KR20190049303A - Method of producing virus free plant using meristem-tip culture from dormant bud of apple - Google Patents

Abstract

The present invention relates to a method for producing a virus-resistant plant, comprising the steps of: (a) collecting and disinfecting a vertebrate from a dormant baby of an infected apple tree, cutting the vertebrae from the sterilized vertebrae, (b) (C) propagating the regenerated shoots; (d) inducing rooting from the propagated shoots; and a method for producing a virus-free disease plant and a virus produced by the method The present invention relates to a disease-free plant.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for producing a virus-free plant,

More particularly, the present invention relates to a method for producing virus-free disease plants by culturing apple trees in a hermaphroditic tissue, and more particularly, to a method for producing virus- (B) regenerating shoots by tissue culture of the sterilized insect vertebrae in the cabin, (c) propagating the regenerated shoots, (d) recovering the regenerated shoots from the propagated shoots A method for producing a virus-free disease plant comprising the step of inducing rooting, and a virus-free disease plant produced by the above method.

When a plant is infected with a virus, it has a disadvantage that the yield decreases, the appearance becomes worse, the sugar content decreases, and the color becomes faded. Once a virus-infected plant is difficult to heal, it is imperative to remove the virus to produce a virus-free plant.

Methods for producing conventional virus-free plants are largely based on the method using a growth point culture (Crop Sci. (1979) 19: 213-216; Crop Protection (2004) 23: 469-473) (1992) 309: 393-400), a method using heat treatment and tissue culture (Am. J. Pot. Res. (1984 (1997) 43: 631-634), a method using chemical treatment and heat treatment (RDA J. Crop Protect. (1997) 39: 19-24; Plant Cell Tissue Organ Cult. (1992) 29: 51-55.), But the production efficiency is low and the process is complicated.

In addition, a method for producing an in-flight plant by culturing the seedlings in a cabinet for harvesting the seedlings for use in growing the leaves (Korean Patent Publication No. 10-2014-0040513), a virus-free apple production system using heat- (2013) 19 (4): 288-293) have been disclosed, but these prior art methods have not been disclosed, for example, by cultivating a plant for harvesting the leaves, culturing the plant by harvesting the harvest point, There has been a problem that the processing must be performed in parallel.

Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made keeping in mind the above problems occurring in the prior art, and it is an object of the present invention to provide a method for producing a plant free from virus infection by cutting, .

In order to achieve the above-mentioned object, the present invention provides a method for producing a disinfection solution, comprising the steps of: (a) collecting a disinfection solution from a dormant apple of an apple tree infected with a virus, (C) propagating the regenerated shoots; and (d) inducing rooting from the propagated shoots. The method for producing a virus-free disease plant according to any one of to provide.

The present invention also provides a virus-free disease plant produced by the above method.

The method for producing a virus-free disease plant through the hosomal tissue culture of apple trees according to the present invention is characterized in that the uninfected part in the apple water body is intactly grown in the natural state without any additional treatment such as heat treatment, , Saving time, labor, and costs, and effectively producing plants that are not infected with viruses in a very economical way.

Fig. 1 shows the results obtained by cutting the mandibular and lateral fissured tissues from the dormant babies of the apple red roots.
Fig. 1 (a) shows the branch of apple tree harvested from the open field, (b) is separated dysplasia of different size and developmental stage, c is apical meristem at the early stage of growth and peripheral side growth points, D is separated from the dormancy of the green arrow of b by a step that is more developed than c, and e is the distance from the d < RTI ID = 0.0 > A scale bar of a and b is 1 cm, and c, d (1, 2, 3, 4, 5, 6, And the scale bar of e is 1 mm.
FIG. 2 shows the regeneration process of ASSVd-free, ASSVd, ASPV, ACLSV, and ASGV-free plants from the apical meristematic tissue of the apple blossom variety. The cultured various fragmented tissue slices a to c, m ) (A to e in Fig. 1), a to l show the ASSVd-free plant regeneration process through direct organogenesis, the scale bar of a to d and m to n is 1 mm, The scale bar of e ~ g and o ~ p is 1 cm.
Fig. 2 (a) is the apical meristem of Stage 1, b is the apical meristem of stage 1, lateral meristem, c is the lateral mitotic structure of Stage 3, f is the shoot primordia in the fragment, g ~ i is the shoot in the shoot, j ~ l is the shoot in one to many regeneration in the fragment, m ~ p is the indirect organogenesis ), ASSVd · ASPV · ACLSV · ASGV-free plant regeneration, m is the apical meristem of Stage 2 + lateral meristem, n is callus formation, o is callus development, p is shoot Is reproduced.
Fig. 3 shows the result of RT-PCR analysis of pre-incubation period of virus infection of apple apple varieties. Lane M is a molecular DNA marker (100 bp), a) ASSVd, b) ASGV, c) ACLSV, d) Lane # 6 to Lane # 11 were virus-infected strains that were subjected to RT-PCR using leaf samples at plant growth. As a result, # 6 used in the experiment of the present invention was found to be ASSVd alone, # 8, and # 11 infected ASSVd, ASGV, ACLSV, and ASPV.
FIG. 4 shows RT-PCR results of shoots regenerated through the tissue culture of the herpes simplex virus of the apple red mosquito varieties. Lane M is a molecular DNA marker (100 bp), Lane # 6-ASSVd is an ASSVd infection , Lane # 6M1- # 6M4 represents shoots regenerated through tissue culture of infected HCCs, and ASSVd viroid (337bp) in infected HCCs was not detected in shoots regenerated through mitotic tissue culture.
Figure 5 shows the results of ASSVd RT-PCR assay on callus formed from the tissue culture of virus infectious virus of apple red mildew. Lane M is a molecular DNA marker (100 bp), a) Lane 1-10 (# 7) , Lane 1-7 (# 8), and b) Lane 1-14 (# 11) represent callus strains formed through infectious dormant mitotic tissue culture, except for Lanes 8 and 9 of a), ASSVd viroid (337bp) was not diagnosed.
FIG. 6 shows ASGV RT-PCR assays for callus formed from the tissue culture of virus infected apple spp. Of L. apple sp., Lane M is a molecular DNA marker (100 bp), a) Lane 1-10 (# 7) , Lane 1-7 (# 8), and b) Lane 1-14 (# 11) represent the callus line formed by infectious Drosophila tissue culture. In the callus line other than the red line, ASGV virus (714 bp) Was not diagnosed.
FIG. 7 shows the results of ACLSV RT-PCR assay on callus formed from the infectious tissue culture of virus infection of apple red mildew. Lane M is a molecular DNA marker (100 bp), a) Lane 1-10 (# 7) , Lane 1-7 (# 8), and b) Lane 1-14 (# 11) represent the callus lines formed by infectious dormant mitotic tissue culture. (676 bp) is not diagnosed.
Figure 8 shows the result of ASPV RT-PCR assay on callus formed from the infectious tissue culture of virus infection of apple red mildew. Lane M is a molecular DNA marker (100 bp), a) Lane 1-10 (# 7) , Lane 1-7 (# 8), and bane Lane 1-14 (# 11) represent the callus lines formed by infectious dormant mitotic tissue culture and lane 10 (# 7) and lane 14 In addition, the ASPV virus (365 bp) diagnosed in the infected state was not diagnosed.

The present invention relates to a method for producing a virus-resistant plant, comprising the steps of: (a) collecting and disinfecting a vertebrate from a dormant baby of an infected apple tree, cutting the vertebrae from the sterilized vertebrae, (b) Regenerating shoots, (c) propagating the regenerated shoots, and (d) inducing rooting from the propagated shoots.

In the method for producing the virus-free disease plant of the present invention, the virus is a virus consisting of an apple viral (ASSVd), an apple leaf spotty virus (ASPV), an apple yellow leaf spot virus (ACLSV) , But the present invention is not limited thereto.

The apple scar skin viroid (ASSVd) It is a viroid belonging to the genus Apscaviroid . It causes serious damage to apple fruit in China and Japan, and it mainly causes symptom in fruit, which causes the fruit quality to deteriorate.

In addition, representative viruses occurring in apples include apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV) These viruses are particularly well expressed in the form of complex infections and can cause high-stungness in virus-sensitive lines.

In the method for producing the virus-free disease plant of the present invention, the apple varieties are selected from the group consisting of Hongo, Fuji, Ruby, Summer Prince, Summer King, Summer Dream, Arisu, Hassa, Topaz, Green Ball, Picnic, And can be selected from the group consisting of ginseng, red ginseng, red ginseng, red ginseng, red ginseng, yellow ginseng, Seongwol, Seolwang, Hwanghong, Gamchong,

In the production method of the virus-free disease plant of the present invention, the apple varieties are preferably red roots.

In the method for producing a virus-free disease plant of the present invention, the size of the vertebrae may be 0.2 mm to 1.2 mm, preferably 0.6 mm to 1.0 mm, but is not limited thereto.

In the method for producing the virus-free disease plant of the present invention, the regenerated fragment has at least one meristem-tip selected from the group consisting of apical meristem and lateral meristem, ). ≪ / RTI > At this time, two or three outer bracts surrounding the rectal tissue may be used as a fragment.

In the method for producing the virus-free disease plant of the present invention, the shoot regeneration medium comprises 4.4 g of MS medium, 30 g of sucrose, 0.5 to 3.0 mg of benzyladenine (BA), 3-indolebutyric acid (IBA) ~ 0.1 mg and agar 7 g, and the pH is adjusted to 5.8.

In the method for producing virus-free disease plants of the present invention, the shoot growth medium is prepared by adding 4.4 g of MS medium, 30 g of sucrose, 0.5 to 1.0 mg of benzyladenine (BA), 3-indolebutyric acid (IBA) ~ 0.1 mg and agar 7 g, and the pH is adjusted to 5.8.

In the method for producing the virus-free disease plant of the present invention, the rooting induction medium comprises 2.2 g of MS medium, 15 g of sucrose, 0.1 to 0.5 mg of 3-indolebutyric acid (IBA) and 7 g of agar in 1 L of distilled water, and may be a medium whose pH is adjusted to 5.8.

In the method for producing the virus-free disease plant of the present invention, the MS (Murashige and Skoog) medium is preferably composed of the following ingredients and contents as shown in Table 1 below.

The method for producing the virus-free disease plant of the present invention may further comprise the step of purifying the roots germinated body induced by the step (d) by transplanting into the soil.

The present invention also relates to a virus-free disease plant produced by the above method.

In the virus-free disease plant of the present invention, the plant is preferably an apple tree, but is not limited thereto.

Hereinafter, the present invention will be described in detail with reference to examples. However, these are for the purpose of illustrating the present invention in more detail, and the scope of the present invention is not limited thereto.

<Example 1> Cutting of slices from apple hibernates

ASSVd single infection and ASSVd, ASPV, ACLSV and ASGV four infections in Nogi during the winter (at the end of January) were cut (about 20-30 cm) from the tips of the main apple apple varieties (Fig.

After removing the dormant baby with a tissue culture scalpel (Fig. 1B), the outer bracts of the dormant babies were removed and the inner bract tissues were left with a length of about 3 to 4 mm.

The above material was immersed in 70% ethanol, sterilized for about 40 seconds, washed once with sterilized water (working in a clean bench), and immersed in 1% sodium hypochlorite for 2 to 3 minutes to obtain 2 The surface of the tea was sterilized and then washed three times with sterilized water.

The meristem-tip was cut from the surface-sterilized material using a tweezers and a scalpel for tissue culture and a disposable syringe (5 ml) under a stereomicroscope. The meristem-tip was cut from the surface, and only the central apical meristem was taken, Or as a suture with three lateral meristems, or by choosing one of the lateral split tissues. In addition, 2-3 pieces of outer bracts around the vertebral tissues were used as a section.

In this case, the size of the sectioned tissue of the cleavage tissue may vary from developmental stage to developmental stage (0.2 to 1.2 mm) according to the size of the dormant infant (c to e in FIG. 1, a to c in FIG.

      &Lt; Example 2 > Culture of retinal tissue

The cut pieces of Example 1 were cut into 10 to 20 pieces of tissue culture medium in a culture medium (model 310100; SPL Life Science, Korea) dispensed in an amount of 50 ml in a 100 mm x 40 mm size culture container.

The tissue culture medium was prepared by adding 4.4 g of MS medium containing vitamin, 30 g of sucrose, 0.5 to 3.0 mg of BA and 0 to 0.1 mg of IBA to 1 L of secondary distilled water and adjusting the pH to 5.8. 7 g of agar was mixed in the autoclave and sterilized by autoclaving at 121 DEG C for 20 minutes.

The culture conditions were incubated for 16 hours at night and 8 hours at night under the conditions of temperature 25 ± 2 ℃ and light intensity 50 ~ 100μmol ^-2 s ^{-1 for} 8 ~ 16 weeks and subcultured in the same medium every 4-8 weeks .

Then, when shoots having a diameter of 5 mm or more were regenerated from the regenerated section, only shoots were removed and cultured in the shoot growth medium. The shoot growth medium was prepared by adding 4.4 g of MS medium containing vitamins, 30 g of sucrose, 0.5 to 1.0 mg of BA and 0 to 0.1 mg of IBA to 1 L of secondary distilled water, adjusting the pH to 5.8 and then mixing 7 g of agar And autoclaved at 121 DEG C for 20 minutes under high pressure steam sterilization. At this time, the cultivation environment of shoots was the same as that of the slice culture, and cultured for 8 weeks.

When the shoots were stretched more than 2 cm, rooting was induced by placing 70 mL of the medium in a 72 mm x 72 mm x 100 mm culture container Incu Tissue Culture (model 310071; SPL Life Science, Korea).

The root induction medium was prepared by adding 2.2 g of MS medium containing vitamins, 15 g of sucrose and 0.1 to 0.5 mg of IBA to 1 L of secondary distilled water, adjusting the pH to 5.8, adding 7 g of agar, Pressure steam sterilization for 20 minutes. At this time, the roots were not subcultured until the stem grows more than 7cm.

Subsequently, the bulb was taken out of the vessel, the root was washed with water, and planted in pots containing artificial soil. The plant was covered with a lid to keep the humidity close to the humidity in the cabin, and the lid was gradually opened for 7 days to gradually purify the environment.

Example 3: Virus diagnosis

The total RNA was extracted by transforming 100 mg of callus or callus tissue from cabbage and out-of-plant plants using the CTAB method (Gambino et al ., 2008). The extracted RNA was extracted by using M-MLV reverse transcriptase (Invitrogen, USA) Respectively.

cDNA was used as a template for each virus-specific primer set [ASSVd (337 bp); F-CCCGGTAAACACCGTGCGGT (SEQ ID NO: 1) / R-ACCGGGAAACACCTATTGTG (SEQ ID NO: 2), ASGV (714 bp); FATGAGTTTGGAAGACGTGCTTCAA (SEQ ID NO: 3) / RCTAACCCTCC AGTTCCAAGTTACT (SEQ ID NO: 4), ACLSV (676 bp); F-TTCATGGAAAGACAGGGGCAA (SEQ ID NO: 5) / RAAGTCTACAGGCTATTTATTATAAGTCTAA (SEQ ID NO: 6), ASPV (365 bp); F-ATGTCTGGAACCTCATGCTGC (SEQ ID NO: 7) / RTTGGGATCAACTTTACTAAAAAGCATAAAT (SEQ ID NO: 8)].

As shown in Figure 3, the virus-infected hosts were diagnosed as single or multiple infections. Infectious strains used in this study were ASSVd alone (# 6), and ASSVd, ASGV, ACLSV and ASPV , # 8, # 11).

In this case, for the initial denaturation, the reaction was carried out at 94 ° C for 2 minutes, followed by reaction (DNA denaturation at 95 ° C for 40 seconds, primer bonding at 60 ° C for 30 seconds, DNA elongation at 72 ° C for 30 seconds) . The reaction was terminated at 72 ° C for 5 minutes for final elongation.

The amplified DNA was electrophoresed on 1.3% agarose gel at 100 V for 30 minutes, stained with ethidium bromide (Sigma Chemical Co.) and observed under UV.

Example 4: Shine regeneration rate and virus removal efficiency from regeneration slices

(One). Shoot regeneration through direct organ formation (using ASSVd single infectious strain # 6)

After 8 weeks from the initial culture, the survival rate, shoot (5 mm or more) regeneration rate, and virus removal efficiency were examined, and the same items were examined every 4 weeks thereafter.

The virus removal efficiency was expressed as a percentage of the number of slices producing RT-PCR negative shoots relative to the number of shoots producing shoots.

(2). (ASSVd, ASGV, ACLSV, and ASPV) (# 7, # 8, # 11) through indirect organ formation.

Survival rate, callus formation rate (more than 10 mm) and virus removal efficiency of the chimpanzees were investigated 16 weeks after the initial culture, and the same items were examined every 4 weeks thereafter.

The virus removal efficiency was expressed as a percentage of the number of slices producing the RT-PCR negative callus relative to the number of calli producing the callus.

(3). result

① Split tissue Splice from shoot regeneration process

From one week after the culture, the slice changed to green and in the second week, the size expanded more than three times (d to f and n in FIG. 2). In the case of direct organ formation, the leaves were differentiated into single or multiple shoots 8 weeks after protruding (Fig. 2, g ~ l).

In the case of indirect formation of the organs, the callus was protruded and developed into callus (o in Fig. 2), and shoot was regenerated (p in Fig. 2).

② Efficiency of shoot regeneration and virus removal from fragmented tissue

The 82nd survival rate was 72.0% and the shoot regeneration rate was 4.9% (see Table 2, below) for a total of 82 slices in the shoot regeneration through direct organ formation using dormant ASSVd alone infected strain (# 6).

As a result of the RT-PCR of the regenerated shoots, the ASSVd viroid, which was diagnosed in the infectious strain, was not detected (negative), and the virus removal rate due to the incubation of the resting slices of the dormant infant was 100% Table 2).

On the other hand, as a result of examining the virus removal efficiency according to the developmental stages of the regenerated segments, the size of the dormant babies was small and the development stage was found to be high at the early stage or intermediate stage (see Table 3 below).

The 12-week survival rate of 71 slices of shoots regenerated through indirect organ formation by using 4-type complex infections (# 7, # 8, # 11) of ASSVd, ASGV, ACLSV and ASPV 68.5%, and a callus formation rate of 42.5% (see Table 4 below).

RT-PCR was performed on 31 calli (more than 10mm in diameter) lines, and the virus removal rates were 100.0% for ACLSV, 93.5% for ASPV, 93.5% for ASPV, and 25.8% for ASGV (See Figs. 5, 6, 7, 8 and Table 4).

At this time, the specificities of ASSVd and ACLSV were not affected by the developmental stage of the fragmented tissue, and ASGV was relatively high in the stage 1 of dormancy. ASPV was removed largely unaffected by the developmental stage of the cleavage tissue fragment, but when the outer bract tissue of the cleavage tissue was included in the stage 3 fragment, the removal rate significantly decreased (see Table 4).

On the other hand, the developmental stage of the cleavage tissue fragment that produced all four virus-free calli (seven out of 31 callus lines) was detected and found to be cut only in dormant stage 1 (see Table 5 below).

From the results of the present invention, it was possible to remove the virus of apple by variously using the size of the cleavage tissue from 0.4 mm to 1.2 mm which is much larger than the size of the rectum (0.2 to 0.4 mm)

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, many variations and modifications may be made without departing from the scope of the present invention as defined by the following claims. It will be understood that the present invention can be changed.

The method for producing a virus-free disease plant through the tissue culture of the present invention of the present invention can be carried out by culturing an uninfected part of an apple waterbody in a natural state without any further treatment such as heat treatment, cold treatment, chemical treatment, The present invention can be advantageously applied to the technical field to which the present invention belongs because it has the advantage of saving labor force and cost and effectively producing plants infected with viruses in a very economical way.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Method of producing virus free plant using meristem-tip culture          from dormant bud <130> PA-D17321 <160> 8 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of ASSVd <400> 1 cccggtaaac accgtgcggt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of ASSVd <400> 2 accgggaaac acctattgtg 20 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> forward primer of ASGV <400> 3 atgagtttgg aagacgtgct tcaa 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of ASGV <400> 4 ctaaccctcc agttccaagt tact 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer of ACLSV <400> 5 ttcatggaaa gacaggggca a 21 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of ACLSV <400> 6 aagtctacag gctatttatt ataagtctaa 30 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer of ASPV <400> 7 atgtctggaa cctcatgctg c 21 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of ASPV <400> 8 ttgggatcaa ctttactaaa aagcataaat 30

Claims (11)

(a) collecting and disinfecting a vertebra from a dormant baby of an apple tree infected with a virus, and cutting the vertebra from the sterilized vermiculite;
(b) regenerating shoots by tissue culture of the disinfected regenerated section in a cabin;
(c) propagating the regenerated shoots; And
(d) inducing rooting from said propagated shoots. The virus according to claim 1, wherein the virus is at least one virus selected from the group consisting of apple violet (ASSVd), apple leaf spot virus (ASPV), apple leaf yellow spot virus (ACLSV) and apple leaf black spot virus (ASGV) A method for producing a virus-free disease plant. The apple according to claim 1, wherein the apple variety is selected from the group consisting of Hongro, Fuji, Ruby, Summer Prince, Summer King, Summer Dream, Arisu, Hsiao, Topaz, Green Ball, Picnic, A method for producing a virus-free disease plant, characterized in that the virus is selected from the group consisting of red ginseng, Seohong, Seonghong, Shandong, Seogwang, Hwanghong, Gamchong, Chuangwha, Sunshine, Zona gold, Tsugaru, The method according to claim 1, wherein the size of the vertebrae is 0.2 mm to 1.2 mm. [Claim 2] The method according to claim 1, wherein the regenerated fragment is obtained by sectioning at least one meristem-tip selected from the group consisting of apical meristems and lateral meristems, A method for producing a virus-free disease plant. 2. The shoot regeneration medium according to claim 1, wherein the shoot regeneration medium comprises 4.4 g of MS medium, 30 g of sucrose, 0.5 to 3.0 mg of benzyladenine (BA), 0 to 0.1 mg of 3-indolebutyric acid (IBA) , And the pH is adjusted to 5.8. 2. The method according to claim 1, wherein the shoot growth medium is prepared by adding 4.4 g of MS medium, 30 g of sucrose, 0.5 to 1.0 mg of benzyladenine (BA), 0 to 0.1 mg of 3-indolebutyric acid (IBA) , And the pH is adjusted to 5.8. The rooting induction medium according to claim 1, wherein the root induction medium comprises 2.2 g of MS medium, 15 g of sucrose, 0.1 to 0.5 mg of 3-indolebutyric acid (IBA) and 7 g of agar in 1 L of distilled water, A method for producing a virus-free disease plant. [2] The method according to claim 1, further comprising the step of purifying the roots germinated by the step (d) into soil. A virus-free plant produced by the method of any one of claims 1 to 9. 11. The virus virus disease-free plant according to claim 10, wherein the plant is an apple tree.

Images