization rate of PCL according to PEG chain length and environment (dry and wet state). (D) the lamellar spacing of PCL-PEG copolymers differing in PEG chain length. (E) PEG chain length. Fig.
FIG. 5 is (A) photographs of focal adhesion formation of hMSCs according to PEG chain length and molar fraction using structured illumination microscopy (SIM). (B) a graph showing the width of the formed focus adhesion.
Figure 6 is a graph showing the expression of NANOG and SOX2 expressed in hMSCs isolated from three patients cultured on a substrate containing (AC) 5% PEG _2k . (DF) PEG _2k in the hMSCs isolated from the three patients cultured on the substrate containing the antioxidant-related genes. (G) is the result of measuring intracellular ROS expressed in hMSCs isolated from three patients cultured on a substrate containing 5% PEG _2k .
FIG. 7 shows the expression level of signal transduction proteins involved in cell-substrate and cell-cell adhesion between (AB) according to the substrate. (CD) cell-substrate and cell-cell adhesion to the expression of genes involved in stem cell function and Redox regulation.

Materials and Methods

Manufacture of polymer matrix

Copolymers of all polymers and polymers are available from Acta Biomater. 2012; 8 (2): 559-569. Unless otherwise stated, all Invitro's experiments were performed on spin-coated polymer films made with a commercially available spin coater (Laurell Technologies, North Wales, Pa.). (Sigma-Aldrich, St. Louis, Mo.) was washed with a 15 mm round glass cover slip (Fisher Scientific, Waltham, MA) or a 10 cm Pyrex dish ₂ O and dried by heating to 80 DEG C for about 20 minutes. A 1% weight / volume (w / v) solution of the specific polymer mixed in tetrahydrofuran (THF, Sigma-Aldrich) was added to the glass cover slip (50 μL solution / sample) for 30 seconds at 3000 rpm, Ml solution / sample) at 1500 rpm for 2 minutes. All samples were then exposed to a constant cold-trap vacuum for more than 30 minutes to remove excess solvent and stored in the dryer until use. For cell experiments, substrates were UV sterilized for 30-60 minutes on each side before use. For the 15 mm cover glass, samples were placed in 24-well plates and fixed with an autoclave silicone O-ring (McMaster Carr, Atlanta, Ga.).

For protein pre-coating experiments, the desired amount of human fibronectin (Fisher Scientific) was diluted with serum-free aMEM and adsorbed to the surface of the material for at least 30 minutes at 37 ° C. Samples were rinsed twice with PBS and used for culture experiments.

Physicochemical Properties of Polymer Surface

Protein adsorption was measured by QCM-D (quartz crystal microbalance with dissipation). The polymer was spin-coated on a gold-coated crystal (5 MHz, QSX 301, QSense AB, Goetenberg, Sweden) for 30 seconds using ~ 50 μL of a 10 mg / mL solution at 3000 rpm using a spin coater. , TX). QCM-D measurements were performed using a Q-Sense E4 instrument (Q-Sense AB, Goetenberg, Sweden) at 37.5 ° C with 10% FBS according to standard protocols. Data was analyzed using the Voigt model in Q-tool software provided by Q-Sense, Inc. The contact angle was measured with a goniometer (Rami-Hart, Succassunna, NJ) using 10 μL of deionized water. Three measurements were performed for each of the three independent samples (n = 9).

Elastic surface modulus near the surface, sometimes referred to as surface coefficient or modulus, is measured using a Veeco NanoScope V (Bruker Corporation, Billerica, MA) using a cantilever with a rectangular cross section (MLCT Tip B; Bruker AFM Probes) ). Glass cover slips were used as control samples and all spin-coated cover slips were tested using the same protocol. Samples were incubated in PBS overnight at 37 C in air prior to testing. Terrain scans in the 5 μm × 5 μm area were performed in a contact mode that sampled 512 samples / line for 512 lines at a scan rate of 30 μm / s. A 5-μm z-limit was used to prevent tip damage. A force volume scan of the force was performed to calculate the area average elastic modulus of the sample. The 16 × 16 grid across the same area as the terrain scan was dominated by a maximum motor movement of 1.54 μm / s to 750 nm. The correction of the flexural-voltage curve d (V) of the cantilever beam was calculated using a series of marks within the glass cover slip assuming the stiffness of the cover slip. The correction has the following form:

V has a unit voltage (n = 3; R2 = 0.997). The Sader method is used to calculate the cantilever stiffness k (approximately 0.02 N / m) so that the force can be calculated as F = kd. The depth u of the station is calculated as follows:

P is the absolute position of the stage, P _C is the absolute position at the point of contact between the tip and sample, and d _c is the flatness of the cantilever at the point of contact. This allows a force-displacement F (u) diagram to be generated for each sample point in a force-volume image. This data was then analyzed using a modified conical indenter theory for the true probe geometry. This result was used as a parameter of the Levenberg-Marquadt fitting algorithm to calculate the elastic modulus E with a least-squares sense. The expected form of the F (u) data is as follows:

Where α is the half angle of the indentation probe (nominal mean 71.25 °) and β = 1.023 is the asymmetric correction factor of the probe with a non-compressible (ie Poisson's ratio υ = 0.5) and square base assuming the stiffness of the probe to be. The regional mean elastic modulus was determined by averaging the coefficients determined for each of the 256 locations of the same spacing within the 5 μm × 5 μm region characterized during the terrain scan. Analysis was performed using NanoScope Analysis v1.50 (Bruker). Ten randomly chosen locations were analyzed using the local analysis tool of this software package. 10-70% of the total force magnitude data was included in the analysis.

¹ H NMR was performed on a 400 MHz AV-400 console (Bruker Instruments, Inc.) using 1% w / v solution in CDCl ₃ . The mole percent composition for each copolymer was determined by comparing the incorporation of CH ₂ CH ₂ protons of PEG (δ = 3.65 ppm) and OCH ₂ protons representing ε-carbon of PCL peak at δ = 4.05 ppm.

The molecular weight was determined by gel permeation chromatography. After dissolving the copolymer in 10% w / v THF, the polymer solution was transferred to a Waters (R) solution equipped with a binary HPLC pump, a refractive index detector, a dual λ absorbance detector and four 5 mm Waters columns connected in series (300 mm x 7.7 mm) (Waters Corporation, Milford, Mass.) At a rate of 1 mL / min through a chromatography system.

The% PEG volume was calculated using three equations. First, the PCL molecular weight for each copolymer was calculated as follows:

PEG Molecular Weight Gel PEG Molecular Weight was taken from the manufacturer's data sheet and copolymer molecular weight reported by gel permeation chromatography. The weight percent of PEG or PCL in each copolymer was calculated as follows:

Finally, the PEG volume percent of each copolymer was calculated as follows:

1.234 and 1.146 are the density (g / cm &lt; 3 &gt;) of PEG and PCL, respectively.

이고, 시료 대 검출기 거리는 각각 작은- 및 중간각 산란에 대해 1479 및 416 ㎜이다. 방사선 손상은 각각 4 초 동안 10 회의 노출을 수집하여 모니터링 되었으며 방사선 손상은 관찰되지 않았다. BioXTAS RAW 0.99.14b 소프트웨어 (sourceforge.net의 오픈 소스)를 사용하여 작은 및 중간각 X-선 산란 데이터를 분석하였다. 넓은 각 X-선 산란 데이터를 회전 양극으로부터의 Cu Kα 방사선 및 88mm의 샘플 대 검출기 거리를 사용하여 브루커(Bruker) 영역 검출기에서 수집하였다. 이 데이터를 JADE 소프트웨어 (Materials Data Inc., Livermore, CA)를 사용하여 분석하였다.In X-ray scattering experiments, a Pyrex Petri dish was spin-coated with 40% w / v copolymer solution in THF. Each Petri dish was rotated twice to produce a film that could be peeled off the dish surface by hand and easily handled for transport, and cut to size for insertion into a 2 mm quartz capillary. X-ray scattering was performed before and after wetting by exposing the polymer to PBS for at least 6 hours (drying conditions). Small- and medium-angle X-ray scattering was performed at the Cornel High Energy Synchrotron Source (CHESS) facility in Ithaca, New York. The wavelength is 1.055

And the sample to detector distance is 1479 and 416 mm for small- and medium-angle scattering, respectively. Radiation damage was monitored by collecting 10 exposures for 4 seconds each and no radiation damage was observed. Small and medium angle X-ray scattering data were analyzed using BioXTAS RAW 0.99.14b software (open source from sourceforge.net). Wide angle X-ray scattering data were collected in a Bruker area detector using Cu Kα radiation from a rotating anode and a sample-to-detector distance of 88 mm. This data was analyzed using JADE software (Materials Data Inc., Livermore, Calif.).

Cell culture

The hMSC was purchased from Lonza (Walkersville, MD) and purchased from Vanderbilt University Medical Center with patients aged 65 years or older with Pampee P. Young according to the previously published method (Figure S9 for surface marker phenotype data). The hMSCs were incubated with the nucleosides (αMEM, Life Technologies, Carlsbad, CA), 1% penicillin / streptomycin (Life Technologies) and 4 μg / ml plasmocin (InvivoGen, San Diego, CA) with 16.7% fetal bovine serum CA) in the complete medium (CM) consisting of the minimal essential medium. Store the cell in humidified incubator at 37 ℃ and 5% CO ₂ and were replaced twice a week the medium. When ~ 80% confluent, hMSCs were separated by 0.05% trypsin-EDTA, re-inoculated at a density of 100-500 cells / cm ² and cultured for 7-14 days before reaching fusion. In all experiments, hMSCs (less than 6) were inoculated at a density of 10000 viable cells / cm ² as determined by trypan blue exclusion and cultured for 3-4 days prior to the last experiment.

Inhibitor study

HMSCs were exposed to various concentrations of inhibitor for 48 h to determine optimal concentrations. The following inhibitors and concentrations were used: 30 μM BTT 3033 (integrin α2β1 inhibitor, Tocris, Avonmouth, Bristol, UK), 30 μM P11 (integrin αvβ3 / αvβ5 inhibitor, Tocris) and 1 mg / mL GAP26 (Connexin- ). (Val-Cys-Tyr-Asp-Lys-Ser-Phe-Pro-Lys-Ser-Phe-Pro-Phe) on a Rink amide-MBHA resin by standard solid fluorenylmethyloxycarbonyl chloride chemistry using a PS3 synthesizer (Protein Technologies, AZ, Tucson) Ile-Ser-His-Val-Arg). These peptides were cleaved and deprotected in trifluoroacetic acid / thioanisole / ethanedithiol / anisole (90/5/3/2). The formation of the peptides was characterized by liquid chromatography-mass spectrometry (LC-MS).

For inhibition experiments, inhibitors of the indicated concentrations were added to the hMSC suspension and cells were inoculated onto the substrate. Cells were cultured for 4 days prior to harvesting RNA for gene expression analysis.

Intracellular activity Oxygen species (Reactive Oxygen Species, ROS ) Level measurement

hMSCs were incubated with 10 μM 5- (and -6) -chloromethyl-2 ', 7'-dichlorodehydrofluorene diacetate acetyl ester (DCFDA) (Life Technologies) in serum-free DMEM for 30 min according to the manufacturer's instructions Lt; / RTI &gt; Cells were trypsinized and run on a FACS Calibur flow cytometer (BD Biosciences, Franklin Lakes, NJ) with appropriate non-staining control. N = 3 biological replication was performed for each substrate condition. Data was analyzed using FlowJo software (Tree Star Inc., Ashland, OR).

Ultra-high resolution Imaging

The hMSCs were fixed with 4% paraformaldehyde (PFA, Sigma-Aldrich) for 15 min at room temperature, washed three times with 1X PBS and then permeabilized with 0.3% Triton X-100 (Sigma-Aldrich) . (Cat. No. A11004, Life Technologies) antibodies were incubated in 10% bovine serum albumin (Sigma-Aldrich) with 1 &lt; RTI ID = 0.0 &gt; : 200 and 1: 100, respectively, and centrifuged at 13000 rpm for 10 minutes before use. Samples were blocked at 10% bovine serum albumin for 20 minutes at room temperature, incubated for 1 hour and 45 minutes at room temperature for primary antibody culture, washed three times with 1X PBS and incubated for 2 hours at room temperature And washed three times with 1X PBS. The cells were mounted on a mounting medium of Vectashield (H-1000, Vector Laboratories, Inc. Burlingame, Calif.). Structured illumination microscopy imaging was performed on a GE Healthcare DeltaVision OMX equipped with a 60 Х 1.42 NA oil objective and an sCMOS camera. Images were collected from N = 3 biological replicates with n = 3 images per replicate. SIM images with maximum projections (Z) of 3D acquisition were analyzed using ImageJ (National Institutes of Health, Bethesda, Md.). The focal adhesion width was calculated by plotting a line across the leading edge of the cell using an ImageJ 1D line tool (width = 10). A 1D plot of pixel intensity was generated as the line was drawn to identify the focal adhesion region in the plot. The maximum radial width (fwhm) was used as the width measurement of each focus adhesive. At least 40 cell averages in three images were shown for each group.

Western Blat

Western blot analysis was performed according to the basic protocol. The primary antibodies used in this study were as follows: Integrin-α2 (1: 200, sc-6586r, Santa Cruz Biotechnology, Dallas, TX), Integrin-β3 (1: 200, D7X3P, , Cell Signaling Technologies), Connexin-43 (1: 200, # 3512, Cell Signaling Technologies) Integrin-β5 (1: 200, D24A5, Cell Signaling Technologies), Connexin- ), and GAPDH (1: 5000, 14C10, Cell Signaling Technologies). Blots were imaged on an Odyssey imaging system according to the manufacturer's protocol using a suitable secondary antibody from Li-COR (Lincoln, NB).

Flow cytometry Cytometry ) And Immunophenotyping Analysis

The hMSCs were fixed with 4% paraformaldehyde (PFA, Sigma-Aldrich) for 15 min and permeabilized with 0.3% Triton-X (Sigma-Aldrich) for 15 min when probed intracellularly and incubated with 10% goat serum -Aldrich) for at least 2 hours, all at room temperature. The hMSCs were then incubated overnight at 4 ° C with 1% bovine serum albumin and incubated with appropriate secondary antibodies at 1: 500 in 5% goat serum for 2 h at room temperature. Hoechst (2 μg / mL, Sigma-Aldrich). To stain the actin cytoskeleton, cells were incubated with Alexa 488-phallodin (1:40 v / v in PBS, Life Technologies) for 10 minutes and then incubated with Hoechst (2 μg / mL, Sigma-Aldrich) And stained for 20 minutes. Imaging was performed with a Nikon Ti inverted microscope (Nikon Instruments Inc., Melville, NY, USA) or Zeiss LSM 710 confocal microscope (Carl Zeiss, Oberkochen, Germany) and images were processed with ImageJ (National Institutes of Health).

For flow cytometry, the fluorescence and scattering channel voltages were set using unstained hMSCs. The compensation value was determined using a single-stained hMSC and the fluorescence signal in one channel was clearly visible in cells stained positive. Cells were then measured on a FACS Calibur flow cytometer (BD Biosciences). Each experiment represents 10000 gate cells and the data was analyzed by FlowJo software (Tree Star Inc., Ashland, OR).

Quantitative real time PCR  ( cPCR  And qRT - PCR )

The hMSCs on the spin-coated substrate were homogenized with Trizol reagent (Life Technologies), mixed with chloroform (1: 5 Trizol: chloroform) and centrifuged (12000 g, 15 min, 4 ° C). The RNA contained in the aqueous phase was separated on an RNeasy column (Bio-Rad, Hercules, Calif.) According to the manufacturer's instructions. CDNA was synthesized using a kit (Applied Biosystems, Life Technologies), and a CFX real-time PCR system (Bio-Rad) was performed with SYBR Green Master Mix (Bio-Rad) with 15-20 ng cDNA and 500 Nm each of forward and reverse primers, Was used to perform qRT-PCR. The qRT-PCR protocol was repeated for 40 minutes at 95 ° C for 3 minutes, followed by denaturation at 95 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, and denaturation at 72 ° C for 30 seconds. The expression of the gene was normalized by the expression of a housekeeping gene, GAPDH (glyceraldehyde 3-phosphate dehydrogenase), and the value of ΔC (t) was calculated. The primer sequences used in the PCR in the present invention are listed in Table 1 below, and only those that represent a single specific amplicon were used in the qRT-PCR experiment.

Gene
Accession Number
Forward Primer (5 '- 3')
Reverse Primer (3'-5 ')
Amplicon (bp)
SOX2
NM_003106.3
ATCAGGAGTTGTCAAGGCAGAG
(SEQ ID NO: 1)
CGCCGCCGATGATTGTTATT
(SEQ ID NO: 2)
172
Nanog
NM_024865.2
AATACCTCAGCCTCCAGCAGATG
(SEQ ID NO: 3)
TGCGTCACACCATTGCTATTCTTC
(SEQ ID NO: 4)
148
SESN1
NM_001199933
CGACCAGGACGAGGAACTT
(SEQ ID NO: 5)
CCAATGTAGTGACGATAATGTAGG
(SEQ ID NO: 6)
273

SOD2
NM_000636
GCTGACGGCTGCATCTGTT
(SEQ ID NO: 7)
CCTGATTTGGACAAGCAGCAA
(SEQ ID NO: 8)
101

TRX
NM_003329
TGAAGCAGATCGAGAGCAAGAC
(SEQ ID NO: 9)
TTCATTAATGGTGGCTTCAAGC
(SEQ ID NO: 10)
305

APE / REF-1
NM_001641
GCAGATACGGGGTTGCTCTT
(SEQ ID NO: 11)
TTTTACCGCGTTGCCCTACT
(SEQ ID NO: 12)
136

CX43
NM_000165.3
TCATTAGGGGGAAGGCGTGA
(SEQ ID NO: 13)
GGGCACCACTCTTTTGCTTAAA
(SEQ ID NO: 14)
164

ICAM -One
NM_000201.2
TGTGACCAGCCCAAGTTGTT
(SEQ ID NO: 15)
TGGAGTCCAGTACACGGTGA
(SEQ ID NO: 16)
186
N- Cadherin
NM_001792
CGAGCCGCCTGCGCTGCCAC
(SEQ ID NO: 17)
CGCTGCTCTCCGCTCCCCGC
(SEQ ID NO: 18)
199
ITGA1
NM_181501.1
ACGCTGCTGCGTATCATTCA
(SEQ ID NO: 19)
CACCTCTCCCAACTGGACAC
(SEQ ID NO: 20)
194
ITGA2
NM_002203.3.
TTAGCGCTCAGTCAAGGCAT (SEQ ID NO: 21)
CGGTTCTCAGGAAAGCCACT (SEQ ID NO: 22)
179
ITGA3
NM_002204.2
GCTGACCGACGACTACTGAG
(SEQ ID NO: 23)
CTGGTCACCCAGTGCTTCTT
(SEQ ID NO: 24)
178
ITGA5
NM_002205.2
AGACTTCTTTGGCTCTGCCC
(SEQ ID NO: 25)
CGCTCCTCTGGGTTGAACAT
(SEQ ID NO: 26)
174
ITGA6
NM_001079818.1
TCATGGATCTGCAAATGGAA
(SEQ ID NO: 27)
AGGGAACCAACAGCAACATC
(SEQ ID NO: 28)
135
ITGA11
NM_001004439
GCCTACTGAAGCTGAGGGAC
(SEQ ID NO: 29)
TGTGATTCAGCTGTGGAGCA
(SEQ ID NO: 30)
129
ITGAv
NM_002210.4
TCCGATTCCAAACTGGGAGC
(SEQ ID NO: 31)
AAGGCCACTGAAGATGGAGC
(SEQ ID NO: 32)
137
ITGB1
NM_002211.3
GCGCGGAAAAGATGAATTTACAAC
(SEQ ID NO: 33)
ATCTGGAGGGCAACCCTTCT
(SEQ ID NO: 34)
245
ITGB3
NM_000212.2
ACCAGTAACCTGCGGATTGG
(SEQ ID NO: 35)
TCCGTGACACACTCTGCTTC
(SEQ ID NO: 36)
208
ITGB5
NM_002213.3
TACCTGGAACAACGGTGGAG
(SEQ ID NO: 37)
GCTTCGGGCCTCCAATGATA
(SEQ ID NO: 38
242
GAPDH
NM_002046.4
GCACCGTCAAGGCTGAGAAC
(SEQ ID NO: 39
TGGTGAAGACGCCAGTGGA
(SEQ ID NO: 40)
138

Cell proliferation measurement

hMSCs were cultured in 10 μM 5-ethynyl-2'-deoxyuridine (EDU) (Life Technologies, Carlsbad, CA) in serum-free medium for 12 hours before the 96 hour incubation period was completed. Cells were fixed in 4% paraformaldehyde (PFA, Sigma-Aldrich, St. Louis, MO) and processed according to the manufacturer's instructions. Images were taken with a Zeiss LSM 710 microscope (Carl Zeiss, Oberkochen, Germany) and the images were processed with Zeiss Zen software and ImageJ (National Institutes of Health, Bethesda, MD). N = 6 biological replication was used for each of the substrate conditions.

result

Synthesis of copolymer library

We have shown that PCL with hydrophobicity and protein adsorption; PEG with hydrophilic and cell-repellant properties; And carboxylated-PCL (cPCL), which is hydrophilic but has affinity for proteins. Specifically, the PEG-PCL copolymer represented by Chemical Formula (1) and the PEG-PCL-cPCL copolymer substrate shown in FIG. 1A were polymerized to change the mole fractions of each polymer constituting the copolymer. In particular, The copolymer was prepared using PEG having a length (molecular weight).

cPCL was introduced as a "rescue" material for the repulsive force of PEG to determine how the cell antiretension of PEG affects the behavior of stem cells.

The composition of the copolymer is derived from human Intermediate lobe  Stem Cells( hMSC )of Stem cell ability  And Redix  Effect on phenotype

We observed the behavior of hMSCs by culturing hMSCs on substrates made of the copolymers produced. As a result, it was confirmed that the protein adsorbability (FIG. 1B) and the contact angle (FIG. 1C) varied with the PEG mole% in the copolymer. This shows that as the PEG content increases, it causes more hydrophilic and protein-repellent surfaces, and therefore, the increase of the PEG mole% in the copolymer decreases the protein adsorption and the contact angle. These effects, however, are hydrophilic but have the opposite effect by introducing a protein-affinity cPCL (carboxylated-PCL).

In addition, hMSCs formed agglutinates on the PEG-PCL copolymer substrate, but confirmed that they were spread widely in the 100% PCL and cPCL-containing copolymer (FIG. 1D) substrate, demonstrating functional repulsion of PEG and adhesion of PCL and cPCL.

We next assessed the control of the copolymerization of NANOG and SOX2 , two basic stem cell genes that maintain their ability to regenerate and differentiate. In support of our hypothesis that the repulsive force would regulate stem cells, one copolymer 10% PEG-90% PCL significantly increased NANOG and SOX2 expression compared to the TCPS control with reduced intracellular ROS (Fig. 1E, 1F and 1G).

In addition, the expression of STRO-1, the most commonly used in vivo marker of undifferentiated hMSCs, was gradually lost during in vitro culture in TCPS but was restored in 10% PEG-90% PCL (Fig. 1H). Increasing the mol% PEG to 25% PEG-75% PCL also reduced the expression of stem cells, which resulted in a large area without cell attachment due to the high repulsion surface of 25% PEG (data not shown) , And the molar fraction of the PEG was defined as the upper limit of the cellular foot reaction force.

Verification of the effect of copolymer film chemistry on hMSC behavior

The copolymer surface was previously coated with adhesive fibronectin (FN) at various concentrations to mask the repulsive force area without changing the copolymer composition. FN performed cell attachment and spreading while reducing aggregation (Figure 2A). After 8 hours, hMSCs on 10% PEG-90% PCL coated with uncoated copolymer and 0.05 μg / cm ² FN formed independent aggregates (red arrows) and after 72 hours the cells were elongated but still agglutinated Cell-cell interaction. For qPCR, TCPS and HD were used as a control group without repulsive force, respectively. 10% PEG-90% hMSCs showed similar levels of NANOG and SOX2 expression as HD, but this effect decreased with increasing FN concentration (Figs. 2B and C). For reference, in most known biomaterial systems aimed at assessing the effect of stiffness of a material, the material is coated with an adhesive protein layer that does not interfere with the material derivative effect. Thus, FN precoating also suggests that changes in stiffness of the substrate are less effective in stem cell behavioral changes than in our system, since the stiffness of the material below does not change and the observed changes in stem cell function are lost.

Phenotypic evaluation of hMSC according to changes in PEG chain length and molar fraction

The cellular reaction was further confirmed by controlling the chain length and / or mol% of PEG in the copolymer. (i) 5-20 mol% of PEG and (ii) a block length of 750 Da, 2 kDa or 5 kDa (denoted by the subscript numbers) were synthesized and characterized as described above. After 4 days of incubation, the PEG ₇₅₀ copolymer allowed to adhere but decreased with increasing molar% of PEG (FIG. 3A).

This tendency was more evident in PEG _2k copolymers such that 10 mol% PEG inhibited cell adhesion and virtually no adhesion was observed in the PEG _5k copolymer. For further study of the two variables, four copolymers (5%) were added for further study of variables such as (1) increased PEG chain size at constant mol% and (2) increased molar% at constant PEG chain size. PEG ₇₅₀ , 20% PEG ₇₅₀ , 5% PEG _2k and 10% PEG _2k ) (Figure 3A, B, red letter).

PEG ₇₅₀ The hMSC on the copolymer interacted with the surface and extended, but the cells on the PEG _2k copolymer produced more isolated aggregates (Figure 3B). Expression of NANOG (Fig. 3C) and SOX2 (Fig. 3D) was greatly affected by both PEG chain length and mol%. NANOG expression was significantly increased in all the copolymers compared to the TCPS control, and continued to increase at 10% PEG _2k . Copolymers composed of longer PEG chains (2 kDa to 750 Da) further stimulated the expression of the SOX2 gene, and the mol% increase (10% / 20% vs. 5%) of PEG in each group further enhanced this effect . The expression of major antioxidant mediators including sestrin 1 (SESN1), thioredoxin (TRX), superoxide dismutase 2 (SOD2) and apurinic endonuclease / redox-factor 1 (APE / Ref-1) was increased in all the copolymers. (FIG. 3E-H) and intracellular ROS load (FIG. 3I) were significantly reduced compared to TCPS.

Investigation at the nano and angstrom levels of PEG and PCL phase separation

In order to understand how the polymer structure affects cell function at the cell-material interface, the nanoscale properties of the copolymer surface were investigated by X-ray scattering (XRS). Small XRS layered peaks (Figure 4A) and wide XRS crystal peaks (Figure 4B) associated with the PCL domain are present in all samples, confirming that PEG does not interfere with the formation of PCL lamellar. The absence of PEG crystal peaks in all samples of PEG _2k and PEG _5k , where PEG is expected to crystallize, suggests that PEG crystallization is interrupted in the copolymer. In addition, these two observations can be concluded that the PEG chain is embedded as an amorphous segment within the amorphous domain of semi-crystalline PCL. However, the effect of the PEG segment on the shape of the copolymer depends on its chain length. For example, the PCL crystallinity of the PEG ₇₅₀ copolymer during hydration did not change (Fig. 4C), but the median angle XRS was widened, indicating that the PCL chain of the copolymer was less aligned when hydrated. In contrast, the PCL crystallinity in the copolymers of 100% PCL and PEG _2k and PEG _5k is increased during hydration and the intermediate angular XRS peak is steep and indicates that the PCL crystal heat does not increase or change during hydration.

In connection with our data, although PEG does not interfere with the formation of PCL lamellae, its chain length-dependent distribution affects the properties of the lamella (Figure 4D): shorter PEG segments within the PEG ₇₅₀ copolymer Is dispersed in the amorphous matrix and reduces the PCL crystallinity upon wetting. In contrast, longer PEG segments in the PEG _2k and PEG _5k copolymers are excluded from the amorphous PCL, allowing increased PCL crystallinity in wetting. These excluded PEG segments expand during hydration, form mushrooms on the material surface, and form loops that stop cell attachment (Fig. 4E). These loops account for the increase in lamellar spacing in PEG ₇₅₀ and PEG _2K compared to 100% PCL in hydration; That is, the swollen PEG domain pushes the crystalline PCL lamella in a physically wet state (FIG. 4D). In fact, the PEG loop formed on the polymer surface creates a protective surface that explains the improved cell repellency of the PEG _2k and PEG _5k copolymers. Thus, the PEG chain exhibits a chain length-dependent effect in hMSC behavior control. The inserted PEG ₇₅₀ chain can not collectively diffuse into the polymer-air / water interface, thus reducing the repulsive force at a given mole percent. The PEG _2k and PEG _5k copolymers exhibit increased repulsive force even at 5 mol% because the phase-separated PEG chains on hydration form a ring on the material surface to mask the adherent and amorphous PCL and increase the effect at each mol%.

To demonstrate that hMSC recognizes the cell-matter interface differently depending on the PEG chain length, we visualized focal adhesion (FA) formation at the cell-material interface using a super resolution, structured illumination microscope. The major FA protein, paxillin, was chosen to form non-transient adherent complexes on the surface of the material (Fig. 5). Cells cultured on glass and 100% PCL substrates have large FA sites, 5% PEG ₇₅₀ and 20% PEG ₇₅₀ copolymers form FAs with similar morphologies, and short PEG chains do not interfere with cell attachment on the material surface (Fig. 5A). In contrast, the size and number of FA regions decreased in 5% PEG _2k and 10% PEG _2k . FA width reduction and long axis extension are associated with weak cell-substrate binding and FA observed in PEG _2k copolymers exhibit weak cell-material interactions. When quantified, the FA width was similar in the PEG ₇₅₀ copolymer compared to the glass and 100% PCL, but the surface crystallinity was significantly reduced in the PEG _2k copolymer (FIG. 5B). Substrates affect surface roughness and can affect FA formation. However, based on the data presented in Figure 4C, the difference in surface roughness caused by crystallinity is small, since the wetted surfaces for all the copolymers have the same degree of crystallinity. Therefore, it could be concluded that the difference of the FA type is due to the copolymer skeletal chemical reaction (PEG steric hindrance effect).

hMSC  Stem cells from donors Stem cell ability  And Redox  Prove the effect of copolymer on phenotype

Since strong cell responses were consistently observed in the 5% PEG _2k copolymer to demonstrate whether the effect of the substance was due to donor dependence, the hMSCs derived from the three patients were incubated in 5% PEG _2k copolymer . The expression of NANOG and SOX2 was significantly increased at 5% PEG _2k compared to TCPS for all donors (Fig. 6A-C), and in almost all cases the expression of antioxidant genes was increased (Fig. 6D-F). Intracellular ROS levels were reduced in all patient cells cultured in the copolymer compared to the TCPS control (Fig. 6G). Since a balance of cell-cell and cell-substrate adhesion was assumed to induce this effect, we measured gene expression of multiple cell adhesion molecules and integrin subtypes (Fig. 7A) and found that CX43, integrin alpha 2 (ITGA2) β3 / β5 (ITGB3 / B5) were selected as candidate modulators of the substance-induced effects. An increase in protein level expression through inhibitor treatment was confirmed by Western blot (Fig. 7B). It was confirmed that inhibition of the regulator, particularly inhibition of CX43, strongly suppressed the expression of stem cell function (Fig. 7C) and antioxidation related gene (Fig. 7D).

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> A stem cell culture composition comprising a copolymer capable of          controlling stemness <130> P18U18C1818 <150> KR 10-2017-0171216 <151> 2017-12-13 <160> 40 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SOX2 Forward Primer <400> 1 atcaggagtt gtcaaggcag ag 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SOX2 Reverse Primer <400> 2 cgccgccgat gattgttatt 20 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Nanog Forward Primer <400> 3 aatacctcag cctccagcag atg 23 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nanog Reverse Primer <400> 4 acgctgctgc gtatcattca 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SESN1 Forward Primer <400> 5 cgaccaggac gaggaactt 19 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SESN1 Reverse Primer <400> 6 ccaatgtagt gacgataatg tagg 24 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SOD2 Forward Primer <400> 7 gctgacggct gcatctgtt 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SOD2 Reverse Primer <400> 8 cctgatttgg acaagcagca a 21 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRX Forward Primer <400> 9 tgaagcagat cgagagcaag ac 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRX Reverse Primer <400> 10 ttcattaatg gtggcttcaa gc 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APE / REF-1 Forward Primer <400> 11 gcagatacgg ggttgctctt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APE / REF-1 Reverse Primer <400> 12 ttttaccgcg ttgccctact 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CX43 Forward Primer <400> 13 tcattagggg gaaggcgtga 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CX43 Reverse Primer <400> 14 gggcaccact cttttgctta aa 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ICAM-1 Forward Primer <400> 15 tgtgaccagc ccaagttgtt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ICAM-1 Reverse Primer <400> 16 tggagtccag tacacggtga 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> N-Cadherin Forward Primer <400> 17 cgagccgcct gcgctgccac 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> N-Cadherin Reverse Primer <400> 18 cgctgctctc cgctccccgc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA1 Forward Primer <400> 19 acgctgctgc gtatcattca 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA1 Reverse Primer <400> 20 cacctctccc aactggacac 20 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITGA2 Forward Primer <400> 21 ttagcgctca gtcaaggc 18 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ITGA2 Reverse Primer <400> 22 cggttctcag gaaagccac 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA3 Forward Primer <400> 23 gctgaccgac gactactgag 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA3 Reverse Primer <400> 24 ctggtcaccc agtgcttctt 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA5 Forward Primer <400> 25 agacttcttt ggctctgccc 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA5 Reverse Primer <400> 26 cgctcctctg ggttgaacat 20 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITGA6 Forward Primer <400> 27 tcatggatct gcaaatgg 18 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITGA6 Reverse Primer <400> 28 agggaaccaa cagcaaca 18 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 Forward Primer <400> 29 gcctactgaa gctgagggac 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 Reverse Primer <400> 30 tgtgattcag ctgtggagca 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGAv Forward Primer <400> 31 tccgattcca aactgggagc 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGAv Reverse Primer <400> 32 aaggccactg aagatggagc 20 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ITGB1 Forward Primer <400> 33 gcgcggaaaa gatgaattta caac 24 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB1 Reverse Primer <400> 34 atctggaggg caacccttct 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB3 Forward Primer <400> 35 accagtaacc tgcggattgg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB3 Reverse Primer <400> 36 tccgtgacac actctgcttc 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB5 Forward Primer <400> 37 tacctggaac aacggtggag 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB5 Reverse Primer <400> 38 gcttcgggcc tccaatgata 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Forward Primer <400> 39 gcaccgtcaa ggctgagaac 20 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Reverse Primer <400> 40 tggtgaagac gccagtgga 19

Claims (13)

A composition for stem cell culture for controlling stem cell function comprising a copolymer comprising PEG (poly (ethylene glycol)) and PCL (poly (? -Caprolactone)). The composition for stem cell culture for controlling stem cell function according to claim 1, wherein the copolymer comprising PEG (poly (ethylene glycol)) and PCL (poly (? -Caprolactone) :
[Chemical Formula 1]

In the above formulas,
x and y mean mole fractions (mol%) of PEG and PCL, respectively. The composition for culturing stem cells according to claim 1, wherein the stem cell performance is improved when the copolymer is polymerized with 5 to 25 mol% of PEG and 95 to 75 mol% of PCL. The composition for culturing stem cells according to claim 1, wherein the PEG has a chain length of 500 Da to 5000 Da, whereby stem cell performance is improved. The method according to claim 1, wherein the copolymer is formed of 5 to 10 mol% of PEG having a chain length of 750 Da to 2000 Da and 95 to 90 mol% of PCL, wherein the stem cell performance is improved. Gt; a stem cell culture. The composition for culturing a stem cell according to claim 1, wherein the stem cell is a human-derived mesenchymal stem cell (hMSC). Preparing a copolymer by controlling the mole fractions of PEG (poly (ethylene glycol)) and PCL (poly (ε-caprolactone)); And
And culturing the stem cells in a stem cell culture composition containing the produced copolymer. 8. The method according to claim 7, wherein the copolymer is prepared by further controlling the chain length or molecular weight of PEG in the step of preparing the copolymer. The method according to claim 7, wherein the copolymer of PEG (poly (ethylene glycol)) and PCL (poly (ε-caprolactone)) is represented by the following formula:
[Chemical Formula 1]

In the above formulas,
X and y mean mole fraction (mol%) of PEG and PCL, respectively. The method according to claim 7, wherein the stem cell performance is improved when the copolymer is polymerized with 5 to 20 mol% of PEG and 95 to 80 mol% of PCL. 8. The method according to claim 7, wherein the PEG has a chain length of 500 Da to 5000 Da, whereby stem cell performance is improved. The method according to claim 7, wherein the copolymer is composed of 5 to 10 mol% of PEG having a chain length of 750 Da to 2000 Da and 95 to 90 mol% of PCL, / RTI &gt; 8. The method according to claim 7, wherein the stem cells are human-derived mesenchymal stem cells.

Images