KR20190070886A - A stem cell culture composition comprising a copolymer capable of controlling stemness - Google Patents
A stem cell culture composition comprising a copolymer capable of controlling stemness Download PDFInfo
- Publication number
- KR20190070886A KR20190070886A KR1020180160310A KR20180160310A KR20190070886A KR 20190070886 A KR20190070886 A KR 20190070886A KR 1020180160310 A KR1020180160310 A KR 1020180160310A KR 20180160310 A KR20180160310 A KR 20180160310A KR 20190070886 A KR20190070886 A KR 20190070886A
- Authority
- KR
- South Korea
- Prior art keywords
- peg
- copolymer
- stem cell
- pcl
- mol
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0662—Stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M23/00—Constructional details, e.g. recesses, hinges
- C12M23/20—Material Coatings
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2533/00—Supports or coatings for cell culture, characterised by material
- C12N2533/30—Synthetic polymers
Abstract
Description
본 발명은 고분자 공중합체를 포함하는 줄기세포능을 제어하기 위한 배양 조성물에 관한 것이다.The present invention relates to a culture composition for controlling stem cell function including a polymeric copolymer.
줄기세포를 조직 공학 및 재생 의학에 적용하는 것은 지난 10 년 동안 엄청난 관심을 받았다. 기초 과학 연구의 결과를 고무함으로써 인간의 질병 치료에 대한 hMSC의 사용에 대한 전세계의 관심이 높아졌으며 현재 수백 건의 임상 시험이 진행 중이다. 이러한 치료법으로 가장 많은 혜택을 보는 노인 환자들은 체내 줄기 세포의 수가 적고, 이들의 증식 속도 및 분화 능력에 현저한 감소로 인해 치료 효능을 심각하게 제한한다. 따라서, 이러한 환자들의 생체 내에서 줄기 세포의 수를 증가시키는 것에 한계가 있으며, 줄기 세포 치료를 위한 적정 수의 줄기 세포를 확보하기 위한 in vitro로의 확장이 요구된다.The application of stem cells to tissue engineering and regenerative medicine has received tremendous attention over the past decade. The global interest in the use of hMSCs in the treatment of human diseases has been heightened by encouraging the results of basic scientific research and hundreds of clinical trials are underway. Elderly patients who receive the most benefit from these therapies have fewer stem cells in their body and severely limit their therapeutic efficacy due to their marked decrease in the rate of proliferation and differentiation. Therefore, there is a limitation in increasing the number of stem cells in vivo of such patients, and expansion in vitro is required to secure an adequate number of stem cells for stem cell treatment.
그러나 in vitro에서도, 세포 치료나 재생의학에서 최소 필요한 세포의 수는 1X109 정도이며, 조건을 잡고 기준을 정하는 실험까지 포함한다면 그 양은 더욱 늘어난다. 기존의 다양한 기원의 줄기세포로 이 정도의 양을 공급하려면 최소 in vitro에서 10번 이상의 계대가 필요하게 된다. 그러면 세포는 노화되고 변형되어 더 이상 치료의 개념에 적합하지 않게 되는 문제점이 있다. 이는 지금의 줄기세포의 배양시스템이 가지고 있는 풀어야 할 큰 문제점이다. 그리고 이러한 세포로 조건과 기준을 잡았다 하더라도 치료에 사용할 시에는 이미 그 세포는 바닥이 나고 다른 인간의 줄기세포를 써야 하는 경우가 발생하며, 그럴 경우 또 다른 세포이용에 따른 부가적인 실험을 다시 거쳐야 하기 때문에 줄기세포를 세포치료제로 사용하기 위해서는, 줄기세포능(stemness)을 증가시켜 상기와 같은 문제점을 해결할 수 있는 새로운 방법의 개발이 절실한 실정이다.In vitro, however, the minimum number of cells required for cell therapy or regenerative medicine is about 1 × 10 9 , which is further increased if the conditions are met and included in the experiment. In order to supply this amount of stem cells of a variety of existing origins, a minimum of at least 10 passages are required in vitro. Then, the cells are aged and deformed, and are no longer suitable for the concept of treatment. This is a big problem to be solved by the culture system of stem cells now. In addition, even if the conditions and criteria for these cells are taken, when the cells are used for treatment, the cells are already floated and other human stem cells must be used. In this case, Therefore, in order to use stem cells as a cell therapy agent, there is an urgent need to develop new methods for solving the above problems by increasing stemness.
이에 본 발명자들은 세포-기질 및 세포-세포간의 상호작용이 줄기세포의 행동을 결정할 것이라는 가정하에, 고분자 조성의 변화를 통한 고분자 표면 반발력의 변화가 상기 줄기세포가 상기 고분자 물질을 인식하여 접착하는 과정에서 줄기세포의 줄기세포능과 같은 기능상의 변화를 야기함을 확인함으로써, 줄기세포능을 제어할 수 있는 고분자 중합체 기반의 배양 조성물을 완성하였다.Therefore, the inventors of the present invention have found that a change in the surface reaction force of the polymer through the change of the polymer composition causes the stem cell to recognize and adhere to the polymer substance, assuming that the interaction between the cell-substrate and the cell-cell will determine the behavior of the stem cell The stem cell function of the stem cells was changed, thereby completing a polymer polymer-based culture composition capable of controlling stem cell function.
본 발명의 목적은 고분자 공중합체를 포함하는 줄기세포능을 제어하는 줄기세포 배양 조성물을 제공하는 것이다.An object of the present invention is to provide a stem cell culture composition for controlling stem cell function including a polymer copolymer.
본 발명의 다른 목적은 고분자 공중합체를 포함하는 줄기세포 배양 조성물에 세포를 배양시키는 단계를 포함하는, 줄기세포의 줄기세포능을 제어하는 방법을 제공하는 것이다.Another object of the present invention is to provide a method for controlling stem cell function of a stem cell, which comprises culturing a cell in a stem cell culture composition comprising a polymer copolymer.
배경기술에서 전술한 바와 같이, 줄기세포를 세포치료제로 이용하기 위해서는 다량의 줄기세포가 필요할 뿐만 아니라, 줄기세포의 줄기세포능을 조절하여 시기 적절하게 세포 치료제를 유지 및 사용하는 것이 세포 치료에 있어 중요한 부분이다.As described in the background art, in order to utilize stem cells as a cell therapy agent, not only a large amount of stem cells are required, but also maintaining and using a cell therapy agent in a timely manner by controlling the stem cell function of stem cells It is an important part.
본 발명에 사용된 용도 "줄기세포능"은 배아줄기세포와 같이 모든 세포를 생성할 수 있는 능력이 있는 만능성(pluripotency)과, 자기와 닮은 세포들을 무한정 만들어 낼 수 있는 자기재생(self-renewal) 능력을 총칭하는 의미로 당업계에서 통용된다. 즉, 줄기세포능은 줄기세포의 특성을 유지하는 능력을 의미한다. 따라서 줄기세포능이 향상되었다는 것은 텔로머라아제 활성을 증가시키거나, 줄기세포성 인자(stemness acting signals)의 발현을 증가시키거나, 미분화 세포를 미분화 상태를 유지하면서 증식시키거나, 세포 이동 활성을 증가시키는 특징이 나타나는 것을 포함할 수 있다(Pittenger, M. F. et al. 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284(5411), 143-147). 반면에 상기 특징이 정반대라면 줄기세포능이 저하된 것일 수 있다. 따라서 본 발명에서 줄기세포능을 제어한다는 것은 줄기세포능을 유지하거나 향상시킬 수도 있고 줄기세포능을 저하시켜 분화단계로 나아가게 할 수 있다는 것을 의미한다.As used herein, the term "stem cell function" refers to pluripotency, which is capable of producing all cells, such as embryonic stem cells, and self-renewal, which can indefinitely produce self- ) Ability is commonly used in the industry. In other words, stem cell function means the ability to maintain the characteristics of stem cells. Therefore, the improvement of stem cell ability means that it increases telomerase activity, increases expression of stemness acting signals, increases proliferation while maintaining undifferentiated cells, or increases cell migration activity (Pittenger, MF et al., 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284 (5411), 143-147). On the other hand, if the above characteristics are opposite, the stem cell capacity may be decreased. Therefore, in the present invention, controlling stem cell function means maintaining or enhancing stem cell function or lowering stem cell function to advance to differentiation stage.
이에 본 발명자들은 줄기세포들의 세포-기질간 및 세포-세포간 상호작용이 줄기세포의 분화 및 미분화 여부와 같은 줄기세포의 행동을 결정하는데 중요한 역할을 할 것이라는 가정하여, 이러한 상호작용에 영향을 미칠 수 있는 배양 조성물을 개발하던 중에 고분자 중합체의 조성변화에 의한 고분자 중합체의 표면 접합성 및 반발력 변화가 이와 상호작용하는 줄기세포의 행동 및 기능상의 변화를 야기함을 확인하였다. 구체적으로 세포 접착성 도메인을 가진 대표적인 고분자 PCL 및 상기 PCL의 접착성을 차단하는 PEG를 다양한 사슬 길이 및 몰분률로 중합한 고분자 중합체를 포함하는 배양 조성물에 줄기세포를 배양함으로써 줄기세포능의 변화를 확인하였고, 상기 고분자 중합체의 조성의 변화가 줄기세포의 줄기세포능을 변화시킴을 확인하였다. Therefore, the present inventors have assumed that the cell-substrate interactions and cell-cell interactions of stem cells will play an important role in determining the behavior of stem cells such as whether differentiation and undifferentiation of stem cells, It was confirmed that the change of the surface bonding property and the repulsive force of the polymer caused by the change of the composition of the high molecular weight polymer caused a change in the behavior and function of the stem cells. Specifically, a stem cell is cultured in a culture composition comprising a polymeric polymer having a typical polymeric PCL having a cell adhesive domain and a polymer polymer having various chain lengths and molar fractions polymerized with PEG blocking the adhesion of the PCL, And it was confirmed that the composition of the polymer changed the stem cell function of stem cells.
이에 따라, 본 발명은 줄기세포의 줄기세포능을 제어하는 고분자 공중합체를 포함하는 줄기세포 배양 조성물을 제공한다. Accordingly, the present invention provides a stem cell culture composition comprising a polymer copolymer controlling stem cell function of stem cells.
상기 고분자 공중합체는 소수성이며 세포 접착성 도메인을 가진 고분자 화합물 및 친수성이며 상기 세포 반발력을 갖는 고분자 화합물의 중합으로 이루질 수 있으며, 바람직하게는 상기 고분자 화합물은 생체 적합성 고분자일 수 있다. The polymeric copolymer may be a polymeric compound having a hydrophobic and cell adhesive domain and a hydrophilic polymeric compound having the cell repelling capability, and the polymeric compound may be a biocompatible polymer.
본 발명의 구체적인 일 실시예에서, 상기 공중합체는 세포 접착성 도메인을 가진 생체 적합성 고분자 화합물인 PCL(poly(ε-caprolactone)) 및 PEG(poly(ethylene glycol))의 중합으로 이루어질 수 있다. 보다 구체적으로는, 하기 화학식 1과 같은 구조로 이루어질 수 있다:In one specific embodiment of the present invention, the copolymer may be a polymer of poly (ε-caprolactone) and PEG (poly (ethylene glycol)), which are biocompatible macromolecular compounds having cell adhesive domains. More specifically, it may have a structure represented by the following Formula 1:
[화학식 1][Chemical Formula 1]
상기 화학식에서, X 및 y는 각각 PEG 및 PCL의 몰분률(mol %)을 의미할 수 있다.In the above formula, X and y may mean molar fractions (mol%) of PEG and PCL, respectively.
구체적으로는, 상기 공중합체를 이루는 PEG 및 PCL의 몰분률(mol %)의 변화는 줄기세포의 상기 공중합체에 대한 부착성에 변화를 주고, 이는 줄기세포간의 상호작용에도 영향을 미쳐, 줄기세포능을 변화시킬 수 있음을 본 발명의 실시예에서 확인하였다. 구체적인 실시예에서, 줄기세포의 줄기세포능은 줄기세포로 존재할 때 발현되는 전사인자의 발현량의 변화를 측정하고, REDOX 조절 인자 및 활성산소종(ROS)의 변화를 측정하여 확인하였다. 따라서, 줄기세포능이 향상되었다는 것은 줄기세포로 존재할 때 발현되는 전사인자의 발현량이 증가하고, 세포 내 산화-환원 반응(REDOX) 조절 인자가 활성화되어 세포의 산화적 스트레스를 유발하는 활성산소종(ROS)의 생산이 적음을 의미할 수 있다.Specifically, the change in molar fraction (mol%) of PEG and PCL constituting the copolymer causes a change in the adhesion of the stem cell to the copolymer, which also influences the interaction between the stem cells, In the examples of the present invention. In a specific example, the stem cell ability of stem cells was measured by measuring changes in the expression level of transcription factors expressed when stem cells were present, and measuring changes in REDOX regulatory factor and ROS. Thus, when stem cells are present as stem cells, the expression level of the transcription factor is increased, and the activation factor (REDOX) is activated to activate oxidative stress (ROS ) May be less.
본 발명의 구체적인 일 실시예에서, 공중합체의 PEG의 몰분률이 증가함에 따라, 줄기세포의 줄기세포능이 향상되지만, 공중합체 중 PEG의 몰분률이 25 mol % 이상인 경우에는, 배양 기질에 세포가 부착할 수 없으므로, NANOG 및 SOX2와 같은 줄기세포에서 발현되는 전사인자의 양이 감소됨을 확인하였다. 바람직하게는, 5 내지 25 mol % 미만의 PEG 및 95 내지 75 mol % 초과의 PCL로 이루어진 공중합체를 포함하는 배양 조성물에서 줄기세포의 줄기세포능이 향상될 수 있다. In a specific embodiment of the present invention, stem cell performance of stem cells is improved as the molar fraction of PEG in the copolymer is increased. However, when the molar fraction of PEG in the copolymer is 25 mol% or more, It is confirmed that the amount of transcription factors expressed in stem cells such as NANOG and SOX2 is reduced. Preferably, the stem cell capability of the stem cells can be improved in a culture composition comprising a copolymer consisting of less than 5 to 25 mol% of PEG and more than 95 to 75 mol% of PCL.
본 발명의 구체적인 다른 실시예에서, 상기 PEG의 사슬 길이가 길어짐에 따라 줄기세포능이 향상됨을 확인하였으며, 구체적으로, 500Da 내지 5000Da의 사슬길이를 가질 때, 줄기세포의 줄기세포능이 향상될 수 있다.In another embodiment of the present invention, it has been confirmed that the stem cell capacity is improved as the chain length of the PEG is increased. Specifically, when the chain length is 500 Da to 5000 Da, the stem cell ability of the stem cell can be improved.
보다 구체적인 실시예에서, 상기 공중합체는 750 내지 2000Da의 사슬길이를 가지는 5 내지 10 mol %의 PEG 및 95 내지 90 mol %의 PCL로 이루어질 때, 줄기세포능이 보다 향상될 수 있다.In a more specific embodiment, the copolymer may be further enhanced in stem cell performance when composed of 5 to 10 mol% of PEG having a chain length of 750 to 2000 Da and 95 to 90 mol% of PCL.
상술한 고분자 중합체를 포함하는 배양용 조성물에 배양되어 줄기세포능이 향상되는 줄기세포는 중간엽 줄기세포일 수 있고, 구체적으로는 골수 유래 중간엽 줄기세포일 수 있다.The stem cells, which are cultured in the composition for a culture comprising the above-mentioned polymer, and whose stem cell performance is improved, may be mesenchymal stem cells, and more specifically, bone marrow-derived mesenchymal stem cells.
또한, 본 발명은 PEG(poly(ethylene glycol)) 및 PCL(poly(ε-caprolactone))의 몰분률을 조절하여 공중합체를 제조하는 단계; 및The present invention also provides a method for preparing a copolymer, comprising: preparing a copolymer by controlling a molar fraction of PEG (poly (ethylene glycol)) and PCL (poly-ε-caprolactone); And
상기 제조된 공중합체를 포함하는 줄기세포 배양 조성물에 줄기세포를 배양하는 단계를 포함하는, 줄기세포의 줄기세포능을 제어하는 방법을 제공한다.And culturing the stem cells in a stem cell culture composition containing the copolymer as described above, to thereby control the stem cell function of the stem cells.
상기 제조된 공중합체 및 줄기세포의 구성 및 특징은 전술한 줄기세포 배양 조성물과 동일하므로, 중복기재를 방지하기 위해 그 설명을 생략한다.Since the constitution and characteristics of the prepared copolymer and stem cell are the same as those of the above-described stem cell culture composition, the description thereof is omitted in order to avoid redundant description.
본 발명은 줄기세포의 행동의 변화가 세포와 접촉하는 합성물질(고분자 중합체)의 내재적 특징 변화에 의해 제어될 수 있음을 확인한 것이다. 이에 따라, 합성물질을 이용한 줄기세포 배양 플랫폼 및 세포 치료제 개발에 이용될 수 있다.The present invention confirms that the change in the behavior of the stem cells can be controlled by a change in the intrinsic characteristics of the synthetic material (polymer polymer) in contact with the cells. Accordingly, it can be used for the development of a stem cell culture platform and a cell therapy agent using a synthetic material.
도 1은 (A) 소수성이고 세포 부착성을 나타내는 PCL, 친수성이고 세포 반발력을 나타내는 PEG, 및 친수성이고 세포 부착성을 나타내는 cPCL을 포함하는 공중합체 구조를 나타내는 개략도이다. 각 서브유닛의 몰분률의 변화에 따른 (B) 단백질 흡착 및 (C) 스핀 코팅된 표면상의 접촉각의 변화를 나타낸 것이다. (D) 다양한 기질에서의 세포 성장을 나타낸 것으로, 세포 부착 및 퍼짐의 변화를 확인할 수 있다. 상기 다양한 기질상에서 hMSCs를 배양시 줄기세포능을 나타내는 (E) NANOG 및 (F) SOX2 유전자의 발현량을 측정한 것이다. 세포 배양 기질에 따른 (G) ROS 의 변화를 나타낸 것이다. 세포 배양 기질에 따른 hMSCs의 미분화를 나타내는 표지인 STRO-1의 발현량을 측정한 것이다.
도 2는 (A) 줄기세포능의 조절에 표면 반발력(surface repellency)이 요구된다는 것을 증명하기 위해 배양 전 10 % PEG-90 % PCL을 다양한 농도의 피브로넥틴(fibronectin, FN)으로 미리 코팅한 공중합체의 배양 결과를 나타낸 것이다(녹색, 팔로이딘(phalloidi)n; 파란색, Hoechst; 스케일 바 = 100 μm). 표면 발수성에 의해 조절된 (B) NANOG 및 (C) SOX2의 발현을 나타낸 것이다. 모든 막대는 TCPS에 비해 평균 ± SD * p <0.05, ** p <0.01이다.
도 3은 공중합체 내 PEG 사슬 길이 및 몰분률의 변화에 따른 세포 부착성의 변화를 (A) 그래프, (B) 형광 사진으로 나타낸 것이며, 줄기세포능의 변화를 (B) NANOG 및 (C) SOX2의 발현량을 측정하여 확인한 것이다. (E) 내지 (H)는 상기 기질 변화에 따른 항산화 관련 유전자들의 발현량을 측정한 것이며, (I)는 상기 기질 변화에 따른 ROS의 량을 측정한 것이다.
도 4는 X-ray scattering (XRS) 를 사용하여 PEG 사슬 길이 의존하는 나노 및 옹그스트롱 스케일 특징을 나타낸 것이다((A) 작은 각 및 (B) 넓은 각). (C) PEG 사슬 길이 및 환경에 따른(건조 및 젖은 상태) PCL의 결정화률을 나타낸 것이다. (D) PEG 사슬 길이에 다른 PCL-PEG 공중합체의 라멜라 공간을 측정한 것이다. (E) PEG 사슬 길이에 따른 PCL과 상호관계를 나타내는 개략도이다.
도 5는 (A) PEG 사슬 길이 및 몰분률에 따른 hMSCs의 초점 접착 형성(Focal adhesion formation)을 structured illumination microscopy (SIM)을 이용하여 촬영한 것이다. (B) 상기 형성된 초점 접착의 너비를 도시한 그래프이다.
도 6은 (A-C) 5 % PEG2k를 포함하는 기질에 배양된 세 환자로부터 분리된 hMSCs에서 발현되는 NANOG 및 SOX2 발현량을 측정한 것이다. (D-F) PEG2k를 포함하는 기질에 배양된 세 환자로부터 분리된 hMSCs에서 발현되는 항산화 관련 유전자들의 발현량을 측정한 것이다. (G) 5 % PEG2k를 포함하는 기질에 배양된 세 환자로부터 분리된 hMSCs에서 발현되는 세포 내 ROS을 측정한 결과이다.
도 7은 (A-B) 세포-기질 및 세포-세포간의 접착에 관여하는 신호 전달 단백질들의 발현량을 기질에 따라 측정한 것이다. (C-D) 세포-기질 및 세포-세포간의 접착에 관여하는 단백질들의 억제제가 줄기세포능 및 Redox 조절에 관여하는 유전자들의 발현에 미치는 영향을 나타낸 것이다.BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic diagram showing (A) a copolymer structure comprising (A) PCL showing hydrophobicity and cell adhesion, PEG showing hydrophilic and cellular repulsive force, and cPCL showing hydrophilicity and cell adhesion. (B) protein adsorption and (C) change in contact angle on the spin-coated surface with changes in the mole fraction of each subunit. (D) Cell growth on various substrates, indicating changes in cell attachment and spread. (E) NANOG and (F) SOX2 genes expressing stem cell function upon culturing hMSCs on the various substrates. (G) ROS according to the cell culture substrate. The expression level of STRO-1, a marker for undifferentiation of hMSCs according to cell culture substrate, was measured.
FIG. 2 shows the results of (A) demonstrating that surface repellency is required for the regulation of stem cell function. In order to prove that surface repellency is required for the regulation of stem cell function, 10% PEG-90% PCL was pre-incubated with various concentrations of fibronectin (FN) (Green, phalloidi n; blue, Hoechst; scale bar = 100 μm). (B) NANOG and (C) SOX2 regulated by surface water repellency. All bars were mean ± SD * p <0.05, ** p <0.01 compared to TCPS.
(B) NANOG and (C) SOX2 (B). FIG. 3 is a graph showing the change in cell adhesion according to the change of the PEG chain length and mole fraction in the copolymer, Was measured and confirmed. (E) to (H) show the expression levels of antioxidation-related genes according to the substrate changes, and (I) the amounts of ROS according to the substrate changes.
Figure 4 shows nano- and angstrom-scale features dependent on PEG chain length using X-ray scattering (XRS) ((A) small angle and (B) wide angle). (C) the crystallization rate of PCL according to PEG chain length and environment (dry and wet state). (D) the lamellar spacing of PCL-PEG copolymers differing in PEG chain length. (E) PEG chain length. Fig.
FIG. 5 is (A) photographs of focal adhesion formation of hMSCs according to PEG chain length and molar fraction using structured illumination microscopy (SIM). (B) a graph showing the width of the formed focus adhesion.
Figure 6 is a graph showing the expression of NANOG and SOX2 expressed in hMSCs isolated from three patients cultured on a substrate containing (AC) 5% PEG 2k . (DF) PEG 2k in the hMSCs isolated from the three patients cultured on the substrate containing the antioxidant-related genes. (G) is the result of measuring intracellular ROS expressed in hMSCs isolated from three patients cultured on a substrate containing 5% PEG 2k .
FIG. 7 shows the expression level of signal transduction proteins involved in cell-substrate and cell-cell adhesion between (AB) according to the substrate. (CD) cell-substrate and cell-cell adhesion to the expression of genes involved in stem cell function and Redox regulation.
실험 재료 및 방법Materials and Methods
고분자 기질 제조Manufacture of polymer matrix
모든 고분자 및 고분자들의 공중합체는 Acta Biomater. 2012; 8(2):559-569에 기술된 바와 같이 합성하였다. 달리 명시하지 않는 한, 모든 인비트로 실험은 시판되는 스핀 코터(Laurell Technologies, North Wales, PA)로 제조된 스핀-코팅된 고분자 필름상에서 수행하였다. 15 ㎜ 원형 유리 커버 슬립 (Fisher Scientific, Waltham, MA) 또는 10 cm Pyrex 배양 접시 (Corning, Inc., Corning, NY)를 먼저 100 % 에탄올 (Sigma-Aldrich, St. Louis, MO)로 씻고, dH2O로 희석시키고, 약 20 분 동안 80 ℃로 가열하여 건조시켰다. 테트라하이드로푸란 (THF, Sigma-Aldrich)에 혼합된 특정 고분자의 1 % 중량/부피 (w/v) 용액을 유리 커버 슬립 (50 μL 용액/샘플)에서 3000 rpm으로 30초 또는 또는 페트리 접시 (1 ML 용액/샘플)에서 1500 rpm로 2 분 동안 회전시켰다. 그런 다음 모든 샘플을 30 분 이상 동안 일정한 콜드 트랩 진공(cold-trap vacuum)에 노출시켜 과량의 용매를 제거하고 사용하기 전까지는 건조기에 보관하였다. 세포 실험을 위해, 기질은 사용하기 전에 각면에 대해 30-60 분 동안 자외선 멸균 처리하였다. 15 mm 커버 글래스에 대해, 샘플을 24-웰 플레이트에 놓고 오토 클레이브 실리콘 O-링 (McMaster Carr, Atlanta, GA)으로 고정시켰다.Copolymers of all polymers and polymers are available from Acta Biomater. 2012; 8 (2): 559-569. Unless otherwise stated, all Invitro's experiments were performed on spin-coated polymer films made with a commercially available spin coater (Laurell Technologies, North Wales, Pa.). (Sigma-Aldrich, St. Louis, Mo.) was washed with a 15 mm round glass cover slip (Fisher Scientific, Waltham, MA) or a 10 cm Pyrex dish 2 O and dried by heating to 80 DEG C for about 20 minutes. A 1% weight / volume (w / v) solution of the specific polymer mixed in tetrahydrofuran (THF, Sigma-Aldrich) was added to the glass cover slip (50 μL solution / sample) for 30 seconds at 3000 rpm, Ml solution / sample) at 1500 rpm for 2 minutes. All samples were then exposed to a constant cold-trap vacuum for more than 30 minutes to remove excess solvent and stored in the dryer until use. For cell experiments, substrates were UV sterilized for 30-60 minutes on each side before use. For the 15 mm cover glass, samples were placed in 24-well plates and fixed with an autoclave silicone O-ring (McMaster Carr, Atlanta, Ga.).
단백질 사전 코팅 실험을 위해, 원하는 양의 인간 피브로넥틴(fibronectin) (Fisher Scientific)을 무혈청 αMEM으로 희석하고 37 ℃에서 30 분 이상 물질 표면에 흡착시켰다. 샘플을 PBS로 두 번 헹구고 배양 실험에 사용했다. For protein pre-coating experiments, the desired amount of human fibronectin (Fisher Scientific) was diluted with serum-free aMEM and adsorbed to the surface of the material for at least 30 minutes at 37 ° C. Samples were rinsed twice with PBS and used for culture experiments.
고분자 표면의 물리화학적 특성Physicochemical Properties of Polymer Surface
단백질 흡착은 QCM-D (quartz crystal microbalance with dissipation)에 의해 측정되었다. 고분자는 스핀 코터를 사용하여 3000rpm에서 10 mg/mL 용액의 ~50μL를 사용하여 30 초 동안 금 코팅된 수정 결정 (5MHz, QSX 301, QSense AB, Goetenberg, Sweden)에 스핀 코팅하였다 (Headway Research Inc., TX). 표준 프로토콜에 따라 10 % FBS가 포함된 37.5 °C에서 Q-Sense E4 장비 (Q-Sense AB, Goetenberg, Sweden)를 사용하여 QCM-D 측정을 수행하였다. 데이터는 Q-Sense, Inc.에서 제공한 Q 도구 소프트웨어에서 Voigt 모델을 사용하여 분석하였다. 접촉각은 10 μL의 탈이온수를 사용하여 각도계 (Ramι-Hart, Succassunna, NJ)로 수행하였다. 3 개의 독립적인 샘플 각각에 대해 3 회의 측정을 수행하였다 (n = 9).Protein adsorption was measured by QCM-D (quartz crystal microbalance with dissipation). The polymer was spin-coated on a gold-coated crystal (5 MHz, QSX 301, QSense AB, Goetenberg, Sweden) for 30 seconds using ~ 50 μL of a 10 mg / mL solution at 3000 rpm using a spin coater. , TX). QCM-D measurements were performed using a Q-Sense E4 instrument (Q-Sense AB, Goetenberg, Sweden) at 37.5 ° C with 10% FBS according to standard protocols. Data was analyzed using the Voigt model in Q-tool software provided by Q-Sense, Inc. The contact angle was measured with a goniometer (Rami-Hart, Succassunna, NJ) using 10 μL of deionized water. Three measurements were performed for each of the three independent samples (n = 9).
때로는 표면 계수 또는 탄성 계수라고도 하는 표면 근처의 탄성 표면 계수(Elastic surface modulus)는 사각 단면 (MLCT 팁 B; Bruker AFM Probes)을 갖는 캔틸레버(cantilever)를 사용하는 Veeco NanoScope V (Bruker Corporation, Billerica, MA)를 사용하여 측정하였다. 유리 커버 슬립을 대조 샘플로 사용하였고, 모든 스핀-코팅된 커버 슬립은 동일한 프로토콜을 사용하여 시험하였다. 샘플을 시험하기 전에 37 ℃ 공기 중에서 밤새 PBS에서 배양하였다. 5 μm Х 5 μm 영역의 지형 스캔은 30 μm/s 스캔 속도의 512 라인에 대해 512 샘플/라인을 샘플링하는 접촉 모드에서 수행하였다. 5 μm의 z-제한은 팁 손상을 방지하기 위해 사용되었다. 샘플의 면적 평균 탄성 계수의 계산을 위해 힘의 볼륨 스캔(force volume scan)을 수행하였다. 지형 스캔과 동일한 영역에 걸친 16 Х 16 그리드는 1.54 μm/s에서 750 nm의 최대 모터 움직임으로 자국내졌다. 캔틸레버 빔의 휨-전압 곡선 d(V)의 보정은 커버슬립의 강성을 가정하여 유리 커버슬립 내로 일련의 자국을 사용하여 계산하였다. 상기 보정은 다음의 형태를 가진다:Elastic surface modulus near the surface, sometimes referred to as surface coefficient or modulus, is measured using a Veeco NanoScope V (Bruker Corporation, Billerica, MA) using a cantilever with a rectangular cross section (MLCT Tip B; Bruker AFM Probes) ). Glass cover slips were used as control samples and all spin-coated cover slips were tested using the same protocol. Samples were incubated in PBS overnight at 37 C in air prior to testing. Terrain scans in the 5 μm × 5 μm area were performed in a contact mode that sampled 512 samples / line for 512 lines at a scan rate of 30 μm / s. A 5-μm z-limit was used to prevent tip damage. A force volume scan of the force was performed to calculate the area average elastic modulus of the sample. The 16 × 16 grid across the same area as the terrain scan was dominated by a maximum motor movement of 1.54 μm / s to 750 nm. The correction of the flexural-voltage curve d (V) of the cantilever beam was calculated using a series of marks within the glass cover slip assuming the stiffness of the cover slip. The correction has the following form:
상기 V는 단위 전압을 갖는다(n = 3; R2 = 0.997). Sader 방법은 힘이 F = kd와 같이 계산될 수 있도록 캔틸레버 강성 k(대략 0.02N/m)를 계산하는데 사용된다. 상기 자국의 깊이 u는 다음과 같이 계산된다:V has a unit voltage (n = 3; R2 = 0.997). The Sader method is used to calculate the cantilever stiffness k (approximately 0.02 N / m) so that the force can be calculated as F = kd. The depth u of the station is calculated as follows:
상기 P는 스테이지의 절대 위치이고, PC는 팁과 샘플 사이의 접촉점에서의 절대 위치이고, dc는 접촉 지점에서의 캔틸레버의 편형이다. 이것은 힘-부피 이미지에서 각 샘플 포인트에 대해 힘-변위 F(u) 다이어그램을 생성하도록 한다. 이러한 데이터는 그 다음 실제 탐침 형상(true probe geometry)에 대해 수정된 원추형 인덴터 이론(conical indenter theory)을 사용하여 분석하였다. 이 결과는 Levenberg-Marquadt 피팅 알고리즘의 파라미터로 처리하여 최소 제곱법 센스(least-squares sense)로 탄성 계수 E를 계산하는데 사용하였다. F(u) 데이터의 예상 형태는 다음과 같다:P is the absolute position of the stage, P C is the absolute position at the point of contact between the tip and sample, and d c is the flatness of the cantilever at the point of contact. This allows a force-displacement F (u) diagram to be generated for each sample point in a force-volume image. This data was then analyzed using a modified conical indenter theory for the true probe geometry. This result was used as a parameter of the Levenberg-Marquadt fitting algorithm to calculate the elastic modulus E with a least-squares sense. The expected form of the F (u) data is as follows:
여기서 α는 자국 프로브(indentation probe)의 반각 (공칭 평균 71.25°)이고 β = 1.023은 비 압축성 (즉, 포아송 비 υ = 0.5) 및 자국 프로브의 강성을 가정한 사각베이스를 갖는 프로브의 비대칭 보정 계수이다. 지역 평균 탄성 계수는 지형 스캔 중에 특징 지어지는 5μm Х 5μm 영역 내에서 동일한 간격의 256개 위치 각각에 대해 결정된 계수를 평균화하여 구했다. 분석은 NanoScope Analysis v1.50 (Bruker)을 사용하여 수행되었다. 무작위로 선택된 10 개의 위치를 이 소프트웨어 패키지의 자국 분석 도구를 사용하여 분석하였다. 전체 힘 크기에 대한 10~70 %의 데이터가 분석에 포함되었다.Where α is the half angle of the indentation probe (nominal mean 71.25 °) and β = 1.023 is the asymmetric correction factor of the probe with a non-compressible (ie Poisson's ratio υ = 0.5) and square base assuming the stiffness of the probe to be. The regional mean elastic modulus was determined by averaging the coefficients determined for each of the 256 locations of the same spacing within the 5 μm × 5 μm region characterized during the terrain scan. Analysis was performed using NanoScope Analysis v1.50 (Bruker). Ten randomly chosen locations were analyzed using the local analysis tool of this software package. 10-70% of the total force magnitude data was included in the analysis.
1H NMR은 CDCl3 중 1 % w/v 용액을 사용하여 400 MHz AV-400 콘솔 (Bruker Instruments, Inc.)상에서 수행하였다. 각각의 공중합체에 대한 몰 % 조성은 PEG (δ = 3.65ppm)의 CH2CH2 양성자 및 δ = 4.05ppm에서의 PCL 피크의 ε-탄소를 나타내는 OCH2 양성자의 통합을 비교함으로써 결정되었다. 1 H NMR was performed on a 400 MHz AV-400 console (Bruker Instruments, Inc.) using 1% w / v solution in CDCl 3 . The mole percent composition for each copolymer was determined by comparing the incorporation of CH 2 CH 2 protons of PEG (δ = 3.65 ppm) and OCH 2 protons representing ε-carbon of PCL peak at δ = 4.05 ppm.
분자량은 겔 투과 크로마토그래피로 측정하였다. 10 % w/v의 THF에 공중합체를 용해시킨 후, 중합체 용액을 이진 HPLC 펌프, 굴절률 검출기, 듀얼 λ 흡광도 검출기 및 시리즈로 연결된 4 개의 5 mm Waters 컬럼(300 mm Х 7.7 mm)이 장착된 Waters 크로마토그래피 시스템을 통해 1 mL/분 속도로 주사하였다(Waters Corporation, Milford, MA).The molecular weight was determined by gel permeation chromatography. After dissolving the copolymer in 10% w / v THF, the polymer solution was transferred to a Waters (R) solution equipped with a binary HPLC pump, a refractive index detector, a dual λ absorbance detector and four 5 mm Waters columns connected in series (300 mm x 7.7 mm) (Waters Corporation, Milford, Mass.) At a rate of 1 mL / min through a chromatography system.
PEG 부피 %는 3 개의 방정식을 사용하여 계산되었다. 먼저, 각 공중합체에 대한 PCL 분자량은 다음과 같이 계산되었다:The% PEG volume was calculated using three equations. First, the PCL molecular weight for each copolymer was calculated as follows:
PEG 분자량은 겔 PEG 분자량은 겔 투과 크로마토그래피에 의해 보고된 제조자의 데이터 시트 및 공중합체 분자량으로부터 취하였다. 각 공중합체 중의 PEG 또는 PCL의 중량 %는 다음과 같이 계산하였다:PEG Molecular Weight Gel PEG Molecular Weight was taken from the manufacturer's data sheet and copolymer molecular weight reported by gel permeation chromatography. The weight percent of PEG or PCL in each copolymer was calculated as follows:
마지막으로, 각각의 공중합체의 PEG 부피 %는 다음과 같이 계산하였다:Finally, the PEG volume percent of each copolymer was calculated as follows:
상기 1.234 및 1.146은 각각 PEG 및 PCL의 밀도 (g/cm3)이다.1.234 and 1.146 are the density (g / cm < 3 >) of PEG and PCL, respectively.
X 선 산란 실험(X-ray scattering experiments)에서 Pyrex 페트리 접시는 THF 중 40 % w/v 공중합체 용액으로 스핀 코팅하였다. 각 페트리 접시를 두 번 돌려서 접시 표면으로부터 손으로 떼어낼 수 있고 운반을 위해 쉽게 처리할 수 있는 필름을 생성하였고 2mm 석영 모세관에 삽입하기 위한 크기로 절단하였다. X-선 산란을 고분자를 PBS에 적어도 6 시간 동안 노출시킴으로써 (건조 조건) 전 및 습윤 후에 수행하였다. 작은- 및 중간각 X-선 산란을 뉴욕 Ithaca 소재 Cornel High Energy Synchrotron Source (CHESS) 시설에서 수행하였다. 파장은 1.055 이고, 시료 대 검출기 거리는 각각 작은- 및 중간각 산란에 대해 1479 및 416 ㎜이다. 방사선 손상은 각각 4 초 동안 10 회의 노출을 수집하여 모니터링 되었으며 방사선 손상은 관찰되지 않았다. BioXTAS RAW 0.99.14b 소프트웨어 (sourceforge.net의 오픈 소스)를 사용하여 작은 및 중간각 X-선 산란 데이터를 분석하였다. 넓은 각 X-선 산란 데이터를 회전 양극으로부터의 Cu Kα 방사선 및 88mm의 샘플 대 검출기 거리를 사용하여 브루커(Bruker) 영역 검출기에서 수집하였다. 이 데이터를 JADE 소프트웨어 (Materials Data Inc., Livermore, CA)를 사용하여 분석하였다.In X-ray scattering experiments, a Pyrex Petri dish was spin-coated with 40% w / v copolymer solution in THF. Each Petri dish was rotated twice to produce a film that could be peeled off the dish surface by hand and easily handled for transport, and cut to size for insertion into a 2 mm quartz capillary. X-ray scattering was performed before and after wetting by exposing the polymer to PBS for at least 6 hours (drying conditions). Small- and medium-angle X-ray scattering was performed at the Cornel High Energy Synchrotron Source (CHESS) facility in Ithaca, New York. The wavelength is 1.055 And the sample to detector distance is 1479 and 416 mm for small- and medium-angle scattering, respectively. Radiation damage was monitored by collecting 10 exposures for 4 seconds each and no radiation damage was observed. Small and medium angle X-ray scattering data were analyzed using BioXTAS RAW 0.99.14b software (open source from sourceforge.net). Wide angle X-ray scattering data were collected in a Bruker area detector using Cu Kα radiation from a rotating anode and a sample-to-detector distance of 88 mm. This data was analyzed using JADE software (Materials Data Inc., Livermore, Calif.).
세포 배양Cell culture
hMSC는 Lonza (Walkersville, MD)에서 구입하였고 Vanderbilt University Medical Center에서 65 세 이상의 환자로부터 Pampee P. Young 박사와 함께 이전에 발표된 방법 (표면 마커 표현형 데이터의 경우 그림 S9)에 따라 구입하였다. hMSCs는 16.7 %의 태아 소 혈청 (Life Technologies)을 갖는 뉴클레오사이드 (αMEM, Life Technologies, Carlsbad, CA), 1 % 페니실린/스트렙토마이신 (Life Technologies) 및 4 μg/mL plasmocin (InvivoGen, San Diego, CA)을 갖는 α 최소 필수 배지로 구성된 완전 배지(CM)에서 보관하였다. 세포를 37 ℃ 및 5 % CO2에서 가습된 배양기에 보관하고 배지를 매주 2 회 교체하였다. ~ 80 % 융합(confluent) 때, hMSCs를 0.05 % 트립신-EDTA로 분리하고, 100-500 세포/cm2의 밀도로 다시 접종하고 융합에 도달하기 전에 7-14 일 동안 배양하였다. 모든 실험에서, hMSCs (6회 미만)는 Trypan blue 배제에 의해 결정된 바와 같이 10000 생존 세포/cm2의 밀도로 접종하고 마지막 실험 전에 3-4 일 동안 배양하였다.The hMSC was purchased from Lonza (Walkersville, MD) and purchased from Vanderbilt University Medical Center with patients aged 65 years or older with Pampee P. Young according to the previously published method (Figure S9 for surface marker phenotype data). The hMSCs were incubated with the nucleosides (αMEM, Life Technologies, Carlsbad, CA), 1% penicillin / streptomycin (Life Technologies) and 4 μg / ml plasmocin (InvivoGen, San Diego, CA) with 16.7% fetal bovine serum CA) in the complete medium (CM) consisting of the minimal essential medium. Store the cell in humidified incubator at 37 ℃ and 5% CO 2 and were replaced twice a week the medium. When ~ 80% confluent, hMSCs were separated by 0.05% trypsin-EDTA, re-inoculated at a density of 100-500 cells / cm 2 and cultured for 7-14 days before reaching fusion. In all experiments, hMSCs (less than 6) were inoculated at a density of 10000 viable cells / cm 2 as determined by trypan blue exclusion and cultured for 3-4 days prior to the last experiment.
억제제 연구Inhibitor study
최적의 농도를 결정하기 위해 hMSCs를 다양한 농도의 억제제에 48 시간 동안 노출시켰다. 다음의 억제제 및 농도가 사용되었다: 30 μM BTT 3033 (인테그린 α2β1 억제제, Tocris, Avonmouth, Bristol, 영국), 30 μM P11 (인테그린 αvβ3/αvβ5 억제제, Tocris) 및 1 mg/mL GAP26 (Connexin-기반 억제제). 표준 고체상 플루오레닐메틸옥시카보닐 클로라이드 화학에 의해 Rink amide-MBHA 수지상에서 PS3 합성기(Protein Technologies, AZ, Tucson)를 사용하여 GAP26 (Val-Cys-Tyr-Asp-Lys-Ser-Phe-Pro-Ile-Ser-His-Val-Arg)을 합성하였다. 이들 펩타이드를 절단하고 트리플루오로 아세트산/티오아니솔/에탄디티올/아니솔 (90/5/3/2) 중에서 탈보호시켰다. 펩타이드의 형성은 액체 크로마토 그래피-질량 분석기 (LC-MS)에 의해 특징화되었다.HMSCs were exposed to various concentrations of inhibitor for 48 h to determine optimal concentrations. The following inhibitors and concentrations were used: 30 μM BTT 3033 (integrin α2β1 inhibitor, Tocris, Avonmouth, Bristol, UK), 30 μM P11 (integrin αvβ3 / αvβ5 inhibitor, Tocris) and 1 mg / mL GAP26 (Connexin- ). (Val-Cys-Tyr-Asp-Lys-Ser-Phe-Pro-Lys-Ser-Phe-Pro-Phe) on a Rink amide-MBHA resin by standard solid fluorenylmethyloxycarbonyl chloride chemistry using a PS3 synthesizer (Protein Technologies, AZ, Tucson) Ile-Ser-His-Val-Arg). These peptides were cleaved and deprotected in trifluoroacetic acid / thioanisole / ethanedithiol / anisole (90/5/3/2). The formation of the peptides was characterized by liquid chromatography-mass spectrometry (LC-MS).
억제 실험을 위해, 지시된 농도의 억제제를 hMSC 현탁액에 첨가하여 세포를 기질 위에 접종하였다. 유전자 발현 분석을 위해 RNA를 수확하기 전에 세포를 4 일간 배양하였다.For inhibition experiments, inhibitors of the indicated concentrations were added to the hMSC suspension and cells were inoculated onto the substrate. Cells were cultured for 4 days prior to harvesting RNA for gene expression analysis.
세포 내 활성 Intracellular activity 산소종Oxygen species (Reactive Oxygen Species, (Reactive Oxygen Species, ROSROS )의 레벨 측정) Level measurement
hMSCs는 제조업체의 지침에 따라 30 분 동안 무혈청 DMEM에서 10 μM 5-(및 -6)-클로로메틸-2 ', 7'-디클로로디히드로플루오레신 디아세테이트 아세틸 에스테르 (DCFDA) (Life Technologies)로 배양하였다. 세포를 트립신 처리하고 적절한 무 염색 대조구를 갖는 FACS Calibur 유동 세포 계측기 (BD Biosciences, Franklin Lakes, NJ)상에서 작동시켰다. N=3 생물학적 복제가 기질 조건마다 수행되었다. FlowJo 소프트웨어 (Tree Star Inc., Ashland, OR)를 사용하여 데이터를 분석하였다.hMSCs were incubated with 10 μM 5- (and -6) -chloromethyl-2 ', 7'-dichlorodehydrofluorene diacetate acetyl ester (DCFDA) (Life Technologies) in serum-free DMEM for 30 min according to the manufacturer's instructions Lt; / RTI > Cells were trypsinized and run on a FACS Calibur flow cytometer (BD Biosciences, Franklin Lakes, NJ) with appropriate non-staining control. N = 3 biological replication was performed for each substrate condition. Data was analyzed using FlowJo software (Tree Star Inc., Ashland, OR).
초 고해상도 Ultra-high resolution 이미징Imaging
hMSCs를 실온에서 15 분 동안 4 % 파라포름알데히드 (PFA, Sigma-Aldrich)로 고정시키고, 1X PBS로 3 회 세척한 후, 실온에서 5 분 동안 0.3 % Triton X-100 (Sigma-Aldrich)로 투과시켰다. 1 차 anti-paxillin (카탈로그 번호 610051, BD Transduction Laboratories, Franklin Lakes, NJ) 및 2 차 AlexaFluor 568 염소 항-마우스 (카탈로그 번호 A11004, Life Technologies) 항체를 10 % 소 혈청 알부민 (Sigma-Aldrich)에 1 : 200 및 1 : 100으로 각각 희석하고 사용 전에 13000 rpm에서 10 분간 원심분리하였다. 샘플을 실온에서 20 분 동안 10 % 소 혈청 알부민에서 차단하고, 실온에서 1 시간 및 45분 동안 1 차 항체 배양을 실시하고, 1X PBS로 3 회 세척한 다음, 실온에서 1 시간 동안 2차 항체 배양한 후 1X PBS로 3 회 세척하였다. 세포를 Vectashield (H-1000, Vector Laboratories, Inc. Burlingame, CA) 장착 배지에 장착하였다. 60 Х 1.42 NA 오일 대물 렌즈 및 sCMOS 카메라가 장착된 GE Healthcare DeltaVision OMX에서 SIM 이미징(Structured illumination microscopy imaging)을 수행하였다. 이미지는 복제당 n = 3 이미지로 N = 3 생물학적 복제로부터 수집되었다. 3D 획득의 최대 투사 (Z)를 갖는 SIM 이미지는 ImageJ (National Institutes of Health, Bethesda, MD)를 사용하여 분석되었다. 초점 접착 너비(Focal adhesion width)는 ImageJ 1D 선 도구 (너비 = 10)를 사용하여 세포의 리딩 엣지를 가로지르는 선을 그리면서 계산되었다. 플롯(plot) 내 초점 접착 영역을 식별하기 위해 선을 그린대로 픽셀 강도의 1D 플롯이 생성되었다. 반경 최대의 전폭(fwhm)을 각 초점 접착의 너비 측정과 같이 사용하였다. 3 개의 이미지에서 최소 40 개의 세포 평균치를 각 그룹별로 나타내었다.The hMSCs were fixed with 4% paraformaldehyde (PFA, Sigma-Aldrich) for 15 min at room temperature, washed three times with 1X PBS and then permeabilized with 0.3% Triton X-100 (Sigma-Aldrich) . (Cat. No. A11004, Life Technologies) antibodies were incubated in 10% bovine serum albumin (Sigma-Aldrich) with 1 < RTI ID = 0.0 > : 200 and 1: 100, respectively, and centrifuged at 13000 rpm for 10 minutes before use. Samples were blocked at 10% bovine serum albumin for 20 minutes at room temperature, incubated for 1 hour and 45 minutes at room temperature for primary antibody culture, washed three times with 1X PBS and incubated for 2 hours at room temperature And washed three times with 1X PBS. The cells were mounted on a mounting medium of Vectashield (H-1000, Vector Laboratories, Inc. Burlingame, Calif.). Structured illumination microscopy imaging was performed on a GE Healthcare DeltaVision OMX equipped with a 60 Х 1.42 NA oil objective and an sCMOS camera. Images were collected from N = 3 biological replicates with n = 3 images per replicate. SIM images with maximum projections (Z) of 3D acquisition were analyzed using ImageJ (National Institutes of Health, Bethesda, Md.). The focal adhesion width was calculated by plotting a line across the leading edge of the cell using an ImageJ 1D line tool (width = 10). A 1D plot of pixel intensity was generated as the line was drawn to identify the focal adhesion region in the plot. The maximum radial width (fwhm) was used as the width measurement of each focus adhesive. At least 40 cell averages in three images were shown for each group.
웨스턴Western 블랏Blat
웨스턴 블롯 분석은 기본 프로토콜에 따라 수행되었다. 이 연구에서 사용된 1 차 항체는 다음과 같다: Integrin-α2 (1 : 200, sc-6586r, Santa Cruz Biotechnology, Dallas, TX), Integrin-β3 (1 : 200, D7X3P, (1 : 200, D24A5, Cell Signaling Technologies), Connexin-43 (1 : 200, # 3512, Cell Signaling Technologies) Integrin-β5 (1:200, D24A5, Cell Signaling Technologies), Connexin-43 (1:200, #3512, Cell Signaling Technologies), and GAPDH (1:5000, 14C10, Cell Signaling Technologies). Li-COR (Lincoln, NB)의 적절한 2 차 항체를 사용하여 제조업체의 프로토콜에 따라 오딧세이 이미징 시스템상에 블롯을 이미지화하였다.Western blot analysis was performed according to the basic protocol. The primary antibodies used in this study were as follows: Integrin-α2 (1: 200, sc-6586r, Santa Cruz Biotechnology, Dallas, TX), Integrin-β3 (1: 200, D7X3P, , Cell Signaling Technologies), Connexin-43 (1: 200, # 3512, Cell Signaling Technologies) Integrin-β5 (1: 200, D24A5, Cell Signaling Technologies), Connexin- ), and GAPDH (1: 5000, 14C10, Cell Signaling Technologies). Blots were imaged on an Odyssey imaging system according to the manufacturer's protocol using a suitable secondary antibody from Li-COR (Lincoln, NB).
유동 세포 계측법(Flow Flow cytometry CytometryCytometry )에 의한 면역 세포학 및 면역 표현형 분석) And Immunophenotyping Analysis
hMSC를 15 분 동안 4 % 파라포름알데히드 (PFA, Sigma-Aldrich)로 고정시키고, 세포 내 표적을 탐침할 때 15 분 동안 0.3 % Triton-X (Sigma-Aldrich)로 투과시키고 10 % 염소 혈청 (Sigma-Aldrich)으로 2 시간 이상 동안 차단하였고, 모두 상온에서 수행되었다. 이어서 hMSCs를 1 % 소 혈청 알부민의 1 차 항체와 함께 4 ℃에서 밤새 인큐베이트한 후 실온에서 2 시간 동안 5 % 염소 혈청에서 1:500으로 적절한 2 차 항체와 인큐베이트 한 후 Hoechst (2 μg/mL, Sigma-Aldrich)로 대조 염색하였다. 액틴 세포 골격을 염색하기 위해, 세포를 10 분 동안 Alexa488-phallodin (1:40 v/v in PBS, Life Technologies)과 함께 인큐베이트한 다음, Hoechst (2 μg / mL, Sigma-Aldrich)로 실온에서 20 분간 대조 염색하였다. 이미징은 Nikon Ti inverted 현미경 (Nikon Instruments Inc., Melville, NY, USA) 또는 Zeiss LSM 710 공 초점 현미경 (Carl Zeiss, Oberkochen, Germany) 으로 수행하였고 이미지는 ImageJ (National Institutes of Health)로 처리하였다.The hMSCs were fixed with 4% paraformaldehyde (PFA, Sigma-Aldrich) for 15 min and permeabilized with 0.3% Triton-X (Sigma-Aldrich) for 15 min when probed intracellularly and incubated with 10% goat serum -Aldrich) for at least 2 hours, all at room temperature. The hMSCs were then incubated overnight at 4 ° C with 1% bovine serum albumin and incubated with appropriate secondary antibodies at 1: 500 in 5% goat serum for 2 h at room temperature. Hoechst (2 μg / mL, Sigma-Aldrich). To stain the actin cytoskeleton, cells were incubated with Alexa 488-phallodin (1:40 v / v in PBS, Life Technologies) for 10 minutes and then incubated with Hoechst (2 μg / mL, Sigma-Aldrich) And stained for 20 minutes. Imaging was performed with a Nikon Ti inverted microscope (Nikon Instruments Inc., Melville, NY, USA) or Zeiss LSM 710 confocal microscope (Carl Zeiss, Oberkochen, Germany) and images were processed with ImageJ (National Institutes of Health).
유동 세포 계측법의 경우 염색되지 않은 hMSC를 사용하여 형광 및 산란 채널의 전압을 설정하였다. 단일 염색 hMSC를 사용하여 보상값을 결정하여 한 채널 내의 형광 신호가 양성으로 염색된 세포에서 명확하게 나타났다. 이어서, 세포를 FACS Calibur 유동 세포 계측기 (BD Biosciences)상에서 측정하였다. 각 실험은 10000개의 게이트 셀을 나타내며, 데이터는 FlowJo 소프트웨어 (Tree Star Inc., Ashland, OR)에 의해 분석되었다.For flow cytometry, the fluorescence and scattering channel voltages were set using unstained hMSCs. The compensation value was determined using a single-stained hMSC and the fluorescence signal in one channel was clearly visible in cells stained positive. Cells were then measured on a FACS Calibur flow cytometer (BD Biosciences). Each experiment represents 10000 gate cells and the data was analyzed by FlowJo software (Tree Star Inc., Ashland, OR).
정량 실시간 Quantitative real time PCRPCR ( ( cPCRcPCR 및 And qRTqRT -- PCRPCR ))
스핀 코팅된 기질상의 hMSCs를 Trizol reagent (Life Technologies)로 균질화하고 클로로포름 (1 : 5 Trizol : 클로로포름)과 혼합하고 원심 분리 (12000g, 15 분, 4 ℃)하였다. 수용액상에 함유된 RNA를 RNeasy 컬럼 (Bio-Rad, Hercules, CA)으로 제조자의 지시에 따라 분리하였다. 키트(Applied Biosystems, Life Technologies)를 사용하여 cDNA를 합성하고, 15-20 ng cDNA 및 정방향 및 역방향 프라이머 각각 500 Nm를 가지고 SYBR Green 마스터 믹스 (Bio-Rad)로 CFX 실시간 PCR 시스템 (Bio-Rad)를 사용하여 qRT-PCR을 수행하였다. qRT-PCR 프로토콜은 95 ℃에서 3 분간, 이어서 95 ℃에서 30 초간 변성, 58 ℃에서 30 초간 어닐링, 72 ℃에서 30 초간 변성을 40 회 반복하였다. 해당 유전자의 발현을 하우스 키핑 유전자인 GAPDH (glyceraldehyde 3-phosphate dehydrogenase)의 발현으로 정규화하여 △C(t) 값을 산출하였다. 본 발명에서 PCR에 사용된 프라이머 서열은 하기 표 1에 나열되어 있으며, 단일의 특정 앰플리콘을 나타내는 것들만 qRT-PCR 실험에 사용되었다.The hMSCs on the spin-coated substrate were homogenized with Trizol reagent (Life Technologies), mixed with chloroform (1: 5 Trizol: chloroform) and centrifuged (12000 g, 15 min, 4 ° C). The RNA contained in the aqueous phase was separated on an RNeasy column (Bio-Rad, Hercules, Calif.) According to the manufacturer's instructions. CDNA was synthesized using a kit (Applied Biosystems, Life Technologies), and a CFX real-time PCR system (Bio-Rad) was performed with SYBR Green Master Mix (Bio-Rad) with 15-20 ng cDNA and 500 Nm each of forward and reverse primers, Was used to perform qRT-PCR. The qRT-PCR protocol was repeated for 40 minutes at 95 ° C for 3 minutes, followed by denaturation at 95 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, and denaturation at 72 ° C for 30 seconds. The expression of the gene was normalized by the expression of a housekeeping gene, GAPDH (glyceraldehyde 3-phosphate dehydrogenase), and the value of ΔC (t) was calculated. The primer sequences used in the PCR in the present invention are listed in Table 1 below, and only those that represent a single specific amplicon were used in the qRT-PCR experiment.
Gene
Gene
Accession Number
Accession Number
Forward Primer (5’ - 3’)
Forward Primer (5 '- 3')
Reverse Primer (3’ - 5’)
Reverse Primer (3'-5 ')
Amplicon (bp)
Amplicon (bp)
SOX2SOX2
NM_003106.3
NM_003106.3
ATCAGGAGTTGTCAAGGCAGAG
(서열번호 1)
ATCAGGAGTTGTCAAGGCAGAG
(SEQ ID NO: 1)
CGCCGCCGATGATTGTTATT
(서열번호 2)
CGCCGCCGATGATTGTTATT
(SEQ ID NO: 2)
172
172
NanogNanog
NM_024865.2
NM_024865.2
AATACCTCAGCCTCCAGCAGATG
(서열번호 3)
AATACCTCAGCCTCCAGCAGATG
(SEQ ID NO: 3)
TGCGTCACACCATTGCTATTCTTC
(서열번호 4)
TGCGTCACACCATTGCTATTCTTC
(SEQ ID NO: 4)
148
148
SESN1SESN1
NM_001199933
NM_001199933
CGACCAGGACGAGGAACTT
(서열번호 5)
CGACCAGGACGAGGAACTT
(SEQ ID NO: 5)
CCAATGTAGTGACGATAATGTAGG
(서열번호 6)
CCAATGTAGTGACGATAATGTAGG
(SEQ ID NO: 6)
273
273
SOD2SOD2
NM_000636
NM_000636
GCTGACGGCTGCATCTGTT
(서열번호 7)
GCTGACGGCTGCATCTGTT
(SEQ ID NO: 7)
CCTGATTTGGACAAGCAGCAA
(서열번호 8)
CCTGATTTGGACAAGCAGCAA
(SEQ ID NO: 8)
101
101
TRXTRX
NM_003329
NM_003329
TGAAGCAGATCGAGAGCAAGAC
(서열번호 9)
TGAAGCAGATCGAGAGCAAGAC
(SEQ ID NO: 9)
TTCATTAATGGTGGCTTCAAGC
(서열번호 10)
TTCATTAATGGTGGCTTCAAGC
(SEQ ID NO: 10)
305
305
APE/REF-1APE / REF-1
NM_001641
NM_001641
GCAGATACGGGGTTGCTCTT
(서열번호 11)
GCAGATACGGGGTTGCTCTT
(SEQ ID NO: 11)
TTTTACCGCGTTGCCCTACT
(서열번호 12)
TTTTACCGCGTTGCCCTACT
(SEQ ID NO: 12)
136
136
CX43CX43
NM_000165.3
NM_000165.3
TCATTAGGGGGAAGGCGTGA
(서열번호 13)
TCATTAGGGGGAAGGCGTGA
(SEQ ID NO: 13)
GGGCACCACTCTTTTGCTTAAA
(서열번호 14)
GGGCACCACTCTTTTGCTTAAA
(SEQ ID NO: 14)
164
164
ICAMICAM
-1-One
NM_000201.2
NM_000201.2
TGTGACCAGCCCAAGTTGTT
(서열번호 15)
TGTGACCAGCCCAAGTTGTT
(SEQ ID NO: 15)
TGGAGTCCAGTACACGGTGA
(서열번호 16)
TGGAGTCCAGTACACGGTGA
(SEQ ID NO: 16)
186
186
N-N-
CadherinCadherin
NM_001792
NM_001792
CGAGCCGCCTGCGCTGCCAC
(서열번호 17)
CGAGCCGCCTGCGCTGCCAC
(SEQ ID NO: 17)
CGCTGCTCTCCGCTCCCCGC
(서열번호 18)
CGCTGCTCTCCGCTCCCCGC
(SEQ ID NO: 18)
199
199
ITGA1ITGA1
NM_181501.1
NM_181501.1
ACGCTGCTGCGTATCATTCA
(서열번호 19)
ACGCTGCTGCGTATCATTCA
(SEQ ID NO: 19)
CACCTCTCCCAACTGGACAC
(서열번호 20)
CACCTCTCCCAACTGGACAC
(SEQ ID NO: 20)
194
194
ITGA2ITGA2
NM_002203.3.
NM_002203.3.
TTAGCGCTCAGTCAAGGCAT(서열번호 21)
TTAGCGCTCAGTCAAGGCAT (SEQ ID NO: 21)
CGGTTCTCAGGAAAGCCACT(서열번호 22)
CGGTTCTCAGGAAAGCCACT (SEQ ID NO: 22)
179
179
ITGA3ITGA3
NM_002204.2
NM_002204.2
GCTGACCGACGACTACTGAG
(서열번호 23)
GCTGACCGACGACTACTGAG
(SEQ ID NO: 23)
CTGGTCACCCAGTGCTTCTT
(서열번호 24)
CTGGTCACCCAGTGCTTCTT
(SEQ ID NO: 24)
178
178
ITGA5ITGA5
NM_002205.2
NM_002205.2
AGACTTCTTTGGCTCTGCCC
(서열번호 25)
AGACTTCTTTGGCTCTGCCC
(SEQ ID NO: 25)
CGCTCCTCTGGGTTGAACAT
(서열번호 26)
CGCTCCTCTGGGTTGAACAT
(SEQ ID NO: 26)
174
174
ITGA6ITGA6
NM_001079818.1
NM_001079818.1
TCATGGATCTGCAAATGGAA
(서열번호 27)
TCATGGATCTGCAAATGGAA
(SEQ ID NO: 27)
AGGGAACCAACAGCAACATC
(서열번호 28)
AGGGAACCAACAGCAACATC
(SEQ ID NO: 28)
135
135
ITGA11ITGA11
NM_001004439
NM_001004439
GCCTACTGAAGCTGAGGGAC
(서열번호 29)
GCCTACTGAAGCTGAGGGAC
(SEQ ID NO: 29)
TGTGATTCAGCTGTGGAGCA
(서열번호 30)
TGTGATTCAGCTGTGGAGCA
(SEQ ID NO: 30)
129
129
ITGAvITGAv
NM_002210.4
NM_002210.4
TCCGATTCCAAACTGGGAGC
(서열번호 31)
TCCGATTCCAAACTGGGAGC
(SEQ ID NO: 31)
AAGGCCACTGAAGATGGAGC
(서열번호 32)
AAGGCCACTGAAGATGGAGC
(SEQ ID NO: 32)
137
137
ITGB1ITGB1
NM_002211.3
NM_002211.3
GCGCGGAAAAGATGAATTTACAAC
(서열번호 33)
GCGCGGAAAAGATGAATTTACAAC
(SEQ ID NO: 33)
ATCTGGAGGGCAACCCTTCT
(서열번호 34)
ATCTGGAGGGCAACCCTTCT
(SEQ ID NO: 34)
245
245
ITGB3ITGB3
NM_000212.2
NM_000212.2
ACCAGTAACCTGCGGATTGG
(서열번호 35)
ACCAGTAACCTGCGGATTGG
(SEQ ID NO: 35)
TCCGTGACACACTCTGCTTC
(서열번호 36)
TCCGTGACACACTCTGCTTC
(SEQ ID NO: 36)
208
208
ITGB5ITGB5
NM_002213.3
NM_002213.3
TACCTGGAACAACGGTGGAG
(서열번호 37)
TACCTGGAACAACGGTGGAG
(SEQ ID NO: 37)
GCTTCGGGCCTCCAATGATA
(서열번호 38
GCTTCGGGCCTCCAATGATA
(SEQ ID NO: 38
242
242
GAPDHGAPDH
NM_002046.4
NM_002046.4
GCACCGTCAAGGCTGAGAAC
(서열번호 39
GCACCGTCAAGGCTGAGAAC
(SEQ ID NO: 39
TGGTGAAGACGCCAGTGGA
(서열번호 40)
TGGTGAAGACGCCAGTGGA
(SEQ ID NO: 40)
138
138
세포 증식 측정Cell proliferation measurement
hMSCs는 96 시간 배양 기간이 완료되기 전에 12 시간 동안 무혈청 배지에서 10 μM 5-에티닐-2'-데옥시우리딘 (EDU) (Life Technologies, Carlsbad, CA)로 배양하였다. 세포를 4 % 파라포름알데히드 (PFA, Sigma-Aldrich, St. Louis, MO)에 고정시키고 제조자의 지시에 따라 처리하였다. Zeiss LSM 710 현미경 (Carl Zeiss, Oberkochen, Germany)으로 이미지를 촬영하고 이미지를 Zeiss Zen 소프트웨어 및 ImageJ (National Institutes of Health, Bethesda, MD)로 처리하였다. N = 6 생물학적 복제가 기질 조건마다 사용되었다.hMSCs were cultured in 10 μM 5-ethynyl-2'-deoxyuridine (EDU) (Life Technologies, Carlsbad, CA) in serum-free medium for 12 hours before the 96 hour incubation period was completed. Cells were fixed in 4% paraformaldehyde (PFA, Sigma-Aldrich, St. Louis, MO) and processed according to the manufacturer's instructions. Images were taken with a Zeiss LSM 710 microscope (Carl Zeiss, Oberkochen, Germany) and the images were processed with Zeiss Zen software and ImageJ (National Institutes of Health, Bethesda, MD). N = 6 biological replication was used for each of the substrate conditions.
결과result
공중합체 라이브러리의 합성Synthesis of copolymer library
우리는 소수성 및 단백질 흡착성을 갖는 PCL; 친수성 및 세포-반발력을 갖는 PEG; 및 친수성이지만 단백질과 친화력을 갖는 cPCL(carboxylated-PCL) 중 둘 이상을 중합한 공중합체 기질을 제조하였다. 구체적으로, 화학식 1로 표시되는 PEG-PCL 공중합체 및 도 1A에 도시된 PEG-PCL-cPCL 공중합체 기질을 중합하였으며, 공중합체를 이루는 각 고분자의 몰분율을 변화시키고, 특히, PEG의 경우 다양한 사슬 길이(분자량)를 가진 PEG를 이용하여 공중합체를 제조하였다. We have shown that PCL with hydrophobicity and protein adsorption; PEG with hydrophilic and cell-repellant properties; And carboxylated-PCL (cPCL), which is hydrophilic but has affinity for proteins. Specifically, the PEG-PCL copolymer represented by Chemical Formula (1) and the PEG-PCL-cPCL copolymer substrate shown in FIG. 1A were polymerized to change the mole fractions of each polymer constituting the copolymer. In particular, The copolymer was prepared using PEG having a length (molecular weight).
cPCL은 PEG의 세포 반박력이 줄기세포의 행동에 어떤 영향을 미치는지를 확인하기 위해 PEG의반발력에 대한 "구조(rescue)" 물질로 도입하였다. cPCL was introduced as a "rescue" material for the repulsive force of PEG to determine how the cell antiretension of PEG affects the behavior of stem cells.
공중합체의 구성이 인간 유래 The composition of the copolymer is derived from human 중간엽Intermediate lobe 줄기세포( Stem Cells( hMSChMSC )의 )of 줄기세포능Stem cell ability 및 And RedixRedix 표현형에 미치는 영향 Effect on phenotype
우리는 제조된 공중합체로 이루어진 기질에 hMSC을 배양하여 hMSC의 행동을 관찰하였다. 그 결과, 단백질 흡착성(도 1B) 및 접촉각(도 1C)은 공중합체 내 PEG 몰 %에 따라 변하는 것을 확인하였다. 이는 PEG 함량이 증가하면 더 많은 친수성 및 단백질-반발 표면을 야기하므로, 공중합체 내 PEG 몰 %가 증가하면 단백질 흡착성 및 접촉각이 감소함을 확인하였다. 그러나 이러한 효과들은 친수성이지만 단백질과 친화력을 갖는 cPCL(carboxylated-PCL)을 도입함으로써 정반대의 효과를 보였다. We observed the behavior of hMSCs by culturing hMSCs on substrates made of the copolymers produced. As a result, it was confirmed that the protein adsorbability (FIG. 1B) and the contact angle (FIG. 1C) varied with the PEG mole% in the copolymer. This shows that as the PEG content increases, it causes more hydrophilic and protein-repellent surfaces, and therefore, the increase of the PEG mole% in the copolymer decreases the protein adsorption and the contact angle. These effects, however, are hydrophilic but have the opposite effect by introducing a protein-affinity cPCL (carboxylated-PCL).
또한, hMSCs는 PEG-PCL 공중합체 기질상에서는 응집체를 형성하였지만 100 % PCL 및 cPCL 포함 공중합체(도 1D) 기질에서는 넓게 퍼져나감을 확인함으로써 PEG의 기능적 반발력 및 PCL 및 cPCL의 접착성을 입증하였다. In addition, hMSCs formed agglutinates on the PEG-PCL copolymer substrate, but confirmed that they were spread widely in the 100% PCL and cPCL-containing copolymer (FIG. 1D) substrate, demonstrating functional repulsion of PEG and adhesion of PCL and cPCL.
우리는 다음으로 자가 재생 및 분화 능력을 유지하는 두 가지 기본 줄기세포능(stemness) 유전자 인 NANOG와 SOX2의 공중합체 매개 조절을 평가했다. 반발력이 줄기세포를 조절할 것이라는 우리의 가설을 뒷받침할 때, 한 공중합체 10 % PEG-90 % PCL는 세포 내 ROS 감소와 함께 TCPS 대조군에 비해 NANOG와 SOX2의 발현을 유의하게 증가시켰다 (도 1E, 1F 및 도 1G).We next assessed the control of the copolymerization of NANOG and SOX2 , two basic stem cell genes that maintain their ability to regenerate and differentiate. In support of our hypothesis that the repulsive force would regulate stem cells, one
또한, 미분화 hMSCs의 가장 일반적으로 사용되는 생체 내 마커인 STRO-1의 발현은 TCPS에서 체외 배양 동안 점차적으로 손실되지만 10 % PEG-90 % PCL에서 복원되었다 (도 1H). mol % PEG를 추가로 25 % PEG-75 % PCL로 증가시키면 줄기세포의 발현이 감소함을 확인하였고 이는 25 % PEG의 높은 반발 표면(데이터는 나타내지 않음)으로 인해 세포 부착이 없는 큰 영역이 생성되었기 때문인 것으로 판단되었고, 상기 PEG의 몰분률을 세포 발반력의 상한선으로 정하였다.In addition, the expression of STRO-1, the most commonly used in vivo marker of undifferentiated hMSCs, was gradually lost during in vitro culture in TCPS but was restored in 10% PEG-90% PCL (Fig. 1H). Increasing the mol% PEG to 25% PEG-75% PCL also reduced the expression of stem cells, which resulted in a large area without cell attachment due to the high repulsion surface of 25% PEG (data not shown) , And the molar fraction of the PEG was defined as the upper limit of the cellular foot reaction force.
공중합체 필름 화학이 hMSC의 행동에 미치는 영향의 검증Verification of the effect of copolymer film chemistry on hMSC behavior
공중합체 조성을 변화시키지 않고 반발력 영역을 마스킹하기 위해 공중합체 표면을 다양한 농도로 접착성 피브로넥틴 (FN)으로 미리 코팅하였다. FN은 응집을 줄이면서 세포 부착과 퍼짐을 수행하였다 (도 2A). 8 시간 후, 코팅되지 않은 공중합체 및 0.05 μg/cm2 FN가 코팅된 10 % PEG-90 % PCL상의 hMSC는 독립적인 응집체 (적색 화살표)를 형성하였고, 72 시간 후 세포는 신장되었지만 여전히 응집된 상태로 세포-세포 상호작용을 보였다. qPCR의 경우 TCPS 및 HD는 각각 반발력이 없는 대조군으로 사용하였다. 10 % PEG-90 % hMSCs는 HD와 비슷한 수준의 NANOG 및 SOX2 발현을 보였으나 FN 농도가 증가함에 따라 이 효과는 감소하였다 (도 2B 및 C). 참고로, 재료의 강성의 효과를 평가하는 것을 목표로 하는 대부분의 공지된 생체 재료 시스템에서 재료는 재료 파생 효과를 저해하지 않는 접착성 단백질 층으로 코팅된다. 따라서 FN 사전 코팅 또한 아래에 있는 재료의 강성이 변하지 않고 관찰된 줄기세포능의 변화가 없어지기 때문에 기질의 강성의 변화는 우리 시스템의 표면 반발력보다 줄기세포의 행동변화에 덜 효과적임을 시사한다.The copolymer surface was previously coated with adhesive fibronectin (FN) at various concentrations to mask the repulsive force area without changing the copolymer composition. FN performed cell attachment and spreading while reducing aggregation (Figure 2A). After 8 hours, hMSCs on 10% PEG-90% PCL coated with uncoated copolymer and 0.05 μg / cm 2 FN formed independent aggregates (red arrows) and after 72 hours the cells were elongated but still agglutinated Cell-cell interaction. For qPCR, TCPS and HD were used as a control group without repulsive force, respectively. 10% PEG-90% hMSCs showed similar levels of NANOG and SOX2 expression as HD, but this effect decreased with increasing FN concentration (Figs. 2B and C). For reference, in most known biomaterial systems aimed at assessing the effect of stiffness of a material, the material is coated with an adhesive protein layer that does not interfere with the material derivative effect. Thus, FN precoating also suggests that changes in stiffness of the substrate are less effective in stem cell behavioral changes than in our system, since the stiffness of the material below does not change and the observed changes in stem cell function are lost.
PEG 사슬 길이 및 몰분률의 변화에 따른 hMSC의 표현형 평가Phenotypic evaluation of hMSC according to changes in PEG chain length and molar fraction
공중합체 내 PEG의 사슬 길이 및/또는 몰 %를 조절하여 세포 반응을 추가로 확인하였다. (i) 5-20mol %의 PEG 및 (ii) 750Da, 2kDa 또는 5kDa의 블록 길이 (아래 첨자 번호로 표시됨)를 포함하는 공중합체를 전술한 바와 같이 합성하고 특성화하였다. 배양 4 일 후에, PEG750 공중합체는 부착을 허용하였으나, PEG의 몰 %가 증가함에 따라 감소하였다 (도 3A).The cellular reaction was further confirmed by controlling the chain length and / or mol% of PEG in the copolymer. (i) 5-20 mol% of PEG and (ii) a block length of 750 Da, 2 kDa or 5 kDa (denoted by the subscript numbers) were synthesized and characterized as described above. After 4 days of incubation, the PEG 750 copolymer allowed to adhere but decreased with increasing molar% of PEG (FIG. 3A).
이러한 경향은 10 몰 % PEG가 세포 부착을 억제하는 것과 같은 PEG2k 공중합체에서 더욱 명백하였고, PEG5k 공중합체에서는 사실상 부착이 관찰되지 않았다. 두 가지 변수에 대한 추가 연구를 위해 (1) 일정한 몰 %에서 증가된 PEG 사슬 크기 및 (2) 일정한 PEG 사슬크기에서 증가된 몰 %와 같은 변수에 대한 추가 연구를 위해 4 개의 공중합체 (5 % PEG750, 20 % PEG750, 5 % PEG2k 및 10 % PEG2k)를 선별하였다 (도 3A, B, 빨간색 문자).This tendency was more evident in PEG 2k copolymers such that 10 mol% PEG inhibited cell adhesion and virtually no adhesion was observed in the PEG 5k copolymer. For further study of the two variables, four copolymers (5%) were added for further study of variables such as (1) increased PEG chain size at constant mol% and (2) increased molar% at constant PEG chain size. PEG 750 , 20% PEG 750 , 5% PEG 2k and 10% PEG 2k ) (Figure 3A, B, red letter).
PEG750 공중합체상의 hMSC는 표면과 상호작용하고 연장되었지만, PEG2k 공중합체상의 세포는 보다 고립된 응집체를 생성하였다 (도 3B). NANOG (도 3C)및 SOX2 (도 3D)의 발현은 PEG 사슬 길이 및 mol % 모두에 의해 크게 영향을 받았다. NANOG 발현은 모든 공중합체에서 TCPS 대조군에 비해 유의하게 증가하였으며, 10 % PEG2k에서도 계속 증가하였다. 더 긴 PEG 사슬 (2 kDa 대 750 Da)으로 구성된 공중합체는 SOX2 유전자의 발현을 더 자극하였고, 각 그룹 내의 PEG의 몰 % 증가 (10%/20% 대 5%)는 이 효과를 더욱 강화시켰다. 모든 공중합체에서 sestrin 1 (SESN1), thioredoxin (TRX), superoxide dismutase 2 (SOD2), apurinic endonuclease/redox-factor 1 (APE/Ref-1)을 포함한 주요 항산화 매개체의 발현이 증가했다. (도 3E-H) 및 세포 내 ROS 부하 (도 3I)는 TCPS에 비해 유의하게 감소하였다.PEG 750 The hMSC on the copolymer interacted with the surface and extended, but the cells on the PEG 2k copolymer produced more isolated aggregates (Figure 3B). Expression of NANOG (Fig. 3C) and SOX2 (Fig. 3D) was greatly affected by both PEG chain length and mol%. NANOG expression was significantly increased in all the copolymers compared to the TCPS control, and continued to increase at 10% PEG 2k . Copolymers composed of longer PEG chains (2 kDa to 750 Da) further stimulated the expression of the SOX2 gene, and the mol% increase (10% / 20% vs. 5%) of PEG in each group further enhanced this effect . The expression of major antioxidant mediators including sestrin 1 (SESN1), thioredoxin (TRX), superoxide dismutase 2 (SOD2) and apurinic endonuclease / redox-factor 1 (APE / Ref-1) was increased in all the copolymers. (FIG. 3E-H) and intracellular ROS load (FIG. 3I) were significantly reduced compared to TCPS.
PEG 및 PCL 상 분리의 나노 및 옹스트롬 레벨에서의 조사Investigation at the nano and angstrom levels of PEG and PCL phase separation
세포-물질 계면에서 고분자 구조가 세포 기능에 어떻게 영향을 미치는지 이해하기 위해, 공중합체 표면의 나노 스케일 특성을 X-선 산란 (X-ray scattering, XRS)으로 조사하였다. PEG가 PCL 라멜라의 형성을 방해하지 않는다는 것을 확인하는 작은 각 XRS 층상 피크 (도 4A) 및 PCL 도메인과 관련된 광각 XRS 결정 피크 (도 4B)가 모든 샘플에 존재한다. PEG가 결정화될 것으로 기대되는 PEG2k 및 PEG5k의 모든 샘플에서 PEG 결정 피크의 부재는 PEG 결정화가 공중합체에서 중단됨을 시사한다. 또한, 이 두 관찰 결과는 PEG 사슬이 반결정성 PCL의 비결정성 도메인 내에 비결정성 분절로서 매립된다고 결론내릴 수 있다. 그러나, 공중합체의 형태에 대한 PEG 분절의 영향은 그의 사슬 길이에 의존한다. 예를 들어, 수화시 PEG750 공중합체의 PCL 결정성은 변하지 않았지만 (도 4C), 중간각 XRS는 넓어졌으며, 이것은 공중합체의 PCL 사슬은 수화되면 덜 정렬됨을 가리킨다. 대조적으로, 100 % PCL 및 PEG2k 및 PEG5k의 공중합체에서의 PCL 결정화도는 수화시 증가하고, 중간각 XRS 피크는 가파르며 수화시 PCL 결정 열이 증가하거나 변화하지 않는 것을 나타낸다.In order to understand how the polymer structure affects cell function at the cell-material interface, the nanoscale properties of the copolymer surface were investigated by X-ray scattering (XRS). Small XRS layered peaks (Figure 4A) and wide XRS crystal peaks (Figure 4B) associated with the PCL domain are present in all samples, confirming that PEG does not interfere with the formation of PCL lamellar. The absence of PEG crystal peaks in all samples of PEG 2k and PEG 5k , where PEG is expected to crystallize, suggests that PEG crystallization is interrupted in the copolymer. In addition, these two observations can be concluded that the PEG chain is embedded as an amorphous segment within the amorphous domain of semi-crystalline PCL. However, the effect of the PEG segment on the shape of the copolymer depends on its chain length. For example, the PCL crystallinity of the PEG 750 copolymer during hydration did not change (Fig. 4C), but the median angle XRS was widened, indicating that the PCL chain of the copolymer was less aligned when hydrated. In contrast, the PCL crystallinity in the copolymers of 100% PCL and PEG 2k and PEG 5k is increased during hydration and the intermediate angular XRS peak is steep and indicates that the PCL crystal heat does not increase or change during hydration.
우리의 데이터와 관련하여, 비록 PEG가 PCL 라멜라(lamellae)의 형성을 방해하지는 않지만, 그것의 사슬 길이 의존적 분포는 라멜라의 특성에 영향을 미친다 (도 4D): PEG750 공중합체 내의 더 짧은 PEG 분절은 비결정성 기질에 분산되고, 습윤시 PCL 결정질을 감소시킨다. 대조적으로, PEG2k 및 PEG5k 공중합체에서 보다 긴 PEG 분절은 비결정성 PCL로부터 배제되므로 습윤시 증가된 PCL 결정성을 허용한다. 이러한 배제된 PEG 분절은 수화시에 팽창하고, 물질 표면에서 버섯 모양을 만들고, 세포 부착을 중단시키는 루프를 형성한다 (도 4E). 이러한 루프는 수화시 100% PCL과 비교하여 PEG750 및 PEG2K에서 라멜라 간격의 증가를 설명한다; 즉, 즉 팽윤된 PEG 도메인은 물리적으로 젖은 상태에서 결정성 PCL 라멜라를 밀어낸다 (도 4D). 사실, 고분자 표면에 형성된 PEG 루프는 PEG2k 및 PEG5k 공중합체의 향상된 세포 반발 효과를 설명하는 방어 표면을 만든다. 따라서, PEG 사슬은 hMSC 행동 조절에서 사슬 길이 의존성 효과를 나타낸다. 삽입된 PEG750 사슬은 중합체-공기/물 계면으로 집합적으로 확산할 수 없으므로 주어진 몰 %에서 반발력이 감소한다. PEG2k 및 PEG5k 공중합체는 수화시 상분리된 PEG 사슬이 재료 표면에 고리를 형성하여 접착성, 비결정성 PCL를 마스크하여 각 mol %에서 효과를 증가시키기 때문에 심지어 5mol %에서도 증가된 반발력을 나타낸다.In connection with our data, although PEG does not interfere with the formation of PCL lamellae, its chain length-dependent distribution affects the properties of the lamella (Figure 4D): shorter PEG segments within the PEG 750 copolymer Is dispersed in the amorphous matrix and reduces the PCL crystallinity upon wetting. In contrast, longer PEG segments in the PEG 2k and PEG 5k copolymers are excluded from the amorphous PCL, allowing increased PCL crystallinity in wetting. These excluded PEG segments expand during hydration, form mushrooms on the material surface, and form loops that stop cell attachment (Fig. 4E). These loops account for the increase in lamellar spacing in PEG 750 and PEG 2K compared to 100% PCL in hydration; That is, the swollen PEG domain pushes the crystalline PCL lamella in a physically wet state (FIG. 4D). In fact, the PEG loop formed on the polymer surface creates a protective surface that explains the improved cell repellency of the PEG 2k and PEG 5k copolymers. Thus, the PEG chain exhibits a chain length-dependent effect in hMSC behavior control. The inserted PEG 750 chain can not collectively diffuse into the polymer-air / water interface, thus reducing the repulsive force at a given mole percent. The PEG 2k and PEG 5k copolymers exhibit increased repulsive force even at 5 mol% because the phase-separated PEG chains on hydration form a ring on the material surface to mask the adherent and amorphous PCL and increase the effect at each mol%.
hMSC가 PEG 사슬 길이에 따라 다르게 세포-물질 계면을 인지하는 것을 증명하기 위해, 우리는 초 해상도, 구조화된 조명 현미경을 사용하여 세포-물질 계면에서 국소 부착(focal adhesion, FA) 형성을 시각화했다. 주요 FA 단백질인 paxillin은 물질 표면에서 비 일시적인 접착착물을 형성하기 위해 선택되었다 (도 5). 유리 및 100 % PCL 기질에서 배양된 세포는 큰 FA 부위를 가지며, 5 % PEG750 및 20 % PEG750 공중합체는 유사한 형태를 나타내는 FA를 형성하고, 짧은 PEG 사슬은 물질 표면에서 세포 부착을 방해하지 않음을 확인하였다 (도 5A). 대조적으로, 5 % PEG2k 및 10 % PEG2k에서는 FA 영역의 크기 및 수가 감소하였다. FA 폭 감소 및 장축 연장은 약한 세포-기질 결합과 관련이 있으며, PEG2k 공중합체에서 관찰된 FA는 약한 세포-물질 상호 작용을 나타낸다. 정량화한 경우, FA 폭은 유리 및 100 % PCL과 비교하여 PEG750 공중합체에서는 유사하지만 PEG2k 공중합체에서 표면 결정성이 유의적으로 감소하였다 (도 5B). 기질은 표면 거칠기에 영향을 미쳐서 FA 형성에 영향을 미칠 수 있다. 그러나, 도 4C에 제시된 데이터에 기초하여, 모든 공중합체에 대한 젖은 표면이 동일한 결정화도를 갖기 때문에, 결정성에 의해 야기되는 표면 조도의 차이는 작다. 따라서, FA 형태의 차이는 공중합체 골격 화학 반응 (PEG 입체 장애 효과)에 기인한 것으로 판단할 수 있었다.To demonstrate that hMSC recognizes the cell-matter interface differently depending on the PEG chain length, we visualized focal adhesion (FA) formation at the cell-material interface using a super resolution, structured illumination microscope. The major FA protein, paxillin, was chosen to form non-transient adherent complexes on the surface of the material (Fig. 5). Cells cultured on glass and 100% PCL substrates have large FA sites, 5% PEG 750 and 20% PEG 750 copolymers form FAs with similar morphologies, and short PEG chains do not interfere with cell attachment on the material surface (Fig. 5A). In contrast, the size and number of FA regions decreased in 5% PEG 2k and 10% PEG 2k . FA width reduction and long axis extension are associated with weak cell-substrate binding and FA observed in PEG 2k copolymers exhibit weak cell-material interactions. When quantified, the FA width was similar in the PEG 750 copolymer compared to the glass and 100% PCL, but the surface crystallinity was significantly reduced in the PEG 2k copolymer (FIG. 5B). Substrates affect surface roughness and can affect FA formation. However, based on the data presented in Figure 4C, the difference in surface roughness caused by crystallinity is small, since the wetted surfaces for all the copolymers have the same degree of crystallinity. Therefore, it could be concluded that the difference of the FA type is due to the copolymer skeletal chemical reaction (PEG steric hindrance effect).
hMSChMSC 공여자에 따른 줄기세포의 Stem cells from donors 줄기세포능Stem cell ability 및 And RedoxRedox 표현형에 대한 공중합체의 효과 입증 Prove the effect of copolymer on phenotype
물질의 효과가 공여자 의존성에 의한 것인지 여부를 입증하기 위해 전술한 실험과정에서 강한 세포 반응이 5 % PEG2k 공중합체에서 일관되게 관찰되었기 때문에 3 개의 환자로부터 유래된 hMSC를 5 % PEG2k 공중합체에서 시험하였다. 모든 공여자에 대해 TCPS와 비교하여 5 % PEG2k에서 NANOG 및 SOX2의 발현이 유의하게 증가했으며 (도 6A-C) 거의 모든 경우 항산화 유전자의 발현이 증가했다 (도 6D-F). 세포 내 ROS 수준은 TCPS 대조군에 비해 공중합체에서 배양된 모든 환자 세포에서 감소했다 (도 6G). 세포-세포 및 세포-기질 접착의 균형이 이러한 효과를 유도하기 위해 가정되었기 때문에, 우리는 다중 세포 부착 분자 및 인테그린 아형의 유전자 발현을 측정하였고 (도 7A), CX43, 인테그린 α2 (ITGA2) 및 인테그린 β3/β5 (ITGB3/B5)를 물질 유도 효과의 후보 조절자로 선정하였다. 억제제 처리를 통한 단백질 수준의 발현 증가를 웨스턴 블롯으로 확인하였다 (도 7B). 상기 조절자을 억제하자, 특히 CX43의 억제가 줄기세포능 (도 7C) 및 항산화 관련 유전자 (도 7D)의 발현을 가장 강력하게 억제함을 확인하였다. Since strong cell responses were consistently observed in the 5% PEG 2k copolymer to demonstrate whether the effect of the substance was due to donor dependence, the hMSCs derived from the three patients were incubated in 5% PEG 2k copolymer . The expression of NANOG and SOX2 was significantly increased at 5% PEG 2k compared to TCPS for all donors (Fig. 6A-C), and in almost all cases the expression of antioxidant genes was increased (Fig. 6D-F). Intracellular ROS levels were reduced in all patient cells cultured in the copolymer compared to the TCPS control (Fig. 6G). Since a balance of cell-cell and cell-substrate adhesion was assumed to induce this effect, we measured gene expression of multiple cell adhesion molecules and integrin subtypes (Fig. 7A) and found that CX43, integrin alpha 2 (ITGA2) β3 / β5 (ITGB3 / B5) were selected as candidate modulators of the substance-induced effects. An increase in protein level expression through inhibitor treatment was confirmed by Western blot (Fig. 7B). It was confirmed that inhibition of the regulator, particularly inhibition of CX43, strongly suppressed the expression of stem cell function (Fig. 7C) and antioxidation related gene (Fig. 7D).
<110> Industry-Academic Cooperation Foundation, Yonsei University <120> A stem cell culture composition comprising a copolymer capable of controlling stemness <130> P18U18C1818 <150> KR 10-2017-0171216 <151> 2017-12-13 <160> 40 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SOX2 Forward Primer <400> 1 atcaggagtt gtcaaggcag ag 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SOX2 Reverse Primer <400> 2 cgccgccgat gattgttatt 20 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Nanog Forward Primer <400> 3 aatacctcag cctccagcag atg 23 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nanog Reverse Primer <400> 4 acgctgctgc gtatcattca 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SESN1 Forward Primer <400> 5 cgaccaggac gaggaactt 19 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SESN1 Reverse Primer <400> 6 ccaatgtagt gacgataatg tagg 24 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SOD2 Forward Primer <400> 7 gctgacggct gcatctgtt 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SOD2 Reverse Primer <400> 8 cctgatttgg acaagcagca a 21 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRX Forward Primer <400> 9 tgaagcagat cgagagcaag ac 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRX Reverse Primer <400> 10 ttcattaatg gtggcttcaa gc 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APE/REF-1 Forward Primer <400> 11 gcagatacgg ggttgctctt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APE/REF-1 Reverse Primer <400> 12 ttttaccgcg ttgccctact 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CX43 Forward Primer <400> 13 tcattagggg gaaggcgtga 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CX43 Reverse Primer <400> 14 gggcaccact cttttgctta aa 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ICAM-1 Forward Primer <400> 15 tgtgaccagc ccaagttgtt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ICAM-1 Reverse Primer <400> 16 tggagtccag tacacggtga 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> N-Cadherin Forward Primer <400> 17 cgagccgcct gcgctgccac 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> N-Cadherin Reverse Primer <400> 18 cgctgctctc cgctccccgc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA1 Forward Primer <400> 19 acgctgctgc gtatcattca 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA1 Reverse Primer <400> 20 cacctctccc aactggacac 20 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITGA2 Forward Primer <400> 21 ttagcgctca gtcaaggc 18 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ITGA2 Reverse Primer <400> 22 cggttctcag gaaagccac 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA3 Forward Primer <400> 23 gctgaccgac gactactgag 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA3 Reverse Primer <400> 24 ctggtcaccc agtgcttctt 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA5 Forward Primer <400> 25 agacttcttt ggctctgccc 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA5 Reverse Primer <400> 26 cgctcctctg ggttgaacat 20 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITGA6 Forward Primer <400> 27 tcatggatct gcaaatgg 18 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITGA6 Reverse Primer <400> 28 agggaaccaa cagcaaca 18 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 Forward Primer <400> 29 gcctactgaa gctgagggac 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 Reverse Primer <400> 30 tgtgattcag ctgtggagca 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGAv Forward Primer <400> 31 tccgattcca aactgggagc 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGAv Reverse Primer <400> 32 aaggccactg aagatggagc 20 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ITGB1 Forward Primer <400> 33 gcgcggaaaa gatgaattta caac 24 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB1 Reverse Primer <400> 34 atctggaggg caacccttct 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB3 Forward Primer <400> 35 accagtaacc tgcggattgg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB3 Reverse Primer <400> 36 tccgtgacac actctgcttc 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB5 Forward Primer <400> 37 tacctggaac aacggtggag 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB5 Reverse Primer <400> 38 gcttcgggcc tccaatgata 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Forward Primer <400> 39 gcaccgtcaa ggctgagaac 20 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Reverse Primer <400> 40 tggtgaagac gccagtgga 19 <110> Industry-Academic Cooperation Foundation, Yonsei University <120> A stem cell culture composition comprising a copolymer capable of controlling stemness <130> P18U18C1818 <150> KR 10-2017-0171216 <151> 2017-12-13 <160> 40 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SOX2 Forward Primer <400> 1 atcaggagtt gtcaaggcag ag 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SOX2 Reverse Primer <400> 2 cgccgccgat gattgttatt 20 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Nanog Forward Primer <400> 3 aatacctcag cctccagcag atg 23 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nanog Reverse Primer <400> 4 acgctgctgc gtatcattca 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SESN1 Forward Primer <400> 5 cgaccaggac gaggaactt 19 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SESN1 Reverse Primer <400> 6 ccaatgtagt gacgataatg tagg 24 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SOD2 Forward Primer <400> 7 gctgacggct gcatctgtt 19 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SOD2 Reverse Primer <400> 8 cctgatttgg acaagcagca a 21 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRX Forward Primer <400> 9 tgaagcagat cgagagcaag ac 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRX Reverse Primer <400> 10 ttcattaatg gtggcttcaa gc 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APE / REF-1 Forward Primer <400> 11 gcagatacgg ggttgctctt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> APE / REF-1 Reverse Primer <400> 12 ttttaccgcg ttgccctact 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CX43 Forward Primer <400> 13 tcattagggg gaaggcgtga 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CX43 Reverse Primer <400> 14 gggcaccact cttttgctta aa 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ICAM-1 Forward Primer <400> 15 tgtgaccagc ccaagttgtt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ICAM-1 Reverse Primer <400> 16 tggagtccag tacacggtga 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> N-Cadherin Forward Primer <400> 17 cgagccgcct gcgctgccac 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> N-Cadherin Reverse Primer <400> 18 cgctgctctc cgctccccgc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA1 Forward Primer <400> 19 acgctgctgc gtatcattca 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA1 Reverse Primer <400> 20 cacctctccc aactggacac 20 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITGA2 Forward Primer <400> 21 ttagcgctca gtcaaggc 18 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ITGA2 Reverse Primer <400> 22 cggttctcag gaaagccac 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA3 Forward Primer <400> 23 gctgaccgac gactactgag 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA3 Reverse Primer <400> 24 ctggtcaccc agtgcttctt 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA5 Forward Primer <400> 25 agacttcttt ggctctgccc 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA5 Reverse Primer <400> 26 cgctcctctg ggttgaacat 20 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITGA6 Forward Primer <400> 27 tcatggatct gcaaatgg 18 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ITGA6 Reverse Primer <400> 28 agggaaccaa cagcaaca 18 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 Forward Primer <400> 29 gcctactgaa gctgagggac 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGA11 Reverse Primer <400> 30 tgtgattcag ctgtggagca 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGAv Forward Primer <400> 31 tccgattcca aactgggagc 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGAv Reverse Primer <400> 32 aaggccactg aagatggagc 20 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ITGB1 Forward Primer <400> 33 gcgcggaaaa gatgaattta caac 24 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB1 Reverse Primer <400> 34 atctggaggg caacccttct 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB3 Forward Primer <400> 35 accagtaacc tgcggattgg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB3 Reverse Primer <400> 36 tccgtgacac actctgcttc 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB5 Forward Primer <400> 37 tacctggaac aacggtggag 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITGB5 Reverse Primer <400> 38 gcttcgggcc tccaatgata 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Forward Primer <400> 39 gcaccgtcaa ggctgagaac 20 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Reverse Primer <400> 40 tggtgaagac gccagtgga 19
Claims (13)
[화학식 1]
상기 화학식에서,
x 및 y는 각각 PEG 및 PCL의 몰분률(mol %)을 의미한다.The composition for stem cell culture for controlling stem cell function according to claim 1, wherein the copolymer comprising PEG (poly (ethylene glycol)) and PCL (poly (? -Caprolactone) :
[Chemical Formula 1]
In the above formulas,
x and y mean mole fractions (mol%) of PEG and PCL, respectively.
상기 제조된 공중합체를 포함하는 줄기세포 배양 조성물에 줄기세포를 배양하는 단계를 포함하는, 줄기세포의 줄기세포능을 제어하는 방법.Preparing a copolymer by controlling the mole fractions of PEG (poly (ethylene glycol)) and PCL (poly (ε-caprolactone)); And
And culturing the stem cells in a stem cell culture composition containing the produced copolymer.
[화학식 1]
상기 화학식에서,
X 및 y는 각각 PEG 및 PCL의 몰분률(mol %)을 의미한다.The method according to claim 7, wherein the copolymer of PEG (poly (ethylene glycol)) and PCL (poly (ε-caprolactone)) is represented by the following formula:
[Chemical Formula 1]
In the above formulas,
X and y mean mole fraction (mol%) of PEG and PCL, respectively.
8. The method according to claim 7, wherein the stem cells are human-derived mesenchymal stem cells.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20170171216 | 2017-12-13 | ||
KR1020170171216 | 2017-12-13 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20190070886A true KR20190070886A (en) | 2019-06-21 |
KR102132807B1 KR102132807B1 (en) | 2020-07-13 |
Family
ID=67056837
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020180160310A KR102132807B1 (en) | 2017-12-13 | 2018-12-12 | A stem cell culture composition comprising a copolymer capable of controlling stemness |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102132807B1 (en) |
Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1970068A1 (en) * | 2004-03-18 | 2008-09-17 | CellCoTec B.V. | Tissue repair using multipotent cells |
US20100040660A1 (en) * | 2008-08-12 | 2010-02-18 | Korea Research Institute Of Chemical Technology | Development of a tissue - engineered scaffold for nerve regeneration using a biocompatible and injectable hydrogel |
KR20120111380A (en) * | 2011-03-31 | 2012-10-10 | 인제대학교 산학협력단 | Complex scaffold for bone-cartilage regeneration, method for preparing thereof and composition for treating bone cartilage disease comprising the same |
JP2013530792A (en) * | 2010-07-12 | 2013-08-01 | ユニバーシティー オブ サザン カリフォルニア | Biocompatible substrate that promotes interconnection of stem cells and target tissue and method of implanting the same |
US20140107292A1 (en) * | 2011-06-16 | 2014-04-17 | Vanderbilt University | Copolymers and methods of use thereof |
KR20160061533A (en) * | 2014-11-21 | 2016-06-01 | 단국대학교 천안캠퍼스 산학협력단 | Fusion protein comprising collagen binding domain, osteocalcin domain and fibronectin domain, and pharmaceutical composition comprising the same |
KR20160089110A (en) | 2015-01-19 | 2016-07-27 | 서울대학교병원 | Method for increasing stemness of human mesenchymal stem cell |
KR101906472B1 (en) * | 2017-04-04 | 2018-10-10 | 연세대학교 산학협력단 | A photo-crosslinkable shape memory polymer and manufacturing method thereof |
KR20190002253A (en) * | 2017-06-29 | 2019-01-08 | 서울대학교산학협력단 | Complex of nanofiber and hydrogel and a scaffold for tissue regeneration |
-
2018
- 2018-12-12 KR KR1020180160310A patent/KR102132807B1/en active IP Right Grant
Patent Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1970068A1 (en) * | 2004-03-18 | 2008-09-17 | CellCoTec B.V. | Tissue repair using multipotent cells |
US20100040660A1 (en) * | 2008-08-12 | 2010-02-18 | Korea Research Institute Of Chemical Technology | Development of a tissue - engineered scaffold for nerve regeneration using a biocompatible and injectable hydrogel |
JP2013530792A (en) * | 2010-07-12 | 2013-08-01 | ユニバーシティー オブ サザン カリフォルニア | Biocompatible substrate that promotes interconnection of stem cells and target tissue and method of implanting the same |
KR20120111380A (en) * | 2011-03-31 | 2012-10-10 | 인제대학교 산학협력단 | Complex scaffold for bone-cartilage regeneration, method for preparing thereof and composition for treating bone cartilage disease comprising the same |
US20140107292A1 (en) * | 2011-06-16 | 2014-04-17 | Vanderbilt University | Copolymers and methods of use thereof |
KR20160061533A (en) * | 2014-11-21 | 2016-06-01 | 단국대학교 천안캠퍼스 산학협력단 | Fusion protein comprising collagen binding domain, osteocalcin domain and fibronectin domain, and pharmaceutical composition comprising the same |
KR20160089110A (en) | 2015-01-19 | 2016-07-27 | 서울대학교병원 | Method for increasing stemness of human mesenchymal stem cell |
KR101906472B1 (en) * | 2017-04-04 | 2018-10-10 | 연세대학교 산학협력단 | A photo-crosslinkable shape memory polymer and manufacturing method thereof |
KR20190002253A (en) * | 2017-06-29 | 2019-01-08 | 서울대학교산학협력단 | Complex of nanofiber and hydrogel and a scaffold for tissue regeneration |
Non-Patent Citations (1)
Title |
---|
Acta Biomater. 2012; 8(2):559-569 |
Also Published As
Publication number | Publication date |
---|---|
KR102132807B1 (en) | 2020-07-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Koivusalo et al. | Tissue adhesive hyaluronic acid hydrogels for sutureless stem cell delivery and regeneration of corneal epithelium and stroma | |
Zhu et al. | Modulation of macrophages by bioactive glass/sodium alginate hydrogel is crucial in skin regeneration enhancement | |
Hoch et al. | Cell-secreted matrices perpetuate the bone-forming phenotype of differentiated mesenchymal stem cells | |
Lee et al. | Topographically defined, biodegradable nanopatterned patches to regulate cell fate and acceleration of bone regeneration | |
Dos Santos et al. | Development of a cell-free and growth factor-free hydrogel capable of inducing angiogenesis and innervation after subcutaneous implantation | |
Witkowska-Zimny et al. | Effect of substrate stiffness on differentiation of umbilical cord stem cells | |
Shendi et al. | Hyaluronic acid as a macromolecular crowding agent for production of cell-derived matrices | |
Wei et al. | Soft hydrogels for balancing cell proliferation and differentiation | |
Sawatjui et al. | Biomimetic scaffolds and dynamic compression enhance the properties of chondrocyte‐and MSC‐based tissue‐engineered cartilage | |
Yu et al. | Insights into the role of focal adhesion modulation in myogenic differentiation of human mesenchymal stem cells | |
Gandhi et al. | Fibrin hydrogels as a xenofree and rapidly degradable support for transplantation of retinal pigment epithelium monolayers | |
Zhao et al. | Ureter tissue engineering with vessel extracellular matrix and differentiated urine-derived stem cells | |
Lee et al. | Microcontact printing of polydopamine on thermally expandable hydrogels for controlled cell adhesion and delivery of geometrically defined microtissues | |
Lacombe et al. | Plant-based scaffolds modify cellular response to drug and radiation exposure compared to standard cell culture models | |
Cha et al. | The modulation of the oxidative stress response in chondrocytes by Wip1 and its effect on senescence and dedifferentiation during in vitro expansion | |
US11666604B2 (en) | Multilayered cell sheet of cardiac stem cells and method of preparing the same | |
Hwang et al. | Artificial cellular nano-environment composed of collagen-based nanofilm promotes osteogenic differentiation of mesenchymal stem cells | |
Kim et al. | Lotus seedpod-inspired hydrogels as an all-in-one platform for culture and delivery of stem cell spheroids | |
Mayer et al. | Pro-angiogenic CD14++ CD16+ CD163+ monocytes accelerate the in vitro endothelialization of soft hydrophobic poly (n-butyl acrylate) networks | |
Huang et al. | Biophysical and chemical effects of fibrin on mesenchymal stromal cell gene expression | |
Pensabene et al. | Flexible polymeric ultrathin film for mesenchymal stem cell differentiation | |
Seow et al. | Thin peptide hydrogel membranes suitable as scaffolds for engineering layered biostructures | |
TW201014914A (en) | Materials and methods for cell growth | |
KR20170029237A (en) | Substrate with biopolymer pattern for culturing micro-sized cell sheet and method for delivering the same | |
Balikov et al. | Tunable surface repellency maintains stemness and redox capacity of human mesenchymal stem cells |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |